Multiple sequence alignment - TraesCS1A01G040100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G040100 chr1A 100.000 4746 0 0 1 4746 22077882 22073137 0.000000e+00 8765.0
1 TraesCS1A01G040100 chr1A 99.620 789 3 0 1145 1933 22075302 22074514 0.000000e+00 1441.0
2 TraesCS1A01G040100 chr1A 99.620 789 3 0 2581 3369 22076738 22075950 0.000000e+00 1441.0
3 TraesCS1A01G040100 chr1A 78.000 400 53 24 3370 3738 22282828 22282433 8.000000e-53 219.0
4 TraesCS1A01G040100 chr1A 79.167 264 24 21 476 723 22272482 22272234 2.290000e-33 154.0
5 TraesCS1A01G040100 chr1A 82.171 129 13 7 1024 1144 22282950 22282824 8.400000e-18 102.0
6 TraesCS1A01G040100 chr6B 99.116 792 5 1 1145 1934 712726 713517 0.000000e+00 1423.0
7 TraesCS1A01G040100 chr6B 98.747 798 6 3 2574 3369 712721 713516 0.000000e+00 1415.0
8 TraesCS1A01G040100 chr6B 93.051 590 29 8 1220 1803 640352550 640351967 0.000000e+00 852.0
9 TraesCS1A01G040100 chr6B 92.881 590 30 8 2656 3239 640352550 640351967 0.000000e+00 846.0
10 TraesCS1A01G040100 chr6B 86.632 389 43 7 1692 2075 25393026 25393410 5.680000e-114 422.0
11 TraesCS1A01G040100 chr6B 94.706 170 8 1 300 469 699610909 699611077 3.640000e-66 263.0
12 TraesCS1A01G040100 chr6B 94.611 167 9 0 299 465 95349409 95349575 4.710000e-65 259.0
13 TraesCS1A01G040100 chr6B 85.600 125 16 1 1587 1711 113066489 113066611 3.850000e-26 130.0
14 TraesCS1A01G040100 chr6B 85.600 125 16 1 3023 3147 113066489 113066611 3.850000e-26 130.0
15 TraesCS1A01G040100 chr6B 92.308 52 4 0 2613 2664 2292983 2292932 1.830000e-09 75.0
16 TraesCS1A01G040100 chr6B 92.308 52 4 0 1177 1228 2292983 2292932 1.830000e-09 75.0
17 TraesCS1A01G040100 chr6B 92.308 52 4 0 2613 2664 2294151 2294100 1.830000e-09 75.0
18 TraesCS1A01G040100 chr6B 92.308 52 4 0 1177 1228 2294151 2294100 1.830000e-09 75.0
19 TraesCS1A01G040100 chr6B 92.308 52 4 0 1177 1228 208173196 208173247 1.830000e-09 75.0
20 TraesCS1A01G040100 chr6B 92.308 52 4 0 2613 2664 208173196 208173247 1.830000e-09 75.0
21 TraesCS1A01G040100 chr6B 85.714 63 9 0 3381 3443 708516290 708516228 3.070000e-07 67.6
22 TraesCS1A01G040100 chrUn 99.097 775 6 1 1686 2460 416309921 416310694 0.000000e+00 1391.0
23 TraesCS1A01G040100 chrUn 93.313 658 29 9 1796 2450 236256873 236256228 0.000000e+00 957.0
24 TraesCS1A01G040100 chrUn 99.194 248 1 1 3122 3369 416309921 416310167 3.370000e-121 446.0
25 TraesCS1A01G040100 chrUn 95.210 167 8 0 300 466 320233968 320234134 1.010000e-66 265.0
26 TraesCS1A01G040100 chrUn 95.210 167 8 0 300 466 361421742 361421908 1.010000e-66 265.0
27 TraesCS1A01G040100 chrUn 95.210 167 8 0 300 466 476170790 476170956 1.010000e-66 265.0
28 TraesCS1A01G040100 chr3B 92.628 936 38 24 1695 2621 758337656 758336743 0.000000e+00 1317.0
29 TraesCS1A01G040100 chr3B 94.346 283 15 1 2339 2621 212247920 212247639 2.620000e-117 433.0
30 TraesCS1A01G040100 chr3B 96.341 164 6 0 302 465 428703874 428704037 2.180000e-68 270.0
31 TraesCS1A01G040100 chr3B 100.000 42 0 0 1144 1185 45302227 45302186 1.420000e-10 78.7
32 TraesCS1A01G040100 chr3B 100.000 42 0 0 1144 1185 212249043 212249002 1.420000e-10 78.7
33 TraesCS1A01G040100 chr3B 100.000 41 0 0 1145 1185 758338173 758338133 5.090000e-10 76.8
34 TraesCS1A01G040100 chr1B 97.516 765 16 2 1858 2621 78811124 78811886 0.000000e+00 1304.0
35 TraesCS1A01G040100 chr1B 97.516 765 16 2 1858 2621 78812522 78813284 0.000000e+00 1304.0
36 TraesCS1A01G040100 chr1B 97.516 765 16 2 1858 2621 78813920 78814682 0.000000e+00 1304.0
37 TraesCS1A01G040100 chr1B 97.255 765 18 2 1858 2621 78815318 78816080 0.000000e+00 1293.0
38 TraesCS1A01G040100 chr1B 79.950 399 47 19 3370 3738 33946622 33946227 3.640000e-66 263.0
39 TraesCS1A01G040100 chr1B 91.489 188 16 0 3370 3557 33857248 33857061 4.710000e-65 259.0
40 TraesCS1A01G040100 chr1B 78.055 401 51 24 3370 3738 33921396 33921001 8.000000e-53 219.0
41 TraesCS1A01G040100 chr1B 78.616 159 21 9 997 1144 33921548 33921392 5.060000e-15 93.5
42 TraesCS1A01G040100 chr1B 78.616 159 21 9 997 1144 33946774 33946618 5.060000e-15 93.5
43 TraesCS1A01G040100 chr1B 100.000 41 0 0 1145 1185 78810448 78810488 5.090000e-10 76.8
44 TraesCS1A01G040100 chr1B 100.000 41 0 0 1145 1185 78811846 78811886 5.090000e-10 76.8
45 TraesCS1A01G040100 chr1B 92.308 52 4 0 2613 2664 31714907 31714856 1.830000e-09 75.0
46 TraesCS1A01G040100 chr1B 92.308 52 4 0 1177 1228 31714907 31714856 1.830000e-09 75.0
47 TraesCS1A01G040100 chr7B 93.769 658 31 4 1824 2481 592613591 592614238 0.000000e+00 979.0
48 TraesCS1A01G040100 chr7B 88.743 382 36 6 1697 2075 707407419 707407042 1.200000e-125 460.0
49 TraesCS1A01G040100 chr7B 86.632 389 43 7 1692 2075 608996044 608996428 5.680000e-114 422.0
50 TraesCS1A01G040100 chr7B 96.624 237 7 1 3133 3369 707406263 707406028 4.450000e-105 392.0
51 TraesCS1A01G040100 chr7B 96.624 237 7 1 3133 3369 707407419 707407184 4.450000e-105 392.0
52 TraesCS1A01G040100 chr7B 95.783 166 7 0 300 465 407093182 407093017 7.830000e-68 268.0
53 TraesCS1A01G040100 chr7B 100.000 142 0 0 2480 2621 592614192 592614333 3.640000e-66 263.0
54 TraesCS1A01G040100 chr7B 78.676 136 18 4 1177 1312 623266539 623266663 3.940000e-11 80.5
55 TraesCS1A01G040100 chr7B 78.676 136 18 4 2613 2748 623266539 623266663 3.940000e-11 80.5
56 TraesCS1A01G040100 chr7B 100.000 41 0 0 1145 1185 592612904 592612944 5.090000e-10 76.8
57 TraesCS1A01G040100 chr7B 100.000 41 0 0 1145 1185 592614293 592614333 5.090000e-10 76.8
58 TraesCS1A01G040100 chr7A 93.920 625 30 6 1827 2450 11664891 11665508 0.000000e+00 937.0
59 TraesCS1A01G040100 chr7A 93.993 283 16 1 2339 2621 729236413 729236132 1.220000e-115 427.0
60 TraesCS1A01G040100 chr7A 93.333 255 14 3 3131 3384 725212997 725212745 1.610000e-99 374.0
61 TraesCS1A01G040100 chr3A 87.206 766 53 33 1177 1933 698031693 698030964 0.000000e+00 830.0
62 TraesCS1A01G040100 chr3A 87.030 771 55 33 2613 3374 698031693 698030959 0.000000e+00 828.0
63 TraesCS1A01G040100 chr3A 93.706 286 14 3 1652 1934 745457565 745457849 4.390000e-115 425.0
64 TraesCS1A01G040100 chr3A 93.684 285 14 3 3088 3369 745457565 745457848 1.580000e-114 424.0
65 TraesCS1A01G040100 chr3A 92.405 79 4 2 3291 3369 687914528 687914452 1.400000e-20 111.0
66 TraesCS1A01G040100 chr2B 96.755 493 13 2 1220 1711 114555945 114556435 0.000000e+00 819.0
67 TraesCS1A01G040100 chr2B 96.552 493 14 2 2656 3147 114555945 114556435 0.000000e+00 813.0
68 TraesCS1A01G040100 chr2B 98.394 249 1 2 3122 3370 51045293 51045538 7.290000e-118 435.0
69 TraesCS1A01G040100 chr2B 98.387 248 1 2 1686 1933 51045293 51045537 2.620000e-117 433.0
70 TraesCS1A01G040100 chr5B 91.400 593 35 9 1220 1809 688051266 688051845 0.000000e+00 798.0
71 TraesCS1A01G040100 chr5B 91.231 593 36 9 2656 3245 688051266 688051845 0.000000e+00 793.0
72 TraesCS1A01G040100 chr4A 82.821 716 81 28 1224 1933 603278993 603278314 1.890000e-168 603.0
73 TraesCS1A01G040100 chr4A 82.706 717 82 28 2660 3370 603278993 603278313 2.440000e-167 599.0
74 TraesCS1A01G040100 chr4A 95.758 165 7 0 301 465 741783849 741783685 2.820000e-67 267.0
75 TraesCS1A01G040100 chr5A 85.618 591 57 20 1224 1805 567748545 567749116 3.160000e-166 595.0
76 TraesCS1A01G040100 chr5A 85.448 591 58 20 2660 3241 567748545 567749116 1.470000e-164 590.0
77 TraesCS1A01G040100 chr5A 75.320 547 83 40 1586 2126 690844946 690845446 1.030000e-51 215.0
78 TraesCS1A01G040100 chr5A 76.705 352 40 32 3022 3369 690844946 690845259 1.770000e-34 158.0
79 TraesCS1A01G040100 chr2D 86.089 381 39 4 1220 1598 612736431 612736063 9.570000e-107 398.0
80 TraesCS1A01G040100 chr2D 85.827 381 40 4 2656 3034 612736431 612736063 4.450000e-105 392.0
81 TraesCS1A01G040100 chr5D 92.697 178 11 2 289 466 198477562 198477387 6.090000e-64 255.0
82 TraesCS1A01G040100 chr5D 95.349 43 2 0 3371 3413 525226751 525226709 8.520000e-08 69.4
83 TraesCS1A01G040100 chr5D 95.238 42 2 0 3372 3413 525250461 525250502 3.070000e-07 67.6
84 TraesCS1A01G040100 chr1D 79.545 396 51 21 3370 3738 20062032 20062424 6.090000e-64 255.0
85 TraesCS1A01G040100 chr1D 90.957 188 17 0 3370 3557 20193549 20193736 2.190000e-63 254.0
86 TraesCS1A01G040100 chr1D 77.019 322 48 18 832 1144 20193249 20193553 1.370000e-35 161.0
87 TraesCS1A01G040100 chr1D 79.845 129 16 4 1024 1144 20061910 20062036 8.460000e-13 86.1
88 TraesCS1A01G040100 chr4D 80.952 126 13 5 1173 1298 356266182 356266296 6.540000e-14 89.8
89 TraesCS1A01G040100 chr4D 80.952 126 13 5 2609 2734 356266182 356266296 6.540000e-14 89.8
90 TraesCS1A01G040100 chr6A 77.397 146 22 4 1177 1322 314066290 314066424 5.090000e-10 76.8
91 TraesCS1A01G040100 chr6A 77.397 146 22 4 2613 2758 314066290 314066424 5.090000e-10 76.8
92 TraesCS1A01G040100 chr6A 83.333 72 12 0 3372 3443 611197759 611197830 3.070000e-07 67.6
93 TraesCS1A01G040100 chr4B 92.308 52 4 0 2613 2664 1794124 1794073 1.830000e-09 75.0
94 TraesCS1A01G040100 chr4B 92.308 52 4 0 1177 1228 1794124 1794073 1.830000e-09 75.0
95 TraesCS1A01G040100 chr6D 85.714 63 9 0 3381 3443 464674915 464674853 3.070000e-07 67.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G040100 chr1A 22073137 22077882 4745 True 3882.333333 8765 99.746667 1 4746 3 chr1A.!!$R2 4745
1 TraesCS1A01G040100 chr6B 712721 713517 796 False 1419.000000 1423 98.931500 1145 3369 2 chr6B.!!$F4 2224
2 TraesCS1A01G040100 chr6B 640351967 640352550 583 True 849.000000 852 92.966000 1220 3239 2 chr6B.!!$R3 2019
3 TraesCS1A01G040100 chrUn 236256228 236256873 645 True 957.000000 957 93.313000 1796 2450 1 chrUn.!!$R1 654
4 TraesCS1A01G040100 chrUn 416309921 416310694 773 False 918.500000 1391 99.145500 1686 3369 2 chrUn.!!$F4 1683
5 TraesCS1A01G040100 chr3B 758336743 758338173 1430 True 696.900000 1317 96.314000 1145 2621 2 chr3B.!!$R3 1476
6 TraesCS1A01G040100 chr3B 212247639 212249043 1404 True 255.850000 433 97.173000 1144 2621 2 chr3B.!!$R2 1477
7 TraesCS1A01G040100 chr1B 78810448 78816080 5632 False 893.100000 1304 98.300500 1145 2621 6 chr1B.!!$F1 1476
8 TraesCS1A01G040100 chr7B 707406028 707407419 1391 True 414.666667 460 93.997000 1697 3369 3 chr7B.!!$R2 1672
9 TraesCS1A01G040100 chr7B 592612904 592614333 1429 False 348.900000 979 98.442250 1145 2621 4 chr7B.!!$F2 1476
10 TraesCS1A01G040100 chr7A 11664891 11665508 617 False 937.000000 937 93.920000 1827 2450 1 chr7A.!!$F1 623
11 TraesCS1A01G040100 chr3A 698030959 698031693 734 True 829.000000 830 87.118000 1177 3374 2 chr3A.!!$R2 2197
12 TraesCS1A01G040100 chr5B 688051266 688051845 579 False 795.500000 798 91.315500 1220 3245 2 chr5B.!!$F1 2025
13 TraesCS1A01G040100 chr4A 603278313 603278993 680 True 601.000000 603 82.763500 1224 3370 2 chr4A.!!$R2 2146
14 TraesCS1A01G040100 chr5A 567748545 567749116 571 False 592.500000 595 85.533000 1224 3241 2 chr5A.!!$F1 2017


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
756 757 0.035458 CTTGGTCTCTTCGCAGGGTT 59.965 55.0 0.00 0.0 0.00 4.11 F
794 795 0.105039 ATTCACTGCCGCCTAGCTAC 59.895 55.0 0.00 0.0 0.00 3.58 F
946 947 0.107654 GCCCGTTACCAATCTCAGCT 60.108 55.0 0.00 0.0 0.00 4.24 F
2819 7600 0.035630 ATGACTGAAGCAGGACTGGC 60.036 55.0 1.01 0.0 35.51 4.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2652 7433 0.098376 CATTGAAGCTCCGCTGAAGC 59.902 55.0 0.00 0.00 39.62 3.86 R
2786 7567 0.109272 AGTCATCTACGTGTGTGCCG 60.109 55.0 0.00 0.00 0.00 5.69 R
2909 7690 0.028505 CTCAACGCATGCATGGCTAC 59.971 55.0 27.34 10.17 0.00 3.58 R
4696 9511 0.034896 GGGTGTTCTTGGAAGCTCGA 59.965 55.0 0.00 0.00 0.00 4.04 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 5.670792 ATGCAGTTTGTTGATCATGGATT 57.329 34.783 0.00 0.00 0.00 3.01
23 24 5.471556 TGCAGTTTGTTGATCATGGATTT 57.528 34.783 0.00 0.00 0.00 2.17
24 25 5.231702 TGCAGTTTGTTGATCATGGATTTG 58.768 37.500 0.00 0.00 0.00 2.32
25 26 5.010820 TGCAGTTTGTTGATCATGGATTTGA 59.989 36.000 0.00 0.00 0.00 2.69
26 27 6.103997 GCAGTTTGTTGATCATGGATTTGAT 58.896 36.000 0.00 0.00 39.04 2.57
34 35 4.543692 GATCATGGATTTGATCGCTTTGG 58.456 43.478 0.00 0.00 41.77 3.28
35 36 2.689471 TCATGGATTTGATCGCTTTGGG 59.311 45.455 0.00 0.00 0.00 4.12
36 37 1.473258 TGGATTTGATCGCTTTGGGG 58.527 50.000 0.00 0.00 0.00 4.96
37 38 1.272425 TGGATTTGATCGCTTTGGGGT 60.272 47.619 0.00 0.00 0.00 4.95
38 39 1.824852 GGATTTGATCGCTTTGGGGTT 59.175 47.619 0.00 0.00 0.00 4.11
39 40 2.233676 GGATTTGATCGCTTTGGGGTTT 59.766 45.455 0.00 0.00 0.00 3.27
40 41 3.306710 GGATTTGATCGCTTTGGGGTTTT 60.307 43.478 0.00 0.00 0.00 2.43
41 42 3.828875 TTTGATCGCTTTGGGGTTTTT 57.171 38.095 0.00 0.00 0.00 1.94
60 61 3.593442 TTTTCTTTTCCTCTCTGGGCA 57.407 42.857 0.00 0.00 36.20 5.36
61 62 3.814504 TTTCTTTTCCTCTCTGGGCAT 57.185 42.857 0.00 0.00 36.20 4.40
62 63 4.927267 TTTCTTTTCCTCTCTGGGCATA 57.073 40.909 0.00 0.00 36.20 3.14
63 64 4.494091 TTCTTTTCCTCTCTGGGCATAG 57.506 45.455 0.00 0.00 36.20 2.23
64 65 3.454858 TCTTTTCCTCTCTGGGCATAGT 58.545 45.455 0.00 0.00 36.20 2.12
65 66 3.846588 TCTTTTCCTCTCTGGGCATAGTT 59.153 43.478 0.00 0.00 36.20 2.24
66 67 4.289672 TCTTTTCCTCTCTGGGCATAGTTT 59.710 41.667 0.00 0.00 36.20 2.66
67 68 4.657814 TTTCCTCTCTGGGCATAGTTTT 57.342 40.909 0.00 0.00 36.20 2.43
68 69 3.634397 TCCTCTCTGGGCATAGTTTTG 57.366 47.619 0.00 0.00 36.20 2.44
69 70 2.239654 TCCTCTCTGGGCATAGTTTTGG 59.760 50.000 0.00 0.00 36.20 3.28
70 71 2.025887 CCTCTCTGGGCATAGTTTTGGT 60.026 50.000 0.00 0.00 0.00 3.67
71 72 3.274288 CTCTCTGGGCATAGTTTTGGTC 58.726 50.000 0.00 0.00 0.00 4.02
72 73 2.912956 TCTCTGGGCATAGTTTTGGTCT 59.087 45.455 0.00 0.00 0.00 3.85
73 74 3.330701 TCTCTGGGCATAGTTTTGGTCTT 59.669 43.478 0.00 0.00 0.00 3.01
74 75 4.534500 TCTCTGGGCATAGTTTTGGTCTTA 59.466 41.667 0.00 0.00 0.00 2.10
75 76 4.843728 TCTGGGCATAGTTTTGGTCTTAG 58.156 43.478 0.00 0.00 0.00 2.18
76 77 4.534500 TCTGGGCATAGTTTTGGTCTTAGA 59.466 41.667 0.00 0.00 0.00 2.10
77 78 4.585879 TGGGCATAGTTTTGGTCTTAGAC 58.414 43.478 3.36 3.36 0.00 2.59
78 79 3.621715 GGGCATAGTTTTGGTCTTAGACG 59.378 47.826 6.27 0.00 32.65 4.18
79 80 4.501071 GGCATAGTTTTGGTCTTAGACGA 58.499 43.478 6.27 0.00 32.65 4.20
80 81 4.329256 GGCATAGTTTTGGTCTTAGACGAC 59.671 45.833 6.27 3.02 32.65 4.34
81 82 5.169295 GCATAGTTTTGGTCTTAGACGACT 58.831 41.667 6.27 9.65 34.38 4.18
82 83 5.638234 GCATAGTTTTGGTCTTAGACGACTT 59.362 40.000 6.27 0.00 34.38 3.01
83 84 6.147328 GCATAGTTTTGGTCTTAGACGACTTT 59.853 38.462 6.27 1.30 34.38 2.66
84 85 7.330208 GCATAGTTTTGGTCTTAGACGACTTTA 59.670 37.037 6.27 0.00 34.38 1.85
85 86 8.645487 CATAGTTTTGGTCTTAGACGACTTTAC 58.355 37.037 6.27 0.50 34.38 2.01
86 87 5.689068 AGTTTTGGTCTTAGACGACTTTACG 59.311 40.000 6.27 0.00 39.31 3.18
87 88 3.837213 TGGTCTTAGACGACTTTACGG 57.163 47.619 6.27 0.00 37.61 4.02
88 89 2.489329 TGGTCTTAGACGACTTTACGGG 59.511 50.000 6.27 0.00 37.61 5.28
89 90 2.489722 GGTCTTAGACGACTTTACGGGT 59.510 50.000 6.27 0.00 37.61 5.28
90 91 3.496155 GTCTTAGACGACTTTACGGGTG 58.504 50.000 0.00 0.00 37.61 4.61
91 92 3.057946 GTCTTAGACGACTTTACGGGTGT 60.058 47.826 0.00 0.00 37.61 4.16
92 93 3.569701 TCTTAGACGACTTTACGGGTGTT 59.430 43.478 0.00 0.00 37.61 3.32
93 94 2.896745 AGACGACTTTACGGGTGTTT 57.103 45.000 0.00 0.00 37.61 2.83
94 95 2.476821 AGACGACTTTACGGGTGTTTG 58.523 47.619 0.00 0.00 37.61 2.93
95 96 2.159057 AGACGACTTTACGGGTGTTTGT 60.159 45.455 0.00 0.00 37.61 2.83
96 97 1.935199 ACGACTTTACGGGTGTTTGTG 59.065 47.619 0.00 0.00 37.61 3.33
97 98 1.935199 CGACTTTACGGGTGTTTGTGT 59.065 47.619 0.00 0.00 0.00 3.72
98 99 2.285950 CGACTTTACGGGTGTTTGTGTG 60.286 50.000 0.00 0.00 0.00 3.82
99 100 2.018515 ACTTTACGGGTGTTTGTGTGG 58.981 47.619 0.00 0.00 0.00 4.17
100 101 1.335496 CTTTACGGGTGTTTGTGTGGG 59.665 52.381 0.00 0.00 0.00 4.61
101 102 0.255318 TTACGGGTGTTTGTGTGGGT 59.745 50.000 0.00 0.00 0.00 4.51
102 103 0.464013 TACGGGTGTTTGTGTGGGTG 60.464 55.000 0.00 0.00 0.00 4.61
103 104 1.751162 CGGGTGTTTGTGTGGGTGT 60.751 57.895 0.00 0.00 0.00 4.16
104 105 1.813192 GGGTGTTTGTGTGGGTGTG 59.187 57.895 0.00 0.00 0.00 3.82
105 106 0.968393 GGGTGTTTGTGTGGGTGTGT 60.968 55.000 0.00 0.00 0.00 3.72
106 107 0.172352 GGTGTTTGTGTGGGTGTGTG 59.828 55.000 0.00 0.00 0.00 3.82
107 108 0.885196 GTGTTTGTGTGGGTGTGTGT 59.115 50.000 0.00 0.00 0.00 3.72
108 109 0.884514 TGTTTGTGTGGGTGTGTGTG 59.115 50.000 0.00 0.00 0.00 3.82
109 110 0.457681 GTTTGTGTGGGTGTGTGTGC 60.458 55.000 0.00 0.00 0.00 4.57
110 111 1.599606 TTTGTGTGGGTGTGTGTGCC 61.600 55.000 0.00 0.00 0.00 5.01
111 112 3.216292 GTGTGGGTGTGTGTGCCC 61.216 66.667 0.00 0.00 45.04 5.36
126 127 3.630148 CCCGCGCGTTGCTGATAG 61.630 66.667 29.95 9.60 43.27 2.08
127 128 3.630148 CCGCGCGTTGCTGATAGG 61.630 66.667 29.95 4.86 43.27 2.57
128 129 2.885644 CGCGCGTTGCTGATAGGT 60.886 61.111 24.19 0.00 43.27 3.08
129 130 2.703409 GCGCGTTGCTGATAGGTG 59.297 61.111 8.43 0.00 41.73 4.00
130 131 2.100631 GCGCGTTGCTGATAGGTGT 61.101 57.895 8.43 0.00 41.73 4.16
131 132 1.709760 CGCGTTGCTGATAGGTGTG 59.290 57.895 0.00 0.00 0.00 3.82
132 133 1.014044 CGCGTTGCTGATAGGTGTGT 61.014 55.000 0.00 0.00 0.00 3.72
133 134 0.443869 GCGTTGCTGATAGGTGTGTG 59.556 55.000 0.00 0.00 0.00 3.82
134 135 0.443869 CGTTGCTGATAGGTGTGTGC 59.556 55.000 0.00 0.00 0.00 4.57
135 136 1.522668 GTTGCTGATAGGTGTGTGCA 58.477 50.000 0.00 0.00 0.00 4.57
136 137 2.086869 GTTGCTGATAGGTGTGTGCAT 58.913 47.619 0.00 0.00 0.00 3.96
137 138 2.489329 GTTGCTGATAGGTGTGTGCATT 59.511 45.455 0.00 0.00 0.00 3.56
138 139 2.358957 TGCTGATAGGTGTGTGCATTC 58.641 47.619 0.00 0.00 0.00 2.67
139 140 2.026915 TGCTGATAGGTGTGTGCATTCT 60.027 45.455 0.00 0.00 0.00 2.40
140 141 3.197549 TGCTGATAGGTGTGTGCATTCTA 59.802 43.478 0.00 0.00 0.00 2.10
141 142 3.557595 GCTGATAGGTGTGTGCATTCTAC 59.442 47.826 0.00 0.00 0.00 2.59
142 143 4.122776 CTGATAGGTGTGTGCATTCTACC 58.877 47.826 0.00 0.00 0.00 3.18
143 144 3.774766 TGATAGGTGTGTGCATTCTACCT 59.225 43.478 15.91 15.91 43.69 3.08
144 145 4.959839 TGATAGGTGTGTGCATTCTACCTA 59.040 41.667 18.31 18.31 45.19 3.08
146 147 4.142609 AGGTGTGTGCATTCTACCTATG 57.857 45.455 11.65 0.00 39.84 2.23
147 148 2.614057 GGTGTGTGCATTCTACCTATGC 59.386 50.000 0.00 0.00 46.63 3.14
159 160 2.983433 CCTATGCAGAGGTCAAGCG 58.017 57.895 19.61 0.00 0.00 4.68
160 161 0.176680 CCTATGCAGAGGTCAAGCGT 59.823 55.000 19.61 0.00 0.00 5.07
161 162 1.409064 CCTATGCAGAGGTCAAGCGTA 59.591 52.381 19.61 0.00 0.00 4.42
162 163 2.036475 CCTATGCAGAGGTCAAGCGTAT 59.964 50.000 19.61 0.00 0.00 3.06
163 164 1.945387 ATGCAGAGGTCAAGCGTATG 58.055 50.000 0.00 0.00 0.00 2.39
164 165 0.740868 TGCAGAGGTCAAGCGTATGC 60.741 55.000 0.00 0.00 46.58 3.14
176 177 2.900122 GCGTATGCTCATTGTGTTGT 57.100 45.000 0.00 0.00 38.39 3.32
178 179 4.536364 GCGTATGCTCATTGTGTTGTAT 57.464 40.909 0.00 0.00 38.39 2.29
179 180 4.518217 GCGTATGCTCATTGTGTTGTATC 58.482 43.478 0.00 0.00 38.39 2.24
180 181 4.271049 GCGTATGCTCATTGTGTTGTATCT 59.729 41.667 0.00 0.00 38.39 1.98
181 182 5.462068 GCGTATGCTCATTGTGTTGTATCTA 59.538 40.000 0.00 0.00 38.39 1.98
182 183 6.562270 GCGTATGCTCATTGTGTTGTATCTAC 60.562 42.308 0.00 0.00 38.39 2.59
183 184 6.697455 CGTATGCTCATTGTGTTGTATCTACT 59.303 38.462 0.00 0.00 0.00 2.57
184 185 7.222805 CGTATGCTCATTGTGTTGTATCTACTT 59.777 37.037 0.00 0.00 0.00 2.24
185 186 6.726258 TGCTCATTGTGTTGTATCTACTTG 57.274 37.500 0.00 0.00 0.00 3.16
186 187 6.463360 TGCTCATTGTGTTGTATCTACTTGA 58.537 36.000 0.00 0.00 0.00 3.02
187 188 7.105588 TGCTCATTGTGTTGTATCTACTTGAT 58.894 34.615 0.00 0.00 39.11 2.57
188 189 7.607607 TGCTCATTGTGTTGTATCTACTTGATT 59.392 33.333 0.00 0.00 36.65 2.57
189 190 8.119226 GCTCATTGTGTTGTATCTACTTGATTC 58.881 37.037 0.00 0.00 36.65 2.52
190 191 9.376075 CTCATTGTGTTGTATCTACTTGATTCT 57.624 33.333 0.00 0.00 36.65 2.40
191 192 9.725019 TCATTGTGTTGTATCTACTTGATTCTT 57.275 29.630 0.00 0.00 36.65 2.52
192 193 9.979270 CATTGTGTTGTATCTACTTGATTCTTC 57.021 33.333 0.00 0.00 36.65 2.87
193 194 9.725019 ATTGTGTTGTATCTACTTGATTCTTCA 57.275 29.630 0.00 0.00 36.65 3.02
194 195 9.725019 TTGTGTTGTATCTACTTGATTCTTCAT 57.275 29.630 0.00 0.00 36.65 2.57
195 196 9.725019 TGTGTTGTATCTACTTGATTCTTCATT 57.275 29.630 0.00 0.00 36.65 2.57
245 246 9.719279 TTGTTAAAAATAAAAGTGTGTAGTCCG 57.281 29.630 0.00 0.00 0.00 4.79
246 247 9.107177 TGTTAAAAATAAAAGTGTGTAGTCCGA 57.893 29.630 0.00 0.00 0.00 4.55
249 250 6.737254 AAATAAAAGTGTGTAGTCCGATGG 57.263 37.500 0.00 0.00 0.00 3.51
250 251 2.094762 AAAGTGTGTAGTCCGATGGC 57.905 50.000 0.00 0.00 0.00 4.40
251 252 0.249398 AAGTGTGTAGTCCGATGGCC 59.751 55.000 0.00 0.00 0.00 5.36
252 253 1.153429 GTGTGTAGTCCGATGGCCC 60.153 63.158 0.00 0.00 0.00 5.80
253 254 1.610967 TGTGTAGTCCGATGGCCCA 60.611 57.895 0.00 0.00 0.00 5.36
254 255 1.144057 GTGTAGTCCGATGGCCCAG 59.856 63.158 0.00 0.00 0.00 4.45
255 256 2.109181 GTAGTCCGATGGCCCAGC 59.891 66.667 0.00 0.00 0.00 4.85
256 257 2.364973 TAGTCCGATGGCCCAGCA 60.365 61.111 0.00 0.00 0.00 4.41
257 258 1.992834 TAGTCCGATGGCCCAGCAA 60.993 57.895 0.00 0.00 0.00 3.91
258 259 1.971505 TAGTCCGATGGCCCAGCAAG 61.972 60.000 0.00 0.00 0.00 4.01
259 260 3.329889 TCCGATGGCCCAGCAAGT 61.330 61.111 0.00 0.00 0.00 3.16
260 261 2.361610 CCGATGGCCCAGCAAGTT 60.362 61.111 0.00 0.00 0.00 2.66
261 262 2.409870 CCGATGGCCCAGCAAGTTC 61.410 63.158 0.00 0.00 0.00 3.01
262 263 2.409870 CGATGGCCCAGCAAGTTCC 61.410 63.158 0.00 0.00 0.00 3.62
263 264 1.304381 GATGGCCCAGCAAGTTCCA 60.304 57.895 0.00 0.00 0.00 3.53
264 265 1.304713 ATGGCCCAGCAAGTTCCAG 60.305 57.895 0.00 0.00 0.00 3.86
265 266 2.677875 GGCCCAGCAAGTTCCAGG 60.678 66.667 0.00 0.00 0.00 4.45
266 267 2.677875 GCCCAGCAAGTTCCAGGG 60.678 66.667 0.00 0.00 42.55 4.45
267 268 3.170362 CCCAGCAAGTTCCAGGGA 58.830 61.111 0.00 0.00 42.25 4.20
268 269 1.460255 CCCAGCAAGTTCCAGGGAA 59.540 57.895 0.00 0.00 42.25 3.97
269 270 0.178964 CCCAGCAAGTTCCAGGGAAA 60.179 55.000 1.58 0.00 42.25 3.13
270 271 1.703411 CCAGCAAGTTCCAGGGAAAA 58.297 50.000 1.58 0.00 35.75 2.29
271 272 2.250924 CCAGCAAGTTCCAGGGAAAAT 58.749 47.619 1.58 0.00 35.75 1.82
272 273 2.028748 CCAGCAAGTTCCAGGGAAAATG 60.029 50.000 1.58 6.21 35.75 2.32
273 274 2.892852 CAGCAAGTTCCAGGGAAAATGA 59.107 45.455 14.95 0.00 35.75 2.57
274 275 3.057033 CAGCAAGTTCCAGGGAAAATGAG 60.057 47.826 14.95 5.99 35.75 2.90
275 276 3.157087 GCAAGTTCCAGGGAAAATGAGA 58.843 45.455 14.95 0.00 35.75 3.27
276 277 3.573967 GCAAGTTCCAGGGAAAATGAGAA 59.426 43.478 14.95 0.00 35.75 2.87
277 278 4.559502 GCAAGTTCCAGGGAAAATGAGAAC 60.560 45.833 14.95 0.00 35.75 3.01
