Multiple sequence alignment - TraesCS1A01G062500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G062500 chr1A 100.000 2488 0 0 1 2488 42669763 42672250 0.000000e+00 4595
1 TraesCS1A01G062500 chr1A 97.622 1724 40 1 765 2488 42685948 42687670 0.000000e+00 2955
2 TraesCS1A01G062500 chr1A 97.332 1724 46 0 765 2488 42721111 42722834 0.000000e+00 2929
3 TraesCS1A01G062500 chr1A 98.251 915 16 0 1574 2488 42696080 42696994 0.000000e+00 1602
4 TraesCS1A01G062500 chr1A 96.786 840 27 0 765 1604 42695242 42696081 0.000000e+00 1402
5 TraesCS1A01G062500 chr1A 98.303 766 10 1 1 766 42683146 42683908 0.000000e+00 1339
6 TraesCS1A01G062500 chr1A 97.520 766 16 2 1 766 42718311 42719073 0.000000e+00 1306
7 TraesCS1A01G062500 chr1A 97.389 766 12 2 1 766 42692496 42693253 0.000000e+00 1297
8 TraesCS1A01G062500 chr1D 94.169 2298 121 11 151 2444 43305361 43307649 0.000000e+00 3489
9 TraesCS1A01G062500 chr1D 87.190 1249 124 26 459 1702 44628763 44629980 0.000000e+00 1387
10 TraesCS1A01G062500 chr1D 89.354 1099 94 13 612 1702 43823101 43824184 0.000000e+00 1360
11 TraesCS1A01G062500 chr1D 91.026 156 10 3 1 156 43285052 43285203 9.020000e-50 207
12 TraesCS1A01G062500 chr1B 91.069 2049 171 11 47 2091 63201290 63203330 0.000000e+00 2760
13 TraesCS1A01G062500 chr1B 88.147 1392 133 22 326 1702 63888648 63890022 0.000000e+00 1628
14 TraesCS1A01G062500 chr1B 87.994 1391 133 25 326 1702 63479349 63480719 0.000000e+00 1613
15 TraesCS1A01G062500 chr1B 87.509 1393 132 28 326 1702 63468117 63469483 0.000000e+00 1570
16 TraesCS1A01G062500 chr1B 87.347 1391 142 23 326 1702 63613759 63615129 0.000000e+00 1563
17 TraesCS1A01G062500 chr1B 87.124 1398 148 22 319 1702 63808353 63809732 0.000000e+00 1555
18 TraesCS1A01G062500 chr1B 87.892 223 23 3 2265 2485 63217397 63217617 2.450000e-65 259
19 TraesCS1A01G062500 chr5A 79.392 1679 258 55 422 2067 608949799 608951422 0.000000e+00 1103
20 TraesCS1A01G062500 chr5D 80.786 1374 201 36 422 1769 488203313 488204649 0.000000e+00 1016


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G062500 chr1A 42669763 42672250 2487 False 4595.000000 4595 100.000000 1 2488 1 chr1A.!!$F1 2487
1 TraesCS1A01G062500 chr1A 42683146 42687670 4524 False 2147.000000 2955 97.962500 1 2488 2 chr1A.!!$F2 2487
2 TraesCS1A01G062500 chr1A 42718311 42722834 4523 False 2117.500000 2929 97.426000 1 2488 2 chr1A.!!$F4 2487
3 TraesCS1A01G062500 chr1A 42692496 42696994 4498 False 1433.666667 1602 97.475333 1 2488 3 chr1A.!!$F3 2487
4 TraesCS1A01G062500 chr1D 43305361 43307649 2288 False 3489.000000 3489 94.169000 151 2444 1 chr1D.!!$F2 2293
5 TraesCS1A01G062500 chr1D 44628763 44629980 1217 False 1387.000000 1387 87.190000 459 1702 1 chr1D.!!$F4 1243
