Multiple sequence alignment - TraesCS1A01G118600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G118600 chr1A 100.000 3238 0 0 1 3238 127093792 127090555 0 5980
1 TraesCS1A01G118600 chr5A 98.919 3239 33 2 1 3238 9631959 9628722 0 5786
2 TraesCS1A01G118600 chr5A 98.672 3239 40 3 1 3238 294240034 294236798 0 5740
3 TraesCS1A01G118600 chr5A 98.642 3239 38 4 1 3238 17471135 17467902 0 5733
4 TraesCS1A01G118600 chr2A 98.796 3239 37 2 1 3238 389203672 389206909 0 5764
5 TraesCS1A01G118600 chr3A 98.765 3240 37 3 1 3238 83036413 83033175 0 5758
6 TraesCS1A01G118600 chr3A 97.166 3246 56 14 1 3238 42791638 42788421 0 5452
7 TraesCS1A01G118600 chr3A 96.684 2352 74 4 888 3238 450957945 450960293 0 3908
8 TraesCS1A01G118600 chr3A 96.599 2352 75 5 888 3238 745751219 745753566 0 3895
9 TraesCS1A01G118600 chr3A 91.432 887 43 14 18 891 745750304 745751170 0 1186
10 TraesCS1A01G118600 chr3A 90.858 886 48 16 18 891 653932662 653933526 0 1157
11 TraesCS1A01G118600 chr3A 90.192 887 51 16 18 891 32205292 32206155 0 1123
12 TraesCS1A01G118600 chr3A 90.068 886 37 19 18 891 450957050 450957896 0 1101
13 TraesCS1A01G118600 chr2B 98.611 3240 37 5 1 3238 741915598 741912365 0 5727


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G118600 chr1A 127090555 127093792 3237 True 5980.0 5980 100.0000 1 3238 1 chr1A.!!$R1 3237
1 TraesCS1A01G118600 chr5A 9628722 9631959 3237 True 5786.0 5786 98.9190 1 3238 1 chr5A.!!$R1 3237
2 TraesCS1A01G118600 chr5A 294236798 294240034 3236 True 5740.0 5740 98.6720 1 3238 1 chr5A.!!$R3 3237
3 TraesCS1A01G118600 chr5A 17467902 17471135 3233 True 5733.0 5733 98.6420 1 3238 1 chr5A.!!$R2 3237
4 TraesCS1A01G118600 chr2A 389203672 389206909 3237 False 5764.0 5764 98.7960 1 3238 1 chr2A.!!$F1 3237
5 TraesCS1A01G118600 chr3A 83033175 83036413 3238 True 5758.0 5758 98.7650 1 3238 1 chr3A.!!$R2 3237
6 TraesCS1A01G118600 chr3A 42788421 42791638 3217 True 5452.0 5452 97.1660 1 3238 1 chr3A.!!$R1 3237
7 TraesCS1A01G118600 chr3A 745750304 745753566 3262 False 2540.5 3895 94.0155 18 3238 2 chr3A.!!$F4 3220
8 TraesCS1A01G118600 chr3A 450957050 450960293 3243 False 2504.5 3908 93.3760 18 3238 2 chr3A.!!$F3 3220
9 TraesCS1A01G118600 chr3A 653932662 653933526 864 False 1157.0 1157 90.8580 18 891 1 chr3A.!!$F2 873
10 TraesCS1A01G118600 chr3A 32205292 32206155 863 False 1123.0 1123 90.1920 18 891 1 chr3A.!!$F1 873
11 TraesCS1A01G118600 chr2B 741912365 741915598 3233 True 5727.0 5727 98.6110 1 3238 1 chr2B.!!$R1 3237

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
371 384 0.776810 TGGCCAAGTGGAAATCCTGA 59.223 50.000 0.61 0.0 37.39 3.86 F
1265 1345 1.273327 GGCAAATGTTCCTGGTCCAAG 59.727 52.381 0.00 0.0 0.00 3.61 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1406 1486 1.117150 ACCCATCCGTAGTGCGTAAT 58.883 50.000 0.00 0.0 39.32 1.89 R
2486 2571 1.124297 CGATATGCAATCGTGGTACGC 59.876 52.381 17.58 0.0 42.21 4.42 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
371 384 0.776810 TGGCCAAGTGGAAATCCTGA 59.223 50.000 0.61 0.00 37.39 3.86
524 538 5.794894 CATATATTCTGGTCCCACACCTAC 58.205 45.833 0.00 0.00 46.98 3.18
675 698 7.557358 TCTCAAATGTAGCATCCAATTATGTGT 59.443 33.333 0.00 0.00 0.00 3.72
800 824 6.538742 GTCATGCTCTTGCCAGTTATTTACTA 59.461 38.462 0.00 0.00 38.71 1.82
1265 1345 1.273327 GGCAAATGTTCCTGGTCCAAG 59.727 52.381 0.00 0.00 0.00 3.61
1331 1411 3.774842 AGAAGAAGGAGAGGATGAGGT 57.225 47.619 0.00 0.00 0.00 3.85
1406 1486 7.446931 TCAAATTGCTAAGGATCACTACAACAA 59.553 33.333 0.00 0.00 0.00 2.83
1518 1598 3.447742 CAACAAGTTCAAGAAGCCCAAC 58.552 45.455 0.00 0.00 0.00 3.77
2301 2385 2.422127 CGTTCGGACCAAAGGCAATAAT 59.578 45.455 0.00 0.00 0.00 1.28
2486 2571 1.594862 CTCGAAAAGCTTATGCGGAGG 59.405 52.381 0.00 0.00 45.42 4.30
2829 2915 1.736586 CCGGAATCCAGGACTCTCG 59.263 63.158 0.00 0.12 0.00 4.04
3035 3121 0.316204 CGTAGTGAGGGGTTCAACGT 59.684 55.000 0.00 0.00 36.03 3.99
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
371 384 6.561614 TCGCTAGAATAGACGTCTCAATTTT 58.438 36.000 23.89 14.49 42.77 1.82
675 698 7.308830 GCAAGGAGCTCTTTTCAGATTTTTCTA 60.309 37.037 14.64 0.00 41.15 2.10
800 824 6.443934 TGTTATGTTAGTTGCACAGTTTGT 57.556 33.333 0.00 0.00 0.00 2.83
1265 1345 1.744741 GCTTCCAGCTCAGTCCTGC 60.745 63.158 0.00 0.00 38.45 4.85
1406 1486 1.117150 ACCCATCCGTAGTGCGTAAT 58.883 50.000 0.00 0.00 39.32 1.89
1518 1598 1.137675 TCAGCTCCTCCATCATCAACG 59.862 52.381 0.00 0.00 0.00 4.10
1947 2030 8.629158 AGTTAAGTCATTTCAGTTGCACAATAA 58.371 29.630 0.00 0.00 0.00 1.40
1950 2033 6.449635 AGTTAAGTCATTTCAGTTGCACAA 57.550 33.333 0.00 0.00 0.00 3.33
2301 2385 9.199982 CTCTACGGAAACTTGTACAAAGATTTA 57.800 33.333 10.03 0.00 0.00 1.40
2486 2571 1.124297 CGATATGCAATCGTGGTACGC 59.876 52.381 17.58 0.00 42.21 4.42
3035 3121 5.175859 GGTTCACATATCTTTTGAGGACGA 58.824 41.667 0.00 0.00 0.00 4.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.