278 279 3.767711 AGTTCCAGGGAAAATGAGAACC 58.232 45.455 1.58 0.00 35.36 3.62
279 280 2.826128 GTTCCAGGGAAAATGAGAACCC 59.174 50.000 1.58 0.00 42.36 4.11
289 290 3.650647 TGAGAACCCTCAATGGCAC 57.349 52.632 0.00 0.00 45.74 5.01
290 291 0.770499 TGAGAACCCTCAATGGCACA 59.230 50.000 0.00 0.00 45.74 4.57
291 292 1.144708 TGAGAACCCTCAATGGCACAA 59.855 47.619 0.00 0.00 45.74 3.33
292 293 2.238521 GAGAACCCTCAATGGCACAAA 58.761 47.619 0.00 0.00 39.96 2.83
293 294 2.229784 GAGAACCCTCAATGGCACAAAG 59.770 50.000 0.00 0.00 39.96 2.77
294 295 4.312677 GAGAACCCTCAATGGCACAAAGT 61.313 47.826 0.00 0.00 39.96 2.66
295 296 6.106185 GAGAACCCTCAATGGCACAAAGTC 62.106 50.000 0.00 0.00 39.96 3.01
306 307 5.086104 TGGCACAAAGTCTTATCTACTCC 57.914 43.478 0.00 0.00 31.92 3.85
307 308 4.530553 TGGCACAAAGTCTTATCTACTCCA 59.469 41.667 0.00 0.00 31.92 3.86
308 309 5.189736 TGGCACAAAGTCTTATCTACTCCAT 59.810 40.000 0.00 0.00 31.92 3.41
309 310 5.755861 GGCACAAAGTCTTATCTACTCCATC 59.244 44.000 0.00 0.00 0.00 3.51
310 311 5.755861 GCACAAAGTCTTATCTACTCCATCC 59.244 44.000 0.00 0.00 0.00 3.51
311 312 5.980116 CACAAAGTCTTATCTACTCCATCCG 59.020 44.000 0.00 0.00 0.00 4.18
312 313 5.657302 ACAAAGTCTTATCTACTCCATCCGT 59.343 40.000 0.00 0.00 0.00 4.69
313 314 6.154706 ACAAAGTCTTATCTACTCCATCCGTT 59.845 38.462 0.00 0.00 0.00 4.44
314 315 6.394025 AAGTCTTATCTACTCCATCCGTTC 57.606 41.667 0.00 0.00 0.00 3.95
315 316 4.828387 AGTCTTATCTACTCCATCCGTTCC 59.172 45.833 0.00 0.00 0.00 3.62
316 317 4.828387 GTCTTATCTACTCCATCCGTTCCT 59.172 45.833 0.00 0.00 0.00 3.36
317 318 6.002704 GTCTTATCTACTCCATCCGTTCCTA 58.997 44.000 0.00 0.00 0.00 2.94
318 319 6.489361 GTCTTATCTACTCCATCCGTTCCTAA 59.511 42.308 0.00 0.00 0.00 2.69
319 320 7.014038 GTCTTATCTACTCCATCCGTTCCTAAA 59.986 40.741 0.00 0.00 0.00 1.85
320 321 7.728981 TCTTATCTACTCCATCCGTTCCTAAAT 59.271 37.037 0.00 0.00 0.00 1.40
321 322 8.945195 TTATCTACTCCATCCGTTCCTAAATA 57.055 34.615 0.00 0.00 0.00 1.40
322 323 9.543231 TTATCTACTCCATCCGTTCCTAAATAT 57.457 33.333 0.00 0.00 0.00 1.28
323 324 7.850935 TCTACTCCATCCGTTCCTAAATATT 57.149 36.000 0.00 0.00 0.00 1.28
324 325 8.258850 TCTACTCCATCCGTTCCTAAATATTT 57.741 34.615 5.89 5.89 0.00 1.40
325 326 8.148351 TCTACTCCATCCGTTCCTAAATATTTG 58.852 37.037 11.05 1.40 0.00 2.32
326 327 6.659824 ACTCCATCCGTTCCTAAATATTTGT 58.340 36.000 11.05 0.00 0.00 2.83
327 328 6.766467 ACTCCATCCGTTCCTAAATATTTGTC 59.234 38.462 11.05 0.00 0.00 3.18
328 329 6.895782 TCCATCCGTTCCTAAATATTTGTCT 58.104 36.000 11.05 0.00 0.00 3.41
329 330 7.343357 TCCATCCGTTCCTAAATATTTGTCTT 58.657 34.615 11.05 0.00 0.00 3.01
330 331 7.832187 TCCATCCGTTCCTAAATATTTGTCTTT 59.168 33.333 11.05 0.00 0.00 2.52
331 332 8.129211 CCATCCGTTCCTAAATATTTGTCTTTC 58.871 37.037 11.05 0.00 0.00 2.62
332 333 8.893727 CATCCGTTCCTAAATATTTGTCTTTCT 58.106 33.333 11.05 0.00 0.00 2.52
334 335 9.595823 TCCGTTCCTAAATATTTGTCTTTCTAG 57.404 33.333 11.05 0.00 0.00 2.43
335 336 9.595823 CCGTTCCTAAATATTTGTCTTTCTAGA 57.404 33.333 11.05 0.00 0.00 2.43
348 349 8.964476 TTGTCTTTCTAGAGATTTCAACAAGT 57.036 30.769 0.00 0.00 0.00 3.16
349 350 8.370493 TGTCTTTCTAGAGATTTCAACAAGTG 57.630 34.615 0.00 0.00 0.00 3.16
350 351 8.204160 TGTCTTTCTAGAGATTTCAACAAGTGA 58.796 33.333 0.00 0.00 0.00 3.41
351 352 8.491950 GTCTTTCTAGAGATTTCAACAAGTGAC 58.508 37.037 0.00 0.00 35.39 3.67
352 353 8.424918 TCTTTCTAGAGATTTCAACAAGTGACT 58.575 33.333 0.00 0.00 35.39 3.41
353 354 9.698309 CTTTCTAGAGATTTCAACAAGTGACTA 57.302 33.333 0.00 0.00 35.39 2.59
354 355 9.477484 TTTCTAGAGATTTCAACAAGTGACTAC 57.523 33.333 0.00 0.00 35.39 2.73
355 356 8.178313 TCTAGAGATTTCAACAAGTGACTACA 57.822 34.615 0.00 0.00 35.39 2.74
356 357 8.807118 TCTAGAGATTTCAACAAGTGACTACAT 58.193 33.333 0.00 0.00 35.39 2.29
358 359 8.764524 AGAGATTTCAACAAGTGACTACATAC 57.235 34.615 0.00 0.00 35.39 2.39
359 360 7.542477 AGAGATTTCAACAAGTGACTACATACG 59.458 37.037 0.00 0.00 35.39 3.06
360 361 6.590292 AGATTTCAACAAGTGACTACATACGG 59.410 38.462 0.00 0.00 35.39 4.02
361 362 4.182693 TCAACAAGTGACTACATACGGG 57.817 45.455 0.00 0.00 0.00 5.28
362 363 3.056393 TCAACAAGTGACTACATACGGGG 60.056 47.826 0.00 0.00 0.00 5.73
363 364 1.206371 ACAAGTGACTACATACGGGGC 59.794 52.381 0.00 0.00 0.00 5.80
364 365 1.206132 CAAGTGACTACATACGGGGCA 59.794 52.381 0.00 0.00 0.00 5.36
365 366 1.563924 AGTGACTACATACGGGGCAA 58.436 50.000 0.00 0.00 0.00 4.52
366 367 1.903860 AGTGACTACATACGGGGCAAA 59.096 47.619 0.00 0.00 0.00 3.68
367 368 2.303600 AGTGACTACATACGGGGCAAAA 59.696 45.455 0.00 0.00 0.00 2.44
368 369 3.054655 AGTGACTACATACGGGGCAAAAT 60.055 43.478 0.00 0.00 0.00 1.82
369 370 3.064820 GTGACTACATACGGGGCAAAATG 59.935 47.826 0.00 0.00 0.00 2.32
370 371 3.055021 TGACTACATACGGGGCAAAATGA 60.055 43.478 0.00 0.00 0.00 2.57
371 372 3.942748 GACTACATACGGGGCAAAATGAA 59.057 43.478 0.00 0.00 0.00 2.57
372 373 4.532834 ACTACATACGGGGCAAAATGAAT 58.467 39.130 0.00 0.00 0.00 2.57
373 374 3.799281 ACATACGGGGCAAAATGAATG 57.201 42.857 0.00 0.00 0.00 2.67
374 375 3.360867 ACATACGGGGCAAAATGAATGA 58.639 40.909 0.00 0.00 0.00 2.57
375 376 3.766591 ACATACGGGGCAAAATGAATGAA 59.233 39.130 0.00 0.00 0.00 2.57
376 377 4.405358 ACATACGGGGCAAAATGAATGAAT 59.595 37.500 0.00 0.00 0.00 2.57
377 378 3.525268 ACGGGGCAAAATGAATGAATC 57.475 42.857 0.00 0.00 0.00 2.52
378 379 3.099141 ACGGGGCAAAATGAATGAATCT 58.901 40.909 0.00 0.00 0.00 2.40
379 380 4.277476 ACGGGGCAAAATGAATGAATCTA 58.723 39.130 0.00 0.00 0.00 1.98
380 381 4.097892 ACGGGGCAAAATGAATGAATCTAC 59.902 41.667 0.00 0.00 0.00 2.59
381 382 4.097741 CGGGGCAAAATGAATGAATCTACA 59.902 41.667 0.00 0.00 0.00 2.74
382 383 5.351458 GGGGCAAAATGAATGAATCTACAC 58.649 41.667 0.00 0.00 0.00 2.90
383 384 5.351458 GGGCAAAATGAATGAATCTACACC 58.649 41.667 0.00 0.00 0.00 4.16
384 385 5.351458 GGCAAAATGAATGAATCTACACCC 58.649 41.667 0.00 0.00 0.00 4.61
385 386 5.127682 GGCAAAATGAATGAATCTACACCCT 59.872 40.000 0.00 0.00 0.00 4.34
386 387 6.321181 GGCAAAATGAATGAATCTACACCCTA 59.679 38.462 0.00 0.00 0.00 3.53
387 388 7.147915 GGCAAAATGAATGAATCTACACCCTAA 60.148 37.037 0.00 0.00 0.00 2.69
388 389 8.250332 GCAAAATGAATGAATCTACACCCTAAA 58.750 33.333 0.00 0.00 0.00 1.85
406 407 9.490379 CACCCTAAAATAAGTCTACATACATCC 57.510 37.037 0.00 0.00 0.00 3.51
407 408 8.365647 ACCCTAAAATAAGTCTACATACATCCG 58.634 37.037 0.00 0.00 0.00 4.18
408 409 8.365647 CCCTAAAATAAGTCTACATACATCCGT 58.634 37.037 0.00 0.00 0.00 4.69
420 421 4.438148 CATACATCCGTATGTTGTGTCCA 58.562 43.478 0.00 0.00 46.70 4.02
421 422 3.627395 ACATCCGTATGTTGTGTCCAT 57.373 42.857 0.00 0.00 44.07 3.41
422 423 3.950397 ACATCCGTATGTTGTGTCCATT 58.050 40.909 0.00 0.00 44.07 3.16
423 424 4.331968 ACATCCGTATGTTGTGTCCATTT 58.668 39.130 0.00 0.00 44.07 2.32
424 425 4.155826 ACATCCGTATGTTGTGTCCATTTG 59.844 41.667 0.00 0.00 44.07 2.32
425 426 4.009370 TCCGTATGTTGTGTCCATTTGA 57.991 40.909 0.00 0.00 0.00 2.69
426 427 4.390264 TCCGTATGTTGTGTCCATTTGAA 58.610 39.130 0.00 0.00 0.00 2.69
427 428 4.822350 TCCGTATGTTGTGTCCATTTGAAA 59.178 37.500 0.00 0.00 0.00 2.69
428 429 5.475220 TCCGTATGTTGTGTCCATTTGAAAT 59.525 36.000 0.00 0.00 0.00 2.17
429 430 5.572511 CCGTATGTTGTGTCCATTTGAAATG 59.427 40.000 10.84 10.84 0.00 2.32
430 431 5.060816 CGTATGTTGTGTCCATTTGAAATGC 59.939 40.000 12.26 0.87 0.00 3.56
431 432 3.726607 TGTTGTGTCCATTTGAAATGCC 58.273 40.909 12.26 5.75 0.00 4.40
432 433 3.387374 TGTTGTGTCCATTTGAAATGCCT 59.613 39.130 12.26 0.00 0.00 4.75
433 434 4.586421 TGTTGTGTCCATTTGAAATGCCTA 59.414 37.500 12.26 0.00 0.00 3.93
434 435 5.163513 GTTGTGTCCATTTGAAATGCCTAG 58.836 41.667 12.26 0.00 0.00 3.02
435 436 4.661222 TGTGTCCATTTGAAATGCCTAGA 58.339 39.130 12.26 1.83 0.00 2.43
436 437 5.076182 TGTGTCCATTTGAAATGCCTAGAA 58.924 37.500 12.26 0.00 0.00 2.10
437 438 5.538053 TGTGTCCATTTGAAATGCCTAGAAA 59.462 36.000 12.26 0.00 0.00 2.52
438 439 6.095377 GTGTCCATTTGAAATGCCTAGAAAG 58.905 40.000 12.26 0.00 0.00 2.62
439 440 6.009589 TGTCCATTTGAAATGCCTAGAAAGA 58.990 36.000 12.26 0.00 0.00 2.52
440 441 6.071952 TGTCCATTTGAAATGCCTAGAAAGAC 60.072 38.462 12.26 11.27 0.00 3.01
441 442 6.009589 TCCATTTGAAATGCCTAGAAAGACA 58.990 36.000 12.26 0.00 0.00 3.41
442 443 6.493115 TCCATTTGAAATGCCTAGAAAGACAA 59.507 34.615 12.26 0.00 0.00 3.18
443 444 7.015098 TCCATTTGAAATGCCTAGAAAGACAAA 59.985 33.333 12.26 0.00 0.00 2.83
444 445 7.116805 CCATTTGAAATGCCTAGAAAGACAAAC 59.883 37.037 12.26 0.00 0.00 2.93
445 446 6.707440 TTGAAATGCCTAGAAAGACAAACA 57.293 33.333 0.00 0.00 0.00 2.83
446 447 6.899393 TGAAATGCCTAGAAAGACAAACAT 57.101 33.333 0.00 0.00 0.00 2.71
447 448 7.288810 TGAAATGCCTAGAAAGACAAACATT 57.711 32.000 0.00 0.00 0.00 2.71
448 449 7.725251 TGAAATGCCTAGAAAGACAAACATTT 58.275 30.769 0.00 0.00 38.72 2.32
449 450 7.867403 TGAAATGCCTAGAAAGACAAACATTTC 59.133 33.333 14.85 14.85 46.15 2.17
450 451 6.899393 ATGCCTAGAAAGACAAACATTTCA 57.101 33.333 0.00 0.00 37.78 2.69
451 452 6.317789 TGCCTAGAAAGACAAACATTTCAG 57.682 37.500 0.00 0.00 37.78 3.02
452 453 6.061441 TGCCTAGAAAGACAAACATTTCAGA 58.939 36.000 0.00 0.00 37.78 3.27
453 454 6.545666 TGCCTAGAAAGACAAACATTTCAGAA 59.454 34.615 0.00 0.00 37.78 3.02
454 455 6.858478 GCCTAGAAAGACAAACATTTCAGAAC 59.142 38.462 0.00 0.00 37.78 3.01
455 456 7.072030 CCTAGAAAGACAAACATTTCAGAACG 58.928 38.462 0.00 0.00 37.78 3.95
456 457 5.821204 AGAAAGACAAACATTTCAGAACGG 58.179 37.500 0.00 0.00 37.78 4.44
457 458 5.588648 AGAAAGACAAACATTTCAGAACGGA 59.411 36.000 0.00 0.00 37.78 4.69
458 459 5.424121 AAGACAAACATTTCAGAACGGAG 57.576 39.130 0.00 0.00 0.00 4.63
459 460 3.815401 AGACAAACATTTCAGAACGGAGG 59.185 43.478 0.00 0.00 0.00 4.30
460 461 2.884639 ACAAACATTTCAGAACGGAGGG 59.115 45.455 0.00 0.00 0.00 4.30
461 462 3.146066 CAAACATTTCAGAACGGAGGGA 58.854 45.455 0.00 0.00 0.00 4.20
462 463 2.770164 ACATTTCAGAACGGAGGGAG 57.230 50.000 0.00 0.00 0.00 4.30
463 464 1.978580 ACATTTCAGAACGGAGGGAGT 59.021 47.619 0.00 0.00 0.00 3.85
464 465 3.170717 ACATTTCAGAACGGAGGGAGTA 58.829 45.455 0.00 0.00 0.00 2.59
465 466 3.775316 ACATTTCAGAACGGAGGGAGTAT 59.225 43.478 0.00 0.00 0.00 2.12
466 467 4.141914 ACATTTCAGAACGGAGGGAGTATC 60.142 45.833 0.00 0.00 0.00 2.24
467 468 3.383698 TTCAGAACGGAGGGAGTATCT 57.616 47.619 0.00 0.00 33.73 1.98
468 469 3.383698 TCAGAACGGAGGGAGTATCTT 57.616 47.619 0.00 0.00 33.73 2.40
469 470 3.288964 TCAGAACGGAGGGAGTATCTTC 58.711 50.000 0.00 0.00 33.73 2.87
470 471 2.362717 CAGAACGGAGGGAGTATCTTCC 59.637 54.545 0.00 0.00 36.12 3.46
471 472 2.024273 AGAACGGAGGGAGTATCTTCCA 60.024 50.000 0.00 0.00 38.27 3.53
472 473 2.777459 ACGGAGGGAGTATCTTCCAT 57.223 50.000 0.00 0.00 38.27 3.41
473 474 3.047695 ACGGAGGGAGTATCTTCCATT 57.952 47.619 0.00 0.00 38.27 3.16
474 475 3.385115 ACGGAGGGAGTATCTTCCATTT 58.615 45.455 0.00 0.00 38.27 2.32
475 476 3.780850 ACGGAGGGAGTATCTTCCATTTT 59.219 43.478 0.00 0.00 38.27 1.82
476 477 4.141688 ACGGAGGGAGTATCTTCCATTTTC 60.142 45.833 0.00 0.00 38.27 2.29
477 478 4.101741 CGGAGGGAGTATCTTCCATTTTCT 59.898 45.833 0.00 0.00 38.27 2.52
478 479 5.372373 GGAGGGAGTATCTTCCATTTTCTG 58.628 45.833 0.00 0.00 38.26 3.02
479 480 5.372373 GAGGGAGTATCTTCCATTTTCTGG 58.628 45.833 0.00 0.00 40.31 3.86
493 494 6.428385 CATTTTCTGGAACTGGTGTCTATC 57.572 41.667 0.00 0.00 0.00 2.08
494 495 5.560722 TTTTCTGGAACTGGTGTCTATCA 57.439 39.130 0.00 0.00 0.00 2.15
495 496 5.560722 TTTCTGGAACTGGTGTCTATCAA 57.439 39.130 0.00 0.00 0.00 2.57
496 497 5.560722 TTCTGGAACTGGTGTCTATCAAA 57.439 39.130 0.00 0.00 0.00 2.69
497 498 5.560722 TCTGGAACTGGTGTCTATCAAAA 57.439 39.130 0.00 0.00 0.00 2.44
498 499 6.126863 TCTGGAACTGGTGTCTATCAAAAT 57.873 37.500 0.00 0.00 0.00 1.82
499 500 6.542821 TCTGGAACTGGTGTCTATCAAAATT 58.457 36.000 0.00 0.00 0.00 1.82
500 501 6.655003 TCTGGAACTGGTGTCTATCAAAATTC 59.345 38.462 0.00 0.00 0.00 2.17
501 502 6.303054 TGGAACTGGTGTCTATCAAAATTCA 58.697 36.000 0.00 0.00 0.00 2.57
502 503 6.947733 TGGAACTGGTGTCTATCAAAATTCAT 59.052 34.615 0.00 0.00 0.00 2.57
503 504 8.106462 TGGAACTGGTGTCTATCAAAATTCATA 58.894 33.333 0.00 0.00 0.00 2.15
504 505 9.125026 GGAACTGGTGTCTATCAAAATTCATAT 57.875 33.333 0.00 0.00 0.00 1.78
507 508 8.906867 ACTGGTGTCTATCAAAATTCATATTGG 58.093 33.333 0.00 0.00 0.00 3.16
508 509 9.123902 CTGGTGTCTATCAAAATTCATATTGGA 57.876 33.333 0.00 0.00 0.00 3.53
509 510 9.645128 TGGTGTCTATCAAAATTCATATTGGAT 57.355 29.630 0.00 0.00 0.00 3.41
522 523 9.745018 AATTCATATTGGATACTGGAATACTGG 57.255 33.333 0.00 0.00 37.61 4.00
523 524 8.504811 TTCATATTGGATACTGGAATACTGGA 57.495 34.615 0.00 0.00 37.61 3.86
524 525 8.685257 TCATATTGGATACTGGAATACTGGAT 57.315 34.615 0.00 0.00 37.61 3.41
525 526 9.782900 TCATATTGGATACTGGAATACTGGATA 57.217 33.333 0.00 0.00 37.61 2.59
526 527 9.823647 CATATTGGATACTGGAATACTGGATAC 57.176 37.037 0.00 0.00 37.61 2.24
527 528 7.872061 ATTGGATACTGGAATACTGGATACA 57.128 36.000 0.00 0.00 41.87 2.29
528 529 7.872061 TTGGATACTGGAATACTGGATACAT 57.128 36.000 0.00 0.00 43.10 2.29
529 530 7.872061 TGGATACTGGAATACTGGATACATT 57.128 36.000 0.00 0.00 43.10 2.71
530 531 8.275187 TGGATACTGGAATACTGGATACATTT 57.725 34.615 0.00 0.00 43.10 2.32
531 532 8.375506 TGGATACTGGAATACTGGATACATTTC 58.624 37.037 0.00 0.00 43.10 2.17
547 548 9.803315 GGATACATTTCTCAGTTTAATTTTCCC 57.197 33.333 0.00 0.00 0.00 3.97
548 549 9.803315 GATACATTTCTCAGTTTAATTTTCCCC 57.197 33.333 0.00 0.00 0.00 4.81
549 550 6.687604 ACATTTCTCAGTTTAATTTTCCCCG 58.312 36.000 0.00 0.00 0.00 5.73
550 551 6.492087 ACATTTCTCAGTTTAATTTTCCCCGA 59.508 34.615 0.00 0.00 0.00 5.14
551 552 6.569179 TTTCTCAGTTTAATTTTCCCCGAG 57.431 37.500 0.00 0.00 0.00 4.63
552 553 5.492855 TCTCAGTTTAATTTTCCCCGAGA 57.507 39.130 0.00 0.00 0.00 4.04
553 554 5.243207 TCTCAGTTTAATTTTCCCCGAGAC 58.757 41.667 0.00 0.00 0.00 3.36
554 555 3.998341 TCAGTTTAATTTTCCCCGAGACG 59.002 43.478 0.00 0.00 0.00 4.18
555 556 3.749609 CAGTTTAATTTTCCCCGAGACGT 59.250 43.478 0.00 0.00 0.00 4.34
556 557 4.931002 CAGTTTAATTTTCCCCGAGACGTA 59.069 41.667 0.00 0.00 0.00 3.57
557 558 5.409214 CAGTTTAATTTTCCCCGAGACGTAA 59.591 40.000 0.00 0.00 0.00 3.18
558 559 5.409520 AGTTTAATTTTCCCCGAGACGTAAC 59.590 40.000 0.00 0.00 0.00 2.50
559 560 3.405823 AATTTTCCCCGAGACGTAACA 57.594 42.857 0.00 0.00 0.00 2.41
560 561 3.622166 ATTTTCCCCGAGACGTAACAT 57.378 42.857 0.00 0.00 0.00 2.71
561 562 2.373540 TTTCCCCGAGACGTAACATG 57.626 50.000 0.00 0.00 0.00 3.21
562 563 1.259609 TTCCCCGAGACGTAACATGT 58.740 50.000 0.00 0.00 0.00 3.21
563 564 1.259609 TCCCCGAGACGTAACATGTT 58.740 50.000 16.68 16.68 0.00 2.71
564 565 1.619827 TCCCCGAGACGTAACATGTTT 59.380 47.619 17.78 0.00 0.00 2.83
565 566 1.997606 CCCCGAGACGTAACATGTTTC 59.002 52.381 17.78 10.94 0.00 2.78
566 567 2.610976 CCCCGAGACGTAACATGTTTCA 60.611 50.000 17.78 0.00 0.00 2.69
567 568 3.061322 CCCGAGACGTAACATGTTTCAA 58.939 45.455 17.78 0.00 0.00 2.69
568 569 3.122948 CCCGAGACGTAACATGTTTCAAG 59.877 47.826 17.78 4.55 0.00 3.02
569 570 3.985279 CCGAGACGTAACATGTTTCAAGA 59.015 43.478 17.78 0.00 0.00 3.02
570 571 4.446385 CCGAGACGTAACATGTTTCAAGAA 59.554 41.667 17.78 0.00 0.00 2.52
571 572 5.388475 CCGAGACGTAACATGTTTCAAGAAG 60.388 44.000 17.78 3.03 0.00 2.85
572 573 5.401376 CGAGACGTAACATGTTTCAAGAAGA 59.599 40.000 17.78 0.00 0.00 2.87
573 574 6.399039 CGAGACGTAACATGTTTCAAGAAGAG 60.399 42.308 17.78 0.00 0.00 2.85
574 575 6.513180 AGACGTAACATGTTTCAAGAAGAGA 58.487 36.000 17.78 0.00 0.00 3.10
575 576 6.984474 AGACGTAACATGTTTCAAGAAGAGAA 59.016 34.615 17.78 0.00 0.00 2.87
576 577 7.494625 AGACGTAACATGTTTCAAGAAGAGAAA 59.505 33.333 17.78 0.00 32.93 2.52
577 578 7.981142 ACGTAACATGTTTCAAGAAGAGAAAA 58.019 30.769 17.78 0.00 36.80 2.29
578 579 7.908601 ACGTAACATGTTTCAAGAAGAGAAAAC 59.091 33.333 17.78 2.43 36.80 2.43
579 580 7.908082 CGTAACATGTTTCAAGAAGAGAAAACA 59.092 33.333 17.78 2.42 36.80 2.83
580 581 9.226345 GTAACATGTTTCAAGAAGAGAAAACAG 57.774 33.333 17.78 1.96 36.80 3.16
581 582 7.396540 ACATGTTTCAAGAAGAGAAAACAGT 57.603 32.000 0.00 2.44 36.80 3.55
582 583 7.830739 ACATGTTTCAAGAAGAGAAAACAGTT 58.169 30.769 0.00 0.00 36.80 3.16
583 584 7.970614 ACATGTTTCAAGAAGAGAAAACAGTTC 59.029 33.333 0.00 0.00 36.80 3.01
584 585 6.542852 TGTTTCAAGAAGAGAAAACAGTTCG 58.457 36.000 0.00 0.00 36.80 3.95
585 586 5.734855 TTCAAGAAGAGAAAACAGTTCGG 57.265 39.130 0.00 0.00 0.00 4.30
586 587 3.560068 TCAAGAAGAGAAAACAGTTCGGC 59.440 43.478 0.00 0.00 0.00 5.54
587 588 2.495084 AGAAGAGAAAACAGTTCGGCC 58.505 47.619 0.00 0.00 0.00 6.13
588 589 1.535896 GAAGAGAAAACAGTTCGGCCC 59.464 52.381 0.00 0.00 0.00 5.80
589 590 0.472471 AGAGAAAACAGTTCGGCCCA 59.528 50.000 0.00 0.00 0.00 5.36
590 591 0.875059 GAGAAAACAGTTCGGCCCAG 59.125 55.000 0.00 0.00 0.00 4.45
591 592 0.472471 AGAAAACAGTTCGGCCCAGA 59.528 50.000 0.00 0.00 0.00 3.86
592 593 1.133915 AGAAAACAGTTCGGCCCAGAA 60.134 47.619 0.00 0.00 0.00 3.02
593 594 1.886542 GAAAACAGTTCGGCCCAGAAT 59.113 47.619 0.00 0.00 32.25 2.40
594 595 1.534729 AAACAGTTCGGCCCAGAATC 58.465 50.000 0.00 0.00 32.25 2.52
595 596 0.693049 AACAGTTCGGCCCAGAATCT 59.307 50.000 0.00 0.00 32.25 2.40
596 597 1.568504 ACAGTTCGGCCCAGAATCTA 58.431 50.000 0.00 0.00 32.25 1.98
597 598 1.906574 ACAGTTCGGCCCAGAATCTAA 59.093 47.619 0.00 0.00 32.25 2.10
598 599 2.505819 ACAGTTCGGCCCAGAATCTAAT 59.494 45.455 0.00 0.00 32.25 1.73
599 600 2.874701 CAGTTCGGCCCAGAATCTAATG 59.125 50.000 0.00 0.00 32.25 1.90
600 601 2.158755 AGTTCGGCCCAGAATCTAATGG 60.159 50.000 0.00 0.00 36.27 3.16
606 607 1.884235 CCAGAATCTAATGGGACGCC 58.116 55.000 0.00 0.00 32.63 5.68
607 608 1.417890 CCAGAATCTAATGGGACGCCT 59.582 52.381 0.00 0.00 32.63 5.52
608 609 2.487934 CAGAATCTAATGGGACGCCTG 58.512 52.381 0.00 0.00 0.00 4.85
609 610 2.119495 AGAATCTAATGGGACGCCTGT 58.881 47.619 0.00 0.00 0.00 4.00
610 611 2.103263 AGAATCTAATGGGACGCCTGTC 59.897 50.000 0.00 0.00 44.72 3.51
611 612 0.389391 ATCTAATGGGACGCCTGTCG 59.611 55.000 0.00 0.00 46.49 4.35
620 621 3.009140 CGCCTGTCGTGCATCATC 58.991 61.111 0.00 0.00 0.00 2.92
621 622 1.810853 CGCCTGTCGTGCATCATCA 60.811 57.895 0.00 0.00 0.00 3.07
622 623 1.156034 CGCCTGTCGTGCATCATCAT 61.156 55.000 0.00 0.00 0.00 2.45
623 624 0.306840 GCCTGTCGTGCATCATCATG 59.693 55.000 0.00 0.00 0.00 3.07
640 641 2.818714 GCACGATCTGCTGCTGCT 60.819 61.111 17.00 0.00 43.33 4.24
641 642 1.520120 GCACGATCTGCTGCTGCTA 60.520 57.895 17.00 5.45 43.33 3.49
642 643 1.086067 GCACGATCTGCTGCTGCTAA 61.086 55.000 17.00 5.10 43.33 3.09
643 644 0.928922 CACGATCTGCTGCTGCTAAG 59.071 55.000 17.00 6.85 40.48 2.18
655 656 2.971430 CTGCTAAGCTGCTGCATATG 57.029 50.000 18.42 0.00 42.74 1.78
656 657 2.219458 CTGCTAAGCTGCTGCATATGT 58.781 47.619 18.42 0.00 42.74 2.29
657 658 3.396560 CTGCTAAGCTGCTGCATATGTA 58.603 45.455 18.42 0.00 42.74 2.29
658 659 4.001652 CTGCTAAGCTGCTGCATATGTAT 58.998 43.478 18.42 0.00 42.74 2.29
659 660 3.999001 TGCTAAGCTGCTGCATATGTATC 59.001 43.478 18.42 0.00 42.74 2.24
660 661 3.373439 GCTAAGCTGCTGCATATGTATCC 59.627 47.826 18.42 0.00 42.74 2.59
661 662 3.497103 AAGCTGCTGCATATGTATCCA 57.503 42.857 18.42 0.00 42.74 3.41
662 663 2.775890 AGCTGCTGCATATGTATCCAC 58.224 47.619 18.42 0.00 42.74 4.02
663 664 2.371179 AGCTGCTGCATATGTATCCACT 59.629 45.455 18.42 0.00 42.74 4.00
664 665 3.580022 AGCTGCTGCATATGTATCCACTA 59.420 43.478 18.42 0.00 42.74 2.74
665 666 3.931468 GCTGCTGCATATGTATCCACTAG 59.069 47.826 11.11 0.00 39.41 2.57
666 667 3.930336 TGCTGCATATGTATCCACTAGC 58.070 45.455 0.00 0.00 0.00 3.42
667 668 3.580022 TGCTGCATATGTATCCACTAGCT 59.420 43.478 0.00 0.00 0.00 3.32
668 669 4.772100 TGCTGCATATGTATCCACTAGCTA 59.228 41.667 0.00 0.00 0.00 3.32
669 670 5.105595 TGCTGCATATGTATCCACTAGCTAG 60.106 44.000 19.44 19.44 0.00 3.42
670 671 5.330455 TGCATATGTATCCACTAGCTAGC 57.670 43.478 20.91 6.62 0.00 3.42
671 672 5.019470 TGCATATGTATCCACTAGCTAGCT 58.981 41.667 23.12 23.12 0.00 3.32
672 673 5.126222 TGCATATGTATCCACTAGCTAGCTC 59.874 44.000 23.26 4.53 0.00 4.09
673 674 5.731967 GCATATGTATCCACTAGCTAGCTCG 60.732 48.000 23.26 18.31 0.00 5.03
674 675 3.487120 TGTATCCACTAGCTAGCTCGA 57.513 47.619 23.26 12.97 0.00 4.04
675 676 3.403968 TGTATCCACTAGCTAGCTCGAG 58.596 50.000 23.26 16.84 0.00 4.04
676 677 2.940994 ATCCACTAGCTAGCTCGAGA 57.059 50.000 23.26 16.92 0.00 4.04
677 678 2.248280 TCCACTAGCTAGCTCGAGAG 57.752 55.000 23.26 15.65 0.00 3.20
678 679 1.763545 TCCACTAGCTAGCTCGAGAGA 59.236 52.381 23.26 13.18 39.12 3.10
679 680 2.170817 TCCACTAGCTAGCTCGAGAGAA 59.829 50.000 23.26 0.00 41.32 2.87
680 681 2.946329 CCACTAGCTAGCTCGAGAGAAA 59.054 50.000 23.26 0.00 41.32 2.52
681 682 3.378742 CCACTAGCTAGCTCGAGAGAAAA 59.621 47.826 23.26 0.00 41.32 2.29
682 683 4.497340 CCACTAGCTAGCTCGAGAGAAAAG 60.497 50.000 23.26 12.13 41.32 2.27
683 684 4.334203 CACTAGCTAGCTCGAGAGAAAAGA 59.666 45.833 23.26 0.00 41.32 2.52
684 685 4.944930 ACTAGCTAGCTCGAGAGAAAAGAA 59.055 41.667 23.26 0.00 41.32 2.52
685 686 4.370364 AGCTAGCTCGAGAGAAAAGAAG 57.630 45.455 18.75 1.83 41.32 2.85
686 687 4.013728 AGCTAGCTCGAGAGAAAAGAAGA 58.986 43.478 18.75 0.00 41.32 2.87
687 688 4.096382 AGCTAGCTCGAGAGAAAAGAAGAG 59.904 45.833 18.75 0.00 41.32 2.85
688 689 4.095782 GCTAGCTCGAGAGAAAAGAAGAGA 59.904 45.833 18.75 0.00 41.32 3.10
689 690 5.221048 GCTAGCTCGAGAGAAAAGAAGAGAT 60.221 44.000 18.75 0.00 41.32 2.75
690 691 4.997565 AGCTCGAGAGAAAAGAAGAGATG 58.002 43.478 18.75 0.00 41.32 2.90
691 692 3.551485 GCTCGAGAGAAAAGAAGAGATGC 59.449 47.826 18.75 0.00 41.32 3.91
692 693 4.742417 CTCGAGAGAAAAGAAGAGATGCA 58.258 43.478 6.58 0.00 41.32 3.96
693 694 5.336150 TCGAGAGAAAAGAAGAGATGCAT 57.664 39.130 0.00 0.00 37.03 3.96
694 695 5.347342 TCGAGAGAAAAGAAGAGATGCATC 58.653 41.667 19.37 19.37 37.03 3.91
695 696 5.105595 TCGAGAGAAAAGAAGAGATGCATCA 60.106 40.000 27.81 0.00 37.03 3.07
696 697 5.754406 CGAGAGAAAAGAAGAGATGCATCAT 59.246 40.000 27.81 13.63 0.00 2.45
697 698 6.292435 CGAGAGAAAAGAAGAGATGCATCATG 60.292 42.308 27.81 0.00 0.00 3.07
698 699 5.297278 AGAGAAAAGAAGAGATGCATCATGC 59.703 40.000 27.81 14.78 45.29 4.06
709 710 2.148916 GCATCATGCATGGTTCCATG 57.851 50.000 25.97 22.95 44.26 3.66
710 711 1.270094 GCATCATGCATGGTTCCATGG 60.270 52.381 25.97 4.97 44.26 3.66
711 712 1.045407 ATCATGCATGGTTCCATGGC 58.955 50.000 25.97 20.10 42.75 4.40
712 713 1.066752 CATGCATGGTTCCATGGCG 59.933 57.895 26.55 8.23 42.75 5.69
713 714 2.788640 ATGCATGGTTCCATGGCGC 61.789 57.895 26.55 16.42 42.75 6.53
714 715 4.211502 GCATGGTTCCATGGCGCC 62.212 66.667 26.55 22.73 42.75 6.53
715 716 3.530260 CATGGTTCCATGGCGCCC 61.530 66.667 26.77 6.80 39.87 6.13
