Multiple sequence alignment - TraesCS1A01G092000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G092000 chr1A 100.000 2537 0 0 1 2537 84620382 84622918 0.000000e+00 4686.0
1 TraesCS1A01G092000 chr1A 98.372 1781 10 3 772 2537 84483941 84485717 0.000000e+00 3110.0
2 TraesCS1A01G092000 chr1A 97.465 789 18 2 1 788 84483141 84483928 0.000000e+00 1345.0
3 TraesCS1A01G092000 chr1A 96.143 726 24 2 67 788 84055301 84056026 0.000000e+00 1182.0
4 TraesCS1A01G092000 chr1A 95.035 705 35 0 870 1574 84796390 84795686 0.000000e+00 1109.0
5 TraesCS1A01G092000 chr1A 94.894 705 36 0 870 1574 85006274 85005570 0.000000e+00 1103.0
6 TraesCS1A01G092000 chr1A 89.091 220 14 5 1942 2161 84795492 84795283 5.380000e-67 265.0
7 TraesCS1A01G092000 chr1A 85.987 157 15 6 712 864 84796951 84796798 7.260000e-36 161.0
8 TraesCS1A01G092000 chr1A 86.667 105 1 1 772 863 84056038 84056142 1.240000e-18 104.0
9 TraesCS1A01G092000 chr1A 93.750 48 2 1 2346 2392 84795174 84795127 1.260000e-08 71.3
10 TraesCS1A01G092000 chr1A 92.683 41 3 0 823 863 85006719 85006679 2.730000e-05 60.2
11 TraesCS1A01G092000 chr3B 92.982 1140 61 8 870 2009 535705299 535704179 0.000000e+00 1644.0
12 TraesCS1A01G092000 chr3B 86.391 676 47 24 1503 2161 535555786 535555139 0.000000e+00 697.0
13 TraesCS1A01G092000 chr3B 80.645 403 52 19 329 708 535709190 535708791 3.190000e-74 289.0
14 TraesCS1A01G092000 chr1D 91.667 1212 53 18 870 2067 87903966 87905143 0.000000e+00 1635.0
15 TraesCS1A01G092000 chr1D 89.320 1236 66 20 1241 2459 88215120 88216306 0.000000e+00 1491.0
16 TraesCS1A01G092000 chr1D 91.458 878 54 7 870 1731 88282278 88281406 0.000000e+00 1186.0
17 TraesCS1A01G092000 chr1D 89.950 597 40 11 1141 1723 88243854 88243264 0.000000e+00 752.0
18 TraesCS1A01G092000 chr1D 85.239 481 27 14 1638 2104 87909280 87909730 2.980000e-124 455.0
19 TraesCS1A01G092000 chr1D 81.360 397 55 14 329 707 88184339 88184734 3.170000e-79 305.0
20 TraesCS1A01G092000 chr1D 90.741 216 20 0 1942 2157 88243199 88242984 3.190000e-74 289.0
21 TraesCS1A01G092000 chr1D 81.588 277 15 16 621 864 88244693 88244420 1.990000e-46 196.0
22 TraesCS1A01G092000 chr1D 80.866 277 18 16 621 864 88282962 88282688 4.310000e-43 185.0
23 TraesCS1A01G092000 chr1D 86.792 159 7 4 718 862 88208045 88208203 5.610000e-37 165.0
24 TraesCS1A01G092000 chr1D 83.030 165 3 6 712 863 87903387 87903539 2.650000e-25 126.0
25 TraesCS1A01G092000 chr1D 95.238 63 2 1 2475 2537 88216395 88216456 5.780000e-17 99.0
26 TraesCS1A01G092000 chr1D 93.750 48 2 1 2346 2392 88242873 88242826 1.260000e-08 71.3
27 TraesCS1A01G092000 chr1B 90.511 1096 74 13 870 1951 142037801 142038880 0.000000e+00 1421.0
