Multiple sequence alignment - TraesCS1A01G130300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G130300 chr1A 100.000 2222 0 0 1 2222 168450275 168448054 0.000000e+00 4104
1 TraesCS1A01G130300 chr5D 97.035 2226 57 7 1 2217 560872760 560874985 0.000000e+00 3736
2 TraesCS1A01G130300 chr5D 95.328 2226 72 13 1 2217 6200989 6198787 0.000000e+00 3506
3 TraesCS1A01G130300 chr5D 96.223 2065 68 9 1 2058 329162469 329164530 0.000000e+00 3373
4 TraesCS1A01G130300 chr1D 96.764 2225 64 7 1 2217 254498290 254500514 0.000000e+00 3703
5 TraesCS1A01G130300 chr1D 91.218 1822 108 31 1 1811 244483757 244481977 0.000000e+00 2431
6 TraesCS1A01G130300 chr4D 95.648 2229 88 8 1 2222 19916787 19919013 0.000000e+00 3570
7 TraesCS1A01G130300 chr7A 93.975 2224 119 14 4 2217 352193729 352191511 0.000000e+00 3350
8 TraesCS1A01G130300 chr3B 95.918 1617 55 10 610 2217 201515580 201517194 0.000000e+00 2610
9 TraesCS1A01G130300 chr3B 92.377 997 62 6 1223 2217 524777564 524776580 0.000000e+00 1408
10 TraesCS1A01G130300 chr6B 95.627 1189 47 4 1 1185 22426236 22427423 0.000000e+00 1903
11 TraesCS1A01G130300 chrUn 96.967 1055 27 4 234 1284 445812538 445811485 0.000000e+00 1766
12 TraesCS1A01G130300 chrUn 96.744 737 20 4 1484 2217 439559440 439558705 0.000000e+00 1225
13 TraesCS1A01G130300 chr4A 90.476 84 8 0 1257 1340 8078751 8078834 6.490000e-21 111


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G130300 chr1A 168448054 168450275 2221 True 4104 4104 100.000 1 2222 1 chr1A.!!$R1 2221
1 TraesCS1A01G130300 chr5D 560872760 560874985 2225 False 3736 3736 97.035 1 2217 1 chr5D.!!$F2 2216
2 TraesCS1A01G130300 chr5D 6198787 6200989 2202 True 3506 3506 95.328 1 2217 1 chr5D.!!$R1 2216
3 TraesCS1A01G130300 chr5D 329162469 329164530 2061 False 3373 3373 96.223 1 2058 1 chr5D.!!$F1 2057
4 TraesCS1A01G130300 chr1D 254498290 254500514 2224 False 3703 3703 96.764 1 2217 1 chr1D.!!$F1 2216
5 TraesCS1A01G130300 chr1D 244481977 244483757 1780 True 2431 2431 91.218 1 1811 1 chr1D.!!$R1 1810
6 TraesCS1A01G130300 chr4D 19916787 19919013 2226 False 3570 3570 95.648 1 2222 1 chr4D.!!$F1 2221
7 TraesCS1A01G130300 chr7A 352191511 352193729 2218 True 3350 3350 93.975 4 2217 1 chr7A.!!$R1 2213
8 TraesCS1A01G130300 chr3B 201515580 201517194 1614 False 2610 2610 95.918 610 2217 1 chr3B.!!$F1 1607
9 TraesCS1A01G130300 chr3B 524776580 524777564 984 True 1408 1408 92.377 1223 2217 1 chr3B.!!$R1 994
10 TraesCS1A01G130300 chr6B 22426236 22427423 1187 False 1903 1903 95.627 1 1185 1 chr6B.!!$F1 1184
11 TraesCS1A01G130300 chrUn 445811485 445812538 1053 True 1766 1766 96.967 234 1284 1 chrUn.!!$R2 1050
12 TraesCS1A01G130300 chrUn 439558705 439559440 735 True 1225 1225 96.744 1484 2217 1 chrUn.!!$R1 733

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
433 434 1.756538 CCAACAACAAGGAAACAGGCT 59.243 47.619 0.0 0.0 0.0 4.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1817 1829 3.187432 GGCTTCTTGACTTTTCTCTTCCG 59.813 47.826 0.0 0.0 0.0 4.3 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
