Multiple sequence alignment - TraesCS1A01G098600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G098600 chr1A 100.000 2487 0 0 1 2487 94783308 94785794 0 4593
1 TraesCS1A01G098600 chrUn 97.990 2488 47 3 1 2487 282364695 282362210 0 4314
2 TraesCS1A01G098600 chrUn 97.870 2488 50 3 1 2487 86510011 86507526 0 4298
3 TraesCS1A01G098600 chr6B 97.951 2489 46 4 1 2487 596620325 596622810 0 4309
4 TraesCS1A01G098600 chr3B 97.629 2488 53 5 1 2487 92317839 92320321 0 4263
5 TraesCS1A01G098600 chr2B 97.547 2487 55 5 1 2487 30670610 30668130 0 4250
6 TraesCS1A01G098600 chr6A 97.470 2490 59 3 1 2487 84434145 84436633 0 4246
7 TraesCS1A01G098600 chr3D 97.507 2487 58 3 1 2487 154704959 154702477 0 4246
8 TraesCS1A01G098600 chr3A 97.026 2488 69 5 1 2487 694375569 694373086 0 4180
9 TraesCS1A01G098600 chr7A 96.665 2489 73 6 1 2487 46402294 46404774 0 4128


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G098600 chr1A 94783308 94785794 2486 False 4593 4593 100.000 1 2487 1 chr1A.!!$F1 2486
1 TraesCS1A01G098600 chrUn 282362210 282364695 2485 True 4314 4314 97.990 1 2487 1 chrUn.!!$R2 2486
2 TraesCS1A01G098600 chrUn 86507526 86510011 2485 True 4298 4298 97.870 1 2487 1 chrUn.!!$R1 2486
3 TraesCS1A01G098600 chr6B 596620325 596622810 2485 False 4309 4309 97.951 1 2487 1 chr6B.!!$F1 2486
4 TraesCS1A01G098600 chr3B 92317839 92320321 2482 False 4263 4263 97.629 1 2487 1 chr3B.!!$F1 2486
5 TraesCS1A01G098600 chr2B 30668130 30670610 2480 True 4250 4250 97.547 1 2487 1 chr2B.!!$R1 2486
6 TraesCS1A01G098600 chr6A 84434145 84436633 2488 False 4246 4246 97.470 1 2487 1 chr6A.!!$F1 2486
7 TraesCS1A01G098600 chr3D 154702477 154704959 2482 True 4246 4246 97.507 1 2487 1 chr3D.!!$R1 2486
8 TraesCS1A01G098600 chr3A 694373086 694375569 2483 True 4180 4180 97.026 1 2487 1 chr3A.!!$R1 2486
9 TraesCS1A01G098600 chr7A 46402294 46404774 2480 False 4128 4128 96.665 1 2487 1 chr7A.!!$F1 2486

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
844 846 1.450312 GGTCAACCAGGCCAGATCG 60.45 63.158 5.01 0.0 43.39 3.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2297 2308 3.112709 GTCCGCGGCAGAGAACAC 61.113 66.667 23.51 6.98 0.0 3.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
523 525 1.497161 AAGCACGGCCTCTAGGTTAT 58.503 50.000 0.00 0.0 37.57 1.89
527 529 2.470821 CACGGCCTCTAGGTTATTTCG 58.529 52.381 0.00 0.0 37.57 3.46
652 654 9.260002 ACATTTCACTTTCTTTCGCAATATTTT 57.740 25.926 0.00 0.0 0.00 1.82
690 692 4.855340 CACTAGGAAAGGGGATTGCTTAA 58.145 43.478 0.00 0.0 32.81 1.85
823 825 5.006386 GGTCCCATCCTTCAATATCATGAC 58.994 45.833 0.00 0.0 0.00 3.06
844 846 1.450312 GGTCAACCAGGCCAGATCG 60.450 63.158 5.01 0.0 43.39 3.69
