Multiple sequence alignment - TraesCS1A01G074600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G074600 chr1A 100.000 3059 0 0 1 3059 58027038 58023980 0.000000e+00 5650.0
1 TraesCS1A01G074600 chr1A 98.903 2553 27 1 1 2552 58021802 58024354 0.000000e+00 4558.0
2 TraesCS1A01G074600 chr1A 91.881 505 15 11 2556 3059 487469228 487468749 0.000000e+00 682.0
3 TraesCS1A01G074600 chr1A 98.667 375 4 1 2685 3059 58024487 58024860 0.000000e+00 664.0
4 TraesCS1A01G074600 chr1A 97.059 34 0 1 761 793 487467998 487468031 4.260000e-04 56.5
5 TraesCS1A01G074600 chr7A 99.061 2556 21 2 1 2555 706441127 706443680 0.000000e+00 4584.0
6 TraesCS1A01G074600 chr7A 98.903 2553 27 1 1 2552 694028224 694030776 0.000000e+00 4558.0
7 TraesCS1A01G074600 chr7A 99.206 504 4 0 2556 3059 694030905 694030402 0.000000e+00 909.0
8 TraesCS1A01G074600 chr7A 98.413 504 8 0 2556 3059 706443806 706443303 0.000000e+00 887.0
9 TraesCS1A01G074600 chr7B 98.631 2556 30 2 1 2555 581347566 581345015 0.000000e+00 4521.0
10 TraesCS1A01G074600 chr7B 95.502 2023 77 7 535 2555 297120954 297118944 0.000000e+00 3219.0
11 TraesCS1A01G074600 chr7B 96.462 537 18 1 1 537 297141759 297141224 0.000000e+00 885.0
12 TraesCS1A01G074600 chr7B 98.214 504 9 0 2556 3059 581344889 581345392 0.000000e+00 881.0
13 TraesCS1A01G074600 chr7B 94.257 505 16 5 2556 3059 297118818 297119310 0.000000e+00 760.0
14 TraesCS1A01G074600 chr3B 98.590 2553 20 2 1 2552 607815313 607817850 0.000000e+00 4501.0
15 TraesCS1A01G074600 chr3B 95.810 2554 86 9 1 2552 821050067 821052601 0.000000e+00 4104.0
16 TraesCS1A01G074600 chr3B 99.405 504 3 0 2556 3059 607817979 607817476 0.000000e+00 915.0
17 TraesCS1A01G074600 chr3B 93.663 505 20 6 2556 3059 821052730 821052237 0.000000e+00 745.0
18 TraesCS1A01G074600 chr1B 93.805 2147 118 5 1 2140 499020712 499018574 0.000000e+00 3214.0
19 TraesCS1A01G074600 chr6B 86.084 1739 181 34 804 2519 654600210 654601910 0.000000e+00 1814.0
20 TraesCS1A01G074600 chrUn 94.702 1057 38 7 1469 2519 94940007 94938963 0.000000e+00 1626.0
21 TraesCS1A01G074600 chrUn 91.423 478 15 7 2583 3059 94938840 94939292 1.550000e-177 632.0
22 TraesCS1A01G074600 chrUn 97.152 316 9 0 2 317 94948221 94947906 4.490000e-148 534.0
23 TraesCS1A01G074600 chr4D 89.776 1027 89 10 806 1828 506088862 506087848 0.000000e+00 1301.0
24 TraesCS1A01G074600 chr4D 91.468 586 40 3 162 738 506089458 506088874 0.000000e+00 797.0
25 TraesCS1A01G074600 chr4D 93.333 255 10 1 2556 2810 366218220 366217973 1.340000e-98 370.0
26 TraesCS1A01G074600 chr4D 87.302 126 8 2 2428 2552 366217973 366218091 1.480000e-28 137.0
27 TraesCS1A01G074600 chr5B 92.277 505 13 11 2556 3059 491652972 491653451 0.000000e+00 693.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G074600 chr1A 58023980 58027038 3058 True 5650 5650 100.000 1 3059 1 chr1A.!!$R1 3058
1 TraesCS1A01G074600 chr1A 58021802 58024860 3058 False 2611 4558 98.785 1 3059 2 chr1A.!!$F2 3058
2 TraesCS1A01G074600 chr7A 706441127 706443680 2553 False 4584 4584 99.061 1 2555 1 chr7A.!!$F2 2554
