Multiple sequence alignment - TraesCS1A01G098100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G098100 chr1A 100.000 2234 0 0 1 2234 94663914 94666147 0 4126
1 TraesCS1A01G098100 chr7D 97.990 2239 40 3 1 2234 382089826 382087588 0 3880
2 TraesCS1A01G098100 chr7D 97.814 2242 38 5 1 2234 626711168 626713406 0 3858
3 TraesCS1A01G098100 chr7D 97.363 2237 56 2 1 2234 307032623 307034859 0 3801
4 TraesCS1A01G098100 chr7A 97.817 2245 38 4 1 2234 638507637 638509881 0 3864
5 TraesCS1A01G098100 chr7A 97.373 2246 45 7 1 2234 708245652 708243409 0 3808
6 TraesCS1A01G098100 chr6B 97.817 2245 37 6 1 2234 596601831 596604074 0 3864
7 TraesCS1A01G098100 chrUn 97.727 2244 41 4 1 2234 171008313 171006070 0 3853
8 TraesCS1A01G098100 chr4D 97.634 2240 46 4 1 2234 123401546 123399308 0 3836
9 TraesCS1A01G098100 chr1B 97.413 2242 48 5 2 2234 672541248 672539008 0 3810


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G098100 chr1A 94663914 94666147 2233 False 4126 4126 100.000 1 2234 1 chr1A.!!$F1 2233
1 TraesCS1A01G098100 chr7D 382087588 382089826 2238 True 3880 3880 97.990 1 2234 1 chr7D.!!$R1 2233
2 TraesCS1A01G098100 chr7D 626711168 626713406 2238 False 3858 3858 97.814 1 2234 1 chr7D.!!$F2 2233
3 TraesCS1A01G098100 chr7D 307032623 307034859 2236 False 3801 3801 97.363 1 2234 1 chr7D.!!$F1 2233
4 TraesCS1A01G098100 chr7A 638507637 638509881 2244 False 3864 3864 97.817 1 2234 1 chr7A.!!$F1 2233
5 TraesCS1A01G098100 chr7A 708243409 708245652 2243 True 3808 3808 97.373 1 2234 1 chr7A.!!$R1 2233
6 TraesCS1A01G098100 chr6B 596601831 596604074 2243 False 3864 3864 97.817 1 2234 1 chr6B.!!$F1 2233
7 TraesCS1A01G098100 chrUn 171006070 171008313 2243 True 3853 3853 97.727 1 2234 1 chrUn.!!$R1 2233
8 TraesCS1A01G098100 chr4D 123399308 123401546 2238 True 3836 3836 97.634 1 2234 1 chr4D.!!$R1 2233
9 TraesCS1A01G098100 chr1B 672539008 672541248 2240 True 3810 3810 97.413 2 2234 1 chr1B.!!$R1 2232

