Multiple sequence alignment - TraesCS1A01G110100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G110100 chr1A 100.000 2784 0 0 1 2784 109430628 109427845 0.000000e+00 5142
1 TraesCS1A01G110100 chr1A 97.670 1545 29 4 998 2536 54009366 54007823 0.000000e+00 2647
2 TraesCS1A01G110100 chr1A 96.456 790 27 1 1 789 54010183 54009394 0.000000e+00 1303
3 TraesCS1A01G110100 chr4A 98.887 2785 27 4 1 2784 76386218 76383437 0.000000e+00 4968
4 TraesCS1A01G110100 chr4A 89.431 615 51 10 2180 2784 207974380 207974990 0.000000e+00 763
5 TraesCS1A01G110100 chr4A 90.855 503 25 7 1470 1969 420515787 420516271 0.000000e+00 654
6 TraesCS1A01G110100 chr4A 89.865 444 31 6 1708 2137 207970503 207970946 2.420000e-155 558
7 TraesCS1A01G110100 chr6B 97.741 1461 28 3 998 2454 710147767 710149226 0.000000e+00 2510
8 TraesCS1A01G110100 chr6B 96.574 788 25 1 1 786 710146949 710147736 0.000000e+00 1304
9 TraesCS1A01G110100 chr6B 88.621 457 42 5 2332 2784 420747578 420747128 5.240000e-152 547
10 TraesCS1A01G110100 chr6B 91.633 251 15 4 1888 2132 149616946 149616696 2.660000e-90 342
11 TraesCS1A01G110100 chr6B 84.195 348 38 10 2449 2784 10071145 10070803 3.460000e-84 322
12 TraesCS1A01G110100 chr6A 97.557 1187 24 3 998 2180 514353621 514352436 0.000000e+00 2026
13 TraesCS1A01G110100 chr6A 96.207 791 28 1 1 789 514347454 514346664 0.000000e+00 1293
14 TraesCS1A01G110100 chr6A 95.954 791 30 1 1 789 514354439 514353649 0.000000e+00 1282
15 TraesCS1A01G110100 chr6A 97.623 631 10 3 998 1624 514346636 514346007 0.000000e+00 1077
16 TraesCS1A01G110100 chr7A 91.818 660 46 6 2132 2784 9390014 9389356 0.000000e+00 913
17 TraesCS1A01G110100 chr7A 92.774 429 26 4 1713 2137 9390870 9390443 1.420000e-172 616
18 TraesCS1A01G110100 chr7A 82.804 535 79 9 998 1522 731681686 731682217 1.510000e-127 466
19 TraesCS1A01G110100 chr7B 91.502 659 48 6 2132 2784 607310171 607309515 0.000000e+00 900
20 TraesCS1A01G110100 chr7B 92.075 429 29 4 1713 2137 607311027 607310600 1.430000e-167 599
21 TraesCS1A01G110100 chr7B 92.188 320 17 3 1347 1659 607311344 607311026 1.970000e-121 446
22 TraesCS1A01G110100 chr5B 90.855 503 25 5 1470 1969 163065997 163066481 0.000000e+00 654
23 TraesCS1A01G110100 chr1B 90.855 503 25 5 1470 1969 558565925 558566409 0.000000e+00 654
24 TraesCS1A01G110100 chr1B 91.633 251 15 4 1888 2132 613030663 613030913 2.660000e-90 342
25 TraesCS1A01G110100 chrUn 84.918 610 63 22 2189 2783 49429847 49429252 8.590000e-165 590
26 TraesCS1A01G110100 chrUn 91.600 250 16 4 1888 2132 49430287 49430038 9.550000e-90 340
27 TraesCS1A01G110100 chr4D 85.294 578 78 7 5 578 494290431 494289857 8.590000e-165 590
28 TraesCS1A01G110100 chr2D 93.506 308 14 3 995 1299 242903623 242903319 1.180000e-123 453
29 TraesCS1A01G110100 chr7D 82.037 540 78 11 998 1522 634572377 634571842 2.540000e-120 442
30 TraesCS1A01G110100 chr3A 81.107 524 71 23 2132 2643 70842884 70843391 7.230000e-106 394
31 TraesCS1A01G110100 chr2A 82.692 260 34 10 2391 2643 6440196 6439941 1.300000e-53 220


