Multiple sequence alignment - TraesCS1A01G098000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G098000 chr1A 100.000 2359 0 0 1 2359 94665784 94663426 0 4357
1 TraesCS1A01G098000 chr7D 98.182 2365 37 4 1 2359 382087951 382090315 0 4124
2 TraesCS1A01G098000 chr7D 97.973 2368 36 6 1 2359 626713043 626710679 0 4096
3 TraesCS1A01G098000 chr7D 97.503 2363 54 4 1 2359 307034496 307032135 0 4032
4 TraesCS1A01G098000 chr7A 98.102 2371 32 6 1 2359 638509518 638507149 0 4117
5 TraesCS1A01G098000 chr7A 97.722 2371 40 7 1 2359 708243773 708246141 0 4067
6 TraesCS1A01G098000 chr6B 97.976 2371 36 6 1 2359 596603712 596601342 0 4102
7 TraesCS1A01G098000 chrUn 97.933 2371 37 6 1 2359 171006433 171008803 0 4096
8 TraesCS1A01G098000 chr4D 97.801 2365 43 6 2 2359 123399672 123402034 0 4071
9 TraesCS1A01G098000 chr1B 97.678 2369 44 6 1 2359 672539371 672541738 0 4060


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G098000 chr1A 94663426 94665784 2358 True 4357 4357 100.000 1 2359 1 chr1A.!!$R1 2358
1 TraesCS1A01G098000 chr7D 382087951 382090315 2364 False 4124 4124 98.182 1 2359 1 chr7D.!!$F1 2358
2 TraesCS1A01G098000 chr7D 626710679 626713043 2364 True 4096 4096 97.973 1 2359 1 chr7D.!!$R2 2358
3 TraesCS1A01G098000 chr7D 307032135 307034496 2361 True 4032 4032 97.503 1 2359 1 chr7D.!!$R1 2358
4 TraesCS1A01G098000 chr7A 638507149 638509518 2369 True 4117 4117 98.102 1 2359 1 chr7A.!!$R1 2358
5 TraesCS1A01G098000 chr7A 708243773 708246141 2368 False 4067 4067 97.722 1 2359 1 chr7A.!!$F1 2358
6 TraesCS1A01G098000 chr6B 596601342 596603712 2370 True 4102 4102 97.976 1 2359 1 chr6B.!!$R1 2358
7 TraesCS1A01G098000 chrUn 171006433 171008803 2370 False 4096 4096 97.933 1 2359 1 chrUn.!!$F1 2358
8 TraesCS1A01G098000 chr4D 123399672 123402034 2362 False 4071 4071 97.801 2 2359 1 chr4D.!!$F1 2357
9 TraesCS1A01G098000 chr1B 672539371 672541738 2367 False 4060 4060 97.678 1 2359 1 chr1B.!!$F1 2358

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
860 870 0.393808 TAATGAGGTGCGGGGCTTTC 60.394 55.0 0.0 0.0 0.0 2.62 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1706 1725 2.179517 CGTCTTTCTCTCGGCGCT 59.82 61.111 7.64 0.0 0.0 5.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
86 87 2.035442 GGGCACTTCGAAGGTCTGC 61.035 63.158 27.86 25.59 0.00 4.26
159 160 2.637947 CTTAGCTCCAGAAGAAAGGGC 58.362 52.381 0.00 0.00 0.00 5.19
560 566 1.693062 TCCCTAGCGTCTCTACTCGAT 59.307 52.381 0.00 0.00 0.00 3.59
