Multiple sequence alignment - TraesCS1A01G116400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G116400 chr1A 100.000 2659 0 0 1 2659 122501731 122499073 0 4911
1 TraesCS1A01G116400 chr1D 97.381 2673 33 17 1 2659 113909548 113906899 0 4514
2 TraesCS1A01G116400 chr1B 95.693 1718 45 8 955 2659 174107897 174109598 0 2736
3 TraesCS1A01G116400 chr1B 97.923 963 14 1 1 957 174106813 174107775 0 1663


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G116400 chr1A 122499073 122501731 2658 True 4911.0 4911 100.000 1 2659 1 chr1A.!!$R1 2658
1 TraesCS1A01G116400 chr1D 113906899 113909548 2649 True 4514.0 4514 97.381 1 2659 1 chr1D.!!$R1 2658
2 TraesCS1A01G116400 chr1B 174106813 174109598 2785 False 2199.5 2736 96.808 1 2659 2 chr1B.!!$F1 2658

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
897 904 2.231478 CGTCTTGAGCCTTCTCCAGTTA 59.769 50.0 0.0 0.0 38.58 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2248 2397 1.003051 AAGTGGGCGGGATAGGTCT 59.997 57.895 0.0 0.0 0.0 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
246 247 6.299922 GCTAAGGATAGGGTTTCAATTAGCT 58.700 40.000 6.41 0.00 37.18 3.32
667 674 8.574251 TTAATAGTGCATTAAGGCAAGAAGAA 57.426 30.769 17.48 6.17 46.93 2.52
897 904 2.231478 CGTCTTGAGCCTTCTCCAGTTA 59.769 50.000 0.00 0.00 38.58 2.24
1249 1387 1.830477 CTCAAGGAGCTAAGGCACTCT 59.170 52.381 0.00 0.00 38.49 3.24
1410 1548 5.549454 GCTCGATGCATGTTCTGTGGAAC 62.549 52.174 2.46 2.38 44.99 3.62
1592 1731 7.656707 ATTTGAATAGGTTTGCATGTTTCAC 57.343 32.000 0.00 0.00 0.00 3.18
1599 1738 3.510719 GTTTGCATGTTTCACTGTGTGT 58.489 40.909 7.79 0.00 34.79 3.72
1773 1918 5.527951 GCTGATCATTGTCTCTGTTCATGAT 59.472 40.000 0.00 0.00 0.00 2.45
1863 2010 9.738832 GTTCTCTTTTATCTGTAAGGCTACTAG 57.261 37.037 0.00 0.00 0.00 2.57
2153 2302 2.542595 AGTCTAACTTTTCAACGGTGCG 59.457 45.455 0.00 0.00 0.00 5.34
2248 2397 6.362248 TGTGATGTAGGCTACTGTATCTGTA 58.638 40.000 24.07 2.26 0.00 2.74
2344 2494 3.057946 GGTCATCTTTCAACTTGTGAGCC 60.058 47.826 0.00 0.00 37.61 4.70
2552 2702 4.940046 CCACTTGAGAATGTATTGCAGAGT 59.060 41.667 0.00 0.00 0.00 3.24
2563 2713 0.687354 TTGCAGAGTCTCCTTCCACC 59.313 55.000 0.00 0.00 0.00 4.61
2574 2724 1.891150 TCCTTCCACCGTTAGTCTGTC 59.109 52.381 0.00 0.00 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
246 247 4.910956 CACTTGCTAGGTGCGCTA 57.089 55.556 9.73 0.00 46.63 4.26
667 674 4.255510 ACAGCAAATATCATCACCCCTT 57.744 40.909 0.00 0.00 0.00 3.95
856 863 7.281366 AGACGAAGGGAGGATATAAGGTATA 57.719 40.000 0.00 0.00 0.00 1.47
897 904 4.444449 CAGGATGAGTCACATGATGGTGAT 60.444 45.833 0.00 0.00 44.39 3.06
1410 1548 3.587506 TGAGGGACCTTCCTTCCTAAAAG 59.412 47.826 0.38 0.00 41.51 2.27
1592 1731 1.865865 AAGGTAGCAACGACACACAG 58.134 50.000 0.00 0.00 0.00 3.66
1599 1738 4.081322 AGAAAAGGAAAGGTAGCAACGA 57.919 40.909 0.00 0.00 0.00 3.85
1651 1790 6.293955 GCACAAACTGTACAAGGACATGTTAT 60.294 38.462 0.00 0.00 34.75 1.89
1773 1918 5.104776 AGCTGAATTTACTGGCTGATCAGTA 60.105 40.000 23.38 12.28 45.18 2.74
2248 2397 1.003051 AAGTGGGCGGGATAGGTCT 59.997 57.895 0.00 0.00 0.00 3.85
2344 2494 3.457610 AAAAGTTTCCAGTGTGCATGG 57.542 42.857 0.00 0.00 39.33 3.66
2552 2702 2.168496 CAGACTAACGGTGGAAGGAGA 58.832 52.381 0.00 0.00 0.00 3.71
2563 2713 6.448006 CCTGGATAATAAGGACAGACTAACG 58.552 44.000 0.00 0.00 35.40 3.18
2574 2724 3.064900 GGCTCTGCCTGGATAATAAGG 57.935 52.381 0.00 0.00 46.69 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.