Multiple sequence alignment - TraesCS1A01G123400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G123400 chr1A 100.000 2403 0 0 1 2403 143378964 143376562 0.000000e+00 4438.0
1 TraesCS1A01G123400 chr1A 94.814 1832 93 2 1 1830 480976003 480974172 0.000000e+00 2856.0
2 TraesCS1A01G123400 chr4A 96.804 2409 66 7 1 2403 622161369 622163772 0.000000e+00 4012.0
3 TraesCS1A01G123400 chr4A 88.272 324 30 4 1978 2296 716535122 716534802 4.850000e-102 381.0
4 TraesCS1A01G123400 chr2B 96.216 2405 86 5 1 2403 631838 634239 0.000000e+00 3932.0
5 TraesCS1A01G123400 chr2B 93.062 2407 144 8 1 2403 488701814 488704201 0.000000e+00 3498.0
6 TraesCS1A01G123400 chr2B 89.920 377 34 4 47 422 485685733 485685360 1.290000e-132 483.0
7 TraesCS1A01G123400 chr7A 93.978 2408 137 8 1 2403 346769592 346767188 0.000000e+00 3637.0
8 TraesCS1A01G123400 chr3D 96.112 1672 62 3 734 2403 124495011 124493341 0.000000e+00 2724.0
9 TraesCS1A01G123400 chr3D 94.830 735 35 3 1 732 124495796 124495062 0.000000e+00 1144.0
10 TraesCS1A01G123400 chr7B 95.904 586 23 1 1 585 511463902 511463317 0.000000e+00 948.0
11 TraesCS1A01G123400 chr1B 90.451 377 32 4 47 422 200035722 200035349 5.970000e-136 494.0
12 TraesCS1A01G123400 chr1B 88.889 45 5 0 1 45 84414545 84414501 3.340000e-04 56.5
13 TraesCS1A01G123400 chr5A 87.425 334 33 2 1835 2163 219128348 219128677 2.260000e-100 375.0
14 TraesCS1A01G123400 chr5A 87.425 334 31 3 1835 2163 208947309 208947636 8.110000e-100 374.0
15 TraesCS1A01G123400 chr3B 87.671 292 23 2 1857 2135 462621384 462621093 6.410000e-86 327.0
16 TraesCS1A01G123400 chrUn 88.583 254 23 2 1910 2157 402215522 402215775 1.080000e-78 303.0
17 TraesCS1A01G123400 chrUn 89.189 74 4 1 1835 1908 388630247 388630316 3.290000e-14 89.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G123400 chr1A 143376562 143378964 2402 True 4438 4438 100.000 1 2403 1 chr1A.!!$R1 2402
1 TraesCS1A01G123400 chr1A 480974172 480976003 1831 True 2856 2856 94.814 1 1830 1 chr1A.!!$R2 1829
2 TraesCS1A01G123400 chr4A 622161369 622163772 2403 False 4012 4012 96.804 1 2403 1 chr4A.!!$F1 2402
3 TraesCS1A01G123400 chr2B 631838 634239 2401 False 3932 3932 96.216 1 2403 1 chr2B.!!$F1 2402
4 TraesCS1A01G123400 chr2B 488701814 488704201 2387 False 3498 3498 93.062 1 2403 1 chr2B.!!$F2 2402
5 TraesCS1A01G123400 chr7A 346767188 346769592 2404 True 3637 3637 93.978 1 2403 1 chr7A.!!$R1 2402
6 TraesCS1A01G123400 chr3D 124493341 124495796 2455 True 1934 2724 95.471 1 2403 2 chr3D.!!$R1 2402
7 TraesCS1A01G123400 chr7B 511463317 511463902 585 True 948 948 95.904 1 585 1 chr7B.!!$R1 584

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
428 443 0.91971 GGTAGGGGGAAATCACTGCT 59.08 55.0 0.0 0.0 0.0 4.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1624 1709 0.033405 AGCAGTAAGGAGGGAGCGTA 60.033 55.0 0.0 0.0 0.0 4.42 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
217 226 7.119992 TGCAAGCAATTCTCGGTTTAAATACTA 59.880 33.333 0.00 0.00 0.00 1.82
428 443 0.919710 GGTAGGGGGAAATCACTGCT 59.080 55.000 0.00 0.00 0.00 4.24
469 484 6.918067 TCTATTTGTGAGTATGATCGGGAT 57.082 37.500 0.00 0.00 0.00 3.85
