Multiple sequence alignment - TraesCS1A01G083600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G083600 chr1A 100.000 2504 0 0 1 2504 67962244 67959741 0 4625
1 TraesCS1A01G083600 chr1A 96.991 2459 57 5 62 2504 359190751 359193208 0 4115
2 TraesCS1A01G083600 chr1A 96.829 2460 60 6 62 2504 181970658 181968200 0 4095
3 TraesCS1A01G083600 chr1A 96.215 2457 60 9 62 2502 579041588 579039149 0 3991
4 TraesCS1A01G083600 chr3A 97.152 2458 54 4 62 2504 171150192 171152648 0 4137
5 TraesCS1A01G083600 chr3A 96.542 2458 69 4 62 2504 545676360 545673904 0 4054
6 TraesCS1A01G083600 chr3A 96.423 2460 53 12 62 2504 58078339 58075898 0 4023
7 TraesCS1A01G083600 chr3A 96.729 1926 45 5 594 2504 122115255 122117177 0 3192
8 TraesCS1A01G083600 chr3A 96.216 1929 55 5 594 2504 48905594 48907522 0 3142
9 TraesCS1A01G083600 chr7A 96.212 1927 55 5 594 2504 723589399 723591323 0 3138
10 TraesCS1A01G083600 chr7A 97.049 1559 32 2 594 2138 723637415 723638973 0 2612
11 TraesCS1A01G083600 chr7A 96.471 595 21 0 2 596 662680360 662680954 0 983
12 TraesCS1A01G083600 chr5B 96.221 688 22 4 1819 2504 62546975 62547660 0 1123
13 TraesCS1A01G083600 chr4D 95.349 559 22 2 1 559 99934807 99935361 0 885
14 TraesCS1A01G083600 chr4D 95.349 559 22 2 1 559 446550929 446550375 0 885


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G083600 chr1A 67959741 67962244 2503 True 4625 4625 100.000 1 2504 1 chr1A.!!$R1 2503
1 TraesCS1A01G083600 chr1A 359190751 359193208 2457 False 4115 4115 96.991 62 2504 1 chr1A.!!$F1 2442
2 TraesCS1A01G083600 chr1A 181968200 181970658 2458 True 4095 4095 96.829 62 2504 1 chr1A.!!$R2 2442
3 TraesCS1A01G083600 chr1A 579039149 579041588 2439 True 3991 3991 96.215 62 2502 1 chr1A.!!$R3 2440
4 TraesCS1A01G083600 chr3A 171150192 171152648 2456 False 4137 4137 97.152 62 2504 1 chr3A.!!$F3 2442
5 TraesCS1A01G083600 chr3A 545673904 545676360 2456 True 4054 4054 96.542 62 2504 1 chr3A.!!$R2 2442
6 TraesCS1A01G083600 chr3A 58075898 58078339 2441 True 4023 4023 96.423 62 2504 1 chr3A.!!$R1 2442
7 TraesCS1A01G083600 chr3A 122115255 122117177 1922 False 3192 3192 96.729 594 2504 1 chr3A.!!$F2 1910
8 TraesCS1A01G083600 chr3A 48905594 48907522 1928 False 3142 3142 96.216 594 2504 1 chr3A.!!$F1 1910
9 TraesCS1A01G083600 chr7A 723589399 723591323 1924 False 3138 3138 96.212 594 2504 1 chr7A.!!$F2 1910
10 TraesCS1A01G083600 chr7A 723637415 723638973 1558 False 2612 2612 97.049 594 2138 1 chr7A.!!$F3 1544
11 TraesCS1A01G083600 chr7A 662680360 662680954 594 False 983 983 96.471 2 596 1 chr7A.!!$F1 594
12 TraesCS1A01G083600 chr5B 62546975 62547660 685 False 1123 1123 96.221 1819 2504 1 chr5B.!!$F1 685
13 TraesCS1A01G083600 chr4D 99934807 99935361 554 False 885 885 95.349 1 559 1 chr4D.!!$F1 558