28 TraesCS1A01G092000 chr1B 93.501 754 49 0 870 1623 142094061 142094814 0.000000e+00 1122.0
29 TraesCS1A01G092000 chr1B 94.334 706 40 0 870 1575 141845292 141845997 0.000000e+00 1083.0
30 TraesCS1A01G092000 chr1B 89.367 884 50 19 870 1731 142134202 142133341 0.000000e+00 1072.0
31 TraesCS1A01G092000 chr1B 86.105 842 61 24 1629 2459 142102573 142103369 0.000000e+00 856.0
32 TraesCS1A01G092000 chr1B 89.020 255 25 1 1947 2201 141846199 141846450 1.890000e-81 313.0
33 TraesCS1A01G092000 chr1B 81.658 398 50 20 329 708 141844223 141844615 2.450000e-80 309.0
34 TraesCS1A01G092000 chr1B 82.370 346 48 11 329 663 142025884 142026227 3.190000e-74 289.0
35 TraesCS1A01G092000 chr1B 83.489 321 40 10 350 663 142135177 142134863 1.150000e-73 287.0
36 TraesCS1A01G092000 chr1B 82.229 332 47 10 329 650 142092991 142093320 2.490000e-70 276.0
37 TraesCS1A01G092000 chr1B 86.228 167 7 9 712 864 142134777 142134613 1.560000e-37 167.0
38 TraesCS1A01G092000 chr1B 86.503 163 4 14 712 863 142037219 142037374 2.020000e-36 163.0
39 TraesCS1A01G092000 chr1B 86.503 163 4 14 712 863 142093479 142093634 2.020000e-36 163.0
40 TraesCS1A01G092000 chr1B 93.750 48 2 1 2346 2392 142132949 142132902 1.260000e-08 71.3
41 TraesCS1A01G092000 chr4D 91.724 870 52 10 875 1731 464797678 464796816 0.000000e+00 1190.0
42 TraesCS1A01G092000 chr4D 86.709 316 37 5 345 655 464798668 464798353 1.870000e-91 346.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G092000 chr1A 84620382 84622918 2536 False 4686.000000 4686 100.000000 1 2537 1 chr1A.!!$F1 2536
1 TraesCS1A01G092000 chr1A 84483141 84485717 2576 False 2227.500000 3110 97.918500 1 2537 2 chr1A.!!$F3 2536
2 TraesCS1A01G092000 chr1A 84055301 84056142 841 False 643.000000 1182 91.405000 67 863 2 chr1A.!!$F2 796
3 TraesCS1A01G092000 chr1A 85005570 85006719 1149 True 581.600000 1103 93.788500 823 1574 2 chr1A.!!$R2 751
4 TraesCS1A01G092000 chr1A 84795127 84796951 1824 True 401.575000 1109 90.965750 712 2392 4 chr1A.!!$R1 1680
5 TraesCS1A01G092000 chr3B 535704179 535709190 5011 True 966.500000 1644 86.813500 329 2009 2 chr3B.!!$R2 1680
6 TraesCS1A01G092000 chr3B 535555139 535555786 647 True 697.000000 697 86.391000 1503 2161 1 chr3B.!!$R1 658
7 TraesCS1A01G092000 chr1D 87903387 87905143 1756 False 880.500000 1635 87.348500 712 2067 2 chr1D.!!$F4 1355
8 TraesCS1A01G092000 chr1D 88215120 88216456 1336 False 795.000000 1491 92.279000 1241 2537 2 chr1D.!!$F5 1296
9 TraesCS1A01G092000 chr1D 88281406 88282962 1556 True 685.500000 1186 86.162000 621 1731 2 chr1D.!!$R2 1110
10 TraesCS1A01G092000 chr1D 88242826 88244693 1867 True 327.075000 752 89.007250 621 2392 4 chr1D.!!$R1 1771
