Multiple sequence alignment - TraesCS1A01G097900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G097900 chr1A 100.000 2648 0 0 1 2648 94579982 94582629 0 4891
1 TraesCS1A01G097900 chr1A 97.315 1788 40 6 3 1788 94664848 94663067 0 3029
2 TraesCS1A01G097900 chr1A 99.030 722 7 0 1927 2648 94663075 94662354 0 1295
3 TraesCS1A01G097900 chr7A 97.170 2650 69 6 1 2648 211365338 211362693 0 4473
4 TraesCS1A01G097900 chr7A 98.574 631 9 0 2018 2648 4949338 4949968 0 1116
5 TraesCS1A01G097900 chr7D 96.843 2059 61 4 1 2057 382088887 382090943 0 3439
6 TraesCS1A01G097900 chr7D 96.600 2059 67 3 1 2057 626712108 626710051 0 3411
7 TraesCS1A01G097900 chr7D 95.682 2061 74 9 1 2057 307033561 307031512 0 3299
8 TraesCS1A01G097900 chr7D 95.146 2060 82 9 1 2057 307162009 307164053 0 3234
9 TraesCS1A01G097900 chr4D 96.359 2060 68 7 1 2057 123400605 123402660 0 3382
10 TraesCS1A01G097900 chr4D 96.257 2057 69 8 1 2052 134962098 134964151 0 3365
11 TraesCS1A01G097900 chr1D 95.779 2061 71 9 1 2057 275787498 275785450 0 3310
12 TraesCS1A01G097900 chr2A 97.727 1100 23 2 1551 2648 423418216 423417117 0 1892
13 TraesCS1A01G097900 chr3A 97.182 1100 28 3 1551 2648 227633804 227634902 0 1857
14 TraesCS1A01G097900 chrUn 98.732 631 8 0 2018 2648 406859804 406860434 0 1122
15 TraesCS1A01G097900 chr5A 98.732 631 8 0 2018 2648 300058356 300058986 0 1122
16 TraesCS1A01G097900 chr5A 98.574 631 9 0 2018 2648 16613431 16612801 0 1116
17 TraesCS1A01G097900 chr6A 98.574 631 9 0 2018 2648 289118161 289118791 0 1116


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G097900 chr1A 94579982 94582629 2647 False 4891 4891 100.0000 1 2648 1 chr1A.!!$F1 2647
1 TraesCS1A01G097900 chr1A 94662354 94664848 2494 True 2162 3029 98.1725 3 2648 2 chr1A.!!$R1 2645
2 TraesCS1A01G097900 chr7A 211362693 211365338 2645 True 4473 4473 97.1700 1 2648 1 chr7A.!!$R1 2647
3 TraesCS1A01G097900 chr7A 4949338 4949968 630 False 1116 1116 98.5740 2018 2648 1 chr7A.!!$F1 630
4 TraesCS1A01G097900 chr7D 382088887 382090943 2056 False 3439 3439 96.8430 1 2057 1 chr7D.!!$F2 2056
5 TraesCS1A01G097900 chr7D 626710051 626712108 2057 True 3411 3411 96.6000 1 2057 1 chr7D.!!$R2 2056
6 TraesCS1A01G097900 chr7D 307031512 307033561 2049 True 3299 3299 95.6820 1 2057 1 chr7D.!!$R1 2056
7 TraesCS1A01G097900 chr7D 307162009 307164053 2044 False 3234 3234 95.1460 1 2057 1 chr7D.!!$F1 2056
8 TraesCS1A01G097900 chr4D 123400605 123402660 2055 False 3382 3382 96.3590 1 2057 1 chr4D.!!$F1 2056
9 TraesCS1A01G097900 chr4D 134962098 134964151 2053 False 3365 3365 96.2570 1 2052 1 chr4D.!!$F2 2051
10 TraesCS1A01G097900 chr1D 275785450 275787498 2048 True 3310 3310 95.7790 1 2057 1 chr1D.!!$R1 2056
11 TraesCS1A01G097900 chr2A 423417117 423418216 1099 True 1892 1892 97.7270 1551 2648 1 chr2A.!!$R1 1097
12 TraesCS1A01G097900 chr3A 227633804 227634902 1098 False 1857 1857 97.1820 1551 2648 1 chr3A.!!$F1 1097
13 TraesCS1A01G097900 chrUn 406859804 406860434 630 False 1122 1122 98.7320 2018 2648 1 chrUn.!!$F1 630
14 TraesCS1A01G097900 chr5A 300058356 300058986 630 False 1122 1122 98.7320 2018 2648 1 chr5A.!!$F1 630
