Multiple sequence alignment - TraesCS1A01G130400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G130400 chr1A 100.000 2132 0 0 1 2132 168448377 168450508 0.000000e+00 3938
1 TraesCS1A01G130400 chr5D 97.202 2109 53 5 1 2103 560874664 560872556 0.000000e+00 3563
2 TraesCS1A01G130400 chr5D 96.447 2139 67 7 1 2132 6199086 6201222 0.000000e+00 3520
3 TraesCS1A01G130400 chr5D 96.399 2138 68 8 1 2132 329164370 329162236 0.000000e+00 3513
4 TraesCS1A01G130400 chr1D 96.681 2139 64 6 1 2132 254500194 254498056 0.000000e+00 3550
5 TraesCS1A01G130400 chr1D 91.873 2055 115 31 89 2132 244481977 244483990 0.000000e+00 2822
6 TraesCS1A01G130400 chr4D 95.410 2135 91 6 1 2130 19918688 19916556 0.000000e+00 3393
7 TraesCS1A01G130400 chr7A 93.826 2138 120 11 3 2132 352191832 352193965 0.000000e+00 3206
8 TraesCS1A01G130400 chr6B 95.921 1422 53 4 715 2132 22427423 22426003 0.000000e+00 2300
9 TraesCS1A01G130400 chr3B 95.837 1297 46 7 1 1290 201516875 201515580 0.000000e+00 2089
10 TraesCS1A01G130400 chr3B 93.215 678 43 3 1 677 524776889 524777564 0.000000e+00 994
11 TraesCS1A01G130400 chr3B 92.825 223 9 2 1910 2132 1791003 1791218 1.230000e-82 316
12 TraesCS1A01G130400 chr3D 97.928 1062 21 1 1072 2132 21905747 21904686 0.000000e+00 1838
13 TraesCS1A01G130400 chr7B 93.539 681 40 4 1 678 102631435 102632114 0.000000e+00 1011
14 TraesCS1A01G130400 chr2A 97.143 105 3 0 694 798 588453534 588453430 6.050000e-41 178


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G130400 chr1A 168448377 168450508 2131 False 3938 3938 100.000 1 2132 1 chr1A.!!$F1 2131
1 TraesCS1A01G130400 chr5D 560872556 560874664 2108 True 3563 3563 97.202 1 2103 1 chr5D.!!$R2 2102
2 TraesCS1A01G130400 chr5D 6199086 6201222 2136 False 3520 3520 96.447 1 2132 1 chr5D.!!$F1 2131
3 TraesCS1A01G130400 chr5D 329162236 329164370 2134 True 3513 3513 96.399 1 2132 1 chr5D.!!$R1 2131
4 TraesCS1A01G130400 chr1D 254498056 254500194 2138 True 3550 3550 96.681 1 2132 1 chr1D.!!$R1 2131
5 TraesCS1A01G130400 chr1D 244481977 244483990 2013 False 2822 2822 91.873 89 2132 1 chr1D.!!$F1 2043
6 TraesCS1A01G130400 chr4D 19916556 19918688 2132 True 3393 3393 95.410 1 2130 1 chr4D.!!$R1 2129
7 TraesCS1A01G130400 chr7A 352191832 352193965 2133 False 3206 3206 93.826 3 2132 1 chr7A.!!$F1 2129
8 TraesCS1A01G130400 chr6B 22426003 22427423 1420 True 2300 2300 95.921 715 2132 1 chr6B.!!$R1 1417
9 TraesCS1A01G130400 chr3B 201515580 201516875 1295 True 2089 2089 95.837 1 1290 1 chr3B.!!$R1 1289
10 TraesCS1A01G130400 chr3B 524776889 524777564 675 False 994 994 93.215 1 677 1 chr3B.!!$F2 676
11 TraesCS1A01G130400 chr3D 21904686 21905747 1061 True 1838 1838 97.928 1072 2132 1 chr3D.!!$R1 1060
12 TraesCS1A01G130400 chr7B 102631435 102632114 679 False 1011 1011 93.539 1 678 1 chr7B.!!$F1 677

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
