Multiple sequence alignment - TraesCS1A01G099800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G099800 chr1A 100.000 2755 0 0 1 2755 96422242 96424996 0.000000e+00 5088.0
1 TraesCS1A01G099800 chr1A 99.108 897 8 0 1859 2755 309712294 309713190 0.000000e+00 1613.0
2 TraesCS1A01G099800 chr1A 96.023 855 31 2 1 852 295467859 295468713 0.000000e+00 1387.0
3 TraesCS1A01G099800 chr1A 98.450 774 12 0 1089 1862 309711217 309711990 0.000000e+00 1363.0
4 TraesCS1A01G099800 chr1A 95.088 855 39 2 1 852 344084364 344085218 0.000000e+00 1343.0
5 TraesCS1A01G099800 chr1A 91.968 498 37 3 1989 2484 51257912 51257416 0.000000e+00 695.0
6 TraesCS1A01G099800 chr1A 83.916 572 70 12 1292 1847 450977335 450977900 6.760000e-146 527.0
7 TraesCS1A01G099800 chr1A 97.382 191 5 0 858 1048 309704992 309705182 2.650000e-85 326.0
8 TraesCS1A01G099800 chr1A 100.000 56 0 0 1044 1099 309710596 309710651 1.350000e-18 104.0
9 TraesCS1A01G099800 chr7A 98.428 1908 30 0 848 2755 276123907 276122000 0.000000e+00 3358.0
10 TraesCS1A01G099800 chr7A 95.439 855 35 3 1 852 198777364 198776511 0.000000e+00 1360.0
11 TraesCS1A01G099800 chr7A 95.311 853 39 1 1 852 339072454 339073306 0.000000e+00 1352.0
12 TraesCS1A01G099800 chr7A 95.205 855 38 3 1 852 16211139 16211993 0.000000e+00 1349.0
13 TraesCS1A01G099800 chr5A 95.755 1908 73 6 849 2755 351440487 351442387 0.000000e+00 3068.0
14 TraesCS1A01G099800 chr5A 95.088 855 38 3 1 852 690197311 690198164 0.000000e+00 1343.0
15 TraesCS1A01G099800 chr5A 86.165 824 87 11 1188 1987 287638151 287637331 0.000000e+00 865.0
16 TraesCS1A01G099800 chr5A 85.122 820 92 13 1188 1982 77958455 77957641 0.000000e+00 811.0
17 TraesCS1A01G099800 chr5A 93.173 498 31 3 1989 2484 287636017 287635521 0.000000e+00 728.0
18 TraesCS1A01G099800 chr5A 92.958 497 33 2 1989 2484 77956466 77955971 0.000000e+00 723.0
19 TraesCS1A01G099800 chr5A 91.566 498 39 3 1989 2484 602364590 602364094 0.000000e+00 684.0
20 TraesCS1A01G099800 chr5A 83.721 129 20 1 842 970 287638527 287638400 1.340000e-23 121.0
21 TraesCS1A01G099800 chr5A 86.207 87 12 0 1102 1188 32394523 32394437 8.120000e-16 95.3
22 TraesCS1A01G099800 chr5A 86.207 87 12 0 1102 1188 287637791 287637705 8.120000e-16 95.3
23 TraesCS1A01G099800 chr4A 95.322 855 37 2 1 852 164286586 164287440 0.000000e+00 1354.0
24 TraesCS1A01G099800 chr4A 95.396 847 38 1 1 846 375596468 375597314 0.000000e+00 1347.0
25 TraesCS1A01G099800 chr4A 94.231 104 5 1 2449 2551 520139465 520139362 1.020000e-34 158.0
26 TraesCS1A01G099800 chr4A 94.118 102 5 1 2449 2549 606549063 606549164 1.320000e-33 154.0
