Multiple sequence alignment - TraesCS1A01G023000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G023000 chr1A 100.000 6052 0 0 1 6052 11424065 11418014 0.000000e+00 11177.0
1 TraesCS1A01G023000 chr1A 91.287 505 42 2 5324 5826 324522874 324523378 0.000000e+00 688.0
2 TraesCS1A01G023000 chr6D 93.663 505 29 3 5324 5825 17203933 17204437 0.000000e+00 752.0
3 TraesCS1A01G023000 chr6D 83.333 72 12 0 2625 2696 287389248 287389177 3.910000e-07 67.6
4 TraesCS1A01G023000 chr4A 93.227 502 31 3 5324 5824 493780896 493780397 0.000000e+00 736.0
5 TraesCS1A01G023000 chr4A 91.071 504 40 3 5324 5823 19187694 19187192 0.000000e+00 676.0
6 TraesCS1A01G023000 chr4A 77.291 251 43 9 2635 2872 725919375 725919126 1.060000e-27 135.0
7 TraesCS1A01G023000 chrUn 92.460 504 37 1 5324 5826 343702564 343703067 0.000000e+00 719.0
8 TraesCS1A01G023000 chr7A 92.475 505 33 3 5324 5824 254424752 254424249 0.000000e+00 717.0
9 TraesCS1A01G023000 chr7A 92.292 506 34 3 5324 5825 621822433 621822937 0.000000e+00 713.0
10 TraesCS1A01G023000 chr1D 91.897 506 35 4 5324 5825 485643561 485644064 0.000000e+00 702.0
11 TraesCS1A01G023000 chr2A 90.855 503 45 1 5324 5825 773228209 773227707 0.000000e+00 673.0
12 TraesCS1A01G023000 chr3A 81.287 171 27 4 2757 2924 719994929 719994761 3.810000e-27 134.0
13 TraesCS1A01G023000 chr3A 79.006 181 30 7 2750 2925 731739910 731740087 3.830000e-22 117.0
14 TraesCS1A01G023000 chr3A 92.308 52 4 0 3067 3118 703916699 703916750 2.340000e-09 75.0
15 TraesCS1A01G023000 chr3B 88.043 92 8 3 2654 2743 2478636 2478546 8.300000e-19 106.0
16 TraesCS1A01G023000 chr3B 85.507 69 10 0 2627 2695 449055825 449055893 8.410000e-09 73.1
17 TraesCS1A01G023000 chr7D 84.259 108 14 3 2635 2741 54438350 54438455 1.070000e-17 102.0
18 TraesCS1A01G023000 chr7B 84.444 90 12 2 2654 2743 606211340 606211427 3.000000e-13 87.9
19 TraesCS1A01G023000 chr7B 84.375 64 9 1 2633 2696 482067331 482067269 1.820000e-05 62.1
20 TraesCS1A01G023000 chr7B 84.746 59 9 0 2841 2899 703940247 703940189 6.550000e-05 60.2
21 TraesCS1A01G023000 chr7B 94.595 37 2 0 2856 2892 567630919 567630955 2.360000e-04 58.4
22 TraesCS1A01G023000 chr5D 76.506 166 34 5 2297 2460 287406430 287406268 1.080000e-12 86.1
23 TraesCS1A01G023000 chr5D 82.609 69 10 2 2832 2899 342707382 342707315 6.550000e-05 60.2
24 TraesCS1A01G023000 chr4B 84.416 77 10 2 2668 2743 506006805 506006730 2.340000e-09 75.0
25 TraesCS1A01G023000 chr4B 82.192 73 9 4 2626 2696 276863959 276863889 6.550000e-05 60.2
26 TraesCS1A01G023000 chr6A 84.932 73 9 2 2625 2696 438026764 438026835 8.410000e-09 73.1
27 TraesCS1A01G023000 chr1B 100.000 36 0 0 3131 3166 538819268 538819233 3.910000e-07 67.6
28 TraesCS1A01G023000 chr5B 87.273 55 6 1 2410 2463 326163554 326163500 1.820000e-05 62.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G023000 chr1A 11418014 11424065 6051 True 11177 11177 100.000 1 6052 1 chr1A.!!$R1 6051
1 TraesCS1A01G023000 chr1A 324522874 324523378 504 False 688 688 91.287 5324 5826 1 chr1A.!!$F1 502
2 TraesCS1A01G023000 chr6D 17203933 17204437 504 False 752 752 93.663 5324 5825 1 chr6D.!!$F1 501
3 TraesCS1A01G023000 chr4A 19187192 19187694 502 True 676 676 91.071 5324 5823 1 chr4A.!!$R1 499
4 TraesCS1A01G023000 chrUn 343