569 584 3.821033 GCTAAGTTTGGATGTGGAGTTGT 59.179 43.478 0.00 0.00 0.00 3.32
578 593 8.357402 GTTTGGATGTGGAGTTGTAATTTAACT 58.643 33.333 7.31 7.31 40.84 2.24
700 716 1.448013 GGGTCCACGCTGCTTAGAC 60.448 63.158 0.00 0.00 0.00 2.59
710 726 4.090642 CACGCTGCTTAGACTGTCTAAAAG 59.909 45.833 25.52 24.16 38.38 2.27
850 916 8.971321 GTTAGCACATATTTCCTTGCAATTATG 58.029 33.333 0.00 5.88 37.44 1.90
1276 1356 5.531287 GTGTTTTCTACAGGATTCTTGTGGT 59.469 40.000 11.37 0.00 37.45 4.16
1427 1510 6.509418 TTCCAATGGCACTAAACATCTTAC 57.491 37.500 0.00 0.00 0.00 2.34
1445 1528 9.257651 ACATCTTACGGATAAAATAGTAGCAAC 57.742 33.333 0.00 0.00 32.64 4.17
1538 1622 1.192146 AGGTGTGCATGGGTCGTAGT 61.192 55.000 0.00 0.00 0.00 2.73
2059 2145 9.918630 AATATTCATGCTTAACTAAATGCATCC 57.081 29.630 0.00 0.00 43.24 3.51
2158 2244 3.010027 TGCCCATTCTCTTTACATGACCA 59.990 43.478 0.00 0.00 0.00 4.02
2164 2250 8.748412 CCCATTCTCTTTACATGACCAAATAAA 58.252 33.333 0.00 0.00 0.00 1.40
2207 2294 6.751157 TGCTGAGATGAATTGTTTGTTTCAT 58.249 32.000 0.00 0.00 43.42 2.57
2214 2301 5.468592 TGAATTGTTTGTTTCATGGATCCG 58.531 37.500 7.39 0.00 0.00 4.18
2309 2396 0.982704 AGTGCAGCTGAGTTCTGGAT 59.017 50.000 20.43 0.00 34.50 3.41
2348 2435 5.237815 CCAGTAGCAAGATGTGACTAAACA 58.762 41.667 0.00 0.00 0.00 2.83
2351 2438 7.549134 CCAGTAGCAAGATGTGACTAAACATAA 59.451 37.037 0.00 0.00 40.87 1.90
2389 2476 5.934935 AGGAACATGTTACTTTGGTTACG 57.065 39.130 18.05 0.00 26.60 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
230 239 2.746362 AGCATGACAGTTTAGCTCTTGC 59.254 45.455 0.00 0.0 40.05 4.01
233 246 5.350504 ACATAGCATGACAGTTTAGCTCT 57.649 39.130 0.00 0.0 36.80 4.09
372 385 5.852282 ACAGCTTTAAACTGAACCAACAT 57.148 34.783 18.56 0.0 38.55 2.71
469 484 4.829064 ACATACTTTCAGAAAAGCGCAA 57.171 36.364 11.47 0.0 44.82 4.85
524 539 5.565439 GCATGGCACTACATCTTTCTTGTTT 60.565 40.000 0.00 0.0 0.00 2.83
569 584 5.010516 TGGAGCTGCAAAGCAAGTTAAATTA 59.989 36.000 5.01 0.0 38.41 1.40
578 593 2.158928 ACAAAATGGAGCTGCAAAGCAA 60.159 40.909 13.45 0.0 38.41 3.91
850 916 7.425577 AAAAGGATGCAAACAGAAATTTAGC 57.574 32.000 0.00 0.0 0.00 3.09
1038 1118 4.141088 ACACCCTCCCTAACGTAGATATCA 60.141 45.833 5.32 0.0 0.00 2.15
1166 1246 6.122964 CCTAGGATTGCTTTTAAGTAGCCTT 58.877 40.000 1.05 0.0 37.85 4.35
1427 1510 7.929785 TCCTAAAGGTTGCTACTATTTTATCCG 59.070 37.037 0.00 0.0 36.34 4.18
1439 1522 3.649023 TGTCCAGTTCCTAAAGGTTGCTA 59.351 43.478 0.00 0.0 36.34 3.49
1445 1528 4.256920 CAGACATGTCCAGTTCCTAAAGG 58.743 47.826 22.21 0.0 0.00 3.11
1516 1600 0.618458 ACGACCCATGCACACCTAAT 59.382 50.000 0.00 0.0 0.00 1.73
1624 1709 0.033405 AGCAGTAAGGAGGGAGCGTA 60.033 55.000 0.00 0.0 0.00 4.42
2003 2089 5.118990 GTGATTCCACAGTATGCAGTGTAT 58.881 41.667 5.66 0.0 42.53 2.29
2164 2250 8.359642 TCTCAGCAAAAGCAACTACAAATATTT 58.640 29.630 0.00 0.0 0.00 1.40
2176 2262 5.204409 ACAATTCATCTCAGCAAAAGCAA 57.796 34.783 0.00 0.0 0.00 3.91
2207 2294 0.871722 CAAAACAACGCTCGGATCCA 59.128 50.000 13.41 0.0 0.00 3.41
2309 2396 0.988145 CTGGCAAGGAGGGTGGGATA 60.988 60.000 0.00 0.0 0.00 2.59
2351 2438 9.547279 AACATGTTCCTTTCTAATCCCTATTTT 57.453 29.630 4.92 0.0 0.00 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.