716 717 4.839706 ATGGTTCCATGGCGCCCC 62.840 66.667 26.77 17.44 0.00 5.80
719 720 4.476752 GTTCCATGGCGCCCCGTA 62.477 66.667 26.77 4.98 0.00 4.02
720 721 4.476752 TTCCATGGCGCCCCGTAC 62.477 66.667 26.77 0.00 0.00 3.67
723 724 4.210093 CATGGCGCCCCGTACGTA 62.210 66.667 26.77 1.65 0.00 3.57
724 725 4.211502 ATGGCGCCCCGTACGTAC 62.212 66.667 26.77 15.90 0.00 3.67
734 735 2.173382 GTACGTACGTGCGACCGT 59.827 61.111 32.30 16.76 44.50 4.83
735 736 1.440353 GTACGTACGTGCGACCGTT 60.440 57.895 32.30 12.11 42.00 4.44
736 737 0.996727 GTACGTACGTGCGACCGTTT 60.997 55.000 32.30 11.35 42.00 3.60
737 738 0.724453 TACGTACGTGCGACCGTTTC 60.724 55.000 32.30 0.11 42.00 2.78
738 739 1.727022 CGTACGTGCGACCGTTTCT 60.727 57.895 21.98 0.00 42.00 2.52
739 740 1.270777 CGTACGTGCGACCGTTTCTT 61.271 55.000 21.98 0.00 42.00 2.52
740 741 0.160182 GTACGTGCGACCGTTTCTTG 59.840 55.000 0.00 0.00 42.00 3.02
741 742 0.940519 TACGTGCGACCGTTTCTTGG 60.941 55.000 0.00 0.00 42.00 3.61
742 743 2.241880 CGTGCGACCGTTTCTTGGT 61.242 57.895 0.00 0.00 44.10 3.67
749 750 2.150397 ACCGTTTCTTGGTCTCTTCG 57.850 50.000 0.00 0.00 33.35 3.79
750 751 0.790814 CCGTTTCTTGGTCTCTTCGC 59.209 55.000 0.00 0.00 0.00 4.70
751 752 1.497991 CGTTTCTTGGTCTCTTCGCA 58.502 50.000 0.00 0.00 0.00 5.10
752 753 1.457303 CGTTTCTTGGTCTCTTCGCAG 59.543 52.381 0.00 0.00 0.00 5.18
753 754 1.801178 GTTTCTTGGTCTCTTCGCAGG 59.199 52.381 0.00 0.00 0.00 4.85
754 755 0.321671 TTCTTGGTCTCTTCGCAGGG 59.678 55.000 0.00 0.00 0.00 4.45
755 756 0.832135 TCTTGGTCTCTTCGCAGGGT 60.832 55.000 0.00 0.00 0.00 4.34
756 757 0.035458 CTTGGTCTCTTCGCAGGGTT 59.965 55.000 0.00 0.00 0.00 4.11
757 758 1.275291 CTTGGTCTCTTCGCAGGGTTA 59.725 52.381 0.00 0.00 0.00 2.85
758 759 1.344065 TGGTCTCTTCGCAGGGTTAA 58.656 50.000 0.00 0.00 0.00 2.01
759 760 1.001633 TGGTCTCTTCGCAGGGTTAAC 59.998 52.381 0.00 0.00 0.00 2.01
760 761 1.275573 GGTCTCTTCGCAGGGTTAACT 59.724 52.381 5.42 0.00 0.00 2.24
761 762 2.289506 GGTCTCTTCGCAGGGTTAACTT 60.290 50.000 5.42 0.00 0.00 2.66
762 763 2.737252 GTCTCTTCGCAGGGTTAACTTG 59.263 50.000 5.42 5.98 0.00 3.16
763 764 2.367567 TCTCTTCGCAGGGTTAACTTGT 59.632 45.455 5.42 0.00 0.00 3.16
764 765 2.480419 CTCTTCGCAGGGTTAACTTGTG 59.520 50.000 5.42 10.92 0.00 3.33
765 766 2.103432 TCTTCGCAGGGTTAACTTGTGA 59.897 45.455 17.16 17.16 0.00 3.58
766 767 2.851263 TCGCAGGGTTAACTTGTGAT 57.149 45.000 17.16 0.00 0.00 3.06
767 768 2.422597 TCGCAGGGTTAACTTGTGATG 58.577 47.619 17.16 5.74 0.00 3.07
768 769 2.151202 CGCAGGGTTAACTTGTGATGT 58.849 47.619 14.81 0.00 0.00 3.06
769 770 2.552315 CGCAGGGTTAACTTGTGATGTT 59.448 45.455 14.81 0.00 0.00 2.71
770 771 3.749088 CGCAGGGTTAACTTGTGATGTTA 59.251 43.478 14.81 0.00 0.00 2.41
771 772 4.394920 CGCAGGGTTAACTTGTGATGTTAT 59.605 41.667 14.81 0.00 31.13 1.89
772 773 5.583061 CGCAGGGTTAACTTGTGATGTTATA 59.417 40.000 14.81 0.00 31.13 0.98
773 774 6.092944 CGCAGGGTTAACTTGTGATGTTATAA 59.907 38.462 14.81 0.00 31.13 0.98
774 775 7.472543 GCAGGGTTAACTTGTGATGTTATAAG 58.527 38.462 5.42 0.00 31.13 1.73
775 776 7.335924 GCAGGGTTAACTTGTGATGTTATAAGA 59.664 37.037 5.42 0.00 31.13 2.10
776 777 9.396022 CAGGGTTAACTTGTGATGTTATAAGAT 57.604 33.333 5.42 0.00 31.13 2.40
777 778 9.975218 AGGGTTAACTTGTGATGTTATAAGATT 57.025 29.630 5.42 0.00 31.13 2.40
783 784 7.978982 ACTTGTGATGTTATAAGATTCACTGC 58.021 34.615 17.66 0.77 0.00 4.40
784 785 6.925610 TGTGATGTTATAAGATTCACTGCC 57.074 37.500 17.66 0.26 0.00 4.85
785 786 5.523552 TGTGATGTTATAAGATTCACTGCCG 59.476 40.000 17.66 0.00 0.00 5.69
786 787 4.511454 TGATGTTATAAGATTCACTGCCGC 59.489 41.667 0.00 0.00 0.00 6.53
787 788 3.202906 TGTTATAAGATTCACTGCCGCC 58.797 45.455 0.00 0.00 0.00 6.13
788 789 3.118408 TGTTATAAGATTCACTGCCGCCT 60.118 43.478 0.00 0.00 0.00 5.52
789 790 4.100344 TGTTATAAGATTCACTGCCGCCTA 59.900 41.667 0.00 0.00 0.00 3.93
790 791 2.890808 TAAGATTCACTGCCGCCTAG 57.109 50.000 0.00 0.00 0.00 3.02
791 792 0.462759 AAGATTCACTGCCGCCTAGC 60.463 55.000 0.00 0.00 0.00 3.42
792 793 1.144936 GATTCACTGCCGCCTAGCT 59.855 57.895 0.00 0.00 0.00 3.32
793 794 0.389391 GATTCACTGCCGCCTAGCTA 59.611 55.000 0.00 0.00 0.00 3.32
794 795 0.105039 ATTCACTGCCGCCTAGCTAC 59.895 55.000 0.00 0.00 0.00 3.58
795 796 2.278857 CACTGCCGCCTAGCTACG 60.279 66.667 0.00 0.00 0.00 3.51
801 802 3.845259 CGCCTAGCTACGGGCCAA 61.845 66.667 16.22 0.00 45.01 4.52
802 803 2.203029 GCCTAGCTACGGGCCAAC 60.203 66.667 12.04 0.00 42.30 3.77
803 804 2.732619 GCCTAGCTACGGGCCAACT 61.733 63.158 12.04 0.00 42.30 3.16
804 805 1.397390 GCCTAGCTACGGGCCAACTA 61.397 60.000 12.04 0.00 42.30 2.24
805 806 0.388294 CCTAGCTACGGGCCAACTAC 59.612 60.000 4.39 0.00 43.05 2.73
806 807 1.400737 CTAGCTACGGGCCAACTACT 58.599 55.000 4.39 0.00 43.05 2.57
807 808 1.755380 CTAGCTACGGGCCAACTACTT 59.245 52.381 4.39 0.00 43.05 2.24
808 809 0.981943 AGCTACGGGCCAACTACTTT 59.018 50.000 4.39 0.00 43.05 2.66
809 810 2.181975 AGCTACGGGCCAACTACTTTA 58.818 47.619 4.39 0.00 43.05 1.85
810 811 2.770232 AGCTACGGGCCAACTACTTTAT 59.230 45.455 4.39 0.00 43.05 1.40
811 812 3.962718 AGCTACGGGCCAACTACTTTATA 59.037 43.478 4.39 0.00 43.05 0.98
812 813 4.038883 AGCTACGGGCCAACTACTTTATAG 59.961 45.833 4.39 0.00 43.05 1.31
813 814 3.189618 ACGGGCCAACTACTTTATAGC 57.810 47.619 4.39 0.00 0.00 2.97
814 815 2.502538 ACGGGCCAACTACTTTATAGCA 59.497 45.455 4.39 0.00 0.00 3.49
815 816 3.135895 ACGGGCCAACTACTTTATAGCAT 59.864 43.478 4.39 0.00 0.00 3.79
816 817 4.345837 ACGGGCCAACTACTTTATAGCATA 59.654 41.667 4.39 0.00 0.00 3.14
817 818 5.012768 ACGGGCCAACTACTTTATAGCATAT 59.987 40.000 4.39 0.00 0.00 1.78
818 819 6.211986 ACGGGCCAACTACTTTATAGCATATA 59.788 38.462 4.39 0.00 0.00 0.86
819 820 6.757010 CGGGCCAACTACTTTATAGCATATAG 59.243 42.308 4.39 0.00 0.00 1.31
820 821 7.363530 CGGGCCAACTACTTTATAGCATATAGA 60.364 40.741 4.39 0.00 0.00 1.98
821 822 8.487028 GGGCCAACTACTTTATAGCATATAGAT 58.513 37.037 4.39 0.00 0.00 1.98
822 823 9.892130 GGCCAACTACTTTATAGCATATAGATT 57.108 33.333 0.00 0.00 0.00 2.40
835 836 7.033530 AGCATATAGATTATACGAGTCTGCC 57.966 40.000 0.00 0.00 0.00 4.85
836 837 5.910166 GCATATAGATTATACGAGTCTGCCG 59.090 44.000 0.00 0.00 0.00 5.69
837 838 2.708386 AGATTATACGAGTCTGCCGC 57.292 50.000 0.00 0.00 0.00 6.53
838 839 1.269998 AGATTATACGAGTCTGCCGCC 59.730 52.381 0.00 0.00 0.00 6.13
839 840 1.269998 GATTATACGAGTCTGCCGCCT 59.730 52.381 0.00 0.00 0.00 5.52
840 841 1.971481 TTATACGAGTCTGCCGCCTA 58.029 50.000 0.00 0.00 0.00 3.93
841 842 1.520494 TATACGAGTCTGCCGCCTAG 58.480 55.000 0.00 0.00 0.00 3.02
842 843 1.797211 ATACGAGTCTGCCGCCTAGC 61.797 60.000 0.00 0.00 0.00 3.42
843 844 2.888464 TACGAGTCTGCCGCCTAGCT 62.888 60.000 0.00 0.00 0.00 3.32
844 845 2.187493 CGAGTCTGCCGCCTAGCTA 61.187 63.158 0.00 0.00 0.00 3.32
845 846 1.360911 GAGTCTGCCGCCTAGCTAC 59.639 63.158 0.00 0.00 0.00 3.58
846 847 1.076632 AGTCTGCCGCCTAGCTACT 60.077 57.895 0.00 0.00 0.00 2.57
847 848 1.066587 GTCTGCCGCCTAGCTACTG 59.933 63.158 0.00 0.00 0.00 2.74
848 849 2.127869 TCTGCCGCCTAGCTACTGG 61.128 63.158 0.00 0.00 0.00 4.00
849 850 3.798954 CTGCCGCCTAGCTACTGGC 62.799 68.421 12.89 12.89 45.91 4.85
864 865 6.713792 GCTACTGGCTGATAACTTTATAGC 57.286 41.667 0.00 0.00 38.06 2.97
865 866 6.459923 GCTACTGGCTGATAACTTTATAGCT 58.540 40.000 0.00 0.00 38.06 3.32
866 867 6.931840 GCTACTGGCTGATAACTTTATAGCTT 59.068 38.462 0.00 0.00 38.06 3.74
867 868 8.088981 GCTACTGGCTGATAACTTTATAGCTTA 58.911 37.037 0.00 0.00 38.06 3.09
881 882 9.367444 ACTTTATAGCTTATATACATCCGTTGC 57.633 33.333 0.00 0.00 0.00 4.17
882 883 8.712285 TTTATAGCTTATATACATCCGTTGCC 57.288 34.615 0.00 0.00 0.00 4.52
883 884 4.891992 AGCTTATATACATCCGTTGCCT 57.108 40.909 0.00 0.00 0.00 4.75
884 885 5.995565 AGCTTATATACATCCGTTGCCTA 57.004 39.130 0.00 0.00 0.00 3.93
885 886 6.546428 AGCTTATATACATCCGTTGCCTAT 57.454 37.500 0.00 0.00 0.00 2.57
886 887 7.655521 AGCTTATATACATCCGTTGCCTATA 57.344 36.000 0.00 0.00 0.00 1.31
887 888 8.074613 AGCTTATATACATCCGTTGCCTATAA 57.925 34.615 0.00 0.00 0.00 0.98
888 889 8.537016 AGCTTATATACATCCGTTGCCTATAAA 58.463 33.333 0.00 0.00 0.00 1.40
889 890 9.326413 GCTTATATACATCCGTTGCCTATAAAT 57.674 33.333 0.00 0.00 0.00 1.40
895 896 9.959721 ATACATCCGTTGCCTATAAATAAAGAT 57.040 29.630 0.00 0.00 0.00 2.40
896 897 8.099364 ACATCCGTTGCCTATAAATAAAGATG 57.901 34.615 0.00 0.00 0.00 2.90
897 898 6.554334 TCCGTTGCCTATAAATAAAGATGC 57.446 37.500 0.00 0.00 0.00 3.91
898 899 6.058833 TCCGTTGCCTATAAATAAAGATGCA 58.941 36.000 0.00 0.00 0.00 3.96
899 900 6.204688 TCCGTTGCCTATAAATAAAGATGCAG 59.795 38.462 0.00 0.00 0.00 4.41
900 901 6.017109 CCGTTGCCTATAAATAAAGATGCAGT 60.017 38.462 0.00 0.00 0.00 4.40
901 902 7.417612 CGTTGCCTATAAATAAAGATGCAGTT 58.582 34.615 0.00 0.00 0.00 3.16
902 903 7.915397 CGTTGCCTATAAATAAAGATGCAGTTT 59.085 33.333 0.00 0.00 0.00 2.66
903 904 9.023967 GTTGCCTATAAATAAAGATGCAGTTTG 57.976 33.333 7.01 0.00 0.00 2.93
904 905 7.202526 TGCCTATAAATAAAGATGCAGTTTGC 58.797 34.615 7.01 0.00 45.29 3.68
905 906 7.068593 TGCCTATAAATAAAGATGCAGTTTGCT 59.931 33.333 7.01 0.00 45.31 3.91
906 907 7.380602 GCCTATAAATAAAGATGCAGTTTGCTG 59.619 37.037 7.01 0.00 45.31 4.41
915 916 3.083213 CAGTTTGCTGCGCTTCTTC 57.917 52.632 9.73 0.00 35.77 2.87
916 917 0.590195 CAGTTTGCTGCGCTTCTTCT 59.410 50.000 9.73 0.00 35.77 2.85
917 918 1.002033 CAGTTTGCTGCGCTTCTTCTT 60.002 47.619 9.73 0.00 35.77 2.52
918 919 1.265365 AGTTTGCTGCGCTTCTTCTTC 59.735 47.619 9.73 0.00 0.00 2.87
919 920 1.002468 GTTTGCTGCGCTTCTTCTTCA 60.002 47.619 9.73 0.00 0.00 3.02
920 921 1.527034 TTGCTGCGCTTCTTCTTCAT 58.473 45.000 9.73 0.00 0.00 2.57
921 922 1.081892 TGCTGCGCTTCTTCTTCATC 58.918 50.000 9.73 0.00 0.00 2.92
922 923 0.376502 GCTGCGCTTCTTCTTCATCC 59.623 55.000 9.73 0.00 0.00 3.51
923 924 1.730501 CTGCGCTTCTTCTTCATCCA 58.269 50.000 9.73 0.00 0.00 3.41
924 925 2.286872 CTGCGCTTCTTCTTCATCCAT 58.713 47.619 9.73 0.00 0.00 3.41
925 926 2.283298 TGCGCTTCTTCTTCATCCATC 58.717 47.619 9.73 0.00 0.00 3.51
926 927 2.093288 TGCGCTTCTTCTTCATCCATCT 60.093 45.455 9.73 0.00 0.00 2.90
927 928 2.287373 GCGCTTCTTCTTCATCCATCTG 59.713 50.000 0.00 0.00 0.00 2.90
928 929 2.287373 CGCTTCTTCTTCATCCATCTGC 59.713 50.000 0.00 0.00 0.00 4.26
929 930 2.617774 GCTTCTTCTTCATCCATCTGCC 59.382 50.000 0.00 0.00 0.00 4.85
930 931 3.212685 CTTCTTCTTCATCCATCTGCCC 58.787 50.000 0.00 0.00 0.00 5.36
931 932 1.139654 TCTTCTTCATCCATCTGCCCG 59.860 52.381 0.00 0.00 0.00 6.13
932 933 0.911769 TTCTTCATCCATCTGCCCGT 59.088 50.000 0.00 0.00 0.00 5.28
933 934 0.911769 TCTTCATCCATCTGCCCGTT 59.088 50.000 0.00 0.00 0.00 4.44
934 935 2.115427 TCTTCATCCATCTGCCCGTTA 58.885 47.619 0.00 0.00 0.00 3.18
935 936 2.158957 TCTTCATCCATCTGCCCGTTAC 60.159 50.000 0.00 0.00 0.00 2.50
936 937 0.468226 TCATCCATCTGCCCGTTACC 59.532 55.000 0.00 0.00 0.00 2.85
937 938 0.180171 CATCCATCTGCCCGTTACCA 59.820 55.000 0.00 0.00 0.00 3.25
938 939 0.916086 ATCCATCTGCCCGTTACCAA 59.084 50.000 0.00 0.00 0.00 3.67
939 940 0.916086 TCCATCTGCCCGTTACCAAT 59.084 50.000 0.00 0.00 0.00 3.16
940 941 1.134220 TCCATCTGCCCGTTACCAATC 60.134 52.381 0.00 0.00 0.00 2.67
941 942 1.134098 CCATCTGCCCGTTACCAATCT 60.134 52.381 0.00 0.00 0.00 2.40
942 943 2.213499 CATCTGCCCGTTACCAATCTC 58.787 52.381 0.00 0.00 0.00 2.75
943 944 1.271856 TCTGCCCGTTACCAATCTCA 58.728 50.000 0.00 0.00 0.00 3.27
944 945 1.207089 TCTGCCCGTTACCAATCTCAG 59.793 52.381 0.00 0.00 0.00 3.35
945 946 0.392461 TGCCCGTTACCAATCTCAGC 60.392 55.000 0.00 0.00 0.00 4.26
946 947 0.107654 GCCCGTTACCAATCTCAGCT 60.108 55.000 0.00 0.00 0.00 4.24
947 948 1.679032 GCCCGTTACCAATCTCAGCTT 60.679 52.381 0.00 0.00 0.00 3.74
948 949 2.280628 CCCGTTACCAATCTCAGCTTC 58.719 52.381 0.00 0.00 0.00 3.86
949 950 2.093447 CCCGTTACCAATCTCAGCTTCT 60.093 50.000 0.00 0.00 0.00 2.85
950 951 3.600388 CCGTTACCAATCTCAGCTTCTT 58.400 45.455 0.00 0.00 0.00 2.52
951 952 3.619038 CCGTTACCAATCTCAGCTTCTTC 59.381 47.826 0.00 0.00 0.00 2.87
952 953 4.499183 CGTTACCAATCTCAGCTTCTTCT 58.501 43.478 0.00 0.00 0.00 2.85
953 954 4.932200 CGTTACCAATCTCAGCTTCTTCTT 59.068 41.667 0.00 0.00 0.00 2.52
954 955 5.062809 CGTTACCAATCTCAGCTTCTTCTTC 59.937 44.000 0.00 0.00 0.00 2.87
955 956 3.949132 ACCAATCTCAGCTTCTTCTTCC 58.051 45.455 0.00 0.00 0.00 3.46
956 957 3.586618 ACCAATCTCAGCTTCTTCTTCCT 59.413 43.478 0.00 0.00 0.00 3.36
957 958 4.042684 ACCAATCTCAGCTTCTTCTTCCTT 59.957 41.667 0.00 0.00 0.00 3.36
958 959 5.008980 CCAATCTCAGCTTCTTCTTCCTTT 58.991 41.667 0.00 0.00 0.00 3.11
959 960 5.476254 CCAATCTCAGCTTCTTCTTCCTTTT 59.524 40.000 0.00 0.00 0.00 2.27
960 961 6.380190 CAATCTCAGCTTCTTCTTCCTTTTG 58.620 40.000 0.00 0.00 0.00 2.44
961 962 5.041191 TCTCAGCTTCTTCTTCCTTTTGT 57.959 39.130 0.00 0.00 0.00 2.83
962 963 5.059833 TCTCAGCTTCTTCTTCCTTTTGTC 58.940 41.667 0.00 0.00 0.00 3.18
963 964 4.137543 TCAGCTTCTTCTTCCTTTTGTCC 58.862 43.478 0.00 0.00 0.00 4.02
964 965 3.885297 CAGCTTCTTCTTCCTTTTGTCCA 59.115 43.478 0.00 0.00 0.00 4.02
965 966 4.522022 CAGCTTCTTCTTCCTTTTGTCCAT 59.478 41.667 0.00 0.00 0.00 3.41
966 967 4.764308 AGCTTCTTCTTCCTTTTGTCCATC 59.236 41.667 0.00 0.00 0.00 3.51
967 968 4.764308 GCTTCTTCTTCCTTTTGTCCATCT 59.236 41.667 0.00 0.00 0.00 2.90
968 969 5.106357 GCTTCTTCTTCCTTTTGTCCATCTC 60.106 44.000 0.00 0.00 0.00 2.75
969 970 5.567037 TCTTCTTCCTTTTGTCCATCTCA 57.433 39.130 0.00 0.00 0.00 3.27
970 971 5.940617 TCTTCTTCCTTTTGTCCATCTCAA 58.059 37.500 0.00 0.00 0.00 3.02
971 972 5.765182 TCTTCTTCCTTTTGTCCATCTCAAC 59.235 40.000 0.00 0.00 0.00 3.18
972 973 5.310409 TCTTCCTTTTGTCCATCTCAACT 57.690 39.130 0.00 0.00 0.00 3.16
973 974 5.694995 TCTTCCTTTTGTCCATCTCAACTT 58.305 37.500 0.00 0.00 0.00 2.66
974 975 5.765182 TCTTCCTTTTGTCCATCTCAACTTC 59.235 40.000 0.00 0.00 0.00 3.01
975 976 5.310409 TCCTTTTGTCCATCTCAACTTCT 57.690 39.130 0.00 0.00 0.00 2.85
976 977 5.694995 TCCTTTTGTCCATCTCAACTTCTT 58.305 37.500 0.00 0.00 0.00 2.52
977 978 5.765182 TCCTTTTGTCCATCTCAACTTCTTC 59.235 40.000 0.00 0.00 0.00 2.87
978 979 5.767168 CCTTTTGTCCATCTCAACTTCTTCT 59.233 40.000 0.00 0.00 0.00 2.85
979 980 6.264067 CCTTTTGTCCATCTCAACTTCTTCTT 59.736 38.462 0.00 0.00 0.00 2.52
980 981 6.867662 TTTGTCCATCTCAACTTCTTCTTC 57.132 37.500 0.00 0.00 0.00 2.87
981 982 5.551305 TGTCCATCTCAACTTCTTCTTCA 57.449 39.130 0.00 0.00 0.00 3.02
982 983 6.119240 TGTCCATCTCAACTTCTTCTTCAT 57.881 37.500 0.00 0.00 0.00 2.57
983 984 6.537355 TGTCCATCTCAACTTCTTCTTCATT 58.463 36.000 0.00 0.00 0.00 2.57
984 985 6.429078 TGTCCATCTCAACTTCTTCTTCATTG 59.571 38.462 0.00 0.00 0.00 2.82
985 986 5.942236 TCCATCTCAACTTCTTCTTCATTGG 59.058 40.000 0.00 0.00 0.00 3.16
986 987 5.709164 CCATCTCAACTTCTTCTTCATTGGT 59.291 40.000 0.00 0.00 0.00 3.67
987 988 6.208204 CCATCTCAACTTCTTCTTCATTGGTT 59.792 38.462 0.00 0.00 0.00 3.67
988 989 7.391554 CCATCTCAACTTCTTCTTCATTGGTTA 59.608 37.037 0.00 0.00 0.00 2.85
989 990 7.969536 TCTCAACTTCTTCTTCATTGGTTAG 57.030 36.000 0.00 0.00 0.00 2.34
990 991 7.509546 TCTCAACTTCTTCTTCATTGGTTAGT 58.490 34.615 0.00 0.00 0.00 2.24
991 992 7.657761 TCTCAACTTCTTCTTCATTGGTTAGTC 59.342 37.037 0.00 0.00 0.00 2.59
992 993 7.279615 TCAACTTCTTCTTCATTGGTTAGTCA 58.720 34.615 0.00 0.00 0.00 3.41
993 994 7.939039 TCAACTTCTTCTTCATTGGTTAGTCAT 59.061 33.333 0.00 0.00 0.00 3.06
994 995 7.913674 ACTTCTTCTTCATTGGTTAGTCATC 57.086 36.000 0.00 0.00 0.00 2.92
995 996 7.453393 ACTTCTTCTTCATTGGTTAGTCATCA 58.547 34.615 0.00 0.00 0.00 3.07
996 997 7.939039 ACTTCTTCTTCATTGGTTAGTCATCAA 59.061 33.333 0.00 0.00 0.00 2.57
997 998 8.690203 TTCTTCTTCATTGGTTAGTCATCAAA 57.310 30.769 0.00 0.00 0.00 2.69
998 999 8.868522 TCTTCTTCATTGGTTAGTCATCAAAT 57.131 30.769 0.00 0.00 0.00 2.32
999 1000 8.733458 TCTTCTTCATTGGTTAGTCATCAAATG 58.267 33.333 0.00 0.00 0.00 2.32
1000 1001 8.634335 TTCTTCATTGGTTAGTCATCAAATGA 57.366 30.769 0.00 0.00 36.84 2.57
1001 1002 8.812513 TCTTCATTGGTTAGTCATCAAATGAT 57.187 30.769 0.00 0.00 42.04 2.45
1018 1019 9.856488 ATCAAATGATGAAGAGATTTGAGTTTG 57.144 29.630 0.00 0.00 44.89 2.93
1019 1020 9.070179 TCAAATGATGAAGAGATTTGAGTTTGA 57.930 29.630 0.00 0.00 39.84 2.69
1020 1021 9.343103 CAAATGATGAAGAGATTTGAGTTTGAG 57.657 33.333 0.00 0.00 38.72 3.02
1021 1022 6.492007 TGATGAAGAGATTTGAGTTTGAGC 57.508 37.500 0.00 0.00 0.00 4.26
1022 1023 4.997905 TGAAGAGATTTGAGTTTGAGCG 57.002 40.909 0.00 0.00 0.00 5.03
1023 1024 3.748048 TGAAGAGATTTGAGTTTGAGCGG 59.252 43.478 0.00 0.00 0.00 5.52
1024 1025 2.704572 AGAGATTTGAGTTTGAGCGGG 58.295 47.619 0.00 0.00 0.00 6.13
1025 1026 2.303022 AGAGATTTGAGTTTGAGCGGGA 59.697 45.455 0.00 0.00 0.00 5.14
1026 1027 2.675348 GAGATTTGAGTTTGAGCGGGAG 59.325 50.000 0.00 0.00 0.00 4.30
1027 1028 2.303022 AGATTTGAGTTTGAGCGGGAGA 59.697 45.455 0.00 0.00 0.00 3.71
1028 1029 2.859165 TTTGAGTTTGAGCGGGAGAT 57.141 45.000 0.00 0.00 0.00 2.75
1029 1030 2.099141 TTGAGTTTGAGCGGGAGATG 57.901 50.000 0.00 0.00 0.00 2.90
1030 1031 0.250234 TGAGTTTGAGCGGGAGATGG 59.750 55.000 0.00 0.00 0.00 3.51
1031 1032 1.078143 AGTTTGAGCGGGAGATGGC 60.078 57.895 0.00 0.00 0.00 4.40
1032 1033 2.125147 TTTGAGCGGGAGATGGCG 60.125 61.111 0.00 0.00 0.00 5.69
1033 1034 4.838152 TTGAGCGGGAGATGGCGC 62.838 66.667 0.00 0.00 0.00 6.53
1041 1042 2.202743 GAGATGGCGCGTGTGCTA 60.203 61.111 8.43 0.00 39.65 3.49
1042 1043 2.509336 AGATGGCGCGTGTGCTAC 60.509 61.111 8.43 0.00 39.65 3.58
1043 1044 2.509336 GATGGCGCGTGTGCTACT 60.509 61.111 8.43 0.00 39.65 2.57
1044 1045 2.802667 GATGGCGCGTGTGCTACTG 61.803 63.158 8.43 0.00 39.65 2.74
1054 1055 4.336581 TGCTACTGCACGTGTCAC 57.663 55.556 18.38 0.49 45.31 3.67
1055 1056 1.660264 TGCTACTGCACGTGTCACG 60.660 57.895 23.40 23.40 45.31 4.35
1064 1065 3.041940 CGTGTCACGGGAGCAACC 61.042 66.667 17.75 0.00 38.08 3.77
1073 1074 4.734652 GGAGCAACCGATTCCCAA 57.265 55.556 0.00 0.00 0.00 4.12
1074 1075 2.482326 GGAGCAACCGATTCCCAAG 58.518 57.895 0.00 0.00 0.00 3.61
1075 1076 1.657751 GGAGCAACCGATTCCCAAGC 61.658 60.000 0.00 0.00 0.00 4.01
1076 1077 1.657751 GAGCAACCGATTCCCAAGCC 61.658 60.000 0.00 0.00 0.00 4.35
1077 1078 3.051392 GCAACCGATTCCCAAGCCG 62.051 63.158 0.00 0.00 0.00 5.52
1078 1079 2.045340 AACCGATTCCCAAGCCGG 60.045 61.111 0.00 0.00 46.65 6.13
1079 1080 4.796495 ACCGATTCCCAAGCCGGC 62.796 66.667 21.89 21.89 45.29 6.13
1106 1107 4.953868 CGGTGACAACACGCCCGA 62.954 66.667 0.00 0.00 46.77 5.14
1107 1108 3.041940 GGTGACAACACGCCCGAG 61.042 66.667 0.00 0.00 46.77 4.63
1108 1109 3.712881 GTGACAACACGCCCGAGC 61.713 66.667 0.00 0.00 37.28 5.03
1125 1126 4.368808 CGGGCGTTCGTGTGCAAG 62.369 66.667 0.00 0.00 0.00 4.01
1126 1127 2.970324 GGGCGTTCGTGTGCAAGA 60.970 61.111 0.00 0.00 0.00 3.02
1127 1128 2.248431 GGCGTTCGTGTGCAAGAC 59.752 61.111 0.00 0.00 0.00 3.01
1211 1239 4.457466 AGGTTAGAGAGTAGCTAGTCTGC 58.543 47.826 31.31 21.98 36.18 4.26
1957 4940 3.776969 TGGTATCAGAGCCTTGTTGATCT 59.223 43.478 0.00 0.00 33.81 2.75
1958 4941 4.962362 TGGTATCAGAGCCTTGTTGATCTA 59.038 41.667 0.00 0.00 33.81 1.98
2621 7402 2.424246 TGATGTACCAGCATGCATGTTG 59.576 45.455 30.28 30.28 38.53 3.33
2622 7403 0.527113 TGTACCAGCATGCATGTTGC 59.473 50.000 31.42 20.85 45.29 4.17
2636 7417 4.446371 GCATGTTGCATAGGTTAGAGAGT 58.554 43.478 0.00 0.00 44.26 3.24
2637 7418 5.601662 GCATGTTGCATAGGTTAGAGAGTA 58.398 41.667 0.00 0.00 44.26 2.59
2638 7419 5.694006 GCATGTTGCATAGGTTAGAGAGTAG 59.306 44.000 0.00 0.00 44.26 2.57
2639 7420 5.263968 TGTTGCATAGGTTAGAGAGTAGC 57.736 43.478 0.00 0.00 0.00 3.58
2640 7421 4.956700 TGTTGCATAGGTTAGAGAGTAGCT 59.043 41.667 0.00 0.00 0.00 3.32
2641 7422 6.127101 TGTTGCATAGGTTAGAGAGTAGCTA 58.873 40.000 0.00 0.00 0.00 3.32
2642 7423 6.263392 TGTTGCATAGGTTAGAGAGTAGCTAG 59.737 42.308 0.00 0.00 0.00 3.42
2643 7424 5.942961 TGCATAGGTTAGAGAGTAGCTAGT 58.057 41.667 0.00 0.00 0.00 2.57
2644 7425 5.998981 TGCATAGGTTAGAGAGTAGCTAGTC 59.001 44.000 19.23 19.23 0.00 2.59
2645 7426 6.183361 TGCATAGGTTAGAGAGTAGCTAGTCT 60.183 42.308 27.60 27.60 38.64 3.24
2646 7427 6.148811 GCATAGGTTAGAGAGTAGCTAGTCTG 59.851 46.154 31.31 17.07 36.18 3.51
2647 7428 4.457466 AGGTTAGAGAGTAGCTAGTCTGC 58.543 47.826 31.31 21.98 36.18 4.26
2648 7429 4.165372 AGGTTAGAGAGTAGCTAGTCTGCT 59.835 45.833 31.31 26.22 46.11 4.24
2649 7430 4.274950 GGTTAGAGAGTAGCTAGTCTGCTG 59.725 50.000 31.31 0.00 43.87 4.41
2650 7431 3.924114 AGAGAGTAGCTAGTCTGCTGA 57.076 47.619 31.31 0.00 43.87 4.26
2651 7432 4.437682 AGAGAGTAGCTAGTCTGCTGAT 57.562 45.455 31.31 10.29 43.87 2.90
2652 7433 4.136796 AGAGAGTAGCTAGTCTGCTGATG 58.863 47.826 31.31 0.00 43.87 3.07
2653 7434 2.622942 AGAGTAGCTAGTCTGCTGATGC 59.377 50.000 26.87 0.56 43.87 3.91
2654 7435 2.622942 GAGTAGCTAGTCTGCTGATGCT 59.377 50.000 19.51 17.44 43.87 3.79
2655 7436 3.030291 AGTAGCTAGTCTGCTGATGCTT 58.970 45.455 18.12 5.02 43.87 3.91
2656 7437 2.600470 AGCTAGTCTGCTGATGCTTC 57.400 50.000 11.00 0.00 42.33 3.86
2657 7438 1.829849 AGCTAGTCTGCTGATGCTTCA 59.170 47.619 1.92 1.92 42.33 3.02
2679 7460 3.670311 CGGAGCTTCAATGAAGATGTG 57.330 47.619 25.54 10.54 38.45 3.21
2680 7461 3.005554 CGGAGCTTCAATGAAGATGTGT 58.994 45.455 25.54 4.79 38.45 3.72
2681 7462 3.181513 CGGAGCTTCAATGAAGATGTGTG 60.182 47.826 25.54 5.82 38.45 3.82
2682 7463 3.128242 GGAGCTTCAATGAAGATGTGTGG 59.872 47.826 25.54 0.00 38.45 4.17
2683 7464 4.005650 GAGCTTCAATGAAGATGTGTGGA 58.994 43.478 25.54 0.00 38.45 4.02
2684 7465 4.008330 AGCTTCAATGAAGATGTGTGGAG 58.992 43.478 25.54 0.00 41.71 3.86
2685 7466 4.005650 GCTTCAATGAAGATGTGTGGAGA 58.994 43.478 25.54 0.00 41.71 3.71
2686 7467 4.456911 GCTTCAATGAAGATGTGTGGAGAA 59.543 41.667 25.54 0.00 41.71 2.87
2687 7468 5.391736 GCTTCAATGAAGATGTGTGGAGAAG 60.392 44.000 25.54 0.00 41.71 2.85
2688 7469 4.582869 TCAATGAAGATGTGTGGAGAAGG 58.417 43.478 0.00 0.00 0.00 3.46
2689 7470 2.479566 TGAAGATGTGTGGAGAAGGC 57.520 50.000 0.00 0.00 0.00 4.35
2690 7471 1.338105 TGAAGATGTGTGGAGAAGGCG 60.338 52.381 0.00 0.00 0.00 5.52
2691 7472 0.976641 AAGATGTGTGGAGAAGGCGA 59.023 50.000 0.00 0.00 0.00 5.54
2692 7473 0.534412 AGATGTGTGGAGAAGGCGAG 59.466 55.000 0.00 0.00 0.00 5.03
2693 7474 0.532573 GATGTGTGGAGAAGGCGAGA 59.467 55.000 0.00 0.00 0.00 4.04
2694 7475 1.137872 GATGTGTGGAGAAGGCGAGAT 59.862 52.381 0.00 0.00 0.00 2.75
2695 7476 0.247460 TGTGTGGAGAAGGCGAGATG 59.753 55.000 0.00 0.00 0.00 2.90
2696 7477 1.086634 GTGTGGAGAAGGCGAGATGC 61.087 60.000 0.00 0.00 45.38 3.91
2713 7494 3.521605 CCAGACGGCCGTGAGATA 58.478 61.111 39.65 0.00 0.00 1.98
2714 7495 1.065928 CCAGACGGCCGTGAGATAC 59.934 63.158 39.65 20.67 0.00 2.24
2715 7496 1.065928 CAGACGGCCGTGAGATACC 59.934 63.158 39.65 19.83 0.00 2.73
