Multiple sequence alignment - TraesCS1A01G080800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G080800 chr1A 100.000 3401 0 0 1 3401 63755896 63759296 0 6281
1 TraesCS1A01G080800 chr4B 99.060 3404 29 1 1 3401 139749920 139746517 0 6106
2 TraesCS1A01G080800 chr4B 97.620 3403 73 3 5 3401 2615767 2612367 0 5829
3 TraesCS1A01G080800 chr1B 99.030 3403 31 2 1 3401 167922953 167926355 0 6100
4 TraesCS1A01G080800 chr3A 98.853 3401 39 0 1 3401 199418909 199415509 0 6065
5 TraesCS1A01G080800 chr2A 98.824 3401 36 2 1 3401 672543870 672540474 0 6056
6 TraesCS1A01G080800 chr5B 98.645 3395 46 0 5 3399 383530027 383533421 0 6015
7 TraesCS1A01G080800 chr5B 98.708 2709 26 7 702 3401 514847609 514844901 0 4800
8 TraesCS1A01G080800 chr4A 98.634 2709 28 7 702 3401 683245576 683248284 0 4789
9 TraesCS1A01G080800 chr2B 98.487 2709 32 7 702 3401 652843371 652846079 0 4767
10 TraesCS1A01G080800 chrUn 99.016 915 9 0 5 919 309589541 309590455 0 1640
11 TraesCS1A01G080800 chrUn 99.016 915 9 0 5 919 361598807 361597893 0 1640
12 TraesCS1A01G080800 chr3B 98.739 793 10 0 7 799 731133645 731132853 0 1410


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G080800 chr1A 63755896 63759296 3400 False 6281 6281 100.000 1 3401 1 chr1A.!!$F1 3400
1 TraesCS1A01G080800 chr4B 139746517 139749920 3403 True 6106 6106 99.060 1 3401 1 chr4B.!!$R2 3400
2 TraesCS1A01G080800 chr4B 2612367 2615767 3400 True 5829 5829 97.620 5 3401 1 chr4B.!!$R1 3396
3 TraesCS1A01G080800 chr1B 167922953 167926355 3402 False 6100 6100 99.030 1 3401 1 chr1B.!!$F1 3400
4 TraesCS1A01G080800 chr3A 199415509 199418909 3400 True 6065 6065 98.853 1 3401 1 chr3A.!!$R1 3400
5 TraesCS1A01G080800 chr2A 672540474 672543870 3396 True 6056 6056 98.824 1 3401 1 chr2A.!!$R1 3400
6 TraesCS1A01G080800 chr5B 383530027 383533421 3394 False 6015 6015 98.645 5 3399 1 chr5B.!!$F1 3394
7 TraesCS1A01G080800 chr5B 514844901 514847609 2708 True 4800 4800 98.708 702 3401 1 chr5B.!!$R1 2699
8 TraesCS1A01G080800 chr4A 683245576 683248284 2708 False 4789 4789 98.634 702 3401 1 chr4A.!!$F1 2699
9 TraesCS1A01G080800 chr2B 652843371 652846079 2708 False 4767 4767 98.487 702 3401 1 chr2B.!!$F1 2699
10 TraesCS1A01G080800 chrUn 309589541 309590455 914 False 1640 1640 99.016 5 919 1 chrUn.!!$F1 914
11 TraesCS1A01G080800 chrUn 361597893 361598807 914 True 1640 1640 99.016 5 919 1 chrUn.!!$R1 914
12 TraesCS1A01G080800 chr3B 731132853 731133645 792 True 1410 1410 98.739 7 799 1 chr3B.!!$R1 792

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
364 365 0.09715 GAGGACGAAGATTTTGCGGC 59.903 55.000 0.00 0.0 0.00 6.53 F
1039 1042 6.28624 TCTGCAGTTCAGATGTAACATACT 57.714 37.500 14.67 0.0 46.34 2.12 F
1641 1644 4.03296 AGTTGTGCATTATGAGGGTGAA 57.967 40.909 0.00 0.0 0.00 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1441 1444 4.018050 ACTGCCAACATATCCCTCTTCTTT 60.018 41.667 0.0 0.0 0.0 2.52 R
1848 1860 4.204799 CATCATCATCAGCCTCCTTCAAA 58.795 43.478 0.0 0.0 0.0 2.69 R
3076 3088 5.130145 CCATACACTTCTTCAGATCTTCCCT 59.870 44.000 0.0 0.0 0.0 4.20 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
301 302 2.441532 CGACCTCCCCCGCTTAGA 60.442 66.667 0.00 0.0 0.00 2.10
364 365 0.097150 GAGGACGAAGATTTTGCGGC 59.903 55.000 0.00 0.0 0.00 6.53
1039 1042 6.286240 TCTGCAGTTCAGATGTAACATACT 57.714 37.500 14.67 0.0 46.34 2.12
1641 1644 4.032960 AGTTGTGCATTATGAGGGTGAA 57.967 40.909 0.00 0.0 0.00 3.18
1845 1857 6.617782 TCATCTGATGAAGAAGAGAAAGGT 57.382 37.500 17.56 0.0 38.79 3.50
1848 1860 7.941238 TCATCTGATGAAGAAGAGAAAGGTTTT 59.059 33.333 17.56 0.0 38.79 2.43
2398 2410 2.300437 GTGCTAGGAGACCACAAGAAGT 59.700 50.000 0.00 0.0 0.00 3.01
2427 2439 5.338381 CCCTAGGTTGAAAGACTATGCTCAA 60.338 44.000 8.29 0.0 0.00 3.02
2588 2600 1.616725 GGGGTGCAGACCATTCATTGA 60.617 52.381 9.41 0.0 45.25 2.57
3076 3088 3.534357 TCCAAAATGCTGGGTTTAGGA 57.466 42.857 0.00 0.0 37.06 2.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
3 4 2.047655 CCTAAACGGTGCGAGCCA 60.048 61.111 0.00 0.0 0.00 4.75
301 302 1.983224 CAACCACTCCCATCGAGGT 59.017 57.895 0.00 0.0 43.57 3.85
399 400 2.196925 TGGCCAACCAAATTCGCGT 61.197 52.632 0.61 0.0 45.37 6.01
1039 1042 7.259882 GTTTCCATCACTGCAATCATATTCAA 58.740 34.615 0.00 0.0 0.00 2.69
1441 1444 4.018050 ACTGCCAACATATCCCTCTTCTTT 60.018 41.667 0.00 0.0 0.00 2.52
1848 1860 4.204799 CATCATCATCAGCCTCCTTCAAA 58.795 43.478 0.00 0.0 0.00 2.69
2398 2410 7.567622 AGCATAGTCTTTCAACCTAGGGTATTA 59.432 37.037 14.81 0.0 33.12 0.98
2427 2439 4.335416 CAGGGTTTGTATCCATCACTGTT 58.665 43.478 0.00 0.0 0.00 3.16
2588 2600 5.789643 ATGCACAAGGTGAACAAACTAAT 57.210 34.783 0.00 0.0 35.23 1.73
3076 3088 5.130145 CCATACACTTCTTCAGATCTTCCCT 59.870 44.000 0.00 0.0 0.00 4.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.