Multiple sequence alignment - TraesCS1A01G097800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G097800 chr1A 100.000 2234 0 0 1 2234 94580917 94578684 0 4126
1 TraesCS1A01G097800 chr7D 97.853 2236 44 4 1 2234 382089821 382087588 0 3860
2 TraesCS1A01G097800 chr7D 97.678 2239 42 6 1 2234 626711173 626713406 0 3838
3 TraesCS1A01G097800 chr7A 97.812 2240 43 2 1 2234 638507642 638509881 0 3860
4 TraesCS1A01G097800 chr7A 97.279 2242 50 6 1 2234 708245647 708243409 0 3792
5 TraesCS1A01G097800 chr6B 97.724 2241 42 5 1 2234 596601836 596604074 0 3847
6 TraesCS1A01G097800 chrUn 97.634 2240 46 3 1 2234 171008308 171006070 0 3836
7 TraesCS1A01G097800 chr4D 97.585 2236 50 4 1 2234 123401541 123399308 0 3827
8 TraesCS1A01G097800 chr5B 97.367 2241 52 3 1 2234 567280018 567277778 0 3805
9 TraesCS1A01G097800 chr1B 97.232 2240 53 4 1 2234 672541244 672539008 0 3784


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G097800 chr1A 94578684 94580917 2233 True 4126 4126 100.000 1 2234 1 chr1A.!!$R1 2233
1 TraesCS1A01G097800 chr7D 382087588 382089821 2233 True 3860 3860 97.853 1 2234 1 chr7D.!!$R1 2233
2 TraesCS1A01G097800 chr7D 626711173 626713406 2233 False 3838 3838 97.678 1 2234 1 chr7D.!!$F1 2233
3 TraesCS1A01G097800 chr7A 638507642 638509881 2239 False 3860 3860 97.812 1 2234 1 chr7A.!!$F1 2233
4 TraesCS1A01G097800 chr7A 708243409 708245647 2238 True 3792 3792 97.279 1 2234 1 chr7A.!!$R1 2233
5 TraesCS1A01G097800 chr6B 596601836 596604074 2238 False 3847 3847 97.724 1 2234 1 chr6B.!!$F1 2233
6 TraesCS1A01G097800 chrUn 171006070 171008308 2238 True 3836 3836 97.634 1 2234 1 chrUn.!!$R1 2233
7 TraesCS1A01G097800 chr4D 123399308 123401541 2233 True 3827 3827 97.585 1 2234 1 chr4D.!!$R1 2233
8 TraesCS1A01G097800 chr5B 567277778 567280018 2240 True 3805 3805 97.367 1 2234 1 chr5B.!!$R1 2233
9 TraesCS1A01G097800 chr1B 672539008 672541244 2236 True 3784 3784 97.232 1 2234 1 chr1B.!!$R1 2233

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
877 881 0.383949 GCCACGGTTCATTGTTGTGT 59.616 50.0 0.0 0.0 0.0 3.72 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1681 1690 2.369394 CTGGCCTAAACCTTGATCCAC 58.631 52.381 3.32 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 30 5.075493 ACTTGAATGTTGGAGCAAGAAGAT 58.925 37.500 0.0 0.0 39.97 2.40
153 154 7.222000 ACTTACTGAATCTCGTCTTTCTCTT 57.778 36.000 0.0 0.0 0.00 2.85
155 156 5.713792 ACTGAATCTCGTCTTTCTCTTGA 57.286 39.130 0.0 0.0 0.00 3.02
157 158 5.010112 ACTGAATCTCGTCTTTCTCTTGACA 59.990 40.000 0.0 0.0 33.18 3.58
195 196 1.550976 GTCCAGGTCGATCAGAGGTTT 59.449 52.381 0.0 0.0 0.00 3.27