81 82 3.187432 GGCTTCTTGACTTTTCTCTTCCG 59.813 47.826 0.0 0.0 0.0 4.3 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1911 1925 0.584396 TGAGCTTTTTGTACGCCGTG 59.416 50.0 0.0 0.0 0.0 4.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 3.194005 TGGCACGTCTTTCTTTCTTCT 57.806 42.857 0.00 0.00 0.00 2.85
81 82 3.187432 GGCTTCTTGACTTTTCTCTTCCG 59.813 47.826 0.00 0.00 0.00 4.30
188 190 6.678878 TCATACTAGAGCCACGATGATTTAC 58.321 40.000 0.00 0.00 0.00 2.01
385 389 4.082895 TCAGTCTAGTTGCGAGGTCTTAAC 60.083 45.833 0.00 0.00 0.00 2.01
763 770 6.942576 AGGAATATAGCGAATAAAGCCATTGT 59.057 34.615 0.00 0.00 34.64 2.71
777 784 3.706086 AGCCATTGTGATCCCCATAAAAC 59.294 43.478 0.00 0.00 29.63 2.43
847 854 4.386711 GGTTTCAGTAAACTACCTGCACT 58.613 43.478 0.00 0.00 43.76 4.40
873 880 4.716794 TCGTTTTGGCCTAGGTTTAGAAA 58.283 39.130 11.31 2.61 0.00 2.52
900 907 3.331150 TCAACGGTTTGTGTAGCCATAG 58.669 45.455 0.00 0.00 34.02 2.23
949 956 9.230932 GACTTTGTATACTATTCCGTTGTAGTC 57.769 37.037 4.17 0.19 33.48 2.59
1174 1183 6.042208 CCAGATAGGGGGACTTCTTACTTAAG 59.958 46.154 0.00 0.00 34.65 1.85
1253 1265 6.771188 AGAAGATAGCGAACAAATTATCCG 57.229 37.500 0.00 0.00 0.00 4.18
1397 1410 8.354711 AGAAAGAAAAAGAGTCAAAGAAAGGT 57.645 30.769 0.00 0.00 0.00 3.50
1480 1493 2.092429 TCAGACAGCCTGTTTCCTTGTT 60.092 45.455 0.00 0.00 43.38 2.83
1535 1548 4.842531 TCCACTTGAGCATCCAAATCTA 57.157 40.909 0.00 0.00 0.00 1.98
1591 1604 3.190160 GCGCCATGCCAAATGTGC 61.190 61.111 0.00 0.00 37.76 4.57
1703 1716 5.324784 AGCCCGGTCTAATTCAAAAATTC 57.675 39.130 0.00 0.00 36.49 2.17
1792 1805 0.806102 CGCCACCATAGAACTCCACG 60.806 60.000 0.00 0.00 0.00 4.94
2085 2099 6.718522 TTTTTCGGGAATTTTAGACCAAGT 57.281 33.333 0.00 0.00 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 6.889722 CCTCTAATGACCAACATAAGGGAAAA 59.110 38.462 0.00 0.00 38.38 2.29
155 157 5.474825 GTGGCTCTAGTATGAATCTAAGGC 58.525 45.833 0.00 0.00 0.00 4.35
188 190 4.836125 TGCCTTTTGTTTAGCTTGAGAG 57.164 40.909 0.00 0.00 0.00 3.20
385 389 8.899427 AATGGAACTATGATTCATACTCACTG 57.101 34.615 2.14 0.00 0.00 3.66
483 489 8.986991 ACATAGAAAGGGCCTATTATCTCTATG 58.013 37.037 25.23 25.23 43.49 2.23
540 546 6.540083 TCGGTATCTCTGGAATATGAGTGTA 58.460 40.000 0.00 0.00 0.00 2.90
763 770 4.100498 GGACTACTCGTTTTATGGGGATCA 59.900 45.833 0.00 0.00 0.00 2.92
777 784 2.718073 CGGGTTGGGGGACTACTCG 61.718 68.421 0.00 0.00 33.84 4.18
847 854 3.775261 AACCTAGGCCAAAACGAACTA 57.225 42.857 9.30 0.00 0.00 2.24
873 880 4.634443 GGCTACACAAACCGTTGAAGATAT 59.366 41.667 0.00 0.00 38.20 1.63
1253 1265 6.937457 ACGTTCCTTTTAGTTTCGACTTTAC 58.063 36.000 0.00 0.00 0.00 2.01
1465 1478 1.756538 CCAACAACAAGGAAACAGGCT 59.243 47.619 0.00 0.00 0.00 4.58
1535 1548 6.183360 CGAGATGTTTTTGCTGGTATTGATCT 60.183 38.462 0.00 0.00 0.00 2.75
1591 1604 2.034558 TGCTTTGCTCTTCTTTTTCGGG 59.965 45.455 0.00 0.00 0.00 5.14
1703 1716 2.811873 CGAGGCATTCTCAATTAGGGGG 60.812 54.545 0.00 0.00 42.55 5.40
1911 1925 0.584396 TGAGCTTTTTGTACGCCGTG 59.416 50.000 0.00 0.00 0.00 4.94
2085 2099 8.561738 AGCCGAAAATCTTAGTTTATCAGAAA 57.438 30.769 0.00 0.00 0.00 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.