2719 7500 3.896133 GGCCGTGAGATACCGCGA 61.896 66.667 8.23 0.00 42.05 5.87
2720 7501 2.353607 GCCGTGAGATACCGCGAG 60.354 66.667 8.23 0.00 42.05 5.03
2721 7502 3.108343 CCGTGAGATACCGCGAGT 58.892 61.111 8.23 6.57 42.05 4.18
2722 7503 1.009900 CCGTGAGATACCGCGAGTC 60.010 63.158 8.23 1.94 42.05 3.36
2723 7504 1.009900 CGTGAGATACCGCGAGTCC 60.010 63.158 8.23 0.00 42.05 3.85
2724 7505 1.009900 GTGAGATACCGCGAGTCCG 60.010 63.158 8.23 0.00 39.16 4.79
2781 7562 4.681978 GAGGCGGCAAGGTCGTGT 62.682 66.667 13.08 0.00 31.29 4.49
2782 7563 4.988598 AGGCGGCAAGGTCGTGTG 62.989 66.667 13.08 0.00 31.29 3.82
2783 7564 4.980805 GGCGGCAAGGTCGTGTGA 62.981 66.667 3.07 0.00 31.29 3.58
2784 7565 2.742372 GCGGCAAGGTCGTGTGAT 60.742 61.111 0.00 0.00 31.29 3.06
2785 7566 1.447140 GCGGCAAGGTCGTGTGATA 60.447 57.895 0.00 0.00 31.29 2.15
2786 7567 1.693083 GCGGCAAGGTCGTGTGATAC 61.693 60.000 0.00 0.00 31.29 2.24
2796 7577 4.253442 TGTGATACGGCACACACG 57.747 55.556 4.25 0.00 43.35 4.49
2797 7578 1.364536 TGTGATACGGCACACACGT 59.635 52.632 4.25 0.00 43.35 4.49
2802 7583 3.706287 TACGGCACACACGTAGATG 57.294 52.632 0.00 0.00 44.93 2.90
2803 7584 1.166989 TACGGCACACACGTAGATGA 58.833 50.000 0.00 0.00 44.93 2.92
2804 7585 0.388134 ACGGCACACACGTAGATGAC 60.388 55.000 0.00 0.00 43.60 3.06
2805 7586 0.109272 CGGCACACACGTAGATGACT 60.109 55.000 0.00 0.00 0.00 3.41
2806 7587 1.350193 GGCACACACGTAGATGACTG 58.650 55.000 0.00 0.00 0.00 3.51
2807 7588 1.067846 GGCACACACGTAGATGACTGA 60.068 52.381 0.00 0.00 0.00 3.41
2808 7589 2.609491 GGCACACACGTAGATGACTGAA 60.609 50.000 0.00 0.00 0.00 3.02
2809 7590 2.663602 GCACACACGTAGATGACTGAAG 59.336 50.000 0.00 0.00 0.00 3.02
2810 7591 2.663602 CACACACGTAGATGACTGAAGC 59.336 50.000 0.00 0.00 0.00 3.86
2811 7592 2.296190 ACACACGTAGATGACTGAAGCA 59.704 45.455 0.00 0.00 0.00 3.91
2812 7593 2.919859 CACACGTAGATGACTGAAGCAG 59.080 50.000 0.00 0.00 37.52 4.24
2813 7594 2.094494 ACACGTAGATGACTGAAGCAGG 60.094 50.000 0.00 0.00 35.51 4.85
2814 7595 2.164422 CACGTAGATGACTGAAGCAGGA 59.836 50.000 0.00 0.00 35.51 3.86
2815 7596 2.164624 ACGTAGATGACTGAAGCAGGAC 59.835 50.000 0.00 0.00 35.51 3.85
2816 7597 2.425312 CGTAGATGACTGAAGCAGGACT 59.575 50.000 0.00 0.00 35.51 3.85
2817 7598 3.733380 CGTAGATGACTGAAGCAGGACTG 60.733 52.174 0.00 0.00 35.51 3.51
2818 7599 1.554160 AGATGACTGAAGCAGGACTGG 59.446 52.381 1.01 0.00 35.51 4.00
2819 7600 0.035630 ATGACTGAAGCAGGACTGGC 60.036 55.000 1.01 0.00 35.51 4.85
2820 7601 1.376553 GACTGAAGCAGGACTGGCC 60.377 63.158 0.00 0.00 35.51 5.36
2821 7602 2.435586 CTGAAGCAGGACTGGCCG 60.436 66.667 0.00 0.00 43.43 6.13
2822 7603 3.965539 CTGAAGCAGGACTGGCCGG 62.966 68.421 11.02 11.02 43.43 6.13
2837 7618 2.967397 CGGCTGGACGGTGAGTTA 59.033 61.111 0.00 0.00 0.00 2.24
2838 7619 1.153823 CGGCTGGACGGTGAGTTAG 60.154 63.158 0.00 0.00 0.00 2.34
2839 7620 1.874345 CGGCTGGACGGTGAGTTAGT 61.874 60.000 0.00 0.00 0.00 2.24
2840 7621 0.320697 GGCTGGACGGTGAGTTAGTT 59.679 55.000 0.00 0.00 0.00 2.24
2841 7622 1.270678 GGCTGGACGGTGAGTTAGTTT 60.271 52.381 0.00 0.00 0.00 2.66
2842 7623 1.798813 GCTGGACGGTGAGTTAGTTTG 59.201 52.381 0.00 0.00 0.00 2.93
2843 7624 1.798813 CTGGACGGTGAGTTAGTTTGC 59.201 52.381 0.00 0.00 0.00 3.68
2844 7625 1.139256 TGGACGGTGAGTTAGTTTGCA 59.861 47.619 0.00 0.00 0.00 4.08
2845 7626 2.224426 TGGACGGTGAGTTAGTTTGCAT 60.224 45.455 0.00 0.00 0.00 3.96
2846 7627 2.159627 GGACGGTGAGTTAGTTTGCATG 59.840 50.000 0.00 0.00 0.00 4.06
2847 7628 3.064207 GACGGTGAGTTAGTTTGCATGA 58.936 45.455 0.00 0.00 0.00 3.07
2848 7629 3.472652 ACGGTGAGTTAGTTTGCATGAA 58.527 40.909 0.00 0.00 0.00 2.57
2849 7630 4.072131 ACGGTGAGTTAGTTTGCATGAAT 58.928 39.130 0.00 0.00 0.00 2.57
2850 7631 4.083324 ACGGTGAGTTAGTTTGCATGAATG 60.083 41.667 0.00 0.00 0.00 2.67
2851 7632 4.672542 CGGTGAGTTAGTTTGCATGAATGG 60.673 45.833 0.00 0.00 0.00 3.16
2852 7633 4.458989 GGTGAGTTAGTTTGCATGAATGGA 59.541 41.667 0.00 0.00 0.00 3.41
2853 7634 5.392380 GGTGAGTTAGTTTGCATGAATGGAG 60.392 44.000 0.00 0.00 0.00 3.86
2854 7635 5.182001 GTGAGTTAGTTTGCATGAATGGAGT 59.818 40.000 0.00 0.00 0.00 3.85
2855 7636 5.412594 TGAGTTAGTTTGCATGAATGGAGTC 59.587 40.000 0.00 0.00 0.00 3.36
2856 7637 4.393062 AGTTAGTTTGCATGAATGGAGTCG 59.607 41.667 0.00 0.00 0.00 4.18
2857 7638 2.783135 AGTTTGCATGAATGGAGTCGT 58.217 42.857 0.00 0.00 0.00 4.34
2858 7639 2.744202 AGTTTGCATGAATGGAGTCGTC 59.256 45.455 0.00 0.00 0.00 4.20
2873 7654 2.099263 AGTCGTCGTTAGCTGCATGTAT 59.901 45.455 1.02 0.00 0.00 2.29
2874 7655 2.216488 GTCGTCGTTAGCTGCATGTATG 59.784 50.000 1.02 0.00 0.00 2.39
2876 7657 1.867233 GTCGTTAGCTGCATGTATGGG 59.133 52.381 1.02 0.00 0.00 4.00
2877 7658 1.484653 TCGTTAGCTGCATGTATGGGT 59.515 47.619 1.02 0.00 0.00 4.51
2878 7659 2.093181 TCGTTAGCTGCATGTATGGGTT 60.093 45.455 1.02 0.00 0.00 4.11
2879 7660 2.032054 CGTTAGCTGCATGTATGGGTTG 59.968 50.000 1.02 0.00 0.00 3.77
2880 7661 2.346766 TAGCTGCATGTATGGGTTGG 57.653 50.000 1.02 0.00 0.00 3.77
2883 7664 2.025416 AGCTGCATGTATGGGTTGGTTA 60.025 45.455 1.02 0.00 0.00 2.85
2884 7665 2.358898 GCTGCATGTATGGGTTGGTTAG 59.641 50.000 0.00 0.00 0.00 2.34
2885 7666 3.620488 CTGCATGTATGGGTTGGTTAGT 58.380 45.455 0.00 0.00 0.00 2.24
2887 7668 2.687935 GCATGTATGGGTTGGTTAGTGG 59.312 50.000 0.00 0.00 0.00 4.00
2888 7669 3.287222 CATGTATGGGTTGGTTAGTGGG 58.713 50.000 0.00 0.00 0.00 4.61
2889 7670 1.004979 TGTATGGGTTGGTTAGTGGGC 59.995 52.381 0.00 0.00 0.00 5.36
2890 7671 1.283905 GTATGGGTTGGTTAGTGGGCT 59.716 52.381 0.00 0.00 0.00 5.19
2891 7672 1.676248 ATGGGTTGGTTAGTGGGCTA 58.324 50.000 0.00 0.00 0.00 3.93
2892 7673 0.988832 TGGGTTGGTTAGTGGGCTAG 59.011 55.000 0.00 0.00 0.00 3.42
2894 7675 0.618981 GGTTGGTTAGTGGGCTAGCT 59.381 55.000 15.72 0.00 0.00 3.32
2895 7676 1.835531 GGTTGGTTAGTGGGCTAGCTA 59.164 52.381 15.72 0.96 0.00 3.32
2896 7677 2.237893 GGTTGGTTAGTGGGCTAGCTAA 59.762 50.000 15.72 2.16 0.00 3.09
2897 7678 3.307904 GGTTGGTTAGTGGGCTAGCTAAA 60.308 47.826 15.72 0.00 32.63 1.85
2898 7679 4.329392 GTTGGTTAGTGGGCTAGCTAAAA 58.671 43.478 15.72 0.00 32.63 1.52
2899 7680 4.216411 TGGTTAGTGGGCTAGCTAAAAG 57.784 45.455 15.72 0.00 0.00 2.27
2900 7681 3.054655 TGGTTAGTGGGCTAGCTAAAAGG 60.055 47.826 15.72 0.00 0.00 3.11
2901 7682 3.054582 GGTTAGTGGGCTAGCTAAAAGGT 60.055 47.826 15.72 0.00 0.00 3.50
2902 7683 4.190001 GTTAGTGGGCTAGCTAAAAGGTC 58.810 47.826 15.72 0.00 0.00 3.85
2903 7684 1.207329 AGTGGGCTAGCTAAAAGGTCG 59.793 52.381 15.72 0.00 0.00 4.79
2904 7685 0.539986 TGGGCTAGCTAAAAGGTCGG 59.460 55.000 15.72 0.00 0.00 4.79
2905 7686 0.540454 GGGCTAGCTAAAAGGTCGGT 59.460 55.000 15.72 0.00 0.00 4.69
2906 7687 1.472904 GGGCTAGCTAAAAGGTCGGTC 60.473 57.143 15.72 0.00 0.00 4.79
2907 7688 1.206371 GGCTAGCTAAAAGGTCGGTCA 59.794 52.381 15.72 0.00 0.00 4.02
2908 7689 2.158943 GGCTAGCTAAAAGGTCGGTCAT 60.159 50.000 15.72 0.00 0.00 3.06
2909 7690 2.866762 GCTAGCTAAAAGGTCGGTCATG 59.133 50.000 7.70 0.00 0.00 3.07
2910 7691 3.679083 GCTAGCTAAAAGGTCGGTCATGT 60.679 47.826 7.70 0.00 0.00 3.21
2911 7692 4.441079 GCTAGCTAAAAGGTCGGTCATGTA 60.441 45.833 7.70 0.00 0.00 2.29
2912 7693 4.124851 AGCTAAAAGGTCGGTCATGTAG 57.875 45.455 0.00 0.00 0.00 2.74
2913 7694 2.608090 GCTAAAAGGTCGGTCATGTAGC 59.392 50.000 0.00 0.00 0.00 3.58
2914 7695 2.109425 AAAAGGTCGGTCATGTAGCC 57.891 50.000 0.00 0.00 0.00 3.93
2915 7696 0.981183 AAAGGTCGGTCATGTAGCCA 59.019 50.000 0.00 0.00 0.00 4.75
2916 7697 1.204146 AAGGTCGGTCATGTAGCCAT 58.796 50.000 0.00 0.00 0.00 4.40
2918 7699 1.160329 GGTCGGTCATGTAGCCATGC 61.160 60.000 0.00 0.00 46.64 4.06
2919 7700 0.461870 GTCGGTCATGTAGCCATGCA 60.462 55.000 0.00 0.00 46.64 3.96
2920 7701 0.469494 TCGGTCATGTAGCCATGCAT 59.531 50.000 0.00 0.00 46.64 3.96
2922 7703 0.313043 GGTCATGTAGCCATGCATGC 59.687 55.000 21.69 11.82 45.92 4.06
2923 7704 0.040692 GTCATGTAGCCATGCATGCG 60.041 55.000 21.69 15.04 45.92 4.73
2924 7705 0.464193 TCATGTAGCCATGCATGCGT 60.464 50.000 21.69 10.53 45.92 5.24
2925 7706 0.382873 CATGTAGCCATGCATGCGTT 59.617 50.000 21.69 14.24 41.66 4.84
2926 7707 0.382873 ATGTAGCCATGCATGCGTTG 59.617 50.000 21.69 11.53 29.69 4.10
2927 7708 0.676151 TGTAGCCATGCATGCGTTGA 60.676 50.000 21.69 1.55 0.00 3.18
2928 7709 0.028505 GTAGCCATGCATGCGTTGAG 59.971 55.000 21.69 7.57 0.00 3.02
2929 7710 0.392863 TAGCCATGCATGCGTTGAGT 60.393 50.000 21.69 9.77 0.00 3.41
2930 7711 1.226491 GCCATGCATGCGTTGAGTC 60.226 57.895 21.69 6.74 0.00 3.36
2931 7712 1.651240 GCCATGCATGCGTTGAGTCT 61.651 55.000 21.69 0.00 0.00 3.24
2932 7713 0.098200 CCATGCATGCGTTGAGTCTG 59.902 55.000 21.69 0.00 0.00 3.51
2933 7714 0.800631 CATGCATGCGTTGAGTCTGT 59.199 50.000 14.93 0.00 0.00 3.41
2934 7715 1.198408 CATGCATGCGTTGAGTCTGTT 59.802 47.619 14.93 0.00 0.00 3.16
2935 7716 1.308047 TGCATGCGTTGAGTCTGTTT 58.692 45.000 14.09 0.00 0.00 2.83
2936 7717 1.002576 TGCATGCGTTGAGTCTGTTTG 60.003 47.619 14.09 0.00 0.00 2.93
2937 7718 1.002468 GCATGCGTTGAGTCTGTTTGT 60.002 47.619 0.00 0.00 0.00 2.83
2938 7719 2.642995 CATGCGTTGAGTCTGTTTGTG 58.357 47.619 0.00 0.00 0.00 3.33
2939 7720 0.376852 TGCGTTGAGTCTGTTTGTGC 59.623 50.000 0.00 0.00 0.00 4.57
2940 7721 0.376852 GCGTTGAGTCTGTTTGTGCA 59.623 50.000 0.00 0.00 0.00 4.57
2941 7722 1.002468 GCGTTGAGTCTGTTTGTGCAT 60.002 47.619 0.00 0.00 0.00 3.96
2942 7723 2.642995 CGTTGAGTCTGTTTGTGCATG 58.357 47.619 0.00 0.00 0.00 4.06
2943 7724 2.287644 CGTTGAGTCTGTTTGTGCATGA 59.712 45.455 0.00 0.00 0.00 3.07
2944 7725 3.621794 GTTGAGTCTGTTTGTGCATGAC 58.378 45.455 0.00 0.00 0.00 3.06
2945 7726 2.221169 TGAGTCTGTTTGTGCATGACC 58.779 47.619 0.00 0.00 0.00 4.02
2946 7727 1.195448 GAGTCTGTTTGTGCATGACCG 59.805 52.381 0.00 0.00 0.00 4.79
2947 7728 1.202639 AGTCTGTTTGTGCATGACCGA 60.203 47.619 0.00 0.00 0.00 4.69
2948 7729 1.195448 GTCTGTTTGTGCATGACCGAG 59.805 52.381 0.00 0.00 0.00 4.63
2949 7730 1.202639 TCTGTTTGTGCATGACCGAGT 60.203 47.619 0.00 0.00 0.00 4.18
2950 7731 0.943673 TGTTTGTGCATGACCGAGTG 59.056 50.000 0.00 0.00 0.00 3.51
2951 7732 0.944386 GTTTGTGCATGACCGAGTGT 59.056 50.000 0.00 0.00 0.00 3.55
2952 7733 2.139917 GTTTGTGCATGACCGAGTGTA 58.860 47.619 0.00 0.00 0.00 2.90
2953 7734 2.078849 TTGTGCATGACCGAGTGTAG 57.921 50.000 0.00 0.00 0.00 2.74
2954 7735 0.246360 TGTGCATGACCGAGTGTAGG 59.754 55.000 0.00 0.00 0.00 3.18
2955 7736 0.246635 GTGCATGACCGAGTGTAGGT 59.753 55.000 0.00 0.00 46.16 3.08
2956 7737 0.973632 TGCATGACCGAGTGTAGGTT 59.026 50.000 0.00 0.00 43.01 3.50
2957 7738 2.094390 GTGCATGACCGAGTGTAGGTTA 60.094 50.000 0.00 0.00 43.01 2.85
2958 7739 2.165641 TGCATGACCGAGTGTAGGTTAG 59.834 50.000 0.00 0.00 43.01 2.34
2959 7740 2.165845 GCATGACCGAGTGTAGGTTAGT 59.834 50.000 0.00 0.00 43.01 2.24
2960 7741 3.368116 GCATGACCGAGTGTAGGTTAGTT 60.368 47.826 0.00 0.00 43.01 2.24
2961 7742 4.142315 GCATGACCGAGTGTAGGTTAGTTA 60.142 45.833 0.00 0.00 43.01 2.24
2962 7743 5.579718 CATGACCGAGTGTAGGTTAGTTAG 58.420 45.833 0.00 0.00 43.01 2.34
2963 7744 3.441572 TGACCGAGTGTAGGTTAGTTAGC 59.558 47.826 0.00 0.00 43.01 3.09
2964 7745 3.424703 ACCGAGTGTAGGTTAGTTAGCA 58.575 45.455 0.00 0.00 39.29 3.49
2965 7746 3.442977 ACCGAGTGTAGGTTAGTTAGCAG 59.557 47.826 0.00 0.00 39.29 4.24
2966 7747 3.181489 CCGAGTGTAGGTTAGTTAGCAGG 60.181 52.174 0.00 0.00 0.00 4.85
2967 7748 3.442977 CGAGTGTAGGTTAGTTAGCAGGT 59.557 47.826 0.00 0.00 0.00 4.00
2968 7749 4.674623 CGAGTGTAGGTTAGTTAGCAGGTG 60.675 50.000 0.00 0.00 0.00 4.00
2969 7750 4.413760 AGTGTAGGTTAGTTAGCAGGTGA 58.586 43.478 0.00 0.00 0.00 4.02
2970 7751 5.024118 AGTGTAGGTTAGTTAGCAGGTGAT 58.976 41.667 0.00 0.00 0.00 3.06
2971 7752 5.105310 AGTGTAGGTTAGTTAGCAGGTGATG 60.105 44.000 0.00 0.00 0.00 3.07
2990 7771 5.046448 GTGATGCATATCCTGGAGAGATTCT 60.046 44.000 0.00 0.00 32.09 2.40
2999 7780 4.722526 CTGGAGAGATTCTAGGAGGAGA 57.277 50.000 0.00 0.00 31.17 3.71
3000 7781 5.261040 CTGGAGAGATTCTAGGAGGAGAT 57.739 47.826 0.00 0.00 31.17 2.75
3001 7782 4.996793 TGGAGAGATTCTAGGAGGAGATG 58.003 47.826 0.00 0.00 0.00 2.90
3002 7783 4.202663 TGGAGAGATTCTAGGAGGAGATGG 60.203 50.000 0.00 0.00 0.00 3.51
3003 7784 4.202673 GGAGAGATTCTAGGAGGAGATGGT 60.203 50.000 0.00 0.00 0.00 3.55
3005 7786 4.169856 AGAGATTCTAGGAGGAGATGGTGT 59.830 45.833 0.00 0.00 0.00 4.16
3007 7788 6.031964 AGATTCTAGGAGGAGATGGTGTTA 57.968 41.667 0.00 0.00 0.00 2.41
3008 7789 6.629156 AGATTCTAGGAGGAGATGGTGTTAT 58.371 40.000 0.00 0.00 0.00 1.89
3010 7791 3.898123 TCTAGGAGGAGATGGTGTTATGC 59.102 47.826 0.00 0.00 0.00 3.14
3011 7792 1.771255 AGGAGGAGATGGTGTTATGCC 59.229 52.381 0.00 0.00 0.00 4.40
3012 7793 1.541233 GGAGGAGATGGTGTTATGCCG 60.541 57.143 0.00 0.00 0.00 5.69
3013 7794 1.412710 GAGGAGATGGTGTTATGCCGA 59.587 52.381 0.00 0.00 0.00 5.54
3014 7795 1.139058 AGGAGATGGTGTTATGCCGAC 59.861 52.381 0.00 0.00 0.00 4.79
3015 7796 1.209128 GAGATGGTGTTATGCCGACG 58.791 55.000 0.00 0.00 0.00 5.12
3016 7797 0.535335 AGATGGTGTTATGCCGACGT 59.465 50.000 0.00 0.00 0.00 4.34
3017 7798 0.650512 GATGGTGTTATGCCGACGTG 59.349 55.000 0.00 0.00 0.00 4.49
3020 7801 0.947180 GGTGTTATGCCGACGTGTGT 60.947 55.000 0.00 0.00 0.00 3.72
3021 7802 1.669502 GGTGTTATGCCGACGTGTGTA 60.670 52.381 0.00 0.00 0.00 2.90
3022 7803 1.652124 GTGTTATGCCGACGTGTGTAG 59.348 52.381 0.00 0.00 0.00 2.74
3032 7847 0.822164 ACGTGTGTAGGATAGTGGCC 59.178 55.000 0.00 0.00 0.00 5.36
3033 7848 0.248907 CGTGTGTAGGATAGTGGCCG 60.249 60.000 0.00 0.00 0.00 6.13
3034 7849 1.108776 GTGTGTAGGATAGTGGCCGA 58.891 55.000 0.00 0.00 0.00 5.54
3036 7851 2.102588 GTGTGTAGGATAGTGGCCGAAT 59.897 50.000 0.00 0.00 0.00 3.34
3037 7852 2.102420 TGTGTAGGATAGTGGCCGAATG 59.898 50.000 0.00 0.00 0.00 2.67
3038 7853 1.070134 TGTAGGATAGTGGCCGAATGC 59.930 52.381 0.00 0.00 40.16 3.56
3039 7854 0.317160 TAGGATAGTGGCCGAATGCG 59.683 55.000 0.00 0.00 42.61 4.73
3041 7856 1.222115 GGATAGTGGCCGAATGCGTC 61.222 60.000 0.00 0.00 42.61 5.19
3049 7864 3.554692 CGAATGCGTCGGTCAGCC 61.555 66.667 1.83 0.00 46.45 4.85
3050 7865 2.125512 GAATGCGTCGGTCAGCCT 60.126 61.111 0.00 0.00 0.00 4.58
3055 7870 2.991076 GCGTCGGTCAGCCTAGTGT 61.991 63.158 0.00 0.00 0.00 3.55
3056 7871 1.154016 CGTCGGTCAGCCTAGTGTG 60.154 63.158 0.00 0.00 0.00 3.82
3057 7872 1.863662 CGTCGGTCAGCCTAGTGTGT 61.864 60.000 0.00 0.00 0.00 3.72
3060 7875 1.738099 GGTCAGCCTAGTGTGTGCG 60.738 63.158 0.00 0.00 0.00 5.34
3061 7876 1.006102 GTCAGCCTAGTGTGTGCGT 60.006 57.895 0.00 0.00 0.00 5.24
3062 7877 1.006220 TCAGCCTAGTGTGTGCGTG 60.006 57.895 0.00 0.00 0.00 5.34
3063 7878 2.357517 AGCCTAGTGTGTGCGTGC 60.358 61.111 0.00 0.00 0.00 5.34
3064 7879 3.777925 GCCTAGTGTGTGCGTGCG 61.778 66.667 0.00 0.00 0.00 5.34
3065 7880 2.355837 CCTAGTGTGTGCGTGCGT 60.356 61.111 0.00 0.00 0.00 5.24
3066 7881 2.657757 CCTAGTGTGTGCGTGCGTG 61.658 63.158 0.00 0.00 0.00 5.34
3067 7882 1.660264 CTAGTGTGTGCGTGCGTGA 60.660 57.895 0.00 0.00 0.00 4.35
3068 7883 1.608966 CTAGTGTGTGCGTGCGTGAG 61.609 60.000 0.00 0.00 0.00 3.51
3069 7884 2.344521 TAGTGTGTGCGTGCGTGAGT 62.345 55.000 0.00 0.00 0.00 3.41
3072 7887 1.212455 TGTGTGCGTGCGTGAGTTAG 61.212 55.000 0.00 0.00 0.00 2.34
3073 7888 1.066752 TGTGCGTGCGTGAGTTAGT 59.933 52.632 0.00 0.00 0.00 2.24
3074 7889 1.212455 TGTGCGTGCGTGAGTTAGTG 61.212 55.000 0.00 0.00 0.00 2.74
3076 7891 3.011760 GCGTGCGTGAGTTAGTGGC 62.012 63.158 0.00 0.00 0.00 5.01
3077 7892 1.372997 CGTGCGTGAGTTAGTGGCT 60.373 57.895 0.00 0.00 0.00 4.75
3078 7893 1.617755 CGTGCGTGAGTTAGTGGCTG 61.618 60.000 0.00 0.00 0.00 4.85
3079 7894 1.005037 TGCGTGAGTTAGTGGCTGG 60.005 57.895 0.00 0.00 0.00 4.85
3081 7896 1.671742 CGTGAGTTAGTGGCTGGGT 59.328 57.895 0.00 0.00 0.00 4.51
3082 7897 0.670546 CGTGAGTTAGTGGCTGGGTG 60.671 60.000 0.00 0.00 0.00 4.61
3084 7899 0.396435 TGAGTTAGTGGCTGGGTGTG 59.604 55.000 0.00 0.00 0.00 3.82
3085 7900 0.685097 GAGTTAGTGGCTGGGTGTGA 59.315 55.000 0.00 0.00 0.00 3.58
3089 7904 0.685097 TAGTGGCTGGGTGTGAAGTC 59.315 55.000 0.00 0.00 0.00 3.01
3092 7907 0.478072 TGGCTGGGTGTGAAGTCATT 59.522 50.000 0.00 0.00 0.00 2.57
3093 7908 1.133513 TGGCTGGGTGTGAAGTCATTT 60.134 47.619 0.00 0.00 0.00 2.32
3094 7909 1.270550 GGCTGGGTGTGAAGTCATTTG 59.729 52.381 0.00 0.00 0.00 2.32
3095 7910 1.956477 GCTGGGTGTGAAGTCATTTGT 59.044 47.619 0.00 0.00 0.00 2.83
3097 7912 3.058224 GCTGGGTGTGAAGTCATTTGTAC 60.058 47.826 0.00 0.00 0.00 2.90
3098 7913 4.389374 CTGGGTGTGAAGTCATTTGTACT 58.611 43.478 0.00 0.00 0.00 2.73
3099 7914 4.133820 TGGGTGTGAAGTCATTTGTACTG 58.866 43.478 0.00 0.00 0.00 2.74
3100 7915 3.058224 GGGTGTGAAGTCATTTGTACTGC 60.058 47.826 0.00 0.00 0.00 4.40
3101 7916 3.058224 GGTGTGAAGTCATTTGTACTGCC 60.058 47.826 0.00 0.00 0.00 4.85
3102 7917 3.815401 GTGTGAAGTCATTTGTACTGCCT 59.185 43.478 0.00 0.00 0.00 4.75
3103 7918 4.994852 GTGTGAAGTCATTTGTACTGCCTA 59.005 41.667 0.00 0.00 0.00 3.93
3104 7919 5.643777 GTGTGAAGTCATTTGTACTGCCTAT 59.356 40.000 0.00 0.00 0.00 2.57
3105 7920 6.149474 GTGTGAAGTCATTTGTACTGCCTATT 59.851 38.462 0.00 0.00 0.00 1.73
3106 7921 6.714810 TGTGAAGTCATTTGTACTGCCTATTT 59.285 34.615 0.00 0.00 0.00 1.40
3107 7922 7.880713 TGTGAAGTCATTTGTACTGCCTATTTA 59.119 33.333 0.00 0.00 0.00 1.40
3108 7923 8.726988 GTGAAGTCATTTGTACTGCCTATTTAA 58.273 33.333 0.00 0.00 0.00 1.52
3109 7924 8.946085 TGAAGTCATTTGTACTGCCTATTTAAG 58.054 33.333 0.00 0.00 0.00 1.85
3110 7925 8.863872 AAGTCATTTGTACTGCCTATTTAAGT 57.136 30.769 0.00 0.00 0.00 2.24
3111 7926 8.863872 AGTCATTTGTACTGCCTATTTAAGTT 57.136 30.769 0.00 0.00 0.00 2.66
3112 7927 8.947115 AGTCATTTGTACTGCCTATTTAAGTTC 58.053 33.333 0.00 0.00 0.00 3.01
3113 7928 8.726988 GTCATTTGTACTGCCTATTTAAGTTCA 58.273 33.333 0.00 0.00 0.00 3.18
3114 7929 9.290988 TCATTTGTACTGCCTATTTAAGTTCAA 57.709 29.630 0.00 0.00 31.83 2.69
3115 7930 9.341899 CATTTGTACTGCCTATTTAAGTTCAAC 57.658 33.333 0.00 0.00 32.95 3.18
3116 7931 8.453238 TTTGTACTGCCTATTTAAGTTCAACA 57.547 30.769 0.00 0.00 32.95 3.33
3117 7932 8.453238 TTGTACTGCCTATTTAAGTTCAACAA 57.547 30.769 0.00 0.00 29.65 2.83
3118 7933 8.630054 TGTACTGCCTATTTAAGTTCAACAAT 57.370 30.769 0.00 0.00 0.00 2.71
3119 7934 9.073475 TGTACTGCCTATTTAAGTTCAACAATT 57.927 29.630 0.00 0.00 0.00 2.32
3120 7935 9.341899 GTACTGCCTATTTAAGTTCAACAATTG 57.658 33.333 3.24 3.24 0.00 2.32
3121 7936 8.177119 ACTGCCTATTTAAGTTCAACAATTGA 57.823 30.769 13.59 0.00 38.04 2.57
3122 7937 8.637986 ACTGCCTATTTAAGTTCAACAATTGAA 58.362 29.630 13.59 0.00 46.68 2.69
3138 7953 5.950549 ACAATTGAATGAGAATGAAGAGGCT 59.049 36.000 13.59 0.00 0.00 4.58
3285 8100 5.348986 GTGTAGTGTGTGTTCTTGAGAGAA 58.651 41.667 0.00 0.00 39.54 2.87
3325 8140 0.761187 AGTTGTGAGAGGCAGCTCAA 59.239 50.000 10.98 0.00 45.69 3.02
3327 8142 0.035881 TTGTGAGAGGCAGCTCAAGG 59.964 55.000 10.98 0.00 45.69 3.61
3328 8143 1.123861 TGTGAGAGGCAGCTCAAGGT 61.124 55.000 10.98 0.00 45.69 3.50
3329 8144 0.898320 GTGAGAGGCAGCTCAAGGTA 59.102 55.000 10.98 0.00 45.69 3.08
3340 8155 4.562552 GCAGCTCAAGGTAGAAGAAGAAGT 60.563 45.833 0.00 0.00 0.00 3.01
3344 8159 3.646162 TCAAGGTAGAAGAAGAAGTGGCA 59.354 43.478 0.00 0.00 0.00 4.92
3353 8168 2.031163 GAAGTGGCACTGCGAGGT 59.969 61.111 22.83 3.49 0.00 3.85
3374 8189 4.776647 GCGGCGCCAACATGTTCC 62.777 66.667 28.98 6.03 0.00 3.62
3375 8190 4.114997 CGGCGCCAACATGTTCCC 62.115 66.667 28.98 6.12 0.00 3.97
3376 8191 4.114997 GGCGCCAACATGTTCCCG 62.115 66.667 24.80 14.69 0.00 5.14
3377 8192 3.361977 GCGCCAACATGTTCCCGT 61.362 61.111 21.47 0.00 0.00 5.28
3378 8193 2.867472 CGCCAACATGTTCCCGTC 59.133 61.111 8.48 0.00 0.00 4.79
3379 8194 2.867472 GCCAACATGTTCCCGTCG 59.133 61.111 8.48 0.00 0.00 5.12
3380 8195 1.964373 GCCAACATGTTCCCGTCGT 60.964 57.895 8.48 0.00 0.00 4.34
3381 8196 1.512156 GCCAACATGTTCCCGTCGTT 61.512 55.000 8.48 0.00 0.00 3.85
3382 8197 0.515564 CCAACATGTTCCCGTCGTTC 59.484 55.000 8.48 0.00 0.00 3.95
3383 8198 0.515564 CAACATGTTCCCGTCGTTCC 59.484 55.000 8.48 0.00 0.00 3.62
3384 8199 0.107081 AACATGTTCCCGTCGTTCCA 59.893 50.000 4.92 0.00 0.00 3.53
3385 8200 0.320421 ACATGTTCCCGTCGTTCCAG 60.320 55.000 0.00 0.00 0.00 3.86
3386 8201 1.019278 CATGTTCCCGTCGTTCCAGG 61.019 60.000 0.00 0.00 0.00 4.45
3387 8202 2.741211 GTTCCCGTCGTTCCAGGC 60.741 66.667 0.00 0.00 0.00 4.85
3388 8203 4.367023 TTCCCGTCGTTCCAGGCG 62.367 66.667 0.00 0.00 0.00 5.52
3418 8233 4.093952 CGCGCCAGCCACAAGAAG 62.094 66.667 0.00 0.00 41.18 2.85
3419 8234 4.410743 GCGCCAGCCACAAGAAGC 62.411 66.667 0.00 0.00 37.42 3.86
3420 8235 3.741476 CGCCAGCCACAAGAAGCC 61.741 66.667 0.00 0.00 0.00 4.35
3421 8236 2.282745 GCCAGCCACAAGAAGCCT 60.283 61.111 0.00 0.00 0.00 4.58
3422 8237 2.338785 GCCAGCCACAAGAAGCCTC 61.339 63.158 0.00 0.00 0.00 4.70
3423 8238 2.037136 CCAGCCACAAGAAGCCTCG 61.037 63.158 0.00 0.00 0.00 4.63
3424 8239 2.037136 CAGCCACAAGAAGCCTCGG 61.037 63.158 0.00 0.00 0.00 4.63
3425 8240 3.435186 GCCACAAGAAGCCTCGGC 61.435 66.667 0.00 0.00 42.33 5.54
3455 8270 2.347490 GCGACCTCAAGCCCAAGA 59.653 61.111 0.00 0.00 0.00 3.02
3456 8271 1.078143 GCGACCTCAAGCCCAAGAT 60.078 57.895 0.00 0.00 0.00 2.40
3457 8272 1.372087 GCGACCTCAAGCCCAAGATG 61.372 60.000 0.00 0.00 0.00 2.90
3458 8273 1.372087 CGACCTCAAGCCCAAGATGC 61.372 60.000 0.00 0.00 0.00 3.91
3459 8274 0.322816 GACCTCAAGCCCAAGATGCA 60.323 55.000 0.00 0.00 0.00 3.96
3460 8275 0.333993 ACCTCAAGCCCAAGATGCAT 59.666 50.000 0.00 0.00 0.00 3.96
3461 8276 0.744874 CCTCAAGCCCAAGATGCATG 59.255 55.000 2.46 0.00 0.00 4.06
3462 8277 0.744874 CTCAAGCCCAAGATGCATGG 59.255 55.000 2.46 0.00 37.71 3.66
3463 8278 1.143183 CAAGCCCAAGATGCATGGC 59.857 57.895 16.09 16.09 44.35 4.40
3465 8280 2.812499 GCCCAAGATGCATGGCTG 59.188 61.111 16.47 5.58 40.77 4.85
3474 8289 3.200593 GCATGGCTGCTCCGTCTG 61.201 66.667 0.00 0.00 45.32 3.51
3475 8290 3.200593 CATGGCTGCTCCGTCTGC 61.201 66.667 0.00 0.00 37.80 4.26
3476 8291 3.709633 ATGGCTGCTCCGTCTGCA 61.710 61.111 0.00 0.00 37.80 4.41
3481 8296 4.074526 TGCTCCGTCTGCAGCCTC 62.075 66.667 9.47 0.96 35.31 4.70
3483 8298 3.443925 CTCCGTCTGCAGCCTCGA 61.444 66.667 20.86 9.08 0.00 4.04
3484 8299 3.408501 CTCCGTCTGCAGCCTCGAG 62.409 68.421 20.86 5.13 0.00 4.04
3485 8300 3.753434 CCGTCTGCAGCCTCGAGT 61.753 66.667 20.86 0.00 0.00 4.18
3486 8301 2.259818 CGTCTGCAGCCTCGAGTT 59.740 61.111 9.47 0.00 0.00 3.01
3487 8302 1.803519 CGTCTGCAGCCTCGAGTTC 60.804 63.158 9.47 2.61 0.00 3.01
3488 8303 1.803519 GTCTGCAGCCTCGAGTTCG 60.804 63.158 9.47 0.00 41.45 3.95
3489 8304 3.184683 CTGCAGCCTCGAGTTCGC 61.185 66.667 12.31 10.69 39.60 4.70
3490 8305 4.742201 TGCAGCCTCGAGTTCGCC 62.742 66.667 12.31 0.00 39.60 5.54