27 TraesCS1A01G099800 chr4A 94.118 102 5 1 2449 2549 712002814 712002915 1.320000e-33 154.0
28 TraesCS1A01G099800 chr2A 95.188 852 40 1 1 851 515683707 515684558 0.000000e+00 1345.0
29 TraesCS1A01G099800 chr3A 84.807 1402 140 36 849 2217 173529609 173530970 0.000000e+00 1341.0
30 TraesCS1A01G099800 chr3A 84.582 1401 144 32 849 2217 173465120 173466480 0.000000e+00 1325.0
31 TraesCS1A01G099800 chr3A 86.553 818 84 13 1188 1982 734453188 734454002 0.000000e+00 878.0
32 TraesCS1A01G099800 chr3A 92.669 532 33 4 2225 2755 173466443 173466969 0.000000e+00 761.0
33 TraesCS1A01G099800 chr3A 92.293 532 35 4 2225 2755 173530933 173531459 0.000000e+00 750.0
34 TraesCS1A01G099800 chr3A 93.574 498 29 3 1989 2484 734458644 734459140 0.000000e+00 739.0
35 TraesCS1A01G099800 chr3A 86.207 87 12 0 1102 1188 734453547 734453633 8.120000e-16 95.3
36 TraesCS1A01G099800 chr6A 84.048 1166 133 23 858 1997 567083152 567082014 0.000000e+00 1074.0
37 TraesCS1A01G099800 chr6A 92.424 528 34 4 2229 2755 567081794 567081272 0.000000e+00 749.0
38 TraesCS1A01G099800 chr6A 93.307 254 15 2 1965 2217 567082013 567081761 9.320000e-100 374.0
39 TraesCS1A01G099800 chr6A 88.462 104 8 4 842 944 214808244 214808144 3.730000e-24 122.0
40 TraesCS1A01G099800 chr6D 86.207 1015 91 15 884 1873 337760509 337761499 0.000000e+00 1053.0
41 TraesCS1A01G099800 chr1D 94.177 498 27 2 1989 2485 51568971 51569467 0.000000e+00 758.0
42 TraesCS1A01G099800 chr1D 94.118 102 5 1 2449 2549 338063344 338063243 1.320000e-33 154.0
43 TraesCS1A01G099800 chr1D 87.356 87 11 0 1102 1188 51568455 51568541 1.750000e-17 100.0
44 TraesCS1A01G099800 chr7B 93.137 102 6 1 2449 2549 263734234 263734335 6.150000e-32 148.0
45 TraesCS1A01G099800 chr7B 91.176 102 8 1 2449 2549 746859056 746859157 1.330000e-28 137.0
46 TraesCS1A01G099800 chr3D 89.524 105 7 2 2449 2549 479954857 479954961 2.230000e-26 130.0
47 TraesCS1A01G099800 chr3B 87.500 104 10 3 852 954 806994445 806994344 1.730000e-22 117.0
48 TraesCS1A01G099800 chr1B 86.239 109 13 2 837 944 298113525 298113632 1.730000e-22 117.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G099800 chr1A 96422242 96424996 2754 False 5088.000000 5088 100.000000 1 2755 1 chr1A.!!$F1 2754
1 TraesCS1A01G099800 chr1A 295467859 295468713 854 False 1387.000000 1387 96.023000 1 852 1 chr1A.!!$F2 851
2 TraesCS1A01G099800 chr1A 344084364 344085218 854 False 1343.000000 1343 95.088000 1 852 1 chr1A.!!$F4 851
3 TraesCS1A01G099800 chr1A 309710596 309713190 2594 False 1026.666667 1613 99.186000 1044 2755 3 chr1A.!!$F6 1711