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G110100 chr1A 109427845 109430628 2783 True 5142.000000 5142 100.000000 1 2784 1 chr1A.!!$R1 2783
1 TraesCS1A01G110100 chr1A 54007823 54010183 2360 True 1975.000000 2647 97.063000 1 2536 2 chr1A.!!$R2 2535
2 TraesCS1A01G110100 chr4A 76383437 76386218 2781 True 4968.000000 4968 98.887000 1 2784 1 chr4A.!!$R1 2783
3 TraesCS1A01G110100 chr4A 207970503 207974990 4487 False 660.500000 763 89.648000 1708 2784 2 chr4A.!!$F2 1076
4 TraesCS1A01G110100 chr6B 710146949 710149226 2277 False 1907.000000 2510 97.157500 1 2454 2 chr6B.!!$F1 2453
5 TraesCS1A01G110100 chr6A 514352436 514354439 2003 True 1654.000000 2026 96.755500 1 2180 2 chr6A.!!$R2 2179
6 TraesCS1A01G110100 chr6A 514346007 514347454 1447 True 1185.000000 1293 96.915000 1 1624 2 chr6A.!!$R1 1623
7 TraesCS1A01G110100 chr7A 9389356 9390870 1514 True 764.500000 913 92.296000 1713 2784 2 chr7A.!!$R1 1071
8 TraesCS1A01G110100 chr7A 731681686 731682217 531 False 466.000000 466 82.804000 998 1522 1 chr7A.!!$F1 524
9 TraesCS1A01G110100 chr7B 607309515 607311344 1829 True 648.333333 900 91.921667 1347 2784 3 chr7B.!!$R1 1437
10 TraesCS1A01G110100 chrUn 49429252 49430287 1035 True 465.000000 590 88.259000 1888 2783 2 chrUn.!!$R1 895
11 TraesCS1A01G110100 chr4D 494289857 494290431 574 True 590.000000 590 85.294000 5 578 1 chr4D.!!$R1 573
12 TraesCS1A01G110100 chr7D 634571842 634572377 535 True 442.000000 442 82.037000 998 1522 1 chr7D.!!$R1 524
13 TraesCS1A01G110100 chr3A 70842884 70843391 507 False 394.000000 394 81.107000 2132 2643 1 chr3A.!!$F1 511

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
71 72 2.238521 GGAATGGTGAACCTTGAAGCA 58.761 47.619 0.37 0.0 36.82 3.91 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1913 1941 1.14831 CTTGTGTTGTACTCCCAGCG 58.852 55.0 0.0 0.0 0.0 5.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
71 72 2.238521 GGAATGGTGAACCTTGAAGCA 58.761 47.619 0.37 0.0 36.82 3.91
282 285 4.564821 GCTGTAGGTTTTGGATGTCAGGTA 60.565 45.833 0.00 0.0 0.00 3.08
402 405 4.150627 CGGGTTTAGACATTCTCATATGCG 59.849 45.833 0.00 0.0 0.00 4.73
410 413 7.413475 AGACATTCTCATATGCGTGATTAAC 57.587 36.000 0.00 0.0 0.00 2.01
2608 6345 2.494471 TGTAGAATGATCGACAACGGGT 59.506 45.455 0.00 0.0 38.10 5.28
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
282 285 3.398967 TCTTAATGGCCTGCCTATTCCAT 59.601 43.478 9.97 0.0 40.77 3.41
402 405 4.725556 TCACTTCAGTTGCGTTAATCAC 57.274 40.909 0.00 0.0 0.00 3.06
410 413 3.818961 ACATGAATCACTTCAGTTGCG 57.181 42.857 0.00 0.0 44.32 4.85
1115 1128 2.154798 CTTGACCGACTCCTGCCGAA 62.155 60.000 0.00 0.0 0.00 4.30
1913 1941 1.148310 CTTGTGTTGTACTCCCAGCG 58.852 55.000 0.00 0.0 0.00 5.18
2258 5988 5.047590 TGTTGACGTTATCCTCAGCTTTCTA 60.048 40.000 0.00 0.0 0.00 2.10
2608 6345 7.202102 GCTCCTATCCTATTCTTTTACTGGGAA 60.202 40.741 0.00 0.0 0.00 3.97


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.