6 TraesCS1A01G062500 chr1D 43823101 43824184 1083 False 1360.000000 1360 89.354000 612 1702 1 chr1D.!!$F3 1090
7 TraesCS1A01G062500 chr1B 63201290 63203330 2040 False 2760.000000 2760 91.069000 47 2091 1 chr1B.!!$F1 2044
8 TraesCS1A01G062500 chr1B 63888648 63890022 1374 False 1628.000000 1628 88.147000 326 1702 1 chr1B.!!$F7 1376
9 TraesCS1A01G062500 chr1B 63479349 63480719 1370 False 1613.000000 1613 87.994000 326 1702 1 chr1B.!!$F4 1376
10 TraesCS1A01G062500 chr1B 63468117 63469483 1366 False 1570.000000 1570 87.509000 326 1702 1 chr1B.!!$F3 1376
11 TraesCS1A01G062500 chr1B 63613759 63615129 1370 False 1563.000000 1563 87.347000 326 1702 1 chr1B.!!$F5 1376
12 TraesCS1A01G062500 chr1B 63808353 63809732 1379 False 1555.000000 1555 87.124000 319 1702 1 chr1B.!!$F6 1383
13 TraesCS1A01G062500 chr5A 608949799 608951422 1623 False 1103.000000 1103 79.392000 422 2067 1 chr5A.!!$F1 1645
14 TraesCS1A01G062500 chr5D 488203313 488204649 1336 False 1016.000000 1016 80.786000 422 1769 1 chr5D.!!$F1 1347

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
913 3190 5.37823 AGTCATGTATCCCACACATTCAT 57.622 39.13 0.0 0.0 40.86 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2420 4748 5.174395 CAGACTATGGTCCTTCTGTTTCTG 58.826 45.833 5.47 0.0 43.05 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
913 3190 5.378230 AGTCATGTATCCCACACATTCAT 57.622 39.130 0.00 0.00 40.86 2.57
986 3277 6.463053 AGAAGGCTCTAGTGTAGGAGATAT 57.537 41.667 0.00 0.00 0.00 1.63
1138 3429 1.241315 GCCAGCAAACCCGAAGCTAA 61.241 55.000 0.00 0.00 36.73 3.09
1150 3441 1.468565 CGAAGCTAAATCCGTCGGACA 60.469 52.381 18.08 3.92 32.98 4.02
1151 3442 2.613691 GAAGCTAAATCCGTCGGACAA 58.386 47.619 18.08 3.92 32.98 3.18
2059 4387 8.528643 TCTGCTTTGTACAATGTATACACTACT 58.471 33.333 19.31 0.00 32.30 2.57
2221 4549 0.389757 GGATGCTCGGGTAGGACTTC 59.610 60.000 0.00 0.00 0.00 3.01
2420 4748 7.442666 CCAAAGTAGCCCTAATTACAGAAGATC 59.557 40.741 0.00 0.00 0.00 2.75
2463 4791 4.819761 GTCCTCGGCGCAGATGCA 62.820 66.667 11.52 0.00 42.21 3.96
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
39 40 2.299867 GTTGGCCCATGTGAGACAATTT 59.700 45.455 0.00 0.00 0.00 1.82
40 41 1.895131 GTTGGCCCATGTGAGACAATT 59.105 47.619 0.00 0.00 0.00 2.32
41 42 1.203038 TGTTGGCCCATGTGAGACAAT 60.203 47.619 0.00 0.00 0.00 2.71
913 3190 7.573710 ACAATATAGGATTTGTGTGGCTTCTA 58.426 34.615 0.00 0.00 34.87 2.10
1138 3429 1.086696 CAGCATTTGTCCGACGGATT 58.913 50.000 21.53 2.77 32.73 3.01
1322 3613 3.494251 TGTATGAAATGCCGATCATCGTG 59.506 43.478 6.25 0.00 38.40 4.35
2059 4387 9.210329 TGAAATACTTCGTGTGATAAAAAGCTA 57.790 29.630 0.00 0.00 33.94 3.32
2420 4748 5.174395 CAGACTATGGTCCTTCTGTTTCTG 58.826 45.833 5.47 0.00 43.05 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.