15 TraesCS1A01G097900 chr5A 16612801 16613431 630 True 1116 1116 98.5740 2018 2648 1 chr5A.!!$R1 630
16 TraesCS1A01G097900 chr6A 289118161 289118791 630 False 1116 1116 98.5740 2018 2648 1 chr6A.!!$F1 630

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
740 748 1.761174 GTGGGGGAGAAGCAAGACA 59.239 57.895 0.0 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2562 2728 2.637872 CCCAGGTGACCTACTTTCTCAA 59.362 50.0 2.59 0.0 29.64 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
58 59 4.422984 AGAAGGGTAGCCTAGTGTGTAAA 58.577 43.478 15.26 0.0 0.00 2.01
74 75 4.664188 GTGTAAACACAACAATGAACCGT 58.336 39.130 8.35 0.0 45.75 4.83
165 168 9.078990 CTCTTCCACTGACTTATATATGTACCA 57.921 37.037 1.48 0.0 0.00 3.25
311 315 4.263594 GGTTACAAGAATGGTGGGGAAGTA 60.264 45.833 0.00 0.0 0.00 2.24
649 657 2.822707 AAGAATGCATGGCTTCCTCT 57.177 45.000 0.00 0.0 0.00 3.69
664 672 3.261981 TCCTCTTATTCCGCTTCAACC 57.738 47.619 0.00 0.0 0.00 3.77
738 746 2.231380 GGGTGGGGGAGAAGCAAGA 61.231 63.158 0.00 0.0 0.00 3.02
740 748 1.761174 GTGGGGGAGAAGCAAGACA 59.239 57.895 0.00 0.0 0.00 3.41
756 764 2.530701 AGACAAACCTCTGATCGACCT 58.469 47.619 0.00 0.0 0.00 3.85
920 931 3.423749 TGAATGCATCTTCTTGCTCCAA 58.576 40.909 0.00 0.0 43.18 3.53
981 992 2.919228 ACTTTCTGTTTTGTCGAGCCT 58.081 42.857 0.00 0.0 0.00 4.58
984 995 2.613026 TCTGTTTTGTCGAGCCTTGA 57.387 45.000 0.00 0.0 0.00 3.02
1349 1361 2.713877 GGTTTATGCCGGAAAGGTACA 58.286 47.619 5.05 0.0 43.70 2.90
1741 1755 5.639139 AGGAAATTCTCTTTCTGGCTTTCT 58.361 37.500 0.00 0.0 0.00 2.52
1895 1909 3.585732 ACGGAGGAGGAAAGGACAAAATA 59.414 43.478 0.00 0.0 0.00 1.40
2562 2728 1.115467 ACTCCGCCGAATCTCTCATT 58.885 50.000 0.00 0.0 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
58 59 0.383949 GCCACGGTTCATTGTTGTGT 59.616 50.000 0.00 0.0 0.00 3.72
63 64 1.512156 GGTTCGCCACGGTTCATTGT 61.512 55.000 0.00 0.0 37.19 2.71
74 75 2.599281 TCGTCTGAGGGTTCGCCA 60.599 61.111 0.00 0.0 39.65 5.69
111 114 2.691011 GGTCACCACTACTGAGGATCTC 59.309 54.545 0.00 0.0 34.92 2.75
165 168 3.950397 TCACTTTCCCGTATGAGCATTT 58.050 40.909 0.00 0.0 0.00 2.32
311 315 2.559668 TGAATGTCGTCGGGTACTCTTT 59.440 45.455 0.00 0.0 0.00 2.52
554 558 2.557056 CGAACATCTAATCTAGGCCCGA 59.443 50.000 0.00 0.0 0.00 5.14
664 672 2.098117 CAGCAGGATTTTAAGGGCTTCG 59.902 50.000 0.00 0.0 0.00 3.79
738 746 1.276421 CCAGGTCGATCAGAGGTTTGT 59.724 52.381 0.00 0.0 0.00 2.83
740 748 1.550976 GTCCAGGTCGATCAGAGGTTT 59.449 52.381 0.00 0.0 0.00 3.27
778 786 5.010112 ACTGAATCTCGTCTTTCTCTTGACA 59.990 40.000 0.00 0.0 33.18 3.58
782 790 7.222000 ACTTACTGAATCTCGTCTTTCTCTT 57.778 36.000 0.00 0.0 0.00 2.85
920 931 5.147032 TCCCTTGAAATGGAACTTGAATGT 58.853 37.500 0.00 0.0 31.60 2.71
981 992 4.081406 CCATCAACCAGAGACCAAATCAA 58.919 43.478 0.00 0.0 0.00 2.57
984 995 3.814504 ACCATCAACCAGAGACCAAAT 57.185 42.857 0.00 0.0 0.00 2.32
1349 1361 7.714813 CCAATGTTTCCAAATTAGTCCAACTTT 59.285 33.333 0.00 0.0 0.00 2.66
1436 1448 4.833478 ACTATAGCCCCAATCATAGCTG 57.167 45.455 0.00 0.0 36.79 4.24
1895 1909 6.350780 CCATAGGAAAGAAAATGCTTCAAGCT 60.351 38.462 11.57 0.0 42.97 3.74
2562 2728 2.637872 CCCAGGTGACCTACTTTCTCAA 59.362 50.000 2.59 0.0 29.64 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.