195 196 2.811873 CGAGGCATTCTCAATTAGGGGG 60.812 54.545 0.00 0.00 42.55 5.40
307 308 2.034558 TGCTTTGCTCTTCTTTTTCGGG 59.965 45.455 0.00 0.00 0.00 5.14
363 364 6.183360 CGAGATGTTTTTGCTGGTATTGATCT 60.183 38.462 0.00 0.00 0.00 2.75
433 434 1.756538 CCAACAACAAGGAAACAGGCT 59.243 47.619 0.00 0.00 0.00 4.58
645 646 6.937457 ACGTTCCTTTTAGTTTCGACTTTAC 58.063 36.000 0.00 0.00 0.00 2.01
1025 1030 4.634443 GGCTACACAAACCGTTGAAGATAT 59.366 41.667 0.00 0.00 38.20 1.63
1051 1056 3.775261 AACCTAGGCCAAAACGAACTA 57.225 42.857 9.30 0.00 0.00 2.24
1121 1126 2.718073 CGGGTTGGGGGACTACTCG 61.718 68.421 0.00 0.00 33.84 4.18
1135 1140 4.100498 GGACTACTCGTTTTATGGGGATCA 59.900 45.833 0.00 0.00 0.00 2.92
1358 1365 6.540083 TCGGTATCTCTGGAATATGAGTGTA 58.460 40.000 0.00 0.00 0.00 2.90
1415 1422 8.986991 ACATAGAAAGGGCCTATTATCTCTATG 58.013 37.037 25.23 25.23 43.49 2.23
1513 1522 8.899427 AATGGAACTATGATTCATACTCACTG 57.101 34.615 2.14 0.00 0.00 3.66
1710 1722 4.836125 TGCCTTTTGTTTAGCTTGAGAG 57.164 40.909 0.00 0.00 0.00 3.20
1743 1755 5.474825 GTGGCTCTAGTATGAATCTAAGGC 58.525 45.833 0.00 0.00 0.00 4.35
1863 1875 6.889722 CCTCTAATGACCAACATAAGGGAAAA 59.110 38.462 0.00 0.00 38.38 2.29
2129 2145 4.610605 TGATTGGTTTGAGGAACGTCTA 57.389 40.909 0.00 0.00 39.22 2.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
106 107 0.806102 CGCCACCATAGAACTCCACG 60.806 60.000 0.00 0.00 0.00 4.94
195 196 5.324784 AGCCCGGTCTAATTCAAAAATTC 57.675 39.130 0.00 0.00 36.49 2.17
307 308 3.190160 GCGCCATGCCAAATGTGC 61.190 61.111 0.00 0.00 37.76 4.57
363 364 4.842531 TCCACTTGAGCATCCAAATCTA 57.157 40.909 0.00 0.00 0.00 1.98
418 419 2.092429 TCAGACAGCCTGTTTCCTTGTT 60.092 45.455 0.00 0.00 43.38 2.83
501 502 8.354711 AGAAAGAAAAAGAGTCAAAGAAAGGT 57.645 30.769 0.00 0.00 0.00 3.50
645 646 6.771188 AGAAGATAGCGAACAAATTATCCG 57.229 37.500 0.00 0.00 0.00 4.18
724 727 6.042208 CCAGATAGGGGGACTTCTTACTTAAG 59.958 46.154 0.00 0.00 34.65 1.85
949 954 9.230932 GACTTTGTATACTATTCCGTTGTAGTC 57.769 37.037 4.17 0.19 33.48 2.59
998 1003 3.331150 TCAACGGTTTGTGTAGCCATAG 58.669 45.455 0.00 0.00 34.02 2.23
1025 1030 4.716794 TCGTTTTGGCCTAGGTTTAGAAA 58.283 39.130 11.31 2.61 0.00 2.52
1051 1056 4.386711 GGTTTCAGTAAACTACCTGCACT 58.613 43.478 0.00 0.00 43.76 4.40
1121 1126 3.706086 AGCCATTGTGATCCCCATAAAAC 59.294 43.478 0.00 0.00 29.63 2.43
1135 1140 6.942576 AGGAATATAGCGAATAAAGCCATTGT 59.057 34.615 0.00 0.00 34.64 2.71
1513 1522 4.082895 TCAGTCTAGTTGCGAGGTCTTAAC 60.083 45.833 0.00 0.00 0.00 2.01
1710 1722 6.678878 TCATACTAGAGCCACGATGATTTAC 58.321 40.000 0.00 0.00 0.00 2.01
1817 1829 3.187432 GGCTTCTTGACTTTTCTCTTCCG 59.813 47.826 0.00 0.00 0.00 4.30
1863 1875 3.194005 TGGCACGTCTTTCTTTCTTCT 57.806 42.857 0.00 0.00 0.00 2.85
2129 2145 3.361281 TCTGCAATTGCCTGAATCTCT 57.639 42.857 26.94 0.00 41.18 3.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.