197 198 1.276421 CCAGGTCGATCAGAGGTTTGT 59.724 52.381 0.0 0.0 0.00 2.83
271 272 2.098117 CAGCAGGATTTTAAGGGCTTCG 59.902 50.000 0.0 0.0 0.00 3.79
381 384 2.557056 CGAACATCTAATCTAGGCCCGA 59.443 50.000 0.0 0.0 0.00 5.14
384 387 3.779444 ACATCTAATCTAGGCCCGATCA 58.221 45.455 0.0 0.0 0.00 2.92
624 627 2.559668 TGAATGTCGTCGGGTACTCTTT 59.440 45.455 0.0 0.0 0.00 2.52
633 636 2.181975 CGGGTACTCTTTACTTCCCCA 58.818 52.381 0.0 0.0 0.00 4.96
770 774 3.950397 TCACTTTCCCGTATGAGCATTT 58.050 40.909 0.0 0.0 0.00 2.32
861 865 2.599281 TCGTCTGAGGGTTCGCCA 60.599 61.111 0.0 0.0 39.65 5.69
877 881 0.383949 GCCACGGTTCATTGTTGTGT 59.616 50.000 0.0 0.0 0.00 3.72
1169 1178 3.255397 AGCTCCCAGCCAGCAAGT 61.255 61.111 0.0 0.0 43.77 3.16
1440 1449 2.107204 AGAGACAAAAGCAGTCCCACAT 59.893 45.455 0.0 0.0 36.68 3.21
1643 1652 3.279434 ACTTCGTTTTGAGGAGTTTGCT 58.721 40.909 0.0 0.0 0.00 3.91
1688 1697 0.691078 GGCTACTCTGGGGTGGATCA 60.691 60.000 0.0 0.0 0.00 2.92
2219 2236 3.228453 CCTACTACTGCCCGAAATCCTA 58.772 50.000 0.0 0.0 0.00 2.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 30 6.257849 GGTTGTAATAGATCGACTTGAATGCA 59.742 38.462 0.00 0.0 0.00 3.96
170 171 1.092348 CTGATCGACCTGGACACGTA 58.908 55.000 0.00 0.0 0.00 3.57
179 180 2.530701 AGACAAACCTCTGATCGACCT 58.469 47.619 0.00 0.0 0.00 3.85
195 196 1.761174 GTGGGGGAGAAGCAAGACA 59.239 57.895 0.00 0.0 0.00 3.41
197 198 2.231380 GGGTGGGGGAGAAGCAAGA 61.231 63.158 0.00 0.0 0.00 3.02
271 272 3.261981 TCCTCTTATTCCGCTTCAACC 57.738 47.619 0.00 0.0 0.00 3.77
286 287 2.822707 AAGAATGCATGGCTTCCTCT 57.177 45.000 0.00 0.0 0.00 3.69
384 387 1.555075 TGCTCGCCTTCATAGAAAGGT 59.445 47.619 4.71 0.0 46.38 3.50
624 627 4.263594 GGTTACAAGAATGGTGGGGAAGTA 60.264 45.833 0.00 0.0 0.00 2.24
633 636 2.370849 AGGTGACGGTTACAAGAATGGT 59.629 45.455 5.38 0.0 0.00 3.55
770 774 9.078990 CTCTTCCACTGACTTATATATGTACCA 57.921 37.037 1.48 0.0 0.00 3.25
861 865 4.664188 GTGTAAACACAACAATGAACCGT 58.336 39.130 8.35 0.0 45.75 4.83
877 881 4.422984 AGAAGGGTAGCCTAGTGTGTAAA 58.577 43.478 15.26 0.0 0.00 2.01
980 984 1.600636 CGTTGGGCTTTCCTCTGCA 60.601 57.895 0.00 0.0 36.20 4.41
1071 1080 0.680061 ACCTCACTCCCGTCTTCAAC 59.320 55.000 0.00 0.0 0.00 3.18
1169 1178 7.068839 CCATGACTTCTAGAGGAAAGCTAACTA 59.931 40.741 9.14 0.0 33.07 2.24
1681 1690 2.369394 CTGGCCTAAACCTTGATCCAC 58.631 52.381 3.32 0.0 0.00 4.02
1688 1697 3.520550 CCCCCTGGCCTAAACCTT 58.479 61.111 3.32 0.0 0.00 3.50
1936 1950 4.764050 TTGGGGTTTTCTTTTTCCTTCC 57.236 40.909 0.00 0.0 0.00 3.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.