4 TraesCS1A01G099800 chr1A 450977335 450977900 565 False 527.000000 527 83.916000 1292 1847 1 chr1A.!!$F5 555
5 TraesCS1A01G099800 chr7A 276122000 276123907 1907 True 3358.000000 3358 98.428000 848 2755 1 chr7A.!!$R2 1907
6 TraesCS1A01G099800 chr7A 198776511 198777364 853 True 1360.000000 1360 95.439000 1 852 1 chr7A.!!$R1 851
7 TraesCS1A01G099800 chr7A 339072454 339073306 852 False 1352.000000 1352 95.311000 1 852 1 chr7A.!!$F2 851
8 TraesCS1A01G099800 chr7A 16211139 16211993 854 False 1349.000000 1349 95.205000 1 852 1 chr7A.!!$F1 851
9 TraesCS1A01G099800 chr5A 351440487 351442387 1900 False 3068.000000 3068 95.755000 849 2755 1 chr5A.!!$F1 1906
10 TraesCS1A01G099800 chr5A 690197311 690198164 853 False 1343.000000 1343 95.088000 1 852 1 chr5A.!!$F2 851
11 TraesCS1A01G099800 chr5A 77955971 77958455 2484 True 767.000000 811 89.040000 1188 2484 2 chr5A.!!$R3 1296
12 TraesCS1A01G099800 chr5A 287635521 287638527 3006 True 452.325000 865 87.316500 842 2484 4 chr5A.!!$R4 1642
13 TraesCS1A01G099800 chr4A 164286586 164287440 854 False 1354.000000 1354 95.322000 1 852 1 chr4A.!!$F1 851
14 TraesCS1A01G099800 chr4A 375596468 375597314 846 False 1347.000000 1347 95.396000 1 846 1 chr4A.!!$F2 845
15 TraesCS1A01G099800 chr2A 515683707 515684558 851 False 1345.000000 1345 95.188000 1 851 1 chr2A.!!$F1 850
16 TraesCS1A01G099800 chr3A 173529609 173531459 1850 False 1045.500000 1341 88.550000 849 2755 2 chr3A.!!$F3 1906
17 TraesCS1A01G099800 chr3A 173465120 173466969 1849 False 1043.000000 1325 88.625500 849 2755 2 chr3A.!!$F2 1906
18 TraesCS1A01G099800 chr3A 734453188 734454002 814 False 486.650000 878 86.380000 1102 1982 2 chr3A.!!$F4 880
19 TraesCS1A01G099800 chr6A 567081272 567083152 1880 True 732.333333 1074 89.926333 858 2755 3 chr6A.!!$R2 1897
20 TraesCS1A01G099800 chr6D 337760509 337761499 990 False 1053.000000 1053 86.207000 884 1873 1 chr6D.!!$F1 989
21 TraesCS1A01G099800 chr1D 51568455 51569467 1012 False 429.000000 758 90.766500 1102 2485 2 chr1D.!!$F1 1383

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
698 701 0.179127 CTCACACATCATCGGAGCGT 60.179 55.0 0.0 0.0 0.0 5.07 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2604 5095 1.597742 AACTCAAGCAGCAACGTCAT 58.402 45.0 0.0 0.0 0.0 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
45 46 6.769512 AGCATAAGTATTACGATGGGTGAAT 58.230 36.000 11.42 0.00 30.46 2.57
279 280 6.243900 AGAGGGATAAACTCATGCAATATGG 58.756 40.000 0.00 0.00 37.43 2.74
295 296 5.451798 GCAATATGGTGTAAACCCCATCTTG 60.452 44.000 14.33 14.33 43.15 3.02
332 333 5.622041 GCAACAATACAATACGTGTCGTTTT 59.378 36.000 0.00 0.00 41.98 2.43