11 TraesCS1A01G092000 chr1B 142102573 142103369 796 False 856.000000 856 86.105000 1629 2459 1 chr1B.!!$F2 830
12 TraesCS1A01G092000 chr1B 142037219 142038880 1661 False 792.000000 1421 88.507000 712 1951 2 chr1B.!!$F4 1239
13 TraesCS1A01G092000 chr1B 141844223 141846450 2227 False 568.333333 1083 88.337333 329 2201 3 chr1B.!!$F3 1872
14 TraesCS1A01G092000 chr1B 142092991 142094814 1823 False 520.333333 1122 87.411000 329 1623 3 chr1B.!!$F5 1294
15 TraesCS1A01G092000 chr1B 142132902 142135177 2275 True 399.325000 1072 88.208500 350 2392 4 chr1B.!!$R1 2042
16 TraesCS1A01G092000 chr4D 464796816 464798668 1852 True 768.000000 1190 89.216500 345 1731 2 chr4D.!!$R1 1386

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
47 48 1.318576 AGGGCAGAAAACTTTGTCGG 58.681 50.0 0.0 0.0 0.00 4.79 F
65 66 2.290916 TCGGAGCTTCATCGACTATGAC 59.709 50.0 0.0 0.0 44.42 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1045 4533 3.771160 GTCCCGGTGGATGACGCT 61.771 66.667 0.00 0.0 44.28 5.07 R
2334 5925 1.740025 GATGAGACCGGAGCCAAAAAG 59.260 52.381 9.46 0.0 0.00 2.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
47 48 1.318576 AGGGCAGAAAACTTTGTCGG 58.681 50.000 0.00 0.00 0.00 4.79
65 66 2.290916 TCGGAGCTTCATCGACTATGAC 59.709 50.000 0.00 0.00 44.42 3.06
142 143 3.219281 GGTTTTTCAGTAAGAGGGTGCA 58.781 45.455 0.00 0.00 0.00 4.57
171 172 2.523245 TGCAACACATGGCCTATTTCA 58.477 42.857 3.32 0.00 0.00 2.69
213 214 8.224389 TGGTGTAGTTTTTAAGGACTAAAACC 57.776 34.615 16.73 16.73 42.41 3.27
239 241 5.116180 TGAATGCAAGGGTACTATTTCTCG 58.884 41.667 0.00 0.00 0.00 4.04
250 252 5.523916 GGTACTATTTCTCGTGATGCAATGT 59.476 40.000 0.00 0.00 0.00 2.71
1045 4533 2.754552 GCAAAGAACATACATGGAGCCA 59.245 45.455 0.00 0.00 0.00 4.75
1901 5477 6.475504 TGATAAGCTTCTGAATCTGGTTGAA 58.524 36.000 0.00 0.00 0.00 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
6 7 1.238625 TTTTTAGCGGCGAGGTTGGG 61.239 55.000 12.98 0.00 0.00 4.12
47 48 4.274705 TGAGAGTCATAGTCGATGAAGCTC 59.725 45.833 14.28 14.28 46.30 4.09
65 66 0.575859 CATCGCGCAAGACATGAGAG 59.424 55.000 8.75 0.00 43.02 3.20
142 143 0.892755 CATGTGTTGCAATGGGAGCT 59.107 50.000 0.59 0.00 0.00 4.09
171 172 2.359848 CACCATCATCAATTGCCACGAT 59.640 45.455 0.00 0.00 0.00 3.73
213 214 5.760253 AGAAATAGTACCCTTGCATTCATCG 59.240 40.000 0.00 0.00 0.00 3.84
239 241 1.024271 ATGCCCGTACATTGCATCAC 58.976 50.000 7.67 0.00 41.68 3.06
1045 4533 3.771160 GTCCCGGTGGATGACGCT 61.771 66.667 0.00 0.00 44.28 5.07
2334 5925 1.740025 GATGAGACCGGAGCCAAAAAG 59.260 52.381 9.46 0.00 0.00 2.27
2335 5926 1.073125 TGATGAGACCGGAGCCAAAAA 59.927 47.619 9.46 0.00 0.00 1.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.