3 TraesCS1A01G074600 chr7A 694028224 694030776 2552 False 4558 4558 98.903 1 2552 1 chr7A.!!$F1 2551
4 TraesCS1A01G074600 chr7A 694030402 694030905 503 True 909 909 99.206 2556 3059 1 chr7A.!!$R1 503
5 TraesCS1A01G074600 chr7A 706443303 706443806 503 True 887 887 98.413 2556 3059 1 chr7A.!!$R2 503
6 TraesCS1A01G074600 chr7B 581345015 581347566 2551 True 4521 4521 98.631 1 2555 1 chr7B.!!$R3 2554
7 TraesCS1A01G074600 chr7B 297118944 297120954 2010 True 3219 3219 95.502 535 2555 1 chr7B.!!$R1 2020
8 TraesCS1A01G074600 chr7B 297141224 297141759 535 True 885 885 96.462 1 537 1 chr7B.!!$R2 536
9 TraesCS1A01G074600 chr7B 581344889 581345392 503 False 881 881 98.214 2556 3059 1 chr7B.!!$F2 503
10 TraesCS1A01G074600 chr3B 607815313 607817850 2537 False 4501 4501 98.590 1 2552 1 chr3B.!!$F1 2551
11 TraesCS1A01G074600 chr3B 821050067 821052601 2534 False 4104 4104 95.810 1 2552 1 chr3B.!!$F2 2551
12 TraesCS1A01G074600 chr3B 607817476 607817979 503 True 915 915 99.405 2556 3059 1 chr3B.!!$R1 503
13 TraesCS1A01G074600 chr1B 499018574 499020712 2138 True 3214 3214 93.805 1 2140 1 chr1B.!!$R1 2139
14 TraesCS1A01G074600 chr6B 654600210 654601910 1700 False 1814 1814 86.084 804 2519 1 chr6B.!!$F1 1715
15 TraesCS1A01G074600 chrUn 94938963 94940007 1044 True 1626 1626 94.702 1469 2519 1 chrUn.!!$R1 1050
16 TraesCS1A01G074600 chr4D 506087848 506089458 1610 True 1049 1301 90.622 162 1828 2 chr4D.!!$R2 1666

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1420 1441 4.916983 AATGTGTGTGTGCTTGTAATGT 57.083 36.364 0.0 0.0 0.0 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2509 2579 0.106918 TTTCTGCCACGGTTTCCTGT 60.107 50.0 0.0 0.0 0.0 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1420 1441 4.916983 AATGTGTGTGTGCTTGTAATGT 57.083 36.364 0.00 0.0 0.00 2.71
1780 1807 1.000607 CCAAGAGTCGTTTCGTGGAGA 60.001 52.381 14.84 0.0 45.88 3.71
1783 1810 0.313043 GAGTCGTTTCGTGGAGACCA 59.687 55.000 0.00 0.0 34.41 4.02
2196 2260 5.248640 AGTAGATCTTTTGATGTGTGGTGG 58.751 41.667 0.00 0.0 39.67 4.61
2301 2369 9.601217 ACTTGCACGTATCTATCTTATTTTCTT 57.399 29.630 0.00 0.0 0.00 2.52
2509 2579 3.695830 GGTGATTCTAACCACCTGTGA 57.304 47.619 0.00 0.0 46.94 3.58
3006 3179 8.281194 GTCAAGTGATAGTCATTCATAGCAATG 58.719 37.037 0.00 0.0 35.39 2.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
203 205 5.360714 AGAAAGTTTCAGTTTGAAGCCATGA 59.639 36.000 17.65 0.0 38.18 3.07
1780 1807 6.174720 TGTAGAGTTGATTTCTTCAGTGGT 57.825 37.500 0.00 0.0 35.27 4.16
1783 1810 7.605691 CCTCAATGTAGAGTTGATTTCTTCAGT 59.394 37.037 0.00 0.0 35.26 3.41
2196 2260 6.016610 TCTGGCCAAGTTACATTAAAGTGTTC 60.017 38.462 7.01 0.0 33.62 3.18
2301 2369 9.761504 TTCAAAATGCAAACTCATAATCAAGAA 57.238 25.926 0.00 0.0 0.00 2.52
2509 2579 0.106918 TTTCTGCCACGGTTTCCTGT 60.107 50.000 0.00 0.0 0.00 4.00
2682 2855 5.292101 CCAAACGCAAACCATAACTTTTTGA 59.708 36.000 0.00 0.0 32.91 2.69
3006 3179 1.680338 ACTTGGCCAGAACTTGTGTC 58.320 50.000 5.11 0.0 0.00 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.