14 TraesCS1A01G083600 chr4D 446550375 446550929 554 True 885 885 95.349 1 559 1 chr4D.!!$R1 558

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
358 359 3.181429 AATCTTCAAGAAGAAGGTGCCCA 60.181 43.478 15.7 0.0 46.94 5.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1724 1727 0.039074 GCATGTACTCCCTCCGATCG 60.039 60.0 8.51 8.51 0.0 3.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
57 58 6.353323 TGATTGAAGTGGAAGTACTTGTTCA 58.647 36.000 14.14 12.84 40.78 3.18
234 235 8.101419 GGAGTGTTCCTTTCTTCCTTATAAAGA 58.899 37.037 0.00 0.00 40.58 2.52
358 359 3.181429 AATCTTCAAGAAGAAGGTGCCCA 60.181 43.478 15.70 0.00 46.94 5.36
403 404 5.324409 ACTGATGTTTACATGTTGGGTCAT 58.676 37.500 2.30 2.69 36.57 3.06
1095 1096 1.552337 ACCATGAAGCGATGTGAGAGT 59.448 47.619 0.00 0.00 0.00 3.24
1230 1231 4.080863 AGGTTGAAGAAGATGGCGAGTAAT 60.081 41.667 0.00 0.00 0.00 1.89
1319 1320 5.463724 CGGTATTATTCACTTTCTCTCTGCC 59.536 44.000 0.00 0.00 0.00 4.85
1538 1541 6.183361 TGGTTGTTACTTCCAATTGAGGACTA 60.183 38.462 7.12 0.00 37.42 2.59
1724 1727 5.607119 TCAAAGCCGAGACACTTATTTTC 57.393 39.130 0.00 0.00 0.00 2.29
1891 1907 5.314306 AGTTATTGGATCCCTCATTGGCTAT 59.686 40.000 9.90 0.00 0.00 2.97
2189 2207 6.009908 ACAAGGGGGTCCAAGTTATAATAC 57.990 41.667 0.00 0.00 34.83 1.89
2241 2259 7.295322 TGTGTGGGATCAATTTTGTGATAAA 57.705 32.000 0.00 0.00 38.38 1.40
2455 2482 0.834612 AATCGAATTGGACCGGGCTA 59.165 50.000 7.57 0.00 0.00 3.93
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
195 196 3.118261 GGAACACTCCAAGCATCCATCTA 60.118 47.826 0.00 0.00 41.96 1.98
206 207 4.519906 AAGGAAGAAAGGAACACTCCAA 57.480 40.909 0.00 0.00 45.24 3.53
312 313 2.514803 TCTTTGCCCCTAAAGAAGCAC 58.485 47.619 0.00 0.00 42.09 4.40
403 404 6.985059 TCTGCAACAACAAATGATTTTCATCA 59.015 30.769 0.00 0.00 43.85 3.07
709 710 1.986757 GAGAGAGGGACCTGCTGCA 60.987 63.158 0.88 0.88 0.00 4.41
756 757 7.665559 TCAGATTACAGGTGAAAAATAGCAGTT 59.334 33.333 0.00 0.00 0.00 3.16
869 870 7.767261 ACATCTCACAGTGAGTTAACTATCTC 58.233 38.462 26.65 0.00 44.58 2.75
1095 1096 0.326238 CAGCTGTAAGGGTAGGGGGA 60.326 60.000 5.25 0.00 0.00 4.81
1230 1231 1.198759 GGTACTCAACAGGCTCCCCA 61.199 60.000 0.00 0.00 0.00 4.96
1319 1320 0.304705 GACATAATGCCGAACCAGCG 59.695 55.000 0.00 0.00 0.00 5.18
1538 1541 5.766150 TCGATTTCTCAACACCAACAAAT 57.234 34.783 0.00 0.00 0.00 2.32
1724 1727 0.039074 GCATGTACTCCCTCCGATCG 60.039 60.000 8.51 8.51 0.00 3.69
1891 1907 8.450578 AAGAATCTGTACAGAACATCAAACAA 57.549 30.769 28.43 2.26 41.36 2.83
2241 2259 2.376518 AGATTGGTCCCACTTGTCATGT 59.623 45.455 0.00 0.00 0.00 3.21
2455 2482 4.619863 GCAATCTGATGTGGCACAAGATTT 60.620 41.667 30.88 19.78 44.16 2.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.