862 864 7.674240 GCCAGATCGTAAGTGAAATAGTTTGAC 60.674 40.741 0.00 0.0 39.48 3.18
1030 1033 1.289800 GCAACGTCGAAAGGGTCCTC 61.290 60.000 0.00 0.0 0.00 3.71
1044 1047 2.398588 GGTCCTCATGTAGTGGGATCA 58.601 52.381 0.00 0.0 31.97 2.92
1048 1051 4.101585 GTCCTCATGTAGTGGGATCATTCA 59.898 45.833 0.00 0.0 32.24 2.57
1603 1610 2.872245 CGGCTCTTCTTCTTTGTCAACA 59.128 45.455 0.00 0.0 0.00 3.33
1620 1627 4.280174 GTCAACACTACTAAGGACCTGACA 59.720 45.833 0.00 0.0 32.76 3.58
1810 1817 1.852895 GCGTACGTAGCCTTCATTCTG 59.147 52.381 17.90 0.0 0.00 3.02
1837 1844 4.202212 TGCTACACAAAGTCACTTAGCTCA 60.202 41.667 10.02 0.0 0.00 4.26
2159 2166 3.516586 TGGTGAACCTCTCCTTGTGATA 58.483 45.455 0.37 0.0 36.82 2.15
2239 2250 0.320697 GCCACCGACCTACAGTTCTT 59.679 55.000 0.00 0.0 0.00 2.52
2297 2308 2.504026 TACGCTCGCTTGCTGTCG 60.504 61.111 0.00 0.0 0.00 4.35
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
8 9 8.917088 CCAGAATGTTATTTGTTTCATAGGGAT 58.083 33.333 0.00 0.00 0.00 3.85
10 11 8.292444 TCCAGAATGTTATTTGTTTCATAGGG 57.708 34.615 0.00 0.00 0.00 3.53
124 125 1.971357 ACTCGTCAGGGTTGAGTTGAT 59.029 47.619 0.00 0.00 39.87 2.57
523 525 8.746922 ATAGTTCGTTGTATTACACTTCGAAA 57.253 30.769 21.11 13.37 41.00 3.46
527 529 7.959718 TCGATAGTTCGTTGTATTACACTTC 57.040 36.000 0.00 0.00 45.65 3.01
556 558 1.890489 TCCATCTTGACTCGTTTCCGA 59.110 47.619 0.00 0.00 41.73 4.55
559 561 8.420374 TTTATGTATCCATCTTGACTCGTTTC 57.580 34.615 0.00 0.00 32.29 2.78
652 654 4.777366 TCCTAGTGGTTGAGTCATGATCAA 59.223 41.667 0.00 13.31 34.37 2.57
690 692 0.320771 AGCGAAAACGTGGCTGAGAT 60.321 50.000 0.00 0.00 40.25 2.75
844 846 4.999311 ACCCGGTCAAACTATTTCACTTAC 59.001 41.667 0.00 0.00 0.00 2.34
862 864 3.760035 CTGACCTGGTCGACCCGG 61.760 72.222 35.58 35.58 44.90 5.73
920 922 3.886505 ACAAAGTATTTCCGCTGGAACAA 59.113 39.130 9.15 0.00 41.87 2.83
1030 1033 6.060136 ACAATCTGAATGATCCCACTACATG 58.940 40.000 0.00 0.00 33.57 3.21
1044 1047 6.711277 TGCTAGAGGTTGTAACAATCTGAAT 58.289 36.000 5.23 0.00 31.54 2.57
1048 1051 6.344500 CATCTGCTAGAGGTTGTAACAATCT 58.656 40.000 0.00 0.52 33.08 2.40
1309 1312 3.730061 CGTATATCATAGGCGACCGAACC 60.730 52.174 0.00 0.00 0.00 3.62
1459 1463 2.427245 CCACTTCTCGATCCCGGCT 61.427 63.158 0.00 0.00 36.24 5.52
1603 1610 3.757493 CGAACTGTCAGGTCCTTAGTAGT 59.243 47.826 12.38 0.00 0.00 2.73
1620 1627 2.766263 TCATCCATCAAGTAGGCGAACT 59.234 45.455 0.00 0.00 0.00 3.01
1810 1817 5.220491 GCTAAGTGACTTTGTGTAGCATAGC 60.220 44.000 1.97 0.00 30.65 2.97
1837 1844 8.810041 TCCTCCTTTACTCTCTTAATTAACGTT 58.190 33.333 5.88 5.88 0.00 3.99
2239 2250 6.121776 TCCACCAAGCATAGAAGTTTAAGA 57.878 37.500 0.00 0.00 0.00 2.10
2297 2308 3.112709 GTCCGCGGCAGAGAACAC 61.113 66.667 23.51 6.98 0.00 3.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.