368 369 1.091771 ATCGAGCACCGCAAGATTGG 61.092 55.000 0.00 0.00 43.02 3.16
388 389 1.813178 GACCCAAAGCTAAGCACTTCC 59.187 52.381 0.00 0.00 0.00 3.46
403 404 2.368221 CACTTCCCCCATTGCAAGAAAA 59.632 45.455 4.94 0.00 0.00 2.29
553 554 3.394800 TCGGATCTCGACAAACACG 57.605 52.632 2.65 0.00 43.74 4.49
557 558 1.006571 ATCTCGACAAACACGCCGT 60.007 52.632 0.00 0.00 0.00 5.68
585 586 9.619316 AAAGAAGATTACATCGAATAGATCTCG 57.381 33.333 0.00 0.00 37.52 4.04
634 637 6.924913 TGAGATCCAAAGAGAGAGAAGAAA 57.075 37.500 0.00 0.00 0.00 2.52
696 699 2.099921 ACTACTCACACATCATCGGAGC 59.900 50.000 0.00 0.00 0.00 4.70
698 701 0.179127 CTCACACATCATCGGAGCGT 60.179 55.000 0.00 0.00 0.00 5.07
828 832 1.070786 GGTTTCGTGGTGCTCCTGA 59.929 57.895 6.34 1.39 34.23 3.86
1602 2359 1.835531 CGGACCTAAACATGGTAGGGT 59.164 52.381 22.16 15.78 42.23 4.34
2106 4595 2.290093 CCAATTTTGGCACGCAATGTTT 59.710 40.909 0.00 0.00 42.21 2.83
2126 4615 6.047870 TGTTTGTTTTTCAGATTCACCATGG 58.952 36.000 11.19 11.19 0.00 3.66
2409 4899 4.460382 CCTAGCAGATCAACACATTTGGTT 59.540 41.667 0.00 0.00 0.00 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
279 280 5.506708 AGGATAACAAGATGGGGTTTACAC 58.493 41.667 0.00 0.00 0.00 2.90
295 296 4.814234 TGTATTGTTGCCATCGAGGATAAC 59.186 41.667 0.00 4.08 41.22 1.89
332 333 1.550524 CGATCCCAGTGACAGAAAGGA 59.449 52.381 0.00 0.00 0.00 3.36
368 369 1.813178 GGAAGTGCTTAGCTTTGGGTC 59.187 52.381 5.60 0.00 0.00 4.46
388 389 5.493809 AGATTGATTTTTCTTGCAATGGGG 58.506 37.500 0.00 0.00 31.65 4.96
403 404 5.450818 TGGTTTGGCCTACTAGATTGATT 57.549 39.130 3.32 0.00 38.35 2.57
553 554 5.961395 TCGATGTAATCTTCTTTTACGGC 57.039 39.130 0.00 0.00 42.58 5.68
585 586 5.474825 ACAAAGTTCTCCTCGATTCTCTTC 58.525 41.667 0.00 0.00 0.00 2.87
660 663 6.985059 GTGTGAGTAGTTTACTTCAGACCTTT 59.015 38.462 2.18 0.00 39.59 3.11
696 699 3.491619 CCTCTACATCAACTCCATGGACG 60.492 52.174 11.44 9.93 0.00 4.79
698 701 2.435805 GCCTCTACATCAACTCCATGGA 59.564 50.000 15.27 15.27 0.00 3.41
828 832 9.998106 GAGATATATATATACCCCGCAAACATT 57.002 33.333 5.19 0.00 0.00 2.71
1164 1786 1.757699 AGCTCGAAGGACCCTAACATC 59.242 52.381 0.00 0.00 0.00 3.06
1403 2159 2.750815 GGAACTCGTAGCGTTGCAT 58.249 52.632 0.00 0.00 42.97 3.96
1602 2359 1.816863 GAGACCACCAGCTCCAACGA 61.817 60.000 0.00 0.00 0.00 3.85
2106 4595 5.453057 CCAACCATGGTGAATCTGAAAAACA 60.453 40.000 20.60 0.00 42.18 2.83
2409 4899 9.353431 TGCTCATTATCAAATAAGCTAAATCCA 57.647 29.630 0.00 0.00 37.27 3.41
2604 5095 1.597742 AACTCAAGCAGCAACGTCAT 58.402 45.000 0.00 0.00 0.00 3.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.