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
650 657 0.322997 CCCCGCCATTCTTGTAACCA 60.323 55.0 0.0 0.0 0.0 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1784 1802 2.035442 GGGCACTTCGAAGGTCTGC 61.035 63.158 27.86 25.59 0.0 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
164 165 2.179517 CGTCTTTCTCTCGGCGCT 59.820 61.111 7.64 0.00 0.00 5.92
507 514 1.301401 CCTCCTGCGGTCGTTTCAA 60.301 57.895 0.00 0.00 0.00 2.69
530 537 1.660560 CTCAATTGGCTGGCTTCCCG 61.661 60.000 5.42 0.00 0.00 5.14
650 657 0.322997 CCCCGCCATTCTTGTAACCA 60.323 55.000 0.00 0.00 0.00 3.67
655 662 2.746904 CGCCATTCTTGTAACCATCACA 59.253 45.455 0.00 0.00 0.00 3.58
939 948 2.577700 CACCTATCACTAGTCTCGGCT 58.422 52.381 0.00 0.00 0.00 5.52
1010 1019 0.734889 GCCCAACGAATGTCAGATGG 59.265 55.000 0.00 0.00 0.00 3.51
1081 1094 0.036388 GCAGACCCCATTGAAGACGA 60.036 55.000 0.00 0.00 0.00 4.20
1153 1166 1.545136 TGGACGTTACCGCTCATACAA 59.455 47.619 0.00 0.00 37.70 2.41
1310 1323 3.243434 GGTCCTCGAGATCGCATTTTAGA 60.243 47.826 15.71 0.00 39.60 2.10
1784 1802 1.488393 GGGAATCTCAAGGAGGGTCTG 59.512 57.143 0.00 0.00 0.00 3.51
1862 1880 2.158798 GCTCCGGGCTAGAGGTAATTTT 60.159 50.000 0.00 0.00 38.06 1.82
1926 1944 0.892755 AATAAGGAGACGCGGTGACA 59.107 50.000 12.47 0.00 0.00 3.58
1929 1947 1.532604 AAGGAGACGCGGTGACATCA 61.533 55.000 12.47 0.00 0.00 3.07
2130 2151 6.432403 TTTAAAAGGAACTGGCCAATTCAT 57.568 33.333 26.87 18.83 40.86 2.57
2158 2179 5.571778 AAAACTACGTTCTAACTTGAGCG 57.428 39.130 0.00 0.00 44.22 5.03
2199 2220 4.141367 TGACATCTAAAGTTTCACCACCCA 60.141 41.667 0.00 0.00 0.00 4.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
108 109 6.942532 TTCAGTGAGTGCTTTCTTTTACAT 57.057 33.333 0.00 0.00 0.00 2.29
110 111 8.560374 AGTAATTCAGTGAGTGCTTTCTTTTAC 58.440 33.333 0.00 0.00 0.00 2.01
175 176 1.371337 CTGATCGACCCGGACACGTA 61.371 60.000 0.73 0.00 38.78 3.57
507 514 2.097825 GAAGCCAGCCAATTGAGTCAT 58.902 47.619 7.12 0.00 0.00 3.06
530 537 1.735920 CGACACCAGTCTGAGCTGC 60.736 63.158 0.00 0.00 42.73 5.25
650 657 1.220529 CTGCGCGGATTACATGTGAT 58.779 50.000 11.90 5.53 0.00 3.06
655 662 1.089481 CACACCTGCGCGGATTACAT 61.089 55.000 20.25 0.00 36.31 2.29
939 948 2.685106 TTGTGCAATAAACCCCTCCA 57.315 45.000 0.00 0.00 0.00 3.86
1010 1019 0.393808 TAATGAGGTGCGGGGCTTTC 60.394 55.000 0.00 0.00 0.00 2.62
1081 1094 1.348036 GGCCTTGTTGTACCTCACTCT 59.652 52.381 0.00 0.00 0.00 3.24
1153 1166 3.564345 CTGCTTGCTGGCTGGGAGT 62.564 63.158 3.49 0.00 0.00 3.85
1278 1291 0.672711 CTCGAGGACCCCGAAAAACC 60.673 60.000 3.91 0.00 35.48 3.27
1310 1323 1.693062 TCCCTAGCGTCTCTACTCGAT 59.307 52.381 0.00 0.00 0.00 3.59
1711 1729 2.637947 CTTAGCTCCAGAAGAAAGGGC 58.362 52.381 0.00 0.00 0.00 5.19
1784 1802 2.035442 GGGCACTTCGAAGGTCTGC 61.035 63.158 27.86 25.59 0.00 4.26
1862 1880 2.849162 GGGCCGGGGAGATCATCA 60.849 66.667 2.18 0.00 0.00 3.07
1926 1944 8.309656 GTTTTCTTTTTCCTTCTGGATGATGAT 58.690 33.333 0.00 0.00 42.81 2.45
1929 1947 6.014242 GGGTTTTCTTTTTCCTTCTGGATGAT 60.014 38.462 0.00 0.00 42.81 2.45
2060 2080 6.119144 GCGATTGGCTTCACTTTAGATTTA 57.881 37.500 0.00 0.00 39.11 1.40
2165 2186 5.018809 ACTTTAGATGTCAAATGCCACCAT 58.981 37.500 0.00 0.00 0.00 3.55
2199 2220 2.224305 GCAGGATTTCGGGCAGTAGTAT 60.224 50.000 0.00 0.00 0.00 2.12


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.