Multiple sequence alignment - TraesCS1A01G098200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G098200 chr1A 100.000 3617 0 0 1 3617 94680149 94676533 0 6680
1 TraesCS1A01G098200 chrUn 98.397 3619 55 3 1 3617 170992086 170995703 0 6359
2 TraesCS1A01G098200 chr7B 98.288 3621 58 2 1 3617 644449359 644445739 0 6340
3 TraesCS1A01G098200 chr7B 97.210 3620 96 4 1 3617 54066084 54062467 0 6120
4 TraesCS1A01G098200 chr6B 98.038 3619 68 3 1 3617 307011592 307015209 0 6287
5 TraesCS1A01G098200 chr1B 97.624 3620 82 4 1 3617 672525037 672528655 0 6205
6 TraesCS1A01G098200 chr7A 97.543 3623 82 4 1 3617 211380554 211376933 0 6191
7 TraesCS1A01G098200 chr4B 97.541 3619 83 6 1 3617 623331146 623334760 0 6185
8 TraesCS1A01G098200 chr2B 97.154 3619 87 8 1 3617 391128441 391132045 0 6098
9 TraesCS1A01G098200 chr3B 96.657 3620 114 7 1 3617 39860899 39864514 0 6008


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G098200 chr1A 94676533 94680149 3616 True 6680 6680 100.000 1 3617 1 chr1A.!!$R1 3616
1 TraesCS1A01G098200 chrUn 170992086 170995703 3617 False 6359 6359 98.397 1 3617 1 chrUn.!!$F1 3616
2 TraesCS1A01G098200 chr7B 644445739 644449359 3620 True 6340 6340 98.288 1 3617 1 chr7B.!!$R2 3616
3 TraesCS1A01G098200 chr7B 54062467 54066084 3617 True 6120 6120 97.210 1 3617 1 chr7B.!!$R1 3616
4 TraesCS1A01G098200 chr6B 307011592 307015209 3617 False 6287 6287 98.038 1 3617 1 chr6B.!!$F1 3616
5 TraesCS1A01G098200 chr1B 672525037 672528655 3618 False 6205 6205 97.624 1 3617 1 chr1B.!!$F1 3616
6 TraesCS1A01G098200 chr7A 211376933 211380554 3621 True 6191 6191 97.543 1 3617 1 chr7A.!!$R1 3616
7 TraesCS1A01G098200 chr4B 623331146 623334760 3614 False 6185 6185 97.541 1 3617 1 chr4B.!!$F1 3616
8 TraesCS1A01G098200 chr2B 391128441 391132045 3604 False 6098 6098 97.154 1 3617 1 chr2B.!!$F1 3616
9 TraesCS1A01G098200 chr3B 39860899 39864514 3615 False 6008 6008 96.657 1 3617 1 chr3B.!!$F1 3616

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
858 859 0.807667 CGATGAAGCTGTTCCTCCGG 60.808 60.000 0.00 0.0 0.00 5.14 F
1208 1209 1.829222 GAATAAGAGGACGACCCACCA 59.171 52.381 0.00 0.0 37.41 4.17 F
1889 1895 0.467384 CAGTTGAGGAGGCCGATCAT 59.533 55.000 8.18 0.0 0.00 2.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1738 1744 1.033746 GGGTCGAGTCCGTATCACCA 61.034 60.000 0.0 0.0 37.05 4.17 R
2527 2539 1.831106 TGGTCAGGCTATCGAACACAT 59.169 47.619 0.0 0.0 0.00 3.21 R
3293 3307 1.792006 AAGTGAAAGACGCTAACCGG 58.208 50.000 0.0 0.0 42.52 5.28 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
165 166 5.362717 TCTTTCTAGGTCCAATGCGATAGAA 59.637 40.000 0.00 0.00 39.76 2.10
255 256 5.198207 TCATGAGGTACATACTTCTTCCGA 58.802 41.667 0.00 0.00 37.46 4.55
319 320 3.174265 GAGGCTAGGGCAGGGCAT 61.174 66.667 0.00 0.00 40.87 4.40
473 474 2.017138 TGAATGATTCGCGTTAGCCA 57.983 45.000 5.77 0.00 41.18 4.75
539 540 4.529109 AAGAGAGTGCTAAAGGAGTCAC 57.471 45.455 8.75 2.93 38.16 3.67
618 619 6.256912 TGTTAATTAAACGGGCCTTGTTAG 57.743 37.500 13.17 0.00 41.30 2.34
629 630 4.457949 CGGGCCTTGTTAGTGAAGTATTTT 59.542 41.667 0.84 0.00 0.00 1.82
707 708 3.270027 CTCTCACGGTAATTGGATTGCA 58.730 45.455 0.00 0.00 0.00 4.08
