Multiple sequence alignment - TraesCS1A01G124800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G124800 chr1A 100.000 2666 0 0 1 2666 147691720 147689055 0 4924
1 TraesCS1A01G124800 chr7B 98.913 2667 28 1 1 2666 220296740 220294074 0 4763
2 TraesCS1A01G124800 chr7D 83.011 2690 372 37 1 2666 95071466 95074094 0 2357
3 TraesCS1A01G124800 chr6D 82.937 2690 373 38 1 2666 72038490 72035863 0 2346
4 TraesCS1A01G124800 chr7A 82.652 2692 397 36 1 2666 652173700 652171053 0 2320
5 TraesCS1A01G124800 chr2A 94.002 1317 75 4 786 2100 709062716 709061402 0 1991
6 TraesCS1A01G124800 chr2A 83.386 1589 236 18 1087 2666 642732543 642734112 0 1447
7 TraesCS1A01G124800 chr5D 82.181 2256 322 33 432 2666 363187363 363185167 0 1866
8 TraesCS1A01G124800 chr4A 82.929 1898 284 27 785 2666 680343770 680341897 0 1674
9 TraesCS1A01G124800 chr4A 82.877 1898 284 28 785 2666 680333562 680331690 0 1666
10 TraesCS1A01G124800 chr4B 80.872 2018 322 32 1 1994 246309077 246311054 0 1530
11 TraesCS1A01G124800 chr1D 80.491 1994 301 49 1 1969 107599925 107601855 0 1447
12 TraesCS1A01G124800 chr6B 83.384 1312 181 19 1362 2666 413739999 413738718 0 1181
13 TraesCS1A01G124800 chrUn 100.000 392 0 0 412 803 479805443 479805834 0 725


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G124800 chr1A 147689055 147691720 2665 True 4924 4924 100.000 1 2666 1 chr1A.!!$R1 2665
1 TraesCS1A01G124800 chr7B 220294074 220296740 2666 True 4763 4763 98.913 1 2666 1 chr7B.!!$R1 2665
2 TraesCS1A01G124800 chr7D 95071466 95074094 2628 False 2357 2357 83.011 1 2666 1 chr7D.!!$F1 2665
3 TraesCS1A01G124800 chr6D 72035863 72038490 2627 True 2346 2346 82.937 1 2666 1 chr6D.!!$R1 2665
4 TraesCS1A01G124800 chr7A 652171053 652173700 2647 True 2320 2320 82.652 1 2666 1 chr7A.!!$R1 2665
5 TraesCS1A01G124800 chr2A 709061402 709062716 1314 True 1991 1991 94.002 786 2100 1 chr2A.!!$R1 1314
6 TraesCS1A01G124800 chr2A 642732543 642734112 1569 False 1447 1447 83.386 1087 2666 1 chr2A.!!$F1 1579
7 TraesCS1A01G124800 chr5D 363185167 363187363 2196 True 1866 1866 82.181 432 2666 1 chr5D.!!$R1 2234
8 TraesCS1A01G124800 chr4A 680341897 680343770 1873 True 1674 1674 82.929 785 2666 1 chr4A.!!$R2 1881
9 TraesCS1A01G124800 chr4A 680331690 680333562 1872 True 1666 1666 82.877 785 2666 1 chr4A.!!$R1 1881
10 TraesCS1A01G124800 chr4B 246309077 246311054 1977 False 1530 1530 80.872 1 1994 1 chr4B.!!$F1 1993
11 TraesCS1A01G124800 chr1D 107599925 107601855 1930 False 1447 1447 80.491 1 1969 1 chr1D.!!$F1 1968
12 TraesCS1A01G124800 chr6B 413738718 413739999 1281 True 1181 1181 83.384 1362 2666 1 chr6B.!!$R1 1304

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
863 874 0.88649 CATATCCAGGGAAGCACGCC 60.886 60.0 0.0 0.0 0.0 5.68 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1931 1951 1.533753 CATGGGTGCACAGGGGTTT 60.534 57.895 20.43 0.0 0.0 3.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 42 1.153025 GCTGCAGATGAGGGCATGA 60.153 57.895 20.43 0.0 39.65 3.07
130 132 3.282021 GCTGTATGCTTGGGATGAAGAA 58.718 45.455 0.00 0.0 38.95 2.52
863 874 0.886490 CATATCCAGGGAAGCACGCC 60.886 60.000 0.00 0.0 0.00 5.68
1033 1046 1.617947 GCTCCTTGACATCTCCCCGT 61.618 60.000 0.00 0.0 0.00 5.28
1036 1049 0.324943 CCTTGACATCTCCCCGTTGT 59.675 55.000 0.00 0.0 0.00 3.32
1182 1195 1.980772 GCTCATTGTGCCCTGCCTT 60.981 57.895 0.00 0.0 0.00 4.35
1258 1271 3.003173 CGCAACCTCCCCCTGAGA 61.003 66.667 0.00 0.0 44.42 3.27
2460 2480 0.889186 AATCAACCGCTTTCGTGCCT 60.889 50.000 0.00 0.0 0.00 4.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
839 850 1.451504 CTTCCCTGGATATGCGCCA 59.548 57.895 4.18 0.00 0.00 5.69
1218 1231 4.853050 GCAGATGGCAGGAGCGCT 62.853 66.667 11.27 11.27 43.97 5.92
1827 1842 1.535833 AAACAAACACACACCCGTGA 58.464 45.000 0.96 0.00 46.80 4.35
1931 1951 1.533753 CATGGGTGCACAGGGGTTT 60.534 57.895 20.43 0.00 0.00 3.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.