592 598 0.672711 CTCGAGGACCCCGAAAAACC 60.673 60.000 3.91 0.00 35.48 3.27
717 723 3.564345 CTGCTTGCTGGCTGGGAGT 62.564 63.158 3.49 0.00 0.00 3.85
789 795 1.348036 GGCCTTGTTGTACCTCACTCT 59.652 52.381 0.00 0.00 0.00 3.24
860 870 0.393808 TAATGAGGTGCGGGGCTTTC 60.394 55.000 0.00 0.00 0.00 2.62
931 941 2.685106 TTGTGCAATAAACCCCTCCA 57.315 45.000 0.00 0.00 0.00 3.86
1215 1228 1.089481 CACACCTGCGCGGATTACAT 61.089 55.000 20.25 0.00 36.31 2.29
1220 1233 1.220529 CTGCGCGGATTACATGTGAT 58.779 50.000 11.90 5.53 0.00 3.06
1340 1353 1.735920 CGACACCAGTCTGAGCTGC 60.736 63.158 0.00 0.00 42.73 5.25
1363 1376 2.097825 GAAGCCAGCCAATTGAGTCAT 58.902 47.619 7.12 0.00 0.00 3.06
1695 1714 1.371337 CTGATCGACCCGGACACGTA 61.371 60.000 0.73 0.00 38.78 3.57
1760 1779 8.560374 AGTAATTCAGTGAGTGCTTTCTTTTAC 58.440 33.333 0.00 0.00 0.00 2.01
1762 1781 6.942532 TTCAGTGAGTGCTTTCTTTTACAT 57.057 33.333 0.00 0.00 0.00 2.29
2169 2191 6.479972 CCAGTGAGTGGTATTATTGGACTA 57.520 41.667 0.00 0.00 42.17 2.59
2259 2282 8.158132 AGAAATACGACCTCTCTGAGATATACA 58.842 37.037 8.00 0.00 0.00 2.29
2260 2283 8.871629 AAATACGACCTCTCTGAGATATACAT 57.128 34.615 8.00 0.00 0.00 2.29
2331 2354 9.067986 GGCAATTTGCTTTATACCTACTATTCT 57.932 33.333 20.06 0.00 44.28 2.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
8 9 2.158798 GCTCCGGGCTAGAGGTAATTTT 60.159 50.000 0.00 0.0 38.06 1.82
86 87 1.488393 GGGAATCTCAAGGAGGGTCTG 59.512 57.143 0.00 0.0 0.00 3.51
560 566 3.243434 GGTCCTCGAGATCGCATTTTAGA 60.243 47.826 15.71 0.0 39.60 2.10
717 723 1.545136 TGGACGTTACCGCTCATACAA 59.455 47.619 0.00 0.0 37.70 2.41
789 795 0.036388 GCAGACCCCATTGAAGACGA 60.036 55.000 0.00 0.0 0.00 4.20
860 870 0.734889 GCCCAACGAATGTCAGATGG 59.265 55.000 0.00 0.0 0.00 3.51
931 941 2.577700 CACCTATCACTAGTCTCGGCT 58.422 52.381 0.00 0.0 0.00 5.52
1215 1228 2.746904 CGCCATTCTTGTAACCATCACA 59.253 45.455 0.00 0.0 0.00 3.58
1220 1233 0.322997 CCCCGCCATTCTTGTAACCA 60.323 55.000 0.00 0.0 0.00 3.67
1340 1353 1.660560 CTCAATTGGCTGGCTTCCCG 61.661 60.000 5.42 0.0 0.00 5.14
1363 1376 1.301401 CCTCCTGCGGTCGTTTCAA 60.301 57.895 0.00 0.0 0.00 2.69
1706 1725 2.179517 CGTCTTTCTCTCGGCGCT 59.820 61.111 7.64 0.0 0.00 5.92
2169 2191 6.099557 TGAAGAACATTTCCCACCAAAAGATT 59.900 34.615 0.00 0.0 0.00 2.40
2259 2282 3.876341 TCGTACCTTTCCGGCATAAAAT 58.124 40.909 0.00 0.0 35.61 1.82
2260 2283 3.331478 TCGTACCTTTCCGGCATAAAA 57.669 42.857 0.00 0.0 35.61 1.52
2331 2354 5.588648 CAGACTAGAAACCAAAAACCAGACA 59.411 40.000 0.00 0.0 0.00 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.