3492 8307 4.421479 CAGCCTCGAGTTCGCCGT 62.421 66.667 12.31 0.00 39.60 5.68
3493 8308 4.117661 AGCCTCGAGTTCGCCGTC 62.118 66.667 12.31 0.00 39.60 4.79
3495 8310 4.831307 CCTCGAGTTCGCCGTCGG 62.831 72.222 12.31 6.99 39.60 4.79
3517 8332 4.424566 GCGCTTGGTGGCCACATG 62.425 66.667 35.78 24.37 30.78 3.21
3518 8333 2.672651 CGCTTGGTGGCCACATGA 60.673 61.111 35.78 19.76 30.78 3.07
3519 8334 2.693762 CGCTTGGTGGCCACATGAG 61.694 63.158 35.78 27.61 30.78 2.90
3520 8335 2.345760 GCTTGGTGGCCACATGAGG 61.346 63.158 35.78 20.07 30.78 3.86
3527 8342 3.127533 GCCACATGAGGCGTCACC 61.128 66.667 18.70 0.00 46.12 4.02
3528 8343 2.815211 CCACATGAGGCGTCACCG 60.815 66.667 11.97 8.60 46.52 4.94
3529 8344 2.048222 CACATGAGGCGTCACCGT 60.048 61.111 11.97 9.26 46.52 4.83
3530 8345 2.048222 ACATGAGGCGTCACCGTG 60.048 61.111 11.97 9.01 46.52 4.94
3531 8346 3.490759 CATGAGGCGTCACCGTGC 61.491 66.667 11.97 0.00 46.52 5.34
3538 8353 3.049674 CGTCACCGTGCCATGCTT 61.050 61.111 0.00 0.00 0.00 3.91
3539 8354 2.562912 GTCACCGTGCCATGCTTG 59.437 61.111 0.00 0.00 0.00 4.01
3540 8355 3.364441 TCACCGTGCCATGCTTGC 61.364 61.111 0.00 0.00 0.00 4.01
3541 8356 3.672447 CACCGTGCCATGCTTGCA 61.672 61.111 0.00 0.00 36.12 4.08
3542 8357 3.367743 ACCGTGCCATGCTTGCAG 61.368 61.111 0.87 0.00 39.87 4.41
3543 8358 4.124351 CCGTGCCATGCTTGCAGG 62.124 66.667 7.80 7.80 42.58 4.85
3544 8359 3.057548 CGTGCCATGCTTGCAGGA 61.058 61.111 8.91 0.00 44.96 3.86
3545 8360 2.882876 GTGCCATGCTTGCAGGAG 59.117 61.111 8.91 0.00 39.87 3.69
3546 8361 2.361992 TGCCATGCTTGCAGGAGG 60.362 61.111 8.91 7.81 34.05 4.30
3547 8362 3.834799 GCCATGCTTGCAGGAGGC 61.835 66.667 16.50 16.50 45.13 4.70
3548 8363 3.145551 CCATGCTTGCAGGAGGCC 61.146 66.667 8.91 0.00 43.89 5.19
3549 8364 3.515286 CATGCTTGCAGGAGGCCG 61.515 66.667 0.00 0.00 43.89 6.13
3550 8365 4.039092 ATGCTTGCAGGAGGCCGT 62.039 61.111 0.00 0.00 43.89 5.68
3576 8391 3.712881 GACGTCACCGCCAGCAAC 61.713 66.667 11.55 0.00 37.70 4.17
3577 8392 4.539083 ACGTCACCGCCAGCAACA 62.539 61.111 0.00 0.00 37.70 3.33
3578 8393 3.276091 CGTCACCGCCAGCAACAA 61.276 61.111 0.00 0.00 0.00 2.83
3579 8394 2.331451 GTCACCGCCAGCAACAAC 59.669 61.111 0.00 0.00 0.00 3.32
3580 8395 2.186826 GTCACCGCCAGCAACAACT 61.187 57.895 0.00 0.00 0.00 3.16
3581 8396 0.882927 GTCACCGCCAGCAACAACTA 60.883 55.000 0.00 0.00 0.00 2.24
3582 8397 0.036164 TCACCGCCAGCAACAACTAT 59.964 50.000 0.00 0.00 0.00 2.12
3583 8398 0.447801 CACCGCCAGCAACAACTATC 59.552 55.000 0.00 0.00 0.00 2.08
3584 8399 0.036164 ACCGCCAGCAACAACTATCA 59.964 50.000 0.00 0.00 0.00 2.15
3585 8400 1.164411 CCGCCAGCAACAACTATCAA 58.836 50.000 0.00 0.00 0.00 2.57
3586 8401 1.135689 CCGCCAGCAACAACTATCAAC 60.136 52.381 0.00 0.00 0.00 3.18
3587 8402 1.535028 CGCCAGCAACAACTATCAACA 59.465 47.619 0.00 0.00 0.00 3.33
3588 8403 2.031245 CGCCAGCAACAACTATCAACAA 60.031 45.455 0.00 0.00 0.00 2.83
3589 8404 3.568538 GCCAGCAACAACTATCAACAAG 58.431 45.455 0.00 0.00 0.00 3.16
3590 8405 3.568538 CCAGCAACAACTATCAACAAGC 58.431 45.455 0.00 0.00 0.00 4.01
3591 8406 3.568538 CAGCAACAACTATCAACAAGCC 58.431 45.455 0.00 0.00 0.00 4.35
3592 8407 2.558359 AGCAACAACTATCAACAAGCCC 59.442 45.455 0.00 0.00 0.00 5.19
3593 8408 2.668279 GCAACAACTATCAACAAGCCCG 60.668 50.000 0.00 0.00 0.00 6.13
3594 8409 2.552315 CAACAACTATCAACAAGCCCGT 59.448 45.455 0.00 0.00 0.00 5.28
3595 8410 2.423577 ACAACTATCAACAAGCCCGTC 58.576 47.619 0.00 0.00 0.00 4.79
3596 8411 1.393539 CAACTATCAACAAGCCCGTCG 59.606 52.381 0.00 0.00 0.00 5.12
3597 8412 0.606604 ACTATCAACAAGCCCGTCGT 59.393 50.000 0.00 0.00 0.00 4.34
3598 8413 1.278238 CTATCAACAAGCCCGTCGTC 58.722 55.000 0.00 0.00 0.00 4.20
3599 8414 0.457166 TATCAACAAGCCCGTCGTCG 60.457 55.000 0.00 0.00 0.00 5.12
3610 8425 3.542742 GTCGTCGGTAGCAAGCGC 61.543 66.667 0.00 0.00 46.01 5.92
3613 8428 3.838795 GTCGGTAGCAAGCGCGTG 61.839 66.667 19.46 19.46 46.01 5.34
3628 8443 2.125753 GTGCTCTGGCTCGACCTG 60.126 66.667 5.77 5.42 40.22 4.00
3629 8444 2.283173 TGCTCTGGCTCGACCTGA 60.283 61.111 11.21 11.21 43.60 3.86
3630 8445 1.908299 TGCTCTGGCTCGACCTGAA 60.908 57.895 12.27 0.65 44.95 3.02
3631 8446 1.446966 GCTCTGGCTCGACCTGAAC 60.447 63.158 12.27 6.76 44.95 3.18
3632 8447 1.216710 CTCTGGCTCGACCTGAACC 59.783 63.158 12.27 0.00 44.95 3.62
3633 8448 1.533033 TCTGGCTCGACCTGAACCA 60.533 57.895 9.89 0.00 42.93 3.67
3634 8449 1.374758 CTGGCTCGACCTGAACCAC 60.375 63.158 5.77 0.00 37.92 4.16
3635 8450 2.047179 GGCTCGACCTGAACCACC 60.047 66.667 0.00 0.00 32.75 4.61
3636 8451 2.047179 GCTCGACCTGAACCACCC 60.047 66.667 0.00 0.00 0.00 4.61
3637 8452 2.584391 GCTCGACCTGAACCACCCT 61.584 63.158 0.00 0.00 0.00 4.34
3638 8453 1.592223 CTCGACCTGAACCACCCTC 59.408 63.158 0.00 0.00 0.00 4.30
3639 8454 1.889530 CTCGACCTGAACCACCCTCC 61.890 65.000 0.00 0.00 0.00 4.30
3640 8455 2.214216 CGACCTGAACCACCCTCCA 61.214 63.158 0.00 0.00 0.00 3.86
3641 8456 1.553690 CGACCTGAACCACCCTCCAT 61.554 60.000 0.00 0.00 0.00 3.41
3642 8457 0.035056 GACCTGAACCACCCTCCATG 60.035 60.000 0.00 0.00 0.00 3.66
3643 8458 1.379044 CCTGAACCACCCTCCATGC 60.379 63.158 0.00 0.00 0.00 4.06
3644 8459 1.746615 CTGAACCACCCTCCATGCG 60.747 63.158 0.00 0.00 0.00 4.73
3645 8460 2.184020 CTGAACCACCCTCCATGCGA 62.184 60.000 0.00 0.00 0.00 5.10
3646 8461 1.224592 GAACCACCCTCCATGCGAT 59.775 57.895 0.00 0.00 0.00 4.58
3647 8462 1.077501 AACCACCCTCCATGCGATG 60.078 57.895 0.00 0.00 0.00 3.84
3648 8463 1.561769 AACCACCCTCCATGCGATGA 61.562 55.000 0.00 0.00 0.00 2.92
3649 8464 1.348008 ACCACCCTCCATGCGATGAT 61.348 55.000 0.00 0.00 0.00 2.45
3650 8465 0.887836 CCACCCTCCATGCGATGATG 60.888 60.000 0.00 0.00 0.00 3.07
3651 8466 0.887836 CACCCTCCATGCGATGATGG 60.888 60.000 0.00 0.00 43.96 3.51
3652 8467 1.970114 CCCTCCATGCGATGATGGC 60.970 63.158 0.00 0.00 42.52 4.40
3653 8468 2.322830 CCTCCATGCGATGATGGCG 61.323 63.158 0.00 0.00 42.52 5.69
3654 8469 2.281002 TCCATGCGATGATGGCGG 60.281 61.111 0.00 0.00 42.52 6.13
3655 8470 3.359523 CCATGCGATGATGGCGGG 61.360 66.667 0.00 0.00 36.69 6.13
3656 8471 2.281002 CATGCGATGATGGCGGGA 60.281 61.111 0.00 0.00 0.00 5.14
3657 8472 2.031616 ATGCGATGATGGCGGGAG 59.968 61.111 0.00 0.00 0.00 4.30
3669 8484 3.531207 CGGGAGCATCGAGGCTGA 61.531 66.667 31.40 0.00 45.99 4.26
3670 8485 2.865598 CGGGAGCATCGAGGCTGAT 61.866 63.158 31.40 5.45 45.99 2.90
3671 8486 1.005156 GGGAGCATCGAGGCTGATC 60.005 63.158 31.40 15.37 45.99 2.92
3672 8487 1.744639 GGAGCATCGAGGCTGATCA 59.255 57.895 31.40 0.00 45.99 2.92
3673 8488 0.599728 GGAGCATCGAGGCTGATCAC 60.600 60.000 31.40 14.33 45.99 3.06
3674 8489 0.103755 GAGCATCGAGGCTGATCACA 59.896 55.000 31.40 0.00 45.99 3.58
3675 8490 0.104487 AGCATCGAGGCTGATCACAG 59.896 55.000 25.65 0.00 43.89 3.66
3693 8508 3.490759 CGAGTGCGGCCATGACAC 61.491 66.667 2.24 5.24 34.48 3.67
3694 8509 3.127533 GAGTGCGGCCATGACACC 61.128 66.667 2.24 0.00 34.83 4.16
3717 8532 4.360964 CGCCGGGTACACGTTCCA 62.361 66.667 17.68 0.00 0.00 3.53
3718 8533 2.739671 GCCGGGTACACGTTCCAC 60.740 66.667 17.68 0.00 0.00 4.02
3719 8534 2.047939 CCGGGTACACGTTCCACC 60.048 66.667 17.68 2.05 0.00 4.61
3720 8535 2.735883 CGGGTACACGTTCCACCA 59.264 61.111 9.99 0.00 33.78 4.17
3721 8536 1.373748 CGGGTACACGTTCCACCAG 60.374 63.158 9.99 4.50 33.78 4.00
3722 8537 1.750297 GGGTACACGTTCCACCAGT 59.250 57.895 11.08 0.00 33.78 4.00
3723 8538 0.107268 GGGTACACGTTCCACCAGTT 59.893 55.000 11.08 0.00 33.78 3.16
3724 8539 1.505425 GGTACACGTTCCACCAGTTC 58.495 55.000 5.34 0.00 32.32 3.01
3725 8540 1.505425 GTACACGTTCCACCAGTTCC 58.495 55.000 0.00 0.00 0.00 3.62
3726 8541 1.069668 GTACACGTTCCACCAGTTCCT 59.930 52.381 0.00 0.00 0.00 3.36
3727 8542 0.179056 ACACGTTCCACCAGTTCCTG 60.179 55.000 0.00 0.00 0.00 3.86
3736 8551 4.857251 CAGTTCCTGGATACCGGC 57.143 61.111 0.00 0.00 0.00 6.13
3737 8552 1.904771 CAGTTCCTGGATACCGGCA 59.095 57.895 0.00 0.00 0.00 5.69
3738 8553 0.469917 CAGTTCCTGGATACCGGCAT 59.530 55.000 0.00 0.00 0.00 4.40
3739 8554 1.134098 CAGTTCCTGGATACCGGCATT 60.134 52.381 0.00 0.00 0.00 3.56
3740 8555 1.564348 AGTTCCTGGATACCGGCATTT 59.436 47.619 0.00 0.00 0.00 2.32
3741 8556 1.947456 GTTCCTGGATACCGGCATTTC 59.053 52.381 0.00 0.00 0.00 2.17
3742 8557 1.507140 TCCTGGATACCGGCATTTCT 58.493 50.000 0.00 0.00 0.00 2.52
3743 8558 1.843851 TCCTGGATACCGGCATTTCTT 59.156 47.619 0.00 0.00 0.00 2.52
3744 8559 3.042682 TCCTGGATACCGGCATTTCTTA 58.957 45.455 0.00 0.00 0.00 2.10
3745 8560 3.071023 TCCTGGATACCGGCATTTCTTAG 59.929 47.826 0.00 0.00 0.00 2.18
3746 8561 3.071023 CCTGGATACCGGCATTTCTTAGA 59.929 47.826 0.00 0.00 0.00 2.10
3747 8562 4.058817 CTGGATACCGGCATTTCTTAGAC 58.941 47.826 0.00 0.00 0.00 2.59
3748 8563 3.709653 TGGATACCGGCATTTCTTAGACT 59.290 43.478 0.00 0.00 0.00 3.24
3749 8564 4.163458 TGGATACCGGCATTTCTTAGACTT 59.837 41.667 0.00 0.00 0.00 3.01
3750 8565 5.364446 TGGATACCGGCATTTCTTAGACTTA 59.636 40.000 0.00 0.00 0.00 2.24
3751 8566 6.042781 TGGATACCGGCATTTCTTAGACTTAT 59.957 38.462 0.00 0.00 0.00 1.73
3752 8567 7.233962 TGGATACCGGCATTTCTTAGACTTATA 59.766 37.037 0.00 0.00 0.00 0.98
3753 8568 7.544915 GGATACCGGCATTTCTTAGACTTATAC 59.455 40.741 0.00 0.00 0.00 1.47
3754 8569 6.229936 ACCGGCATTTCTTAGACTTATACA 57.770 37.500 0.00 0.00 0.00 2.29
3755 8570 6.281405 ACCGGCATTTCTTAGACTTATACAG 58.719 40.000 0.00 0.00 0.00 2.74
3756 8571 6.097839 ACCGGCATTTCTTAGACTTATACAGA 59.902 38.462 0.00 0.00 0.00 3.41
3757 8572 7.155328 CCGGCATTTCTTAGACTTATACAGAT 58.845 38.462 0.00 0.00 0.00 2.90
3758 8573 7.657761 CCGGCATTTCTTAGACTTATACAGATT 59.342 37.037 0.00 0.00 0.00 2.40
3759 8574 9.046296 CGGCATTTCTTAGACTTATACAGATTT 57.954 33.333 0.00 0.00 0.00 2.17
3796 8611 9.345517 CACAATAAACTCAATGTAACAGAATGG 57.654 33.333 0.00 0.00 43.62 3.16
3797 8612 9.295825 ACAATAAACTCAATGTAACAGAATGGA 57.704 29.630 0.00 0.00 43.62 3.41
3814 8629 9.193806 ACAGAATGGAATTTATATTGAGCTTGT 57.806 29.630 0.00 0.00 43.62 3.16
3815 8630 9.459640 CAGAATGGAATTTATATTGAGCTTGTG 57.540 33.333 0.00 0.00 36.07 3.33
3816 8631 8.636213 AGAATGGAATTTATATTGAGCTTGTGG 58.364 33.333 0.00 0.00 36.07 4.17
3817 8632 7.902920 ATGGAATTTATATTGAGCTTGTGGT 57.097 32.000 0.00 0.00 0.00 4.16
3818 8633 7.716799 TGGAATTTATATTGAGCTTGTGGTT 57.283 32.000 0.00 0.00 0.00 3.67
3819 8634 8.815565 TGGAATTTATATTGAGCTTGTGGTTA 57.184 30.769 0.00 0.00 0.00 2.85
3820 8635 9.249053 TGGAATTTATATTGAGCTTGTGGTTAA 57.751 29.630 0.00 0.00 0.00 2.01
3828 8643 5.957842 TGAGCTTGTGGTTAATAACTTGG 57.042 39.130 2.96 0.00 0.00 3.61
3829 8644 5.381757 TGAGCTTGTGGTTAATAACTTGGT 58.618 37.500 2.96 0.00 0.00 3.67
3830 8645 5.240623 TGAGCTTGTGGTTAATAACTTGGTG 59.759 40.000 2.96 0.00 0.00 4.17
3831 8646 4.022329 AGCTTGTGGTTAATAACTTGGTGC 60.022 41.667 2.96 3.64 0.00 5.01
3832 8647 4.022329 GCTTGTGGTTAATAACTTGGTGCT 60.022 41.667 2.96 0.00 0.00 4.40
3833 8648 5.699097 TTGTGGTTAATAACTTGGTGCTC 57.301 39.130 2.96 0.00 0.00 4.26
3834 8649 4.076394 TGTGGTTAATAACTTGGTGCTCC 58.924 43.478 2.96 0.00 0.00 4.70
3835 8650 4.076394 GTGGTTAATAACTTGGTGCTCCA 58.924 43.478 2.64 2.64 42.66 3.86
3836 8651 4.705023 GTGGTTAATAACTTGGTGCTCCAT 59.295 41.667 8.61 0.00 43.91 3.41
3837 8652 4.704540 TGGTTAATAACTTGGTGCTCCATG 59.295 41.667 16.70 16.70 43.91 3.66
3839 8654 5.883673 GGTTAATAACTTGGTGCTCCATGTA 59.116 40.000 22.26 13.20 46.73 2.29
3840 8655 6.376018 GGTTAATAACTTGGTGCTCCATGTAA 59.624 38.462 22.26 12.63 46.73 2.41
3841 8656 7.068226 GGTTAATAACTTGGTGCTCCATGTAAT 59.932 37.037 22.26 12.93 46.73 1.89
3842 8657 6.455360 AATAACTTGGTGCTCCATGTAATG 57.545 37.500 22.26 6.77 46.73 1.90
3843 8658 3.439857 ACTTGGTGCTCCATGTAATGT 57.560 42.857 21.06 6.45 45.97 2.71
3844 8659 3.766545 ACTTGGTGCTCCATGTAATGTT 58.233 40.909 21.06 0.04 45.97 2.71
3845 8660 3.507233 ACTTGGTGCTCCATGTAATGTTG 59.493 43.478 21.06 2.49 45.97 3.33
3846 8661 1.818060 TGGTGCTCCATGTAATGTTGC 59.182 47.619 2.64 0.00 44.81 4.17
3847 8662 1.818060 GGTGCTCCATGTAATGTTGCA 59.182 47.619 0.00 0.00 44.81 4.08
3848 8663 2.428171 GGTGCTCCATGTAATGTTGCAT 59.572 45.455 0.00 0.00 46.51 3.96
3849 8664 3.489738 GGTGCTCCATGTAATGTTGCATC 60.490 47.826 0.00 0.00 46.51 3.91
3850 8665 3.379372 GTGCTCCATGTAATGTTGCATCT 59.621 43.478 0.00 0.00 46.51 2.90
3851 8666 4.018490 TGCTCCATGTAATGTTGCATCTT 58.982 39.130 0.00 0.00 44.81 2.40
3852 8667 4.096833 TGCTCCATGTAATGTTGCATCTTC 59.903 41.667 0.00 0.00 44.81 2.87
3853 8668 4.337555 GCTCCATGTAATGTTGCATCTTCT 59.662 41.667 0.00 0.00 44.81 2.85
3854 8669 5.528690 GCTCCATGTAATGTTGCATCTTCTA 59.471 40.000 0.00 0.00 44.81 2.10
3855 8670 6.206243 GCTCCATGTAATGTTGCATCTTCTAT 59.794 38.462 0.00 0.00 44.81 1.98
3856 8671 7.255381 GCTCCATGTAATGTTGCATCTTCTATT 60.255 37.037 0.00 0.00 44.81 1.73
3857 8672 9.276590 CTCCATGTAATGTTGCATCTTCTATTA 57.723 33.333 0.00 0.00 44.81 0.98
3858 8673 9.797642 TCCATGTAATGTTGCATCTTCTATTAT 57.202 29.630 0.00 0.00 44.81 1.28
3859 8674 9.836076 CCATGTAATGTTGCATCTTCTATTATG 57.164 33.333 0.00 0.00 44.81 1.90
3866 8681 8.565896 TGTTGCATCTTCTATTATGTTTCTGT 57.434 30.769 0.00 0.00 0.00 3.41
3867 8682 9.013229 TGTTGCATCTTCTATTATGTTTCTGTT 57.987 29.630 0.00 0.00 0.00 3.16
3868 8683 9.495754 GTTGCATCTTCTATTATGTTTCTGTTC 57.504 33.333 0.00 0.00 0.00 3.18
3869 8684 9.453572 TTGCATCTTCTATTATGTTTCTGTTCT 57.546 29.630 0.00 0.00 0.00 3.01
3870 8685 9.453572 TGCATCTTCTATTATGTTTCTGTTCTT 57.546 29.630 0.00 0.00 0.00 2.52
3871 8686 9.928236 GCATCTTCTATTATGTTTCTGTTCTTC 57.072 33.333 0.00 0.00 0.00 2.87
3874 8689 9.436957 TCTTCTATTATGTTTCTGTTCTTCCAC 57.563 33.333 0.00 0.00 0.00 4.02
3875 8690 9.219603 CTTCTATTATGTTTCTGTTCTTCCACA 57.780 33.333 0.00 0.00 0.00 4.17
3876 8691 9.567776 TTCTATTATGTTTCTGTTCTTCCACAA 57.432 29.630 0.00 0.00 0.00 3.33
3877 8692 9.567776 TCTATTATGTTTCTGTTCTTCCACAAA 57.432 29.630 0.00 0.00 0.00 2.83
3881 8696 7.823745 ATGTTTCTGTTCTTCCACAAATACT 57.176 32.000 0.00 0.00 0.00 2.12
3882 8697 8.918202 ATGTTTCTGTTCTTCCACAAATACTA 57.082 30.769 0.00 0.00 0.00 1.82
3883 8698 8.378172 TGTTTCTGTTCTTCCACAAATACTAG 57.622 34.615 0.00 0.00 0.00 2.57
3884 8699 7.990886 TGTTTCTGTTCTTCCACAAATACTAGT 59.009 33.333 0.00 0.00 0.00 2.57
3885 8700 8.837389 GTTTCTGTTCTTCCACAAATACTAGTT 58.163 33.333 0.00 0.00 0.00 2.24
3886 8701 8.974060 TTCTGTTCTTCCACAAATACTAGTTT 57.026 30.769 0.00 0.00 0.00 2.66
3887 8702 8.378172 TCTGTTCTTCCACAAATACTAGTTTG 57.622 34.615 0.00 2.90 43.11 2.93
3888 8703 8.208224 TCTGTTCTTCCACAAATACTAGTTTGA 58.792 33.333 13.09 0.00 40.64 2.69
3889 8704 8.740123 TGTTCTTCCACAAATACTAGTTTGAA 57.260 30.769 13.09 0.00 40.64 2.69
3890 8705 9.179909 TGTTCTTCCACAAATACTAGTTTGAAA 57.820 29.630 13.09 4.99 40.64 2.69
3926 8741 3.708563 GCCAGTGCTCTGTTTGTAAAA 57.291 42.857 14.31 0.00 39.82 1.52
3927 8742 3.632189 GCCAGTGCTCTGTTTGTAAAAG 58.368 45.455 14.31 0.00 39.82 2.27
3928 8743 3.315191 GCCAGTGCTCTGTTTGTAAAAGA 59.685 43.478 14.31 0.00 39.82 2.52
3929 8744 4.202010 GCCAGTGCTCTGTTTGTAAAAGAA 60.202 41.667 14.31 0.00 39.82 2.52
3930 8745 5.678616 GCCAGTGCTCTGTTTGTAAAAGAAA 60.679 40.000 14.31 0.00 39.82 2.52
3931 8746 6.329496 CCAGTGCTCTGTTTGTAAAAGAAAA 58.671 36.000 14.31 0.00 39.82 2.29
3932 8747 6.811170 CCAGTGCTCTGTTTGTAAAAGAAAAA 59.189 34.615 14.31 0.00 39.82 1.94
3955 8770 7.940178 AAAATTACGCTTTAAGTCTTTTGGG 57.060 32.000 0.00 0.00 0.00 4.12
3956 8771 6.644248 AATTACGCTTTAAGTCTTTTGGGT 57.356 33.333 0.00 0.00 0.00 4.51
3957 8772 5.678132 TTACGCTTTAAGTCTTTTGGGTC 57.322 39.130 0.00 0.00 0.00 4.46
3958 8773 3.547746 ACGCTTTAAGTCTTTTGGGTCA 58.452 40.909 0.00 0.00 0.00 4.02
3959 8774 4.142038 ACGCTTTAAGTCTTTTGGGTCAT 58.858 39.130 0.00 0.00 0.00 3.06
3960 8775 4.583073 ACGCTTTAAGTCTTTTGGGTCATT 59.417 37.500 0.00 0.00 0.00 2.57
3961 8776 5.068591 ACGCTTTAAGTCTTTTGGGTCATTT 59.931 36.000 0.00 0.00 0.00 2.32
3962 8777 6.263617 ACGCTTTAAGTCTTTTGGGTCATTTA 59.736 34.615 0.00 0.00 0.00 1.40
3963 8778 7.039993 ACGCTTTAAGTCTTTTGGGTCATTTAT 60.040 33.333 0.00 0.00 0.00 1.40
3964 8779 7.812669 CGCTTTAAGTCTTTTGGGTCATTTATT 59.187 33.333 0.00 0.00 0.00 1.40
3965 8780 9.489084 GCTTTAAGTCTTTTGGGTCATTTATTT 57.511 29.630 0.00 0.00 0.00 1.40
3974 8789 4.906065 GGGTCATTTATTTTACCCCGAC 57.094 45.455 0.00 0.00 44.99 4.79
3975 8790 4.529897 GGGTCATTTATTTTACCCCGACT 58.470 43.478 0.00 0.00 44.99 4.18
3976 8791 5.683681 GGGTCATTTATTTTACCCCGACTA 58.316 41.667 0.00 0.00 44.99 2.59
3977 8792 5.761726 GGGTCATTTATTTTACCCCGACTAG 59.238 44.000 0.00 0.00 44.99 2.57
3978 8793 6.351711 GGTCATTTATTTTACCCCGACTAGT 58.648 40.000 0.00 0.00 0.00 2.57
3979 8794 7.418942 GGGTCATTTATTTTACCCCGACTAGTA 60.419 40.741 0.00 0.00 44.99 1.82
3980 8795 7.986889 GGTCATTTATTTTACCCCGACTAGTAA 59.013 37.037 0.00 0.00 0.00 2.24
3981 8796 9.382275 GTCATTTATTTTACCCCGACTAGTAAA 57.618 33.333 0.00 0.00 36.82 2.01
3985 8800 9.956640 TTTATTTTACCCCGACTAGTAAATTGA 57.043 29.630 0.00 0.00 38.04 2.57
3986 8801 9.956640 TTATTTTACCCCGACTAGTAAATTGAA 57.043 29.630 0.00 0.00 38.04 2.69
3987 8802 7.910441 TTTTACCCCGACTAGTAAATTGAAG 57.090 36.000 0.00 0.00 38.04 3.02
3988 8803 6.855763 TTACCCCGACTAGTAAATTGAAGA 57.144 37.500 0.00 0.00 0.00 2.87
3989 8804 5.750352 ACCCCGACTAGTAAATTGAAGAA 57.250 39.130 0.00 0.00 0.00 2.52
3990 8805 6.117975 ACCCCGACTAGTAAATTGAAGAAA 57.882 37.500 0.00 0.00 0.00 2.52
3991 8806 6.718294 ACCCCGACTAGTAAATTGAAGAAAT 58.282 36.000 0.00 0.00 0.00 2.17
3992 8807 7.854337 ACCCCGACTAGTAAATTGAAGAAATA 58.146 34.615 0.00 0.00 0.00 1.40
3993 8808 8.491958 ACCCCGACTAGTAAATTGAAGAAATAT 58.508 33.333 0.00 0.00 0.00 1.28
3994 8809 8.774586 CCCCGACTAGTAAATTGAAGAAATATG 58.225 37.037 0.00 0.00 0.00 1.78
3995 8810 8.283291 CCCGACTAGTAAATTGAAGAAATATGC 58.717 37.037 0.00 0.00 0.00 3.14
3996 8811 8.826710 CCGACTAGTAAATTGAAGAAATATGCA 58.173 33.333 0.00 0.00 0.00 3.96
4021 8836 9.635632 CAAAAACTTATTGCATGTGTTTTACTG 57.364 29.630 15.52 10.40 39.10 2.74
4022 8837 9.593134 AAAAACTTATTGCATGTGTTTTACTGA 57.407 25.926 15.52 0.00 39.10 3.41
4023 8838 9.762933 AAAACTTATTGCATGTGTTTTACTGAT 57.237 25.926 14.36 0.00 38.52 2.90
4028 8843 9.715123 TTATTGCATGTGTTTTACTGATATTCG 57.285 29.630 0.00 0.00 0.00 3.34
4029 8844 6.976636 TGCATGTGTTTTACTGATATTCGA 57.023 33.333 0.00 0.00 0.00 3.71
4030 8845 7.371126 TGCATGTGTTTTACTGATATTCGAA 57.629 32.000 0.00 0.00 0.00 3.71
4031 8846 7.463544 TGCATGTGTTTTACTGATATTCGAAG 58.536 34.615 3.35 0.00 0.00 3.79
4032 8847 7.333174 TGCATGTGTTTTACTGATATTCGAAGA 59.667 33.333 3.35 0.00 0.00 2.87
4033 8848 8.175069 GCATGTGTTTTACTGATATTCGAAGAA 58.825 33.333 3.35 0.00 45.90 2.52
4041 8856 6.589830 ACTGATATTCGAAGAAATTCACCG 57.410 37.500 3.35 0.00 45.90 4.94
4042 8857 5.523916 ACTGATATTCGAAGAAATTCACCGG 59.476 40.000 3.35 0.00 45.90 5.28
4043 8858 5.424757 TGATATTCGAAGAAATTCACCGGT 58.575 37.500 0.00 0.00 45.90 5.28
4044 8859 6.575267 TGATATTCGAAGAAATTCACCGGTA 58.425 36.000 6.87 0.00 45.90 4.02
4045 8860 7.214381 TGATATTCGAAGAAATTCACCGGTAT 58.786 34.615 6.87 0.00 45.90 2.73
4046 8861 5.986004 ATTCGAAGAAATTCACCGGTATC 57.014 39.130 6.87 0.72 45.90 2.24
4047 8862 4.730949 TCGAAGAAATTCACCGGTATCT 57.269 40.909 6.87 3.35 0.00 1.98
4048 8863 5.840243 TCGAAGAAATTCACCGGTATCTA 57.160 39.130 6.87 0.00 0.00 1.98
4049 8864 6.211587 TCGAAGAAATTCACCGGTATCTAA 57.788 37.500 6.87 0.00 0.00 2.10
4050 8865 6.038356 TCGAAGAAATTCACCGGTATCTAAC 58.962 40.000 6.87 0.00 0.00 2.34
4051 8866 6.040878 CGAAGAAATTCACCGGTATCTAACT 58.959 40.000 6.87 0.19 0.00 2.24
4052 8867 6.534079 CGAAGAAATTCACCGGTATCTAACTT 59.466 38.462 6.87 9.78 0.00 2.66
4053 8868 7.464178 CGAAGAAATTCACCGGTATCTAACTTG 60.464 40.741 6.87 0.00 0.00 3.16
4054 8869 6.708285 AGAAATTCACCGGTATCTAACTTGT 58.292 36.000 6.87 0.00 0.00 3.16
4055 8870 6.817140 AGAAATTCACCGGTATCTAACTTGTC 59.183 38.462 6.87 0.00 0.00 3.18
4056 8871 5.934402 ATTCACCGGTATCTAACTTGTCT 57.066 39.130 6.87 0.00 0.00 3.41
4057 8872 7.414222 AATTCACCGGTATCTAACTTGTCTA 57.586 36.000 6.87 0.00 0.00 2.59
4058 8873 6.839124 TTCACCGGTATCTAACTTGTCTAA 57.161 37.500 6.87 0.00 0.00 2.10
4059 8874 7.414222 TTCACCGGTATCTAACTTGTCTAAT 57.586 36.000 6.87 0.00 0.00 1.73
4060 8875 7.414222 TCACCGGTATCTAACTTGTCTAATT 57.586 36.000 6.87 0.00 0.00 1.40
4061 8876 7.486647 TCACCGGTATCTAACTTGTCTAATTC 58.513 38.462 6.87 0.00 0.00 2.17
4062 8877 7.123098 TCACCGGTATCTAACTTGTCTAATTCA 59.877 37.037 6.87 0.00 0.00 2.57
4063 8878 7.222224 CACCGGTATCTAACTTGTCTAATTCAC 59.778 40.741 6.87 0.00 0.00 3.18
4064 8879 6.700520 CCGGTATCTAACTTGTCTAATTCACC 59.299 42.308 0.00 0.00 0.00 4.02
4065 8880 7.417570 CCGGTATCTAACTTGTCTAATTCACCT 60.418 40.741 0.00 0.00 0.00 4.00
4066 8881 7.435488 CGGTATCTAACTTGTCTAATTCACCTG 59.565 40.741 0.00 0.00 0.00 4.00
4067 8882 8.258708 GGTATCTAACTTGTCTAATTCACCTGT 58.741 37.037 0.00 0.00 0.00 4.00
4071 8886 9.485206 TCTAACTTGTCTAATTCACCTGTAAAC 57.515 33.333 0.00 0.00 0.00 2.01
4072 8887 7.506328 AACTTGTCTAATTCACCTGTAAACC 57.494 36.000 0.00 0.00 0.00 3.27
4073 8888 6.002082 ACTTGTCTAATTCACCTGTAAACCC 58.998 40.000 0.00 0.00 0.00 4.11
4074 8889 4.913784 TGTCTAATTCACCTGTAAACCCC 58.086 43.478 0.00 0.00 0.00 4.95
4075 8890 4.351407 TGTCTAATTCACCTGTAAACCCCA 59.649 41.667 0.00 0.00 0.00 4.96
4076 8891 5.163077 TGTCTAATTCACCTGTAAACCCCAA 60.163 40.000 0.00 0.00 0.00 4.12
4077 8892 5.771165 GTCTAATTCACCTGTAAACCCCAAA 59.229 40.000 0.00 0.00 0.00 3.28
4078 8893 6.436218 GTCTAATTCACCTGTAAACCCCAAAT 59.564 38.462 0.00 0.00 0.00 2.32
4079 8894 5.482163 AATTCACCTGTAAACCCCAAATG 57.518 39.130 0.00 0.00 0.00 2.32
4080 8895 3.885976 TCACCTGTAAACCCCAAATGA 57.114 42.857 0.00 0.00 0.00 2.57
4081 8896 4.186077 TCACCTGTAAACCCCAAATGAA 57.814 40.909 0.00 0.00 0.00 2.57
4082 8897 4.746466 TCACCTGTAAACCCCAAATGAAT 58.254 39.130 0.00 0.00 0.00 2.57
4083 8898 5.151454 TCACCTGTAAACCCCAAATGAATT 58.849 37.500 0.00 0.00 0.00 2.17
4084 8899 5.245075 TCACCTGTAAACCCCAAATGAATTC 59.755 40.000 0.00 0.00 0.00 2.17
4085 8900 4.530553 ACCTGTAAACCCCAAATGAATTCC 59.469 41.667 2.27 0.00 0.00 3.01
4086 8901 4.777366 CCTGTAAACCCCAAATGAATTCCT 59.223 41.667 2.27 0.00 0.00 3.36
4087 8902 5.337491 CCTGTAAACCCCAAATGAATTCCTG 60.337 44.000 2.27 0.00 0.00 3.86
4088 8903 5.151454 TGTAAACCCCAAATGAATTCCTGT 58.849 37.500 2.27 0.00 0.00 4.00
4089 8904 4.890158 AAACCCCAAATGAATTCCTGTC 57.110 40.909 2.27 0.00 0.00 3.51
4090 8905 3.833559 ACCCCAAATGAATTCCTGTCT 57.166 42.857 2.27 0.00 0.00 3.41
4091 8906 4.132122 ACCCCAAATGAATTCCTGTCTT 57.868 40.909 2.27 0.00 0.00 3.01
4092 8907 4.492646 ACCCCAAATGAATTCCTGTCTTT 58.507 39.130 2.27 0.00 0.00 2.52
4093 8908 5.650283 ACCCCAAATGAATTCCTGTCTTTA 58.350 37.500 2.27 0.00 0.00 1.85
4094 8909 5.716703 ACCCCAAATGAATTCCTGTCTTTAG 59.283 40.000 2.27 0.00 0.00 1.85
4095 8910 5.716703 CCCCAAATGAATTCCTGTCTTTAGT 59.283 40.000 2.27 0.00 0.00 2.24
4096 8911 6.350445 CCCCAAATGAATTCCTGTCTTTAGTG 60.350 42.308 2.27 0.00 0.00 2.74
4097 8912 6.434028 CCCAAATGAATTCCTGTCTTTAGTGA 59.566 38.462 2.27 0.00 0.00 3.41
4098 8913 7.039784 CCCAAATGAATTCCTGTCTTTAGTGAA 60.040 37.037 2.27 0.00 0.00 3.18
4099 8914 7.809806 CCAAATGAATTCCTGTCTTTAGTGAAC 59.190 37.037 2.27 0.00 0.00 3.18
4100 8915 7.454260 AATGAATTCCTGTCTTTAGTGAACC 57.546 36.000 2.27 0.00 0.00 3.62
4101 8916 5.313712 TGAATTCCTGTCTTTAGTGAACCC 58.686 41.667 2.27 0.00 0.00 4.11
4102 8917 3.782656 TTCCTGTCTTTAGTGAACCCC 57.217 47.619 0.00 0.00 0.00 4.95
4103 8918 2.986050 TCCTGTCTTTAGTGAACCCCT 58.014 47.619 0.00 0.00 0.00 4.79
4104 8919 3.323775 TCCTGTCTTTAGTGAACCCCTT 58.676 45.455 0.00 0.00 0.00 3.95
4105 8920 3.720002 TCCTGTCTTTAGTGAACCCCTTT 59.280 43.478 0.00 0.00 0.00 3.11
4106 8921 3.821033 CCTGTCTTTAGTGAACCCCTTTG 59.179 47.826 0.00 0.00 0.00 2.77
4107 8922 4.445735 CCTGTCTTTAGTGAACCCCTTTGA 60.446 45.833 0.00 0.00 0.00 2.69
4108 8923 5.118729 TGTCTTTAGTGAACCCCTTTGAA 57.881 39.130 0.00 0.00 0.00 2.69
4109 8924 5.511363 TGTCTTTAGTGAACCCCTTTGAAA 58.489 37.500 0.00 0.00 0.00 2.69
4110 8925 5.592688 TGTCTTTAGTGAACCCCTTTGAAAG 59.407 40.000 0.00 0.00 0.00 2.62
4150 8965 9.740239 ATAAATTAACATCGACATGTACGTACT 57.260 29.630 25.12 6.47 42.89 2.73
4152 8967 9.740239 AAATTAACATCGACATGTACGTACTAT 57.260 29.630 25.12 14.42 42.89 2.12
4153 8968 8.723777 ATTAACATCGACATGTACGTACTATG 57.276 34.615 25.12 24.59 42.89 2.23
4154 8969 5.746307 ACATCGACATGTACGTACTATGT 57.254 39.130 28.22 28.22 41.81 2.29
4155 8970 6.849588 ACATCGACATGTACGTACTATGTA 57.150 37.500 28.05 20.13 41.81 2.29
4156 8971 6.653183 ACATCGACATGTACGTACTATGTAC 58.347 40.000 28.05 22.35 41.81 2.90
4157 8972 5.657470 TCGACATGTACGTACTATGTACC 57.343 43.478 28.05 20.58 39.28 3.34
4158 8973 5.115480 TCGACATGTACGTACTATGTACCA 58.885 41.667 28.05 18.48 39.28 3.25
4159 8974 5.584251 TCGACATGTACGTACTATGTACCAA 59.416 40.000 28.05 17.74 39.28 3.67
4160 8975 6.260714 TCGACATGTACGTACTATGTACCAAT 59.739 38.462 28.05 14.81 39.28 3.16
4161 8976 7.440856 TCGACATGTACGTACTATGTACCAATA 59.559 37.037 28.05 15.60 39.28 1.90
4162 8977 8.069574 CGACATGTACGTACTATGTACCAATAA 58.930 37.037 28.05 9.05 39.28 1.40
4163 8978 9.734620 GACATGTACGTACTATGTACCAATAAA 57.265 33.333 28.05 8.70 39.28 1.40
4174 8989 9.120538 ACTATGTACCAATAAAACTAATGGCTG 57.879 33.333 0.00 0.00 36.37 4.85
4175 8990 7.954666 ATGTACCAATAAAACTAATGGCTGT 57.045 32.000 0.00 0.00 36.37 4.40
4176 8991 7.768807 TGTACCAATAAAACTAATGGCTGTT 57.231 32.000 0.00 0.00 36.37 3.16
4177 8992 8.184304 TGTACCAATAAAACTAATGGCTGTTT 57.816 30.769 0.00 0.00 37.92 2.83
4178 8993 9.298250 TGTACCAATAAAACTAATGGCTGTTTA 57.702 29.630 0.00 0.00 35.63 2.01
4185 9000 7.961325 AAAACTAATGGCTGTTTATTTGTGG 57.039 32.000 0.00 0.00 35.63 4.17
4186 9001 6.664428 AACTAATGGCTGTTTATTTGTGGT 57.336 33.333 0.00 0.00 0.00 4.16
4187 9002 6.267496 ACTAATGGCTGTTTATTTGTGGTC 57.733 37.500 0.00 0.00 0.00 4.02
4188 9003 5.772672 ACTAATGGCTGTTTATTTGTGGTCA 59.227 36.000 0.00 0.00 0.00 4.02
4189 9004 4.519540 ATGGCTGTTTATTTGTGGTCAC 57.480 40.909 0.00 0.00 0.00 3.67
4190 9005 3.291584 TGGCTGTTTATTTGTGGTCACA 58.708 40.909 0.00 0.00 39.98 3.58
4191 9006 3.317711 TGGCTGTTTATTTGTGGTCACAG 59.682 43.478 3.93 0.00 42.94 3.66
4192 9007 3.568007 GGCTGTTTATTTGTGGTCACAGA 59.432 43.478 3.93 0.39 42.94 3.41
4193 9008 4.037446 GGCTGTTTATTTGTGGTCACAGAA 59.963 41.667 3.93 3.31 42.94 3.02
4194 9009 5.215160 GCTGTTTATTTGTGGTCACAGAAG 58.785 41.667 3.93 0.00 42.94 2.85
4195 9010 5.008613 GCTGTTTATTTGTGGTCACAGAAGA 59.991 40.000 3.93 0.00 42.94 2.87
4196 9011 6.459573 GCTGTTTATTTGTGGTCACAGAAGAA 60.460 38.462 3.93 3.81 42.94 2.52
4197 9012 7.397892 TGTTTATTTGTGGTCACAGAAGAAA 57.602 32.000 3.93 8.53 42.94 2.52
4198 9013 8.006298 TGTTTATTTGTGGTCACAGAAGAAAT 57.994 30.769 14.84 10.27 42.94 2.17
4199 9014 9.126151 TGTTTATTTGTGGTCACAGAAGAAATA 57.874 29.630 14.84 12.00 42.94 1.40
4200 9015 9.959749 GTTTATTTGTGGTCACAGAAGAAATAA 57.040 29.630 14.84 13.08 42.94 1.40
4246 9061 7.090319 ACCTACCATTTGCTATTATGGATCA 57.910 36.000 8.03 0.00 43.25 2.92
4247 9062 7.526041 ACCTACCATTTGCTATTATGGATCAA 58.474 34.615 8.03 0.00 43.25 2.57
4248 9063 8.004215 ACCTACCATTTGCTATTATGGATCAAA 58.996 33.333 8.03 0.00 43.25 2.69
4249 9064 8.299570 CCTACCATTTGCTATTATGGATCAAAC 58.700 37.037 8.03 0.00 43.25 2.93
4250 9065 7.658525 ACCATTTGCTATTATGGATCAAACA 57.341 32.000 8.03 0.00 43.25 2.83
4251 9066 8.253867 ACCATTTGCTATTATGGATCAAACAT 57.746 30.769 8.03 0.00 43.25 2.71
4252 9067 9.365906 ACCATTTGCTATTATGGATCAAACATA 57.634 29.630 8.03 0.00 43.25 2.29
4257 9072 9.571816 TTGCTATTATGGATCAAACATATGTGA 57.428 29.630 9.63 3.66 31.46 3.58
4258 9073 9.002600 TGCTATTATGGATCAAACATATGTGAC 57.997 33.333 9.63 0.00 31.46 3.67
4259 9074 8.454106 GCTATTATGGATCAAACATATGTGACC 58.546 37.037 9.63 9.15 31.46 4.02
4260 9075 9.730705 CTATTATGGATCAAACATATGTGACCT 57.269 33.333 9.63 0.00 31.46 3.85
4262 9077 8.821686 TTATGGATCAAACATATGTGACCTTT 57.178 30.769 9.63 0.00 31.46 3.11
4263 9078 7.722949 ATGGATCAAACATATGTGACCTTTT 57.277 32.000 9.63 0.00 0.00 2.27
4264 9079 7.537596 TGGATCAAACATATGTGACCTTTTT 57.462 32.000 9.63 0.00 0.00 1.94
4265 9080 7.377398 TGGATCAAACATATGTGACCTTTTTG 58.623 34.615 9.63 8.35 0.00 2.44
4266 9081 7.015098 TGGATCAAACATATGTGACCTTTTTGT 59.985 33.333 9.63 0.08 0.00 2.83
4267 9082 7.542130 GGATCAAACATATGTGACCTTTTTGTC 59.458 37.037 9.63 8.17 35.77 3.18
4268 9083 7.581213 TCAAACATATGTGACCTTTTTGTCT 57.419 32.000 9.63 0.00 36.21 3.41
4269 9084 8.684386 TCAAACATATGTGACCTTTTTGTCTA 57.316 30.769 9.63 0.00 36.21 2.59
4270 9085 8.783093 TCAAACATATGTGACCTTTTTGTCTAG 58.217 33.333 9.63 0.00 36.21 2.43
4271 9086 6.743575 ACATATGTGACCTTTTTGTCTAGC 57.256 37.500 7.78 0.00 36.21 3.42
4272 9087 5.648092 ACATATGTGACCTTTTTGTCTAGCC 59.352 40.000 7.78 0.00 36.21 3.93
4273 9088 2.858745 TGTGACCTTTTTGTCTAGCCC 58.141 47.619 0.00 0.00 36.21 5.19
4274 9089 2.173782 TGTGACCTTTTTGTCTAGCCCA 59.826 45.455 0.00 0.00 36.21 5.36
4275 9090 3.219281 GTGACCTTTTTGTCTAGCCCAA 58.781 45.455 0.00 0.00 36.21 4.12
4276 9091 3.634910 GTGACCTTTTTGTCTAGCCCAAA 59.365 43.478 4.00 4.00 36.21 3.28
4277 9092 4.098807 GTGACCTTTTTGTCTAGCCCAAAA 59.901 41.667 13.09 13.09 39.36 2.44
4278 9093 4.098807 TGACCTTTTTGTCTAGCCCAAAAC 59.901 41.667 15.47 8.28 40.44 2.43
4279 9094 4.286707 ACCTTTTTGTCTAGCCCAAAACT 58.713 39.130 15.47 4.02 40.44 2.66
4280 9095 4.714802 ACCTTTTTGTCTAGCCCAAAACTT 59.285 37.500 15.47 5.06 40.44 2.66
4281 9096 5.894964 ACCTTTTTGTCTAGCCCAAAACTTA 59.105 36.000 15.47 5.47 40.44 2.24
4282 9097 6.381707 ACCTTTTTGTCTAGCCCAAAACTTAA 59.618 34.615 15.47 5.22 40.44 1.85
4283 9098 6.923508 CCTTTTTGTCTAGCCCAAAACTTAAG 59.076 38.462 15.47 0.00 40.44 1.85
4284 9099 7.412853 TTTTTGTCTAGCCCAAAACTTAAGT 57.587 32.000 15.47 1.12 40.44 2.24
4285 9100 7.412853 TTTTGTCTAGCCCAAAACTTAAGTT 57.587 32.000 15.22 15.22 36.99 2.66
4286 9101 8.522542 TTTTGTCTAGCCCAAAACTTAAGTTA 57.477 30.769 20.83 3.11 36.99 2.24
4287 9102 8.700439 TTTGTCTAGCCCAAAACTTAAGTTAT 57.300 30.769 20.83 8.89 37.25 1.89
4288 9103 8.700439 TTGTCTAGCCCAAAACTTAAGTTATT 57.300 30.769 20.83 13.80 37.25 1.40
4289 9104 8.700439 TGTCTAGCCCAAAACTTAAGTTATTT 57.300 30.769 20.83 10.07 37.25 1.40
4290 9105 8.789762 TGTCTAGCCCAAAACTTAAGTTATTTC 58.210 33.333 20.83 9.65 37.25 2.17
4291 9106 9.011095 GTCTAGCCCAAAACTTAAGTTATTTCT 57.989 33.333 20.83 15.33 37.25 2.52
4292 9107 9.010029 TCTAGCCCAAAACTTAAGTTATTTCTG 57.990 33.333 20.83 12.49 37.25 3.02
4293 9108 7.833285 AGCCCAAAACTTAAGTTATTTCTGA 57.167 32.000 20.83 0.00 37.25 3.27
4294 9109 8.245195 AGCCCAAAACTTAAGTTATTTCTGAA 57.755 30.769 20.83 0.00 37.25 3.02
4295 9110 8.870116 AGCCCAAAACTTAAGTTATTTCTGAAT 58.130 29.630 20.83 0.00 37.25 2.57
4296 9111 8.925700 GCCCAAAACTTAAGTTATTTCTGAATG 58.074 33.333 20.83 8.87 37.25 2.67
4315 9130 9.508642 TCTGAATGATATTCTATAGAGACGTGT 57.491 33.333 2.02 0.00 0.00 4.49
4320 9135 8.041829 TGATATTCTATAGAGACGTGTAAGGC 57.958 38.462 2.02 0.00 0.00 4.35
4321 9136 7.664318 TGATATTCTATAGAGACGTGTAAGGCA 59.336 37.037 2.02 0.00 0.00 4.75
4322 9137 5.496133 TTCTATAGAGACGTGTAAGGCAC 57.504 43.478 2.02 0.00 44.36 5.01
4338 9153 9.801873 GTGTAAGGCACATCAACATTTAAATAT 57.198 29.630 0.00 0.00 46.91 1.28
4364 9179 8.776376 AATGTTCTGTTGAATTGTTTGAAACT 57.224 26.923 9.69 0.00 34.40 2.66
4365 9180 8.776376 ATGTTCTGTTGAATTGTTTGAAACTT 57.224 26.923 9.69 0.00 34.40 2.66
4366 9181 8.238481 TGTTCTGTTGAATTGTTTGAAACTTC 57.762 30.769 9.69 6.38 34.40 3.01
4367 9182 8.087750 TGTTCTGTTGAATTGTTTGAAACTTCT 58.912 29.630 9.69 0.00 34.40 2.85
4368 9183 9.567848 GTTCTGTTGAATTGTTTGAAACTTCTA 57.432 29.630 9.69 0.51 34.40 2.10
4394 9209 9.603921 AAATGTGATTTTCAGAATGTTGAAACT 57.396 25.926 4.80 1.00 44.33 2.66
4395 9210 8.807667 ATGTGATTTTCAGAATGTTGAAACTC 57.192 30.769 12.09 12.09 44.33 3.01
4396 9211 6.912051 TGTGATTTTCAGAATGTTGAAACTCG 59.088 34.615 13.23 0.00 44.33 4.18
4397 9212 6.360681 GTGATTTTCAGAATGTTGAAACTCGG 59.639 38.462 13.23 0.00 44.33 4.63
4398 9213 6.262049 TGATTTTCAGAATGTTGAAACTCGGA 59.738 34.615 13.23 0.00 44.33 4.55
4399 9214 5.673337 TTTCAGAATGTTGAAACTCGGAG 57.327 39.130 2.83 2.83 40.95 4.63
4400 9215 3.067106 TCAGAATGTTGAAACTCGGAGC 58.933 45.455 4.58 0.00 37.40 4.70
4401 9216 3.070018 CAGAATGTTGAAACTCGGAGCT 58.930 45.455 4.58 0.00 0.00 4.09
4402 9217 3.124297 CAGAATGTTGAAACTCGGAGCTC 59.876 47.826 4.71 4.71 0.00 4.09
4403 9218 2.839486 ATGTTGAAACTCGGAGCTCA 57.161 45.000 17.19 5.63 0.00 4.26
4404 9219 2.613026 TGTTGAAACTCGGAGCTCAA 57.387 45.000 17.19 15.42 0.00 3.02
4405 9220 3.126001 TGTTGAAACTCGGAGCTCAAT 57.874 42.857 17.19 0.00 30.96 2.57
4406 9221 2.807967 TGTTGAAACTCGGAGCTCAATG 59.192 45.455 17.19 6.79 30.96 2.82
4407 9222 3.067106 GTTGAAACTCGGAGCTCAATGA 58.933 45.455 17.19 9.12 30.96 2.57
4408 9223 2.964740 TGAAACTCGGAGCTCAATGAG 58.035 47.619 21.47 21.47 34.65 2.90
4420 9235 3.681593 CTCAATGAGCCTAGGATCCAG 57.318 52.381 23.96 13.45 0.00 3.86
4421 9236 2.971330 CTCAATGAGCCTAGGATCCAGT 59.029 50.000 23.96 8.88 0.00 4.00
4422 9237 2.702478 TCAATGAGCCTAGGATCCAGTG 59.298 50.000 23.96 19.22 0.00 3.66
4423 9238 2.702478 CAATGAGCCTAGGATCCAGTGA 59.298 50.000 23.96 5.48 0.00 3.41
4424 9239 2.550277 TGAGCCTAGGATCCAGTGAA 57.450 50.000 23.96 1.14 0.00 3.18
4425 9240 3.051940 TGAGCCTAGGATCCAGTGAAT 57.948 47.619 23.96 0.00 0.00 2.57
4426 9241 2.702478 TGAGCCTAGGATCCAGTGAATG 59.298 50.000 23.96 0.00 0.00 2.67
4427 9242 1.419387 AGCCTAGGATCCAGTGAATGC 59.581 52.381 14.75 6.42 0.00 3.56
4428 9243 1.419387 GCCTAGGATCCAGTGAATGCT 59.581 52.381 14.75 0.00 0.00 3.79
4429 9244 2.158696 GCCTAGGATCCAGTGAATGCTT 60.159 50.000 14.75 0.00 0.00 3.91
4430 9245 3.686691 GCCTAGGATCCAGTGAATGCTTT 60.687 47.826 14.75 0.00 0.00 3.51
4431 9246 4.444876 GCCTAGGATCCAGTGAATGCTTTA 60.445 45.833 14.75 0.00 0.00 1.85
4432 9247 5.059833 CCTAGGATCCAGTGAATGCTTTAC 58.940 45.833 15.82 0.00 0.00 2.01
4433 9248 4.851639 AGGATCCAGTGAATGCTTTACT 57.148 40.909 15.82 0.00 0.00 2.24
4434 9249 5.957771 AGGATCCAGTGAATGCTTTACTA 57.042 39.130 15.82 0.00 0.00 1.82
4435 9250 6.506538 AGGATCCAGTGAATGCTTTACTAT 57.493 37.500 15.82 0.00 0.00 2.12
4436 9251 7.618019 AGGATCCAGTGAATGCTTTACTATA 57.382 36.000 15.82 0.00 0.00 1.31
4437 9252 8.034313 AGGATCCAGTGAATGCTTTACTATAA 57.966 34.615 15.82 0.00 0.00 0.98
4438 9253 8.664079 AGGATCCAGTGAATGCTTTACTATAAT 58.336 33.333 15.82 0.00 0.00 1.28
4439 9254 8.725148 GGATCCAGTGAATGCTTTACTATAATG 58.275 37.037 6.95 0.00 0.00 1.90
4440 9255 9.494271 GATCCAGTGAATGCTTTACTATAATGA 57.506 33.333 0.00 0.00 0.00 2.57
4442 9257 9.276590 TCCAGTGAATGCTTTACTATAATGATG 57.723 33.333 0.00 0.00 0.00 3.07
4443 9258 8.509690 CCAGTGAATGCTTTACTATAATGATGG 58.490 37.037 0.00 0.00 0.00 3.51
4444 9259 9.276590 CAGTGAATGCTTTACTATAATGATGGA 57.723 33.333 0.00 0.00 0.00 3.41
4445 9260 9.851686 AGTGAATGCTTTACTATAATGATGGAA 57.148 29.630 0.00 0.00 0.00 3.53
4457 9272 8.307483 ACTATAATGATGGAATCTTACTCACCG 58.693 37.037 0.00 0.00 45.81 4.94
4458 9273 3.179443 TGATGGAATCTTACTCACCGC 57.821 47.619 0.00 0.00 45.81 5.68
4459 9274 2.766263 TGATGGAATCTTACTCACCGCT 59.234 45.455 0.00 0.00 45.81 5.52
4460 9275 3.958147 TGATGGAATCTTACTCACCGCTA 59.042 43.478 0.00 0.00 45.81 4.26
4461 9276 4.038042 TGATGGAATCTTACTCACCGCTAG 59.962 45.833 0.00 0.00 45.81 3.42
4462 9277 3.362706 TGGAATCTTACTCACCGCTAGT 58.637 45.455 0.00 0.00 0.00 2.57
4463 9278 4.529897 TGGAATCTTACTCACCGCTAGTA 58.470 43.478 0.00 0.00 0.00 1.82
4464 9279 5.138276 TGGAATCTTACTCACCGCTAGTAT 58.862 41.667 0.00 0.00 29.86 2.12
4465 9280 5.597182 TGGAATCTTACTCACCGCTAGTATT 59.403 40.000 0.00 0.00 29.86 1.89
4466 9281 6.774170 TGGAATCTTACTCACCGCTAGTATTA 59.226 38.462 0.00 0.00 29.86 0.98
4467 9282 7.083230 GGAATCTTACTCACCGCTAGTATTAC 58.917 42.308 0.00 0.00 29.86 1.89
4468 9283 7.255381 GGAATCTTACTCACCGCTAGTATTACA 60.255 40.741 0.00 0.00 29.86 2.41
4469 9284 7.578310 ATCTTACTCACCGCTAGTATTACAA 57.422 36.000 0.00 0.00 29.86 2.41
4470 9285 7.024340 TCTTACTCACCGCTAGTATTACAAG 57.976 40.000 0.00 0.00 29.86 3.16
4471 9286 4.043037 ACTCACCGCTAGTATTACAAGC 57.957 45.455 0.00 0.00 0.00 4.01
4472 9287 3.700038 ACTCACCGCTAGTATTACAAGCT 59.300 43.478 0.00 0.00 34.03 3.74
4473 9288 4.041740 TCACCGCTAGTATTACAAGCTG 57.958 45.455 0.00 0.00 34.03 4.24
4474 9289 3.123804 CACCGCTAGTATTACAAGCTGG 58.876 50.000 0.00 0.00 36.58 4.85
4475 9290 2.764572 ACCGCTAGTATTACAAGCTGGT 59.235 45.455 0.00 0.00 37.89 4.00
4476 9291 3.197116 ACCGCTAGTATTACAAGCTGGTT 59.803 43.478 0.00 0.00 38.84 3.67
4477 9292 4.189231 CCGCTAGTATTACAAGCTGGTTT 58.811 43.478 0.00 0.00 34.03 3.27
4478 9293 4.270325 CCGCTAGTATTACAAGCTGGTTTC 59.730 45.833 0.00 0.00 34.03 2.78
4479 9294 4.270325 CGCTAGTATTACAAGCTGGTTTCC 59.730 45.833 0.00 0.00 34.03 3.13
4480 9295 5.429130 GCTAGTATTACAAGCTGGTTTCCT 58.571 41.667 0.00 0.00 33.40 3.36
4481 9296 5.880887 GCTAGTATTACAAGCTGGTTTCCTT 59.119 40.000 0.00 0.00 33.40 3.36
4482 9297 6.037281 GCTAGTATTACAAGCTGGTTTCCTTC 59.963 42.308 0.00 0.00 33.40 3.46
4483 9298 6.128138 AGTATTACAAGCTGGTTTCCTTCT 57.872 37.500 0.00 0.00 0.00 2.85
4484 9299 5.940470 AGTATTACAAGCTGGTTTCCTTCTG 59.060 40.000 0.00 0.00 0.00 3.02
4485 9300 1.986882 ACAAGCTGGTTTCCTTCTGG 58.013 50.000 0.00 0.00 0.00 3.86
4486 9301 1.251251 CAAGCTGGTTTCCTTCTGGG 58.749 55.000 0.00 0.00 0.00 4.45
4487 9302 0.540597 AAGCTGGTTTCCTTCTGGGC 60.541 55.000 0.00 0.00 34.39 5.36
4488 9303 1.075659 GCTGGTTTCCTTCTGGGCT 59.924 57.895 0.00 0.00 34.39 5.19
4489 9304 0.962855 GCTGGTTTCCTTCTGGGCTC 60.963 60.000 0.00 0.00 34.39 4.70
4490 9305 0.695347 CTGGTTTCCTTCTGGGCTCT 59.305 55.000 0.00 0.00 34.39 4.09
4491 9306 1.074566 CTGGTTTCCTTCTGGGCTCTT 59.925 52.381 0.00 0.00 34.39 2.85
4492 9307 2.305927 CTGGTTTCCTTCTGGGCTCTTA 59.694 50.000 0.00 0.00 34.39 2.10
4493 9308 2.919602 TGGTTTCCTTCTGGGCTCTTAT 59.080 45.455 0.00 0.00 34.39 1.73
4494 9309 3.054361 TGGTTTCCTTCTGGGCTCTTATC 60.054 47.826 0.00 0.00 34.39 1.75
4495 9310 3.054361 GGTTTCCTTCTGGGCTCTTATCA 60.054 47.826 0.00 0.00 34.39 2.15
4496 9311 4.567747 GGTTTCCTTCTGGGCTCTTATCAA 60.568 45.833 0.00 0.00 34.39 2.57
4497 9312 4.927267 TTCCTTCTGGGCTCTTATCAAA 57.073 40.909 0.00 0.00 34.39 2.69
4498 9313 4.927267 TCCTTCTGGGCTCTTATCAAAA 57.073 40.909 0.00 0.00 34.39 2.44
4499 9314 5.456921 TCCTTCTGGGCTCTTATCAAAAT 57.543 39.130 0.00 0.00 34.39 1.82
4500 9315 6.575244 TCCTTCTGGGCTCTTATCAAAATA 57.425 37.500 0.00 0.00 34.39 1.40
4501 9316 6.357367 TCCTTCTGGGCTCTTATCAAAATAC 58.643 40.000 0.00 0.00 34.39 1.89
4502 9317 6.158695 TCCTTCTGGGCTCTTATCAAAATACT 59.841 38.462 0.00 0.00 34.39 2.12
4503 9318 6.830838 CCTTCTGGGCTCTTATCAAAATACTT 59.169 38.462 0.00 0.00 0.00 2.24
4504 9319 7.340487 CCTTCTGGGCTCTTATCAAAATACTTT 59.660 37.037 0.00 0.00 0.00 2.66
4505 9320 8.650143 TTCTGGGCTCTTATCAAAATACTTTT 57.350 30.769 0.00 0.00 0.00 2.27
4506 9321 8.281212 TCTGGGCTCTTATCAAAATACTTTTC 57.719 34.615 0.00 0.00 0.00 2.29
4507 9322 7.888021 TCTGGGCTCTTATCAAAATACTTTTCA 59.112 33.333 0.00 0.00 0.00 2.69
4508 9323 8.593945 TGGGCTCTTATCAAAATACTTTTCAT 57.406 30.769 0.00 0.00 0.00 2.57
4509 9324 8.469200 TGGGCTCTTATCAAAATACTTTTCATG 58.531 33.333 0.00 0.00 0.00 3.07
4510 9325 7.436376 GGGCTCTTATCAAAATACTTTTCATGC 59.564 37.037 0.00 0.00 0.00 4.06
4511 9326 7.975616 GGCTCTTATCAAAATACTTTTCATGCA 59.024 33.333 0.00 0.00 0.00 3.96
4512 9327 9.357652 GCTCTTATCAAAATACTTTTCATGCAA 57.642 29.630 0.00 0.00 0.00 4.08
4543 9358 7.283625 AGTGCATTTTTAGTTATTGTGGACA 57.716 32.000 0.00 0.00 0.00 4.02
4544 9359 7.145323 AGTGCATTTTTAGTTATTGTGGACAC 58.855 34.615 0.00 0.00 0.00 3.67
4545 9360 6.364976 GTGCATTTTTAGTTATTGTGGACACC 59.635 38.462 0.00 0.00 0.00 4.16
4546 9361 6.040955 TGCATTTTTAGTTATTGTGGACACCA 59.959 34.615 0.00 0.00 0.00 4.17
4547 9362 6.926272 GCATTTTTAGTTATTGTGGACACCAA 59.074 34.615 0.00 0.00 34.18 3.67
4548 9363 7.602265 GCATTTTTAGTTATTGTGGACACCAAT 59.398 33.333 0.00 3.34 34.18 3.16
4549 9364 8.924691 CATTTTTAGTTATTGTGGACACCAATG 58.075 33.333 0.00 0.00 34.18 2.82
4550 9365 7.589958 TTTTAGTTATTGTGGACACCAATGT 57.410 32.000 0.00 0.00 43.71 2.71
4551 9366 8.693120 TTTTAGTTATTGTGGACACCAATGTA 57.307 30.769 0.00 0.00 39.95 2.29
4552 9367 8.693120 TTTAGTTATTGTGGACACCAATGTAA 57.307 30.769 0.00 0.00 39.95 2.41
4553 9368 8.693120 TTAGTTATTGTGGACACCAATGTAAA 57.307 30.769 0.00 0.00 39.95 2.01
4554 9369 7.589958 AGTTATTGTGGACACCAATGTAAAA 57.410 32.000 0.00 0.00 39.95 1.52
4555 9370 7.430441 AGTTATTGTGGACACCAATGTAAAAC 58.570 34.615 0.00 2.84 39.95 2.43
4556 9371 5.860941 ATTGTGGACACCAATGTAAAACA 57.139 34.783 0.00 0.00 39.95 2.83
4557 9372 5.661056 TTGTGGACACCAATGTAAAACAA 57.339 34.783 0.00 0.00 39.95 2.83
4558 9373 5.000012 TGTGGACACCAATGTAAAACAAC 58.000 39.130 0.00 0.00 39.95 3.32
4559 9374 4.142138 TGTGGACACCAATGTAAAACAACC 60.142 41.667 0.00 0.00 39.95 3.77
4560 9375 3.385111 TGGACACCAATGTAAAACAACCC 59.615 43.478 0.00 0.00 39.95 4.11
4561 9376 3.639561 GGACACCAATGTAAAACAACCCT 59.360 43.478 0.00 0.00 39.95 4.34
4562 9377 4.828387 GGACACCAATGTAAAACAACCCTA 59.172 41.667 0.00 0.00 39.95 3.53
4563 9378 5.278610 GGACACCAATGTAAAACAACCCTAC 60.279 44.000 0.00 0.00 39.95 3.18
4564 9379 5.451354 ACACCAATGTAAAACAACCCTACT 58.549 37.500 0.00 0.00 37.26 2.57
4565 9380 5.894964 ACACCAATGTAAAACAACCCTACTT 59.105 36.000 0.00 0.00 37.26 2.24
4566 9381 7.061688 ACACCAATGTAAAACAACCCTACTTA 58.938 34.615 0.00 0.00 37.26 2.24
4567 9382 7.560626 ACACCAATGTAAAACAACCCTACTTAA 59.439 33.333 0.00 0.00 37.26 1.85
4568 9383 8.414778 CACCAATGTAAAACAACCCTACTTAAA 58.585 33.333 0.00 0.00 0.00 1.52
4569 9384 9.150028 ACCAATGTAAAACAACCCTACTTAAAT 57.850 29.630 0.00 0.00 0.00 1.40
4570 9385 9.634163 CCAATGTAAAACAACCCTACTTAAATC 57.366 33.333 0.00 0.00 0.00 2.17
4574 9389 9.357161 TGTAAAACAACCCTACTTAAATCATGT 57.643 29.630 0.00 0.00 0.00 3.21
4579 9394 9.528489 AACAACCCTACTTAAATCATGTTATGT 57.472 29.630 0.00 0.00 0.00 2.29
4580 9395 9.528489 ACAACCCTACTTAAATCATGTTATGTT 57.472 29.630 0.00 0.00 0.00 2.71
4583 9398 9.747898 ACCCTACTTAAATCATGTTATGTTTCA 57.252 29.630 0.00 0.00 0.00 2.69
4599 9414 9.662545 GTTATGTTTCAACAATTTTTCATTGGG 57.337 29.630 0.00 0.00 43.03 4.12
4600 9415 6.690194 TGTTTCAACAATTTTTCATTGGGG 57.310 33.333 0.00 0.00 35.67 4.96
4601 9416 6.418101 TGTTTCAACAATTTTTCATTGGGGA 58.582 32.000 0.00 0.00 35.67 4.81
4602 9417 6.541641 TGTTTCAACAATTTTTCATTGGGGAG 59.458 34.615 0.00 0.00 35.67 4.30
4603 9418 5.226194 TCAACAATTTTTCATTGGGGAGG 57.774 39.130 0.00 0.00 33.56 4.30
4604 9419 4.904251 TCAACAATTTTTCATTGGGGAGGA 59.096 37.500 0.00 0.00 33.56 3.71
4605 9420 5.367937 TCAACAATTTTTCATTGGGGAGGAA 59.632 36.000 0.00 0.00 33.56 3.36
4606 9421 5.903198 ACAATTTTTCATTGGGGAGGAAA 57.097 34.783 0.00 0.00 36.35 3.13
4607 9422 6.259346 ACAATTTTTCATTGGGGAGGAAAA 57.741 33.333 0.00 0.00 43.83 2.29
4694 9509 7.755582 GCTAAAAGCCACATATTTAACCAAG 57.244 36.000 0.00 0.00 34.48 3.61
4695 9510 7.320399 GCTAAAAGCCACATATTTAACCAAGT 58.680 34.615 0.00 0.00 34.48 3.16
4696 9511 7.817478 GCTAAAAGCCACATATTTAACCAAGTT 59.183 33.333 0.00 0.00 34.48 2.66
4697 9512 9.353999 CTAAAAGCCACATATTTAACCAAGTTC 57.646 33.333 0.00 0.00 0.00 3.01
4698 9513 5.560966 AGCCACATATTTAACCAAGTTCG 57.439 39.130 0.00 0.00 0.00 3.95
4699 9514 5.250200 AGCCACATATTTAACCAAGTTCGA 58.750 37.500 0.00 0.00 0.00 3.71
4700 9515 5.354234 AGCCACATATTTAACCAAGTTCGAG 59.646 40.000 0.00 0.00 0.00 4.04
4701 9516 5.569413 CCACATATTTAACCAAGTTCGAGC 58.431 41.667 0.00 0.00 0.00 5.03
4702 9517 5.354234 CCACATATTTAACCAAGTTCGAGCT 59.646 40.000 0.00 0.00 0.00 4.09
4703 9518 6.128007 CCACATATTTAACCAAGTTCGAGCTT 60.128 38.462 8.90 8.90 0.00 3.74
4704 9519 6.961554 CACATATTTAACCAAGTTCGAGCTTC 59.038 38.462 11.97 0.00 0.00 3.86
4705 9520 6.093633 ACATATTTAACCAAGTTCGAGCTTCC 59.906 38.462 11.97 0.00 0.00 3.46
4706 9521 3.478857 TTAACCAAGTTCGAGCTTCCA 57.521 42.857 11.97 0.00 0.00 3.53
4707 9522 2.341846 AACCAAGTTCGAGCTTCCAA 57.658 45.000 11.97 0.00 0.00 3.53
4708 9523 1.884235 ACCAAGTTCGAGCTTCCAAG 58.116 50.000 11.97 4.22 0.00 3.61
4709 9524 1.416401 ACCAAGTTCGAGCTTCCAAGA 59.584 47.619 11.97 0.00 0.00 3.02
4710 9525 2.158813 ACCAAGTTCGAGCTTCCAAGAA 60.159 45.455 11.97 0.00 0.00 2.52
4711 9526 2.224314 CCAAGTTCGAGCTTCCAAGAAC 59.776 50.000 11.97 10.09 42.17 3.01
4712 9527 2.872245 CAAGTTCGAGCTTCCAAGAACA 59.128 45.455 11.97 0.00 43.71 3.18
4713 9528 2.484889 AGTTCGAGCTTCCAAGAACAC 58.515 47.619 16.40 0.00 43.71 3.32
4714 9529 1.531578 GTTCGAGCTTCCAAGAACACC 59.468 52.381 12.04 0.00 41.66 4.16
4715 9530 0.034896 TCGAGCTTCCAAGAACACCC 59.965 55.000 0.00 0.00 0.00 4.61
4716 9531 0.955919 CGAGCTTCCAAGAACACCCC 60.956 60.000 0.00 0.00 0.00 4.95
4717 9532 0.402121 GAGCTTCCAAGAACACCCCT 59.598 55.000 0.00 0.00 0.00 4.79
4718 9533 0.402121 AGCTTCCAAGAACACCCCTC 59.598 55.000 0.00 0.00 0.00 4.30
4719 9534 0.110486 GCTTCCAAGAACACCCCTCA 59.890 55.000 0.00 0.00 0.00 3.86
4720 9535 1.897560 CTTCCAAGAACACCCCTCAC 58.102 55.000 0.00 0.00 0.00 3.51
4721 9536 0.107831 TTCCAAGAACACCCCTCACG 59.892 55.000 0.00 0.00 0.00 4.35
4722 9537 0.761323 TCCAAGAACACCCCTCACGA 60.761 55.000 0.00 0.00 0.00 4.35
4723 9538 0.324943 CCAAGAACACCCCTCACGAT 59.675 55.000 0.00 0.00 0.00 3.73
4724 9539 1.271379 CCAAGAACACCCCTCACGATT 60.271 52.381 0.00 0.00 0.00 3.34
4725 9540 2.504367 CAAGAACACCCCTCACGATTT 58.496 47.619 0.00 0.00 0.00 2.17
4726 9541 2.884639 CAAGAACACCCCTCACGATTTT 59.115 45.455 0.00 0.00 0.00 1.82
4727 9542 4.069304 CAAGAACACCCCTCACGATTTTA 58.931 43.478 0.00 0.00 0.00 1.52
4728 9543 4.569719 AGAACACCCCTCACGATTTTAT 57.430 40.909 0.00 0.00 0.00 1.40
4729 9544 4.918588 AGAACACCCCTCACGATTTTATT 58.081 39.130 0.00 0.00 0.00 1.40
4730 9545 4.941873 AGAACACCCCTCACGATTTTATTC 59.058 41.667 0.00 0.00 0.00 1.75
4731 9546 4.295141 ACACCCCTCACGATTTTATTCA 57.705 40.909 0.00 0.00 0.00 2.57
4732 9547 4.658063 ACACCCCTCACGATTTTATTCAA 58.342 39.130 0.00 0.00 0.00 2.69
4733 9548 5.074115 ACACCCCTCACGATTTTATTCAAA 58.926 37.500 0.00 0.00 0.00 2.69
4734 9549 5.536916 ACACCCCTCACGATTTTATTCAAAA 59.463 36.000 0.00 0.00 38.00 2.44
4735 9550 6.210584 ACACCCCTCACGATTTTATTCAAAAT 59.789 34.615 0.00 0.00 45.06 1.82
4736 9551 7.096551 CACCCCTCACGATTTTATTCAAAATT 58.903 34.615 0.00 0.00 42.97 1.82
4737 9552 8.247562 CACCCCTCACGATTTTATTCAAAATTA 58.752 33.333 0.00 0.00 42.97 1.40
4738 9553 8.808092 ACCCCTCACGATTTTATTCAAAATTAA 58.192 29.630 0.00 0.00 42.97 1.40
4739 9554 9.301153 CCCCTCACGATTTTATTCAAAATTAAG 57.699 33.333 0.00 0.00 42.97 1.85
4740 9555 9.855021 CCCTCACGATTTTATTCAAAATTAAGT 57.145 29.630 0.00 0.00 42.97 2.24
4743 9558 9.684448 TCACGATTTTATTCAAAATTAAGTGCA 57.316 25.926 14.81 0.00 42.97 4.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
13 14 3.319972 CCCAAAGCGATCAAATCCATGAT 59.680 43.478 0.00 0.00 42.62 2.45
14 15 2.689471 CCCAAAGCGATCAAATCCATGA 59.311 45.455 0.00 0.00 0.00 3.07
15 16 2.223876 CCCCAAAGCGATCAAATCCATG 60.224 50.000 0.00 0.00 0.00 3.66
16 17 2.034124 CCCCAAAGCGATCAAATCCAT 58.966 47.619 0.00 0.00 0.00 3.41
17 18 1.272425 ACCCCAAAGCGATCAAATCCA 60.272 47.619 0.00 0.00 0.00 3.41
18 19 1.474330 ACCCCAAAGCGATCAAATCC 58.526 50.000 0.00 0.00 0.00 3.01
19 20 3.592898 AAACCCCAAAGCGATCAAATC 57.407 42.857 0.00 0.00 0.00 2.17
20 21 4.350368 AAAAACCCCAAAGCGATCAAAT 57.650 36.364 0.00 0.00 0.00 2.32
21 22 3.828875 AAAAACCCCAAAGCGATCAAA 57.171 38.095 0.00 0.00 0.00 2.69
39 40 3.909732 TGCCCAGAGAGGAAAAGAAAAA 58.090 40.909 0.00 0.00 41.22 1.94
40 41 3.593442 TGCCCAGAGAGGAAAAGAAAA 57.407 42.857 0.00 0.00 41.22 2.29
41 42 3.814504 ATGCCCAGAGAGGAAAAGAAA 57.185 42.857 0.00 0.00 41.22 2.52
42 43 3.846588 ACTATGCCCAGAGAGGAAAAGAA 59.153 43.478 0.00 0.00 41.22 2.52
43 44 3.454858 ACTATGCCCAGAGAGGAAAAGA 58.545 45.455 0.00 0.00 41.22 2.52
44 45 3.922171 ACTATGCCCAGAGAGGAAAAG 57.078 47.619 0.00 0.00 41.22 2.27
45 46 4.657814 AAACTATGCCCAGAGAGGAAAA 57.342 40.909 0.00 0.00 41.22 2.29
46 47 4.335416 CAAAACTATGCCCAGAGAGGAAA 58.665 43.478 0.00 0.00 41.22 3.13
47 48 3.308402 CCAAAACTATGCCCAGAGAGGAA 60.308 47.826 0.00 0.00 41.22 3.36
48 49 2.239654 CCAAAACTATGCCCAGAGAGGA 59.760 50.000 0.00 0.00 41.22 3.71
49 50 2.025887 ACCAAAACTATGCCCAGAGAGG 60.026 50.000 0.00 0.00 37.03 3.69
50 51 3.054802 AGACCAAAACTATGCCCAGAGAG 60.055 47.826 0.00 0.00 0.00 3.20
51 52 2.912956 AGACCAAAACTATGCCCAGAGA 59.087 45.455 0.00 0.00 0.00 3.10
52 53 3.356529 AGACCAAAACTATGCCCAGAG 57.643 47.619 0.00 0.00 0.00 3.35
53 54 3.806949 AAGACCAAAACTATGCCCAGA 57.193 42.857 0.00 0.00 0.00 3.86
54 55 4.636206 GTCTAAGACCAAAACTATGCCCAG 59.364 45.833 0.00 0.00 0.00 4.45
55 56 4.585879 GTCTAAGACCAAAACTATGCCCA 58.414 43.478 0.00 0.00 0.00 5.36
56 57 3.621715 CGTCTAAGACCAAAACTATGCCC 59.378 47.826 0.00 0.00 0.00 5.36
57 58 4.329256 GTCGTCTAAGACCAAAACTATGCC 59.671 45.833 0.00 0.00 35.22 4.40
58 59 5.169295 AGTCGTCTAAGACCAAAACTATGC 58.831 41.667 0.00 0.00 41.83 3.14
59 60 7.653767 AAAGTCGTCTAAGACCAAAACTATG 57.346 36.000 0.00 0.00 41.83 2.23
60 61 7.540055 CGTAAAGTCGTCTAAGACCAAAACTAT 59.460 37.037 0.00 0.00 41.83 2.12
61 62 6.857964 CGTAAAGTCGTCTAAGACCAAAACTA 59.142 38.462 0.00 0.00 41.83 2.24
62 63 5.689068 CGTAAAGTCGTCTAAGACCAAAACT 59.311 40.000 0.00 0.00 41.83 2.66
63 64 5.107722 CCGTAAAGTCGTCTAAGACCAAAAC 60.108 44.000 0.00 0.00 41.83 2.43
64 65 4.984161 CCGTAAAGTCGTCTAAGACCAAAA 59.016 41.667 0.00 0.00 41.83 2.44
65 66 4.549458 CCGTAAAGTCGTCTAAGACCAAA 58.451 43.478 0.00 0.00 41.83 3.28
66 67 3.057315 CCCGTAAAGTCGTCTAAGACCAA 60.057 47.826 0.00 0.00 41.83 3.67
67 68 2.489329 CCCGTAAAGTCGTCTAAGACCA 59.511 50.000 0.00 0.00 41.83 4.02
68 69 2.489722 ACCCGTAAAGTCGTCTAAGACC 59.510 50.000 0.00 0.00 41.83 3.85
69 70 3.057946 ACACCCGTAAAGTCGTCTAAGAC 60.058 47.826 0.00 0.00 41.23 3.01
70 71 3.149196 ACACCCGTAAAGTCGTCTAAGA 58.851 45.455 0.00 0.00 0.00 2.10
71 72 3.565905 ACACCCGTAAAGTCGTCTAAG 57.434 47.619 0.00 0.00 0.00 2.18
72 73 4.050553 CAAACACCCGTAAAGTCGTCTAA 58.949 43.478 0.00 0.00 0.00 2.10
73 74 3.068024 ACAAACACCCGTAAAGTCGTCTA 59.932 43.478 0.00 0.00 0.00 2.59
74 75 2.159057 ACAAACACCCGTAAAGTCGTCT 60.159 45.455 0.00 0.00 0.00 4.18
75 76 2.033492 CACAAACACCCGTAAAGTCGTC 60.033 50.000 0.00 0.00 0.00 4.20
76 77 1.935199 CACAAACACCCGTAAAGTCGT 59.065 47.619 0.00 0.00 0.00 4.34
77 78 1.935199 ACACAAACACCCGTAAAGTCG 59.065 47.619 0.00 0.00 0.00 4.18
78 79 2.032426 CCACACAAACACCCGTAAAGTC 59.968 50.000 0.00 0.00 0.00 3.01
79 80 2.018515 CCACACAAACACCCGTAAAGT 58.981 47.619 0.00 0.00 0.00 2.66
80 81 1.335496 CCCACACAAACACCCGTAAAG 59.665 52.381 0.00 0.00 0.00 1.85
81 82 1.340795 ACCCACACAAACACCCGTAAA 60.341 47.619 0.00 0.00 0.00 2.01
82 83 0.255318 ACCCACACAAACACCCGTAA 59.745 50.000 0.00 0.00 0.00 3.18
83 84 0.464013 CACCCACACAAACACCCGTA 60.464 55.000 0.00 0.00 0.00 4.02
84 85 1.751162 CACCCACACAAACACCCGT 60.751 57.895 0.00 0.00 0.00 5.28
85 86 1.751162 ACACCCACACAAACACCCG 60.751 57.895 0.00 0.00 0.00 5.28
86 87 0.968393 ACACACCCACACAAACACCC 60.968 55.000 0.00 0.00 0.00 4.61
87 88 0.172352 CACACACCCACACAAACACC 59.828 55.000 0.00 0.00 0.00 4.16
88 89 0.885196 ACACACACCCACACAAACAC 59.115 50.000 0.00 0.00 0.00 3.32
89 90 0.884514 CACACACACCCACACAAACA 59.115 50.000 0.00 0.00 0.00 2.83
90 91 0.457681 GCACACACACCCACACAAAC 60.458 55.000 0.00 0.00 0.00 2.93
91 92 1.599606 GGCACACACACCCACACAAA 61.600 55.000 0.00 0.00 0.00 2.83
92 93 2.049185 GGCACACACACCCACACAA 61.049 57.895 0.00 0.00 0.00 3.33
93 94 2.439338 GGCACACACACCCACACA 60.439 61.111 0.00 0.00 0.00 3.72
94 95 3.216292 GGGCACACACACCCACAC 61.216 66.667 0.00 0.00 46.22 3.82
112 113 2.100631 ACACCTATCAGCAACGCGC 61.101 57.895 5.73 0.00 42.91 6.86
113 114 1.014044 ACACACCTATCAGCAACGCG 61.014 55.000 3.53 3.53 0.00 6.01
114 115 0.443869 CACACACCTATCAGCAACGC 59.556 55.000 0.00 0.00 0.00 4.84
115 116 0.443869 GCACACACCTATCAGCAACG 59.556 55.000 0.00 0.00 0.00 4.10
116 117 1.522668 TGCACACACCTATCAGCAAC 58.477 50.000 0.00 0.00 0.00 4.17
117 118 2.495155 ATGCACACACCTATCAGCAA 57.505 45.000 0.00 0.00 35.45 3.91
118 119 2.026915 AGAATGCACACACCTATCAGCA 60.027 45.455 0.00 0.00 36.34 4.41
119 120 2.636830 AGAATGCACACACCTATCAGC 58.363 47.619 0.00 0.00 0.00 4.26
120 121 4.122776 GGTAGAATGCACACACCTATCAG 58.877 47.826 0.00 0.00 0.00 2.90
121 122 3.774766 AGGTAGAATGCACACACCTATCA 59.225 43.478 8.87 0.00 37.85 2.15
122 123 4.408182 AGGTAGAATGCACACACCTATC 57.592 45.455 8.87 0.00 37.85 2.08
124 125 5.276461 CATAGGTAGAATGCACACACCTA 57.724 43.478 16.40 16.40 43.94 3.08
125 126 4.142609 CATAGGTAGAATGCACACACCT 57.857 45.455 13.73 13.73 42.25 4.00
141 142 0.176680 ACGCTTGACCTCTGCATAGG 59.823 55.000 16.24 16.24 42.82 2.57
142 143 2.871182 TACGCTTGACCTCTGCATAG 57.129 50.000 0.00 0.00 0.00 2.23
143 144 2.803133 GCATACGCTTGACCTCTGCATA 60.803 50.000 0.00 0.00 34.30 3.14
144 145 1.945387 CATACGCTTGACCTCTGCAT 58.055 50.000 0.00 0.00 0.00 3.96
145 146 0.740868 GCATACGCTTGACCTCTGCA 60.741 55.000 0.00 0.00 34.30 4.41
146 147 2.009888 GCATACGCTTGACCTCTGC 58.990 57.895 0.00 0.00 34.30 4.26
157 158 2.900122 ACAACACAATGAGCATACGC 57.100 45.000 0.00 0.00 38.99 4.42
158 159 5.973651 AGATACAACACAATGAGCATACG 57.026 39.130 0.00 0.00 0.00 3.06
159 160 8.331022 CAAGTAGATACAACACAATGAGCATAC 58.669 37.037 0.00 0.00 0.00 2.39
160 161 8.257306 TCAAGTAGATACAACACAATGAGCATA 58.743 33.333 0.00 0.00 0.00 3.14
161 162 7.105588 TCAAGTAGATACAACACAATGAGCAT 58.894 34.615 0.00 0.00 0.00 3.79
162 163 6.463360 TCAAGTAGATACAACACAATGAGCA 58.537 36.000 0.00 0.00 0.00 4.26
163 164 6.968131 TCAAGTAGATACAACACAATGAGC 57.032 37.500 0.00 0.00 0.00 4.26
164 165 9.376075 AGAATCAAGTAGATACAACACAATGAG 57.624 33.333 0.00 0.00 35.39 2.90
165 166 9.725019 AAGAATCAAGTAGATACAACACAATGA 57.275 29.630 0.00 0.00 35.39 2.57
166 167 9.979270 GAAGAATCAAGTAGATACAACACAATG 57.021 33.333 0.00 0.00 35.39 2.82
167 168 9.725019 TGAAGAATCAAGTAGATACAACACAAT 57.275 29.630 0.00 0.00 35.39 2.71
168 169 9.725019 ATGAAGAATCAAGTAGATACAACACAA 57.275 29.630 0.00 0.00 39.49 3.33
169 170 9.725019 AATGAAGAATCAAGTAGATACAACACA 57.275 29.630 0.00 0.00 39.49 3.72
219 220 9.719279 CGGACTACACACTTTTATTTTTAACAA 57.281 29.630 0.00 0.00 0.00 2.83
220 221 9.107177 TCGGACTACACACTTTTATTTTTAACA 57.893 29.630 0.00 0.00 0.00 2.41
223 224 8.723311 CCATCGGACTACACACTTTTATTTTTA 58.277 33.333 0.00 0.00 0.00 1.52
224 225 7.590279 CCATCGGACTACACACTTTTATTTTT 58.410 34.615 0.00 0.00 0.00 1.94
225 226 6.349033 GCCATCGGACTACACACTTTTATTTT 60.349 38.462 0.00 0.00 0.00 1.82
226 227 5.123344 GCCATCGGACTACACACTTTTATTT 59.877 40.000 0.00 0.00 0.00 1.40
227 228 4.634443 GCCATCGGACTACACACTTTTATT 59.366 41.667 0.00 0.00 0.00 1.40
228 229 4.189231 GCCATCGGACTACACACTTTTAT 58.811 43.478 0.00 0.00 0.00 1.40
229 230 3.592059 GCCATCGGACTACACACTTTTA 58.408 45.455 0.00 0.00 0.00 1.52
230 231 2.423577 GCCATCGGACTACACACTTTT 58.576 47.619 0.00 0.00 0.00 2.27
231 232 1.338769 GGCCATCGGACTACACACTTT 60.339 52.381 0.00 0.00 0.00 2.66
232 233 0.249398 GGCCATCGGACTACACACTT 59.751 55.000 0.00 0.00 0.00 3.16
233 234 1.614241 GGGCCATCGGACTACACACT 61.614 60.000 4.39 0.00 0.00 3.55
234 235 1.153429 GGGCCATCGGACTACACAC 60.153 63.158 4.39 0.00 0.00 3.82
235 236 1.610967 TGGGCCATCGGACTACACA 60.611 57.895 0.00 0.00 0.00 3.72
236 237 1.144057 CTGGGCCATCGGACTACAC 59.856 63.158 6.72 0.00 0.00 2.90
237 238 2.731571 GCTGGGCCATCGGACTACA 61.732 63.158 6.72 0.00 0.00 2.74
238 239 2.109181 GCTGGGCCATCGGACTAC 59.891 66.667 6.72 0.00 0.00 2.73
239 240 1.971505 CTTGCTGGGCCATCGGACTA 61.972 60.000 6.72 0.00 0.00 2.59
240 241 3.329889 TTGCTGGGCCATCGGACT 61.330 61.111 6.72 0.00 0.00 3.85
241 242 2.825836 CTTGCTGGGCCATCGGAC 60.826 66.667 6.72 0.00 0.00 4.79
242 243 2.819984 GAACTTGCTGGGCCATCGGA 62.820 60.000 6.72 0.00 0.00 4.55
243 244 2.361610 AACTTGCTGGGCCATCGG 60.362 61.111 6.72 2.35 0.00 4.18
244 245 2.409870 GGAACTTGCTGGGCCATCG 61.410 63.158 6.72 0.00 0.00 3.84
245 246 1.304381 TGGAACTTGCTGGGCCATC 60.304 57.895 6.72 2.53 0.00 3.51
246 247 1.304713 CTGGAACTTGCTGGGCCAT 60.305 57.895 6.72 0.00 0.00 4.40
247 248 2.115910 CTGGAACTTGCTGGGCCA 59.884 61.111 5.85 5.85 0.00 5.36
248 249 2.677875 CCTGGAACTTGCTGGGCC 60.678 66.667 0.00 0.00 0.00 5.80
249 250 2.677875 CCCTGGAACTTGCTGGGC 60.678 66.667 11.60 0.00 39.82 5.36
250 251 0.178964 TTTCCCTGGAACTTGCTGGG 60.179 55.000 16.57 16.57 46.05 4.45
251 252 1.703411 TTTTCCCTGGAACTTGCTGG 58.297 50.000 0.00 0.00 33.41 4.85
252 253 2.892852 TCATTTTCCCTGGAACTTGCTG 59.107 45.455 0.00 0.00 33.41 4.41
253 254 3.160269 CTCATTTTCCCTGGAACTTGCT 58.840 45.455 0.00 0.00 33.41 3.91
254 255 3.157087 TCTCATTTTCCCTGGAACTTGC 58.843 45.455 0.00 0.00 33.41 4.01
255 256 4.021981 GGTTCTCATTTTCCCTGGAACTTG 60.022 45.833 0.00 0.00 35.07 3.16
256 257 4.152647 GGTTCTCATTTTCCCTGGAACTT 58.847 43.478 0.00 0.00 35.07 2.66
257 258 3.500471 GGGTTCTCATTTTCCCTGGAACT 60.500 47.826 0.00 0.00 37.18 3.01
258 259 2.826128 GGGTTCTCATTTTCCCTGGAAC 59.174 50.000 0.00 0.00 37.18 3.62
259 260 3.169512 GGGTTCTCATTTTCCCTGGAA 57.830 47.619 0.00 0.00 37.18 3.53
260 261 2.899303 GGGTTCTCATTTTCCCTGGA 57.101 50.000 0.00 0.00 37.18 3.86
272 273 1.909700 TTGTGCCATTGAGGGTTCTC 58.090 50.000 0.00 0.00 40.36 2.87
273 274 2.242043 CTTTGTGCCATTGAGGGTTCT 58.758 47.619 0.00 0.00 38.09 3.01
274 275 1.963515 ACTTTGTGCCATTGAGGGTTC 59.036 47.619 0.00 0.00 38.09 3.62
275 276 1.963515 GACTTTGTGCCATTGAGGGTT 59.036 47.619 0.00 0.00 38.09 4.11
276 277 1.145738 AGACTTTGTGCCATTGAGGGT 59.854 47.619 0.00 0.00 38.09 4.34
277 278 1.915141 AGACTTTGTGCCATTGAGGG 58.085 50.000 0.00 0.00 38.09 4.30
278 279 4.946157 AGATAAGACTTTGTGCCATTGAGG 59.054 41.667 0.00 0.00 41.84 3.86
279 280 6.820656 AGTAGATAAGACTTTGTGCCATTGAG 59.179 38.462 0.00 0.00 0.00 3.02
280 281 6.711277 AGTAGATAAGACTTTGTGCCATTGA 58.289 36.000 0.00 0.00 0.00 2.57
281 282 6.037610 GGAGTAGATAAGACTTTGTGCCATTG 59.962 42.308 0.00 0.00 0.00 2.82
282 283 6.116126 GGAGTAGATAAGACTTTGTGCCATT 58.884 40.000 0.00 0.00 0.00 3.16
283 284 5.189736 TGGAGTAGATAAGACTTTGTGCCAT 59.810 40.000 0.00 0.00 0.00 4.40
284 285 4.530553 TGGAGTAGATAAGACTTTGTGCCA 59.469 41.667 0.00 0.00 0.00 4.92
285 286 5.086104 TGGAGTAGATAAGACTTTGTGCC 57.914 43.478 0.00 0.00 0.00 5.01
286 287 5.755861 GGATGGAGTAGATAAGACTTTGTGC 59.244 44.000 0.00 0.00 0.00 4.57
287 288 5.980116 CGGATGGAGTAGATAAGACTTTGTG 59.020 44.000 0.00 0.00 0.00 3.33
288 289 5.657302 ACGGATGGAGTAGATAAGACTTTGT 59.343 40.000 0.00 0.00 0.00 2.83
289 290 6.150396 ACGGATGGAGTAGATAAGACTTTG 57.850 41.667 0.00 0.00 0.00 2.77
290 291 6.183360 GGAACGGATGGAGTAGATAAGACTTT 60.183 42.308 0.00 0.00 0.00 2.66
291 292 5.302313 GGAACGGATGGAGTAGATAAGACTT 59.698 44.000 0.00 0.00 0.00 3.01
292 293 4.828387 GGAACGGATGGAGTAGATAAGACT 59.172 45.833 0.00 0.00 0.00 3.24
293 294 4.828387 AGGAACGGATGGAGTAGATAAGAC 59.172 45.833 0.00 0.00 0.00 3.01
294 295 5.063017 AGGAACGGATGGAGTAGATAAGA 57.937 43.478 0.00 0.00 0.00 2.10
295 296 6.896021 TTAGGAACGGATGGAGTAGATAAG 57.104 41.667 0.00 0.00 0.00 1.73
296 297 7.850935 ATTTAGGAACGGATGGAGTAGATAA 57.149 36.000 0.00 0.00 0.00 1.75
297 298 9.543231 AATATTTAGGAACGGATGGAGTAGATA 57.457 33.333 0.00 0.00 0.00 1.98
298 299 8.437274 AATATTTAGGAACGGATGGAGTAGAT 57.563 34.615 0.00 0.00 0.00 1.98
299 300 7.850935 AATATTTAGGAACGGATGGAGTAGA 57.149 36.000 0.00 0.00 0.00 2.59
300 301 7.931948 ACAAATATTTAGGAACGGATGGAGTAG 59.068 37.037 0.00 0.00 0.00 2.57
301 302 7.798071 ACAAATATTTAGGAACGGATGGAGTA 58.202 34.615 0.00 0.00 0.00 2.59
302 303 6.659824 ACAAATATTTAGGAACGGATGGAGT 58.340 36.000 0.00 0.00 0.00 3.85
303 304 6.992715 AGACAAATATTTAGGAACGGATGGAG 59.007 38.462 0.00 0.00 0.00 3.86
304 305 6.895782 AGACAAATATTTAGGAACGGATGGA 58.104 36.000 0.00 0.00 0.00 3.41
305 306 7.568199 AAGACAAATATTTAGGAACGGATGG 57.432 36.000 0.00 0.00 0.00 3.51
306 307 8.893727 AGAAAGACAAATATTTAGGAACGGATG 58.106 33.333 0.00 0.00 0.00 3.51
308 309 9.595823 CTAGAAAGACAAATATTTAGGAACGGA 57.404 33.333 0.00 0.00 0.00 4.69
309 310 9.595823 TCTAGAAAGACAAATATTTAGGAACGG 57.404 33.333 0.00 0.00 0.00 4.44
322 323 9.396022 ACTTGTTGAAATCTCTAGAAAGACAAA 57.604 29.630 0.00 0.00 0.00 2.83
323 324 8.830580 CACTTGTTGAAATCTCTAGAAAGACAA 58.169 33.333 0.00 0.00 0.00 3.18
324 325 8.204160 TCACTTGTTGAAATCTCTAGAAAGACA 58.796 33.333 0.00 0.00 0.00 3.41
325 326 8.491950 GTCACTTGTTGAAATCTCTAGAAAGAC 58.508 37.037 0.00 0.00 35.39 3.01
326 327 8.424918 AGTCACTTGTTGAAATCTCTAGAAAGA 58.575 33.333 0.00 0.00 35.39 2.52
327 328 8.600449 AGTCACTTGTTGAAATCTCTAGAAAG 57.400 34.615 0.00 0.00 35.39 2.62
328 329 9.477484 GTAGTCACTTGTTGAAATCTCTAGAAA 57.523 33.333 0.00 0.00 35.39 2.52
329 330 8.638873 TGTAGTCACTTGTTGAAATCTCTAGAA 58.361 33.333 0.00 0.00 35.39 2.10
330 331 8.178313 TGTAGTCACTTGTTGAAATCTCTAGA 57.822 34.615 0.00 0.00 35.39 2.43
331 332 8.994429 ATGTAGTCACTTGTTGAAATCTCTAG 57.006 34.615 0.00 0.00 35.39 2.43
332 333 9.856488 GTATGTAGTCACTTGTTGAAATCTCTA 57.144 33.333 0.00 0.00 35.39 2.43
333 334 7.542477 CGTATGTAGTCACTTGTTGAAATCTCT 59.458 37.037 0.00 0.00 35.39 3.10
334 335 7.201444 CCGTATGTAGTCACTTGTTGAAATCTC 60.201 40.741 0.00 0.00 35.39 2.75
335 336 6.590292 CCGTATGTAGTCACTTGTTGAAATCT 59.410 38.462 0.00 0.00 35.39 2.40
336 337 6.183360 CCCGTATGTAGTCACTTGTTGAAATC 60.183 42.308 0.00 0.00 35.39 2.17
337 338 5.642063 CCCGTATGTAGTCACTTGTTGAAAT 59.358 40.000 0.00 0.00 35.39 2.17
338 339 4.992319 CCCGTATGTAGTCACTTGTTGAAA 59.008 41.667 0.00 0.00 35.39 2.69
339 340 4.561938 CCCCGTATGTAGTCACTTGTTGAA 60.562 45.833 0.00 0.00 35.39 2.69
340 341 3.056393 CCCCGTATGTAGTCACTTGTTGA 60.056 47.826 0.00 0.00 0.00 3.18
341 342 3.259064 CCCCGTATGTAGTCACTTGTTG 58.741 50.000 0.00 0.00 0.00 3.33
342 343 2.354403 GCCCCGTATGTAGTCACTTGTT 60.354 50.000 0.00 0.00 0.00 2.83
343 344 1.206371 GCCCCGTATGTAGTCACTTGT 59.794 52.381 0.00 0.00 0.00 3.16
344 345 1.206132 TGCCCCGTATGTAGTCACTTG 59.794 52.381 0.00 0.00 0.00 3.16
345 346 1.563924 TGCCCCGTATGTAGTCACTT 58.436 50.000 0.00 0.00 0.00 3.16
346 347 1.563924 TTGCCCCGTATGTAGTCACT 58.436 50.000 0.00 0.00 0.00 3.41
347 348 2.389962 TTTGCCCCGTATGTAGTCAC 57.610 50.000 0.00 0.00 0.00 3.67
348 349 3.055021 TCATTTTGCCCCGTATGTAGTCA 60.055 43.478 0.00 0.00 0.00 3.41
349 350 3.537580 TCATTTTGCCCCGTATGTAGTC 58.462 45.455 0.00 0.00 0.00 2.59
350 351 3.637911 TCATTTTGCCCCGTATGTAGT 57.362 42.857 0.00 0.00 0.00 2.73
351 352 4.578516 TCATTCATTTTGCCCCGTATGTAG 59.421 41.667 0.00 0.00 0.00 2.74
352 353 4.527944 TCATTCATTTTGCCCCGTATGTA 58.472 39.130 0.00 0.00 0.00 2.29
353 354 3.360867 TCATTCATTTTGCCCCGTATGT 58.639 40.909 0.00 0.00 0.00 2.29
354 355 4.383850 TTCATTCATTTTGCCCCGTATG 57.616 40.909 0.00 0.00 0.00 2.39
355 356 4.895297 AGATTCATTCATTTTGCCCCGTAT 59.105 37.500 0.00 0.00 0.00 3.06
356 357 4.277476 AGATTCATTCATTTTGCCCCGTA 58.723 39.130 0.00 0.00 0.00 4.02
357 358 3.099141 AGATTCATTCATTTTGCCCCGT 58.901 40.909 0.00 0.00 0.00 5.28
358 359 3.806625 AGATTCATTCATTTTGCCCCG 57.193 42.857 0.00 0.00 0.00 5.73
359 360 5.351458 GTGTAGATTCATTCATTTTGCCCC 58.649 41.667 0.00 0.00 0.00 5.80
360 361 5.351458 GGTGTAGATTCATTCATTTTGCCC 58.649 41.667 0.00 0.00 0.00 5.36
361 362 5.127682 AGGGTGTAGATTCATTCATTTTGCC 59.872 40.000 0.00 0.00 0.00 4.52
362 363 6.212888 AGGGTGTAGATTCATTCATTTTGC 57.787 37.500 0.00 0.00 0.00 3.68
380 381 9.490379 GGATGTATGTAGACTTATTTTAGGGTG 57.510 37.037 0.00 0.00 0.00 4.61
381 382 8.365647 CGGATGTATGTAGACTTATTTTAGGGT 58.634 37.037 0.00 0.00 0.00 4.34
382 383 8.365647 ACGGATGTATGTAGACTTATTTTAGGG 58.634 37.037 0.00 0.00 0.00 3.53
399 400 4.746535 TGGACACAACATACGGATGTAT 57.253 40.909 15.10 2.23 45.93 2.29
400 401 4.746535 ATGGACACAACATACGGATGTA 57.253 40.909 15.10 0.00 45.93 2.29
402 403 4.394610 TCAAATGGACACAACATACGGATG 59.605 41.667 5.94 5.94 39.16 3.51
403 404 4.584874 TCAAATGGACACAACATACGGAT 58.415 39.130 0.00 0.00 0.00 4.18
404 405 4.009370 TCAAATGGACACAACATACGGA 57.991 40.909 0.00 0.00 0.00 4.69
405 406 4.757799 TTCAAATGGACACAACATACGG 57.242 40.909 0.00 0.00 0.00 4.02
406 407 5.060816 GCATTTCAAATGGACACAACATACG 59.939 40.000 12.14 0.00 0.00 3.06
407 408 5.348451 GGCATTTCAAATGGACACAACATAC 59.652 40.000 12.14 0.00 0.00 2.39
408 409 5.245751 AGGCATTTCAAATGGACACAACATA 59.754 36.000 12.14 0.00 0.00 2.29
409 410 4.040706 AGGCATTTCAAATGGACACAACAT 59.959 37.500 12.14 0.00 0.00 2.71
410 411 3.387374 AGGCATTTCAAATGGACACAACA 59.613 39.130 12.14 0.00 0.00 3.33
411 412 3.993920 AGGCATTTCAAATGGACACAAC 58.006 40.909 12.14 0.00 0.00 3.32
412 413 5.076182 TCTAGGCATTTCAAATGGACACAA 58.924 37.500 12.14 0.00 0.00 3.33
413 414 4.661222 TCTAGGCATTTCAAATGGACACA 58.339 39.130 12.14 0.00 0.00 3.72
414 415 5.643379 TTCTAGGCATTTCAAATGGACAC 57.357 39.130 12.14 0.00 0.00 3.67
415 416 6.009589 TCTTTCTAGGCATTTCAAATGGACA 58.990 36.000 12.14 0.00 0.00 4.02
416 417 6.071952 TGTCTTTCTAGGCATTTCAAATGGAC 60.072 38.462 12.14 8.23 29.10 4.02
417 418 6.009589 TGTCTTTCTAGGCATTTCAAATGGA 58.990 36.000 12.14 0.00 29.10 3.41
418 419 6.271488 TGTCTTTCTAGGCATTTCAAATGG 57.729 37.500 12.14 0.00 29.10 3.16
419 420 7.652909 TGTTTGTCTTTCTAGGCATTTCAAATG 59.347 33.333 5.68 5.68 35.56 2.32
420 421 7.725251 TGTTTGTCTTTCTAGGCATTTCAAAT 58.275 30.769 0.00 0.00 35.56 2.32
421 422 7.106439 TGTTTGTCTTTCTAGGCATTTCAAA 57.894 32.000 0.00 0.00 35.56 2.69
422 423 6.707440 TGTTTGTCTTTCTAGGCATTTCAA 57.293 33.333 0.00 0.00 35.56 2.69
423 424 6.899393 ATGTTTGTCTTTCTAGGCATTTCA 57.101 33.333 0.00 0.00 35.56 2.69
424 425 7.867403 TGAAATGTTTGTCTTTCTAGGCATTTC 59.133 33.333 15.47 15.47 45.06 2.17
425 426 7.725251 TGAAATGTTTGTCTTTCTAGGCATTT 58.275 30.769 0.00 0.00 35.56 2.32
426 427 7.231317 TCTGAAATGTTTGTCTTTCTAGGCATT 59.769 33.333 0.00 0.00 35.56 3.56
427 428 6.716628 TCTGAAATGTTTGTCTTTCTAGGCAT 59.283 34.615 0.00 0.00 35.56 4.40
428 429 6.061441 TCTGAAATGTTTGTCTTTCTAGGCA 58.939 36.000 0.00 0.00 33.22 4.75
429 430 6.560253 TCTGAAATGTTTGTCTTTCTAGGC 57.440 37.500 0.00 0.00 33.50 3.93
430 431 7.072030 CGTTCTGAAATGTTTGTCTTTCTAGG 58.928 38.462 0.00 0.00 33.50 3.02
431 432 7.042051 TCCGTTCTGAAATGTTTGTCTTTCTAG 60.042 37.037 0.00 0.00 33.50 2.43
432 433 6.764085 TCCGTTCTGAAATGTTTGTCTTTCTA 59.236 34.615 0.00 0.00 33.50 2.10
433 434 5.588648 TCCGTTCTGAAATGTTTGTCTTTCT 59.411 36.000 0.00 0.00 33.50 2.52
434 435 5.816919 TCCGTTCTGAAATGTTTGTCTTTC 58.183 37.500 0.00 0.00 33.06 2.62
435 436 5.221048 CCTCCGTTCTGAAATGTTTGTCTTT 60.221 40.000 0.00 0.00 0.00 2.52
436 437 4.275936 CCTCCGTTCTGAAATGTTTGTCTT 59.724 41.667 0.00 0.00 0.00 3.01
437 438 3.815401 CCTCCGTTCTGAAATGTTTGTCT 59.185 43.478 0.00 0.00 0.00 3.41
438 439 3.058224 CCCTCCGTTCTGAAATGTTTGTC 60.058 47.826 0.00 0.00 0.00 3.18
439 440 2.884639 CCCTCCGTTCTGAAATGTTTGT 59.115 45.455 0.00 0.00 0.00 2.83
440 441 3.146066 TCCCTCCGTTCTGAAATGTTTG 58.854 45.455 0.00 0.00 0.00 2.93
441 442 3.181443 ACTCCCTCCGTTCTGAAATGTTT 60.181 43.478 0.00 0.00 0.00 2.83
442 443 2.372172 ACTCCCTCCGTTCTGAAATGTT 59.628 45.455 0.00 0.00 0.00 2.71
443 444 1.978580 ACTCCCTCCGTTCTGAAATGT 59.021 47.619 0.00 0.00 0.00 2.71
444 445 2.770164 ACTCCCTCCGTTCTGAAATG 57.230 50.000 0.00 0.00 0.00 2.32
445 446 4.290942 AGATACTCCCTCCGTTCTGAAAT 58.709 43.478 0.00 0.00 0.00 2.17
446 447 3.709587 AGATACTCCCTCCGTTCTGAAA 58.290 45.455 0.00 0.00 0.00 2.69
447 448 3.383698 AGATACTCCCTCCGTTCTGAA 57.616 47.619 0.00 0.00 0.00 3.02
448 449 3.288964 GAAGATACTCCCTCCGTTCTGA 58.711 50.000 0.00 0.00 0.00 3.27
449 450 2.362717 GGAAGATACTCCCTCCGTTCTG 59.637 54.545 0.00 0.00 0.00 3.02
450 451 2.024273 TGGAAGATACTCCCTCCGTTCT 60.024 50.000 0.00 0.00 34.22 3.01
451 452 2.385803 TGGAAGATACTCCCTCCGTTC 58.614 52.381 0.00 0.00 34.22 3.95
452 453 2.544844 TGGAAGATACTCCCTCCGTT 57.455 50.000 0.00 0.00 34.22 4.44
453 454 2.777459 ATGGAAGATACTCCCTCCGT 57.223 50.000 0.00 0.00 34.22 4.69
454 455 4.101741 AGAAAATGGAAGATACTCCCTCCG 59.898 45.833 0.00 0.00 34.22 4.63
455 456 5.372373 CAGAAAATGGAAGATACTCCCTCC 58.628 45.833 0.00 0.00 34.22 4.30
470 471 5.939883 TGATAGACACCAGTTCCAGAAAATG 59.060 40.000 0.00 0.00 32.75 2.32
471 472 6.126863 TGATAGACACCAGTTCCAGAAAAT 57.873 37.500 0.00 0.00 0.00 1.82
472 473 5.560722 TGATAGACACCAGTTCCAGAAAA 57.439 39.130 0.00 0.00 0.00 2.29
473 474 5.560722 TTGATAGACACCAGTTCCAGAAA 57.439 39.130 0.00 0.00 0.00 2.52
474 475 5.560722 TTTGATAGACACCAGTTCCAGAA 57.439 39.130 0.00 0.00 0.00 3.02
475 476 5.560722 TTTTGATAGACACCAGTTCCAGA 57.439 39.130 0.00 0.00 0.00 3.86
476 477 6.430925 TGAATTTTGATAGACACCAGTTCCAG 59.569 38.462 0.00 0.00 0.00 3.86
477 478 6.303054 TGAATTTTGATAGACACCAGTTCCA 58.697 36.000 0.00 0.00 0.00 3.53
478 479 6.817765 TGAATTTTGATAGACACCAGTTCC 57.182 37.500 0.00 0.00 0.00 3.62
481 482 8.906867 CCAATATGAATTTTGATAGACACCAGT 58.093 33.333 0.00 0.00 0.00 4.00
482 483 9.123902 TCCAATATGAATTTTGATAGACACCAG 57.876 33.333 0.00 0.00 0.00 4.00
483 484 9.645128 ATCCAATATGAATTTTGATAGACACCA 57.355 29.630 0.00 0.00 0.00 4.17
496 497 9.745018 CCAGTATTCCAGTATCCAATATGAATT 57.255 33.333 0.00 0.00 0.00 2.17
497 498 9.116080 TCCAGTATTCCAGTATCCAATATGAAT 57.884 33.333 0.00 0.00 0.00 2.57
498 499 8.504811 TCCAGTATTCCAGTATCCAATATGAA 57.495 34.615 0.00 0.00 0.00 2.57
499 500 8.685257 ATCCAGTATTCCAGTATCCAATATGA 57.315 34.615 0.00 0.00 0.00 2.15
500 501 9.823647 GTATCCAGTATTCCAGTATCCAATATG 57.176 37.037 0.00 0.00 0.00 1.78
501 502 9.560860 TGTATCCAGTATTCCAGTATCCAATAT 57.439 33.333 0.00 0.00 0.00 1.28
502 503 8.966155 TGTATCCAGTATTCCAGTATCCAATA 57.034 34.615 0.00 0.00 0.00 1.90
503 504 7.872061 TGTATCCAGTATTCCAGTATCCAAT 57.128 36.000 0.00 0.00 0.00 3.16
504 505 7.872061 ATGTATCCAGTATTCCAGTATCCAA 57.128 36.000 0.00 0.00 0.00 3.53
505 506 7.872061 AATGTATCCAGTATTCCAGTATCCA 57.128 36.000 0.00 0.00 0.00 3.41
506 507 8.598041 AGAAATGTATCCAGTATTCCAGTATCC 58.402 37.037 0.00 0.00 0.00 2.59
507 508 9.646427 GAGAAATGTATCCAGTATTCCAGTATC 57.354 37.037 0.00 0.00 0.00 2.24
508 509 9.159254 TGAGAAATGTATCCAGTATTCCAGTAT 57.841 33.333 0.00 0.00 0.00 2.12
509 510 8.547481 TGAGAAATGTATCCAGTATTCCAGTA 57.453 34.615 0.00 0.00 0.00 2.74
510 511 7.126421 ACTGAGAAATGTATCCAGTATTCCAGT 59.874 37.037 0.00 0.00 36.44 4.00
511 512 7.504403 ACTGAGAAATGTATCCAGTATTCCAG 58.496 38.462 0.00 0.00 36.44 3.86
512 513 7.437713 ACTGAGAAATGTATCCAGTATTCCA 57.562 36.000 0.00 0.00 36.44 3.53
513 514 8.738645 AAACTGAGAAATGTATCCAGTATTCC 57.261 34.615 0.00 0.00 37.12 3.01
521 522 9.803315 GGGAAAATTAAACTGAGAAATGTATCC 57.197 33.333 0.00 0.00 0.00 2.59
522 523 9.803315 GGGGAAAATTAAACTGAGAAATGTATC 57.197 33.333 0.00 0.00 0.00 2.24
523 524 8.466798 CGGGGAAAATTAAACTGAGAAATGTAT 58.533 33.333 0.00 0.00 0.00 2.29
524 525 7.666388 TCGGGGAAAATTAAACTGAGAAATGTA 59.334 33.333 0.00 0.00 0.00 2.29
525 526 6.492087 TCGGGGAAAATTAAACTGAGAAATGT 59.508 34.615 0.00 0.00 0.00 2.71
526 527 6.919721 TCGGGGAAAATTAAACTGAGAAATG 58.080 36.000 0.00 0.00 0.00 2.32
527 528 6.946009 TCTCGGGGAAAATTAAACTGAGAAAT 59.054 34.615 0.00 0.00 39.77 2.17
528 529 6.206048 GTCTCGGGGAAAATTAAACTGAGAAA 59.794 38.462 10.58 0.00 43.06 2.52
529 530 5.704053 GTCTCGGGGAAAATTAAACTGAGAA 59.296 40.000 10.58 0.00 43.06 2.87
530 531 5.243207 GTCTCGGGGAAAATTAAACTGAGA 58.757 41.667 0.00 0.00 40.27 3.27
531 532 4.092968 CGTCTCGGGGAAAATTAAACTGAG 59.907 45.833 0.00 0.00 36.22 3.35
532 533 3.998341 CGTCTCGGGGAAAATTAAACTGA 59.002 43.478 0.00 0.00 0.00 3.41
533 534 3.749609 ACGTCTCGGGGAAAATTAAACTG 59.250 43.478 0.00 0.00 0.00 3.16
534 535 4.011966 ACGTCTCGGGGAAAATTAAACT 57.988 40.909 0.00 0.00 0.00 2.66
535 536 5.179182 TGTTACGTCTCGGGGAAAATTAAAC 59.821 40.000 0.00 0.00 0.00 2.01
536 537 5.303971 TGTTACGTCTCGGGGAAAATTAAA 58.696 37.500 0.00 0.00 0.00 1.52
537 538 4.892433 TGTTACGTCTCGGGGAAAATTAA 58.108 39.130 0.00 0.00 0.00 1.40
538 539 4.533919 TGTTACGTCTCGGGGAAAATTA 57.466 40.909 0.00 0.00 0.00 1.40
539 540 3.405823 TGTTACGTCTCGGGGAAAATT 57.594 42.857 0.00 0.00 0.00 1.82
540 541 3.267483 CATGTTACGTCTCGGGGAAAAT 58.733 45.455 0.00 0.00 0.00 1.82
541 542 2.037511 ACATGTTACGTCTCGGGGAAAA 59.962 45.455 0.00 0.00 0.00 2.29
542 543 1.619827 ACATGTTACGTCTCGGGGAAA 59.380 47.619 0.00 0.00 0.00 3.13
543 544 1.259609 ACATGTTACGTCTCGGGGAA 58.740 50.000 0.00 0.00 0.00 3.97
544 545 1.259609 AACATGTTACGTCTCGGGGA 58.740 50.000 9.97 0.00 0.00 4.81
545 546 1.997606 GAAACATGTTACGTCTCGGGG 59.002 52.381 12.39 0.00 0.00 5.73
546 547 2.679450 TGAAACATGTTACGTCTCGGG 58.321 47.619 12.39 0.00 0.00 5.14
547 548 3.985279 TCTTGAAACATGTTACGTCTCGG 59.015 43.478 12.39 3.12 0.00 4.63
548 549 5.401376 TCTTCTTGAAACATGTTACGTCTCG 59.599 40.000 12.39 2.18 0.00 4.04
549 550 6.641314 TCTCTTCTTGAAACATGTTACGTCTC 59.359 38.462 12.39 5.89 0.00 3.36
550 551 6.513180 TCTCTTCTTGAAACATGTTACGTCT 58.487 36.000 12.39 0.00 0.00 4.18
551 552 6.764877 TCTCTTCTTGAAACATGTTACGTC 57.235 37.500 12.39 6.66 0.00 4.34
552 553 7.548196 TTTCTCTTCTTGAAACATGTTACGT 57.452 32.000 12.39 0.00 0.00 3.57
553 554 7.908082 TGTTTTCTCTTCTTGAAACATGTTACG 59.092 33.333 12.39 0.98 33.77 3.18
554 555 9.226345 CTGTTTTCTCTTCTTGAAACATGTTAC 57.774 33.333 12.39 1.54 33.77 2.50
555 556 8.956426 ACTGTTTTCTCTTCTTGAAACATGTTA 58.044 29.630 12.39 0.00 33.77 2.41
556 557 7.830739 ACTGTTTTCTCTTCTTGAAACATGTT 58.169 30.769 4.92 4.92 33.77 2.71
557 558 7.396540 ACTGTTTTCTCTTCTTGAAACATGT 57.603 32.000 0.00 0.00 33.77 3.21
558 559 7.164826 CGAACTGTTTTCTCTTCTTGAAACATG 59.835 37.037 0.00 0.00 33.77 3.21
559 560 7.189512 CGAACTGTTTTCTCTTCTTGAAACAT 58.810 34.615 0.00 0.00 33.77 2.71
560 561 6.403200 CCGAACTGTTTTCTCTTCTTGAAACA 60.403 38.462 0.00 0.00 33.77 2.83
561 562 5.965918 CCGAACTGTTTTCTCTTCTTGAAAC 59.034 40.000 0.00 0.00 33.77 2.78
562 563 5.448632 GCCGAACTGTTTTCTCTTCTTGAAA 60.449 40.000 0.00 0.00 0.00 2.69
563 564 4.035208 GCCGAACTGTTTTCTCTTCTTGAA 59.965 41.667 0.00 0.00 0.00 2.69
564 565 3.560068 GCCGAACTGTTTTCTCTTCTTGA 59.440 43.478 0.00 0.00 0.00 3.02
565 566 3.304057 GGCCGAACTGTTTTCTCTTCTTG 60.304 47.826 0.00 0.00 0.00 3.02
566 567 2.879026 GGCCGAACTGTTTTCTCTTCTT 59.121 45.455 0.00 0.00 0.00 2.52
567 568 2.495084 GGCCGAACTGTTTTCTCTTCT 58.505 47.619 0.00 0.00 0.00 2.85
568 569 1.535896 GGGCCGAACTGTTTTCTCTTC 59.464 52.381 0.00 0.00 0.00 2.87
569 570 1.133915 TGGGCCGAACTGTTTTCTCTT 60.134 47.619 0.00 0.00 0.00 2.85
570 571 0.472471 TGGGCCGAACTGTTTTCTCT 59.528 50.000 0.00 0.00 0.00 3.10
571 572 0.875059 CTGGGCCGAACTGTTTTCTC 59.125 55.000 0.00 0.00 0.00 2.87
572 573 0.472471 TCTGGGCCGAACTGTTTTCT 59.528 50.000 0.00 0.00 0.00 2.52
573 574 1.314730 TTCTGGGCCGAACTGTTTTC 58.685 50.000 0.00 0.00 0.00 2.29
574 575 1.886542 GATTCTGGGCCGAACTGTTTT 59.113 47.619 11.92 0.00 0.00 2.43
575 576 1.073923 AGATTCTGGGCCGAACTGTTT 59.926 47.619 11.92 0.00 0.00 2.83
576 577 0.693049 AGATTCTGGGCCGAACTGTT 59.307 50.000 11.92 0.00 0.00 3.16
577 578 1.568504 TAGATTCTGGGCCGAACTGT 58.431 50.000 11.92 4.27 0.00 3.55
578 579 2.691409 TTAGATTCTGGGCCGAACTG 57.309 50.000 11.92 0.00 0.00 3.16
579 580 2.158755 CCATTAGATTCTGGGCCGAACT 60.159 50.000 11.92 12.64 0.00 3.01
580 581 2.222027 CCATTAGATTCTGGGCCGAAC 58.778 52.381 11.92 7.44 0.00 3.95
581 582 1.142870 CCCATTAGATTCTGGGCCGAA 59.857 52.381 12.04 12.04 45.41 4.30
582 583 0.764890 CCCATTAGATTCTGGGCCGA 59.235 55.000 0.00 0.00 45.41 5.54
583 584 3.329300 CCCATTAGATTCTGGGCCG 57.671 57.895 0.00 0.00 45.41 6.13
587 588 1.417890 AGGCGTCCCATTAGATTCTGG 59.582 52.381 0.00 0.00 0.00 3.86
588 589 2.158900 ACAGGCGTCCCATTAGATTCTG 60.159 50.000 0.00 0.00 0.00 3.02
589 590 2.103263 GACAGGCGTCCCATTAGATTCT 59.897 50.000 0.00 0.00 36.02 2.40
590 591 2.484889 GACAGGCGTCCCATTAGATTC 58.515 52.381 0.00 0.00 36.02 2.52
591 592 1.202533 CGACAGGCGTCCCATTAGATT 60.203 52.381 0.00 0.00 39.11 2.40
592 593 0.389391 CGACAGGCGTCCCATTAGAT 59.611 55.000 0.00 0.00 39.11 1.98
593 594 1.813859 CGACAGGCGTCCCATTAGA 59.186 57.895 0.00 0.00 39.11 2.10
594 595 4.420143 CGACAGGCGTCCCATTAG 57.580 61.111 0.00 0.00 39.11 1.73
604 605 0.306840 CATGATGATGCACGACAGGC 59.693 55.000 0.00 0.00 0.00 4.85
624 625 0.928922 CTTAGCAGCAGCAGATCGTG 59.071 55.000 3.17 0.00 45.49 4.35
625 626 0.809241 GCTTAGCAGCAGCAGATCGT 60.809 55.000 3.17 0.00 46.49 3.73
626 627 1.933005 GCTTAGCAGCAGCAGATCG 59.067 57.895 3.17 0.00 46.49 3.69
636 637 2.219458 ACATATGCAGCAGCTTAGCAG 58.781 47.619 12.58 0.00 42.14 4.24
637 638 2.336945 ACATATGCAGCAGCTTAGCA 57.663 45.000 9.71 9.71 42.74 3.49
638 639 3.373439 GGATACATATGCAGCAGCTTAGC 59.627 47.826 0.00 0.00 42.74 3.09
639 640 4.572909 TGGATACATATGCAGCAGCTTAG 58.427 43.478 0.00 0.00 46.17 2.18
640 641 4.622260 TGGATACATATGCAGCAGCTTA 57.378 40.909 0.00 0.31 46.17 3.09
641 642 3.497103 TGGATACATATGCAGCAGCTT 57.503 42.857 0.00 0.00 46.17 3.74
655 656 3.666274 TCTCGAGCTAGCTAGTGGATAC 58.334 50.000 19.38 1.02 0.00 2.24
656 657 3.579151 TCTCTCGAGCTAGCTAGTGGATA 59.421 47.826 19.38 10.15 0.00 2.59
657 658 2.370519 TCTCTCGAGCTAGCTAGTGGAT 59.629 50.000 19.38 6.16 0.00 3.41
658 659 1.763545 TCTCTCGAGCTAGCTAGTGGA 59.236 52.381 19.38 17.55 0.00 4.02
659 660 2.248280 TCTCTCGAGCTAGCTAGTGG 57.752 55.000 19.38 14.46 0.00 4.00
660 661 4.334203 TCTTTTCTCTCGAGCTAGCTAGTG 59.666 45.833 19.38 18.34 0.00 2.74
661 662 4.519213 TCTTTTCTCTCGAGCTAGCTAGT 58.481 43.478 19.38 8.90 0.00 2.57
662 663 5.295787 TCTTCTTTTCTCTCGAGCTAGCTAG 59.704 44.000 19.38 18.55 0.00 3.42
663 664 5.186942 TCTTCTTTTCTCTCGAGCTAGCTA 58.813 41.667 19.38 1.34 0.00 3.32
664 665 4.013728 TCTTCTTTTCTCTCGAGCTAGCT 58.986 43.478 19.45 19.45 0.00 3.32
665 666 4.095782 TCTCTTCTTTTCTCTCGAGCTAGC 59.904 45.833 6.62 6.62 0.00 3.42
666 667 5.811399 TCTCTTCTTTTCTCTCGAGCTAG 57.189 43.478 7.81 0.44 0.00 3.42
667 668 5.449862 GCATCTCTTCTTTTCTCTCGAGCTA 60.450 44.000 7.81 0.00 0.00 3.32
668 669 4.677779 GCATCTCTTCTTTTCTCTCGAGCT 60.678 45.833 7.81 0.00 0.00 4.09
669 670 3.551485 GCATCTCTTCTTTTCTCTCGAGC 59.449 47.826 7.81 0.00 0.00 5.03
670 671 4.742417 TGCATCTCTTCTTTTCTCTCGAG 58.258 43.478 5.93 5.93 0.00 4.04
671 672 4.790765 TGCATCTCTTCTTTTCTCTCGA 57.209 40.909 0.00 0.00 0.00 4.04
672 673 5.107824 TGATGCATCTCTTCTTTTCTCTCG 58.892 41.667 26.32 0.00 0.00 4.04
673 674 6.512091 GCATGATGCATCTCTTCTTTTCTCTC 60.512 42.308 26.32 0.00 44.26 3.20
674 675 5.297278 GCATGATGCATCTCTTCTTTTCTCT 59.703 40.000 26.32 0.00 44.26 3.10
675 676 5.512473 GCATGATGCATCTCTTCTTTTCTC 58.488 41.667 26.32 0.00 44.26 2.87
676 677 5.502153 GCATGATGCATCTCTTCTTTTCT 57.498 39.130 26.32 0.00 44.26 2.52
699 700 4.839706 GGGGCGCCATGGAACCAT 62.840 66.667 30.85 0.00 37.08 3.55
702 703 4.476752 TACGGGGCGCCATGGAAC 62.477 66.667 30.85 9.47 0.00 3.62
703 704 4.476752 GTACGGGGCGCCATGGAA 62.477 66.667 30.85 9.50 0.00 3.53
706 707 4.210093 TACGTACGGGGCGCCATG 62.210 66.667 30.85 22.17 0.00 3.66
707 708 4.211502 GTACGTACGGGGCGCCAT 62.212 66.667 30.85 15.82 0.00 4.40
717 718 2.173382 ACGGTCGCACGTACGTAC 59.827 61.111 22.34 15.19 46.58 3.67
724 725 2.154427 GACCAAGAAACGGTCGCACG 62.154 60.000 0.00 0.00 43.36 5.34
725 726 1.568025 GACCAAGAAACGGTCGCAC 59.432 57.895 0.00 0.00 43.36 5.34
726 727 4.036977 GACCAAGAAACGGTCGCA 57.963 55.556 0.00 0.00 43.36 5.10
730 731 1.872653 GCGAAGAGACCAAGAAACGGT 60.873 52.381 0.00 0.00 40.30 4.83
731 732 0.790814 GCGAAGAGACCAAGAAACGG 59.209 55.000 0.00 0.00 0.00 4.44
732 733 1.457303 CTGCGAAGAGACCAAGAAACG 59.543 52.381 0.00 0.00 0.00 3.60
733 734 1.801178 CCTGCGAAGAGACCAAGAAAC 59.199 52.381 0.00 0.00 0.00 2.78
734 735 1.270839 CCCTGCGAAGAGACCAAGAAA 60.271 52.381 0.00 0.00 0.00 2.52
735 736 0.321671 CCCTGCGAAGAGACCAAGAA 59.678 55.000 0.00 0.00 0.00 2.52
736 737 0.832135 ACCCTGCGAAGAGACCAAGA 60.832 55.000 0.00 0.00 0.00 3.02
737 738 0.035458 AACCCTGCGAAGAGACCAAG 59.965 55.000 0.00 0.00 0.00 3.61
738 739 1.344065 TAACCCTGCGAAGAGACCAA 58.656 50.000 0.00 0.00 0.00 3.67
739 740 1.001633 GTTAACCCTGCGAAGAGACCA 59.998 52.381 0.00 0.00 0.00 4.02
740 741 1.275573 AGTTAACCCTGCGAAGAGACC 59.724 52.381 0.88 0.00 0.00 3.85
741 742 2.737252 CAAGTTAACCCTGCGAAGAGAC 59.263 50.000 0.88 0.00 0.00 3.36
742 743 2.367567 ACAAGTTAACCCTGCGAAGAGA 59.632 45.455 0.88 0.00 0.00 3.10
743 744 2.480419 CACAAGTTAACCCTGCGAAGAG 59.520 50.000 0.88 0.00 0.00 2.85
744 745 2.103432 TCACAAGTTAACCCTGCGAAGA 59.897 45.455 0.88 0.00 0.00 2.87
745 746 2.489971 TCACAAGTTAACCCTGCGAAG 58.510 47.619 0.88 0.00 0.00 3.79
746 747 2.623878 TCACAAGTTAACCCTGCGAA 57.376 45.000 0.88 0.00 0.00 4.70
747 748 2.224426 ACATCACAAGTTAACCCTGCGA 60.224 45.455 0.88 0.40 0.00 5.10
748 749 2.151202 ACATCACAAGTTAACCCTGCG 58.849 47.619 0.88 0.00 0.00 5.18
749 750 5.897377 ATAACATCACAAGTTAACCCTGC 57.103 39.130 0.88 0.00 35.33 4.85
750 751 8.786826 TCTTATAACATCACAAGTTAACCCTG 57.213 34.615 0.88 2.86 35.33 4.45
751 752 9.975218 AATCTTATAACATCACAAGTTAACCCT 57.025 29.630 0.88 0.00 35.33 4.34
757 758 8.454106 GCAGTGAATCTTATAACATCACAAGTT 58.546 33.333 16.72 0.00 42.12 2.66
758 759 7.066284 GGCAGTGAATCTTATAACATCACAAGT 59.934 37.037 16.72 1.71 42.12 3.16
759 760 7.412853 GGCAGTGAATCTTATAACATCACAAG 58.587 38.462 16.72 11.99 42.12 3.16
760 761 6.037062 CGGCAGTGAATCTTATAACATCACAA 59.963 38.462 16.72 0.00 42.12 3.33
761 762 5.523552 CGGCAGTGAATCTTATAACATCACA 59.476 40.000 16.72 1.93 42.12 3.58
762 763 5.559035 GCGGCAGTGAATCTTATAACATCAC 60.559 44.000 0.00 10.46 40.45 3.06
763 764 4.511454 GCGGCAGTGAATCTTATAACATCA 59.489 41.667 0.00 0.00 0.00 3.07
764 765 4.083802 GGCGGCAGTGAATCTTATAACATC 60.084 45.833 3.07 0.00 0.00 3.06
765 766 3.815401 GGCGGCAGTGAATCTTATAACAT 59.185 43.478 3.07 0.00 0.00 2.71
766 767 3.118408 AGGCGGCAGTGAATCTTATAACA 60.118 43.478 13.08 0.00 0.00 2.41
767 768 3.467803 AGGCGGCAGTGAATCTTATAAC 58.532 45.455 13.08 0.00 0.00 1.89
768 769 3.838244 AGGCGGCAGTGAATCTTATAA 57.162 42.857 13.08 0.00 0.00 0.98
769 770 3.306088 GCTAGGCGGCAGTGAATCTTATA 60.306 47.826 13.08 0.00 0.00 0.98
770 771 2.548920 GCTAGGCGGCAGTGAATCTTAT 60.549 50.000 13.08 0.00 0.00 1.73
771 772 1.202533 GCTAGGCGGCAGTGAATCTTA 60.203 52.381 13.08 0.00 0.00 2.10
772 773 0.462759 GCTAGGCGGCAGTGAATCTT 60.463 55.000 13.08 0.00 0.00 2.40
773 774 1.144936 GCTAGGCGGCAGTGAATCT 59.855 57.895 13.08 0.00 0.00 2.40
774 775 0.389391 TAGCTAGGCGGCAGTGAATC 59.611 55.000 13.08 0.00 34.17 2.52
775 776 0.105039 GTAGCTAGGCGGCAGTGAAT 59.895 55.000 13.08 0.00 34.17 2.57
776 777 1.515954 GTAGCTAGGCGGCAGTGAA 59.484 57.895 13.08 0.00 34.17 3.18
777 778 2.771639 CGTAGCTAGGCGGCAGTGA 61.772 63.158 13.08 0.00 34.17 3.41
778 779 2.278857 CGTAGCTAGGCGGCAGTG 60.279 66.667 13.08 1.19 34.17 3.66
779 780 3.528370 CCGTAGCTAGGCGGCAGT 61.528 66.667 13.08 0.00 41.53 4.40
780 781 4.286320 CCCGTAGCTAGGCGGCAG 62.286 72.222 15.51 7.92 45.98 4.85
786 787 0.388294 GTAGTTGGCCCGTAGCTAGG 59.612 60.000 0.00 6.46 43.05 3.02
787 788 1.400737 AGTAGTTGGCCCGTAGCTAG 58.599 55.000 0.00 0.00 43.05 3.42
788 789 1.856629 AAGTAGTTGGCCCGTAGCTA 58.143 50.000 0.00 0.00 43.05 3.32
789 790 0.981943 AAAGTAGTTGGCCCGTAGCT 59.018 50.000 0.00 0.00 43.05 3.32
790 791 2.678471 TAAAGTAGTTGGCCCGTAGC 57.322 50.000 0.00 0.00 42.60 3.58
791 792 4.202182 TGCTATAAAGTAGTTGGCCCGTAG 60.202 45.833 0.00 0.00 0.00 3.51
792 793 3.705579 TGCTATAAAGTAGTTGGCCCGTA 59.294 43.478 0.00 0.00 0.00 4.02
793 794 2.502538 TGCTATAAAGTAGTTGGCCCGT 59.497 45.455 0.00 0.00 0.00 5.28
794 795 3.188159 TGCTATAAAGTAGTTGGCCCG 57.812 47.619 0.00 0.00 0.00 6.13
795 796 7.848128 TCTATATGCTATAAAGTAGTTGGCCC 58.152 38.462 0.00 0.00 0.00 5.80
796 797 9.892130 AATCTATATGCTATAAAGTAGTTGGCC 57.108 33.333 0.00 0.00 0.00 5.36
809 810 8.788806 GGCAGACTCGTATAATCTATATGCTAT 58.211 37.037 0.00 0.00 0.00 2.97
810 811 7.041984 CGGCAGACTCGTATAATCTATATGCTA 60.042 40.741 0.00 0.00 0.00 3.49
811 812 6.238511 CGGCAGACTCGTATAATCTATATGCT 60.239 42.308 0.00 0.00 0.00 3.79
812 813 5.910166 CGGCAGACTCGTATAATCTATATGC 59.090 44.000 0.00 0.00 0.00 3.14
813 814 5.910166 GCGGCAGACTCGTATAATCTATATG 59.090 44.000 0.00 0.00 0.00 1.78
814 815 5.008811 GGCGGCAGACTCGTATAATCTATAT 59.991 44.000 3.07 0.00 0.00 0.86
815 816 4.334759 GGCGGCAGACTCGTATAATCTATA 59.665 45.833 3.07 0.00 0.00 1.31
816 817 3.128938 GGCGGCAGACTCGTATAATCTAT 59.871 47.826 3.07 0.00 0.00 1.98
817 818 2.486982 GGCGGCAGACTCGTATAATCTA 59.513 50.000 3.07 0.00 0.00 1.98
818 819 1.269998 GGCGGCAGACTCGTATAATCT 59.730 52.381 3.07 0.00 0.00 2.40
819 820 1.269998 AGGCGGCAGACTCGTATAATC 59.730 52.381 13.08 0.00 0.00 1.75
820 821 1.329256 AGGCGGCAGACTCGTATAAT 58.671 50.000 13.08 0.00 0.00 1.28
821 822 1.878088 CTAGGCGGCAGACTCGTATAA 59.122 52.381 13.08 0.00 36.79 0.98
822 823 1.520494 CTAGGCGGCAGACTCGTATA 58.480 55.000 13.08 0.00 36.79 1.47
823 824 1.797211 GCTAGGCGGCAGACTCGTAT 61.797 60.000 13.08 0.00 36.79 3.06
824 825 2.478890 GCTAGGCGGCAGACTCGTA 61.479 63.158 13.08 0.00 36.79 3.43
825 826 2.888464 TAGCTAGGCGGCAGACTCGT 62.888 60.000 13.08 0.00 36.79 4.18
826 827 2.187493 TAGCTAGGCGGCAGACTCG 61.187 63.158 13.08 0.00 36.79 4.18
827 828 1.104577 AGTAGCTAGGCGGCAGACTC 61.105 60.000 13.08 0.00 36.79 3.36
828 829 1.076632 AGTAGCTAGGCGGCAGACT 60.077 57.895 13.08 7.34 40.27 3.24
829 830 1.066587 CAGTAGCTAGGCGGCAGAC 59.933 63.158 13.08 0.00 34.17 3.51
830 831 2.127869 CCAGTAGCTAGGCGGCAGA 61.128 63.158 13.08 0.00 34.17 4.26
831 832 2.419198 CCAGTAGCTAGGCGGCAG 59.581 66.667 13.08 7.92 34.17 4.85
832 833 3.849951 GCCAGTAGCTAGGCGGCA 61.850 66.667 18.66 0.00 41.70 5.69
841 842 6.459923 AGCTATAAAGTTATCAGCCAGTAGC 58.540 40.000 0.00 0.00 44.25 3.58
855 856 9.367444 GCAACGGATGTATATAAGCTATAAAGT 57.633 33.333 0.00 0.00 0.00 2.66
856 857 8.818057 GGCAACGGATGTATATAAGCTATAAAG 58.182 37.037 0.00 0.00 0.00 1.85
857 858 8.537016 AGGCAACGGATGTATATAAGCTATAAA 58.463 33.333 0.00 0.00 46.39 1.40
858 859 8.074613 AGGCAACGGATGTATATAAGCTATAA 57.925 34.615 0.00 0.00 46.39 0.98
859 860 7.655521 AGGCAACGGATGTATATAAGCTATA 57.344 36.000 0.00 0.00 46.39 1.31
860 861 6.546428 AGGCAACGGATGTATATAAGCTAT 57.454 37.500 0.00 0.00 46.39 2.97
861 862 5.995565 AGGCAACGGATGTATATAAGCTA 57.004 39.130 0.00 0.00 46.39 3.32
862 863 4.891992 AGGCAACGGATGTATATAAGCT 57.108 40.909 0.00 0.00 46.39 3.74
863 864 8.712285 TTTATAGGCAACGGATGTATATAAGC 57.288 34.615 0.00 0.00 46.39 3.09
869 870 9.959721 ATCTTTATTTATAGGCAACGGATGTAT 57.040 29.630 0.00 0.00 46.39 2.29
870 871 9.214957 CATCTTTATTTATAGGCAACGGATGTA 57.785 33.333 0.00 0.00 46.39 2.29
871 872 7.308589 GCATCTTTATTTATAGGCAACGGATGT 60.309 37.037 0.00 0.00 46.39 3.06
872 873 7.023575 GCATCTTTATTTATAGGCAACGGATG 58.976 38.462 0.00 0.00 46.39 3.51
873 874 6.714810 TGCATCTTTATTTATAGGCAACGGAT 59.285 34.615 0.00 0.00 46.39 4.18
874 875 6.058833 TGCATCTTTATTTATAGGCAACGGA 58.941 36.000 0.00 0.00 46.39 4.69
875 876 6.017109 ACTGCATCTTTATTTATAGGCAACGG 60.017 38.462 0.00 0.00 46.39 4.44
876 877 6.959361 ACTGCATCTTTATTTATAGGCAACG 58.041 36.000 0.00 0.00 46.39 4.10
877 878 9.023967 CAAACTGCATCTTTATTTATAGGCAAC 57.976 33.333 0.00 0.00 0.00 4.17
878 879 7.706179 GCAAACTGCATCTTTATTTATAGGCAA 59.294 33.333 0.00 0.00 44.26 4.52
879 880 7.202526 GCAAACTGCATCTTTATTTATAGGCA 58.797 34.615 0.00 0.00 44.26 4.75
880 881 7.629027 GCAAACTGCATCTTTATTTATAGGC 57.371 36.000 0.00 0.00 44.26 3.93
904 905 1.730501 TGGATGAAGAAGAAGCGCAG 58.269 50.000 11.47 0.00 0.00 5.18
905 906 2.093288 AGATGGATGAAGAAGAAGCGCA 60.093 45.455 11.47 0.00 0.00 6.09
906 907 2.287373 CAGATGGATGAAGAAGAAGCGC 59.713 50.000 0.00 0.00 0.00 5.92
907 908 2.287373 GCAGATGGATGAAGAAGAAGCG 59.713 50.000 0.00 0.00 0.00 4.68
908 909 2.617774 GGCAGATGGATGAAGAAGAAGC 59.382 50.000 0.00 0.00 0.00 3.86
909 910 3.212685 GGGCAGATGGATGAAGAAGAAG 58.787 50.000 0.00 0.00 0.00 2.85
910 911 2.420547 CGGGCAGATGGATGAAGAAGAA 60.421 50.000 0.00 0.00 0.00 2.52
911 912 1.139654 CGGGCAGATGGATGAAGAAGA 59.860 52.381 0.00 0.00 0.00 2.87
912 913 1.134280 ACGGGCAGATGGATGAAGAAG 60.134 52.381 0.00 0.00 0.00 2.85
913 914 0.911769 ACGGGCAGATGGATGAAGAA 59.088 50.000 0.00 0.00 0.00 2.52
914 915 0.911769 AACGGGCAGATGGATGAAGA 59.088 50.000 0.00 0.00 0.00 2.87
915 916 2.213499 GTAACGGGCAGATGGATGAAG 58.787 52.381 0.00 0.00 0.00 3.02
916 917 1.134220 GGTAACGGGCAGATGGATGAA 60.134 52.381 0.00 0.00 0.00 2.57
917 918 0.468226 GGTAACGGGCAGATGGATGA 59.532 55.000 0.00 0.00 0.00 2.92
918 919 0.180171 TGGTAACGGGCAGATGGATG 59.820 55.000 0.00 0.00 42.51 3.51
919 920 0.916086 TTGGTAACGGGCAGATGGAT 59.084 50.000 0.00 0.00 42.51 3.41
920 921 0.916086 ATTGGTAACGGGCAGATGGA 59.084 50.000 0.00 0.00 42.51 3.41
921 922 1.134098 AGATTGGTAACGGGCAGATGG 60.134 52.381 0.00 0.00 42.51 3.51
922 923 2.213499 GAGATTGGTAACGGGCAGATG 58.787 52.381 0.00 0.00 42.51 2.90
923 924 1.837439 TGAGATTGGTAACGGGCAGAT 59.163 47.619 0.00 0.00 42.51 2.90
924 925 1.207089 CTGAGATTGGTAACGGGCAGA 59.793 52.381 0.00 0.00 42.51 4.26
925 926 1.656652 CTGAGATTGGTAACGGGCAG 58.343 55.000 0.00 0.00 42.51 4.85
926 927 0.392461 GCTGAGATTGGTAACGGGCA 60.392 55.000 0.00 0.00 42.51 5.36
927 928 0.107654 AGCTGAGATTGGTAACGGGC 60.108 55.000 0.00 0.00 42.51 6.13
928 929 2.093447 AGAAGCTGAGATTGGTAACGGG 60.093 50.000 0.00 0.00 42.51 5.28
929 930 3.252974 AGAAGCTGAGATTGGTAACGG 57.747 47.619 0.00 0.00 42.51 4.44
930 931 4.499183 AGAAGAAGCTGAGATTGGTAACG 58.501 43.478 0.00 0.00 42.51 3.18
931 932 5.352846 GGAAGAAGAAGCTGAGATTGGTAAC 59.647 44.000 0.00 0.00 0.00 2.50
932 933 5.249393 AGGAAGAAGAAGCTGAGATTGGTAA 59.751 40.000 0.00 0.00 0.00 2.85
933 934 4.780021 AGGAAGAAGAAGCTGAGATTGGTA 59.220 41.667 0.00 0.00 0.00 3.25
934 935 3.586618 AGGAAGAAGAAGCTGAGATTGGT 59.413 43.478 0.00 0.00 0.00 3.67
935 936 4.219264 AGGAAGAAGAAGCTGAGATTGG 57.781 45.455 0.00 0.00 0.00 3.16
936 937 6.016443 ACAAAAGGAAGAAGAAGCTGAGATTG 60.016 38.462 0.00 0.00 0.00 2.67
937 938 6.067350 ACAAAAGGAAGAAGAAGCTGAGATT 58.933 36.000 0.00 0.00 0.00 2.40
938 939 5.629125 ACAAAAGGAAGAAGAAGCTGAGAT 58.371 37.500 0.00 0.00 0.00 2.75
939 940 5.041191 ACAAAAGGAAGAAGAAGCTGAGA 57.959 39.130 0.00 0.00 0.00 3.27
940 941 4.215185 GGACAAAAGGAAGAAGAAGCTGAG 59.785 45.833 0.00 0.00 0.00 3.35
941 942 4.137543 GGACAAAAGGAAGAAGAAGCTGA 58.862 43.478 0.00 0.00 0.00 4.26
942 943 3.885297 TGGACAAAAGGAAGAAGAAGCTG 59.115 43.478 0.00 0.00 0.00 4.24
943 944 4.170468 TGGACAAAAGGAAGAAGAAGCT 57.830 40.909 0.00 0.00 0.00 3.74
944 945 4.764308 AGATGGACAAAAGGAAGAAGAAGC 59.236 41.667 0.00