817 818 1.889170 GAAGGAACAAGGCTTGAAGGG 59.111 52.381 32.50 7.12 0.00 3.95
858 859 0.807667 CGATGAAGCTGTTCCTCCGG 60.808 60.000 0.00 0.00 0.00 5.14
989 990 9.449719 AAATCCTCTTCACAAGTTATTTCGTAT 57.550 29.630 0.00 0.00 0.00 3.06
1208 1209 1.829222 GAATAAGAGGACGACCCACCA 59.171 52.381 0.00 0.00 37.41 4.17
1342 1343 2.351060 CGTCTTGCGTAACTGACCACTA 60.351 50.000 1.11 0.00 35.54 2.74
1419 1422 4.549458 CCGCTTGAACATTGTCTGATTTT 58.451 39.130 0.00 0.00 0.00 1.82
1716 1722 5.895636 ATTGCCGAGTAGATAGATCAGAG 57.104 43.478 0.00 0.00 0.00 3.35
1738 1744 2.203015 ACGCTGCAGTTGTTCCGT 60.203 55.556 16.64 12.19 0.00 4.69
1832 1838 3.087031 CTGGACTTAACTACTCCCGTCA 58.913 50.000 0.00 0.00 0.00 4.35
1859 1865 4.284550 TCTGCCGCCCTGCCTTTT 62.285 61.111 0.00 0.00 0.00 2.27
1889 1895 0.467384 CAGTTGAGGAGGCCGATCAT 59.533 55.000 8.18 0.00 0.00 2.45
2118 2124 1.519234 CGCGAGCTGGTTAGATGCA 60.519 57.895 0.00 0.00 0.00 3.96
2248 2258 1.300963 CATACAGTGCCAGGCAGGT 59.699 57.895 16.83 18.74 40.08 4.00
2355 2365 1.523758 CGTACTTCTTTTGCCAGGCT 58.476 50.000 14.15 0.00 0.00 4.58
2397 2407 3.406764 GCAGAAGATCAAGTTGGTGAGT 58.593 45.455 2.34 0.00 0.00 3.41
2406 2416 2.872245 CAAGTTGGTGAGTCGTGTGATT 59.128 45.455 0.00 0.00 0.00 2.57
2443 2453 1.205893 GGTTCGGAGAGCACTGAAGAT 59.794 52.381 0.00 0.00 40.41 2.40
2527 2539 6.866770 CCTGACTCGTAATTCACTTTTGACTA 59.133 38.462 0.00 0.00 0.00 2.59
2547 2559 1.262417 TGTGTTCGATAGCCTGACCA 58.738 50.000 0.00 0.00 0.00 4.02
2799 2812 5.182001 CAGGCGGATAAAGCTGCTATAAAAT 59.818 40.000 0.90 0.00 40.05 1.82
3293 3307 2.734079 GCTTGCGGCATCTCTAACTATC 59.266 50.000 2.28 0.00 41.35 2.08
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
165 166 0.250901 ATCCGTTCACTGCCTGCTTT 60.251 50.000 0.00 0.0 0.00 3.51
255 256 4.928398 CTCGGCAACAGAGCAGAT 57.072 55.556 0.00 0.0 38.03 2.90
629 630 9.581289 TCAAAATCAGAATAAAGGAAGGTAACA 57.419 29.630 0.00 0.0 41.41 2.41
707 708 7.837689 TCATTGAGATTGAATCCAGAGGAAATT 59.162 33.333 0.75 0.0 34.34 1.82
817 818 3.829026 GGATTCATTCCCTTGCTAATCCC 59.171 47.826 0.00 0.0 38.75 3.85
839 840 2.670635 CGGAGGAACAGCTTCATCG 58.329 57.895 0.00 0.0 37.96 3.84
989 990 4.907875 AGCCAATAGACCTTGAATAGCCTA 59.092 41.667 0.00 0.0 0.00 3.93
1208 1209 0.348370 ACTCATTCCATCCTCCCCCT 59.652 55.000 0.00 0.0 0.00 4.79
1342 1343 4.900635 AAGCACTTTCGACTTGATTTGT 57.099 36.364 0.00 0.0 0.00 2.83
1580 1585 0.674895 GCTCCCAGTGCGACTTCATT 60.675 55.000 0.00 0.0 0.00 2.57
1738 1744 1.033746 GGGTCGAGTCCGTATCACCA 61.034 60.000 0.00 0.0 37.05 4.17
1859 1865 3.381590 CCTCCTCAACTGTGTATCGATCA 59.618 47.826 0.00 0.0 0.00 2.92
1889 1895 1.145156 CCCACACCTGTCACGTTCA 59.855 57.895 0.00 0.0 0.00 3.18
2118 2124 3.696518 TACGAGCCCTCTGCCCCAT 62.697 63.158 0.00 0.0 42.71 4.00
2248 2258 5.016173 CCTAATCCAAAAATGAGTCCACCA 58.984 41.667 0.00 0.0 0.00 4.17
2443 2453 2.859165 GGTGGTGAACCTCTCATTCA 57.141 50.000 0.37 0.0 46.55 2.57
2527 2539 1.831106 TGGTCAGGCTATCGAACACAT 59.169 47.619 0.00 0.0 0.00 3.21
2799 2812 4.645136 ACCTACTCGATTGACAAGCATAGA 59.355 41.667 4.07 0.0 0.00 1.98
3293 3307 1.792006 AAGTGAAAGACGCTAACCGG 58.208 50.000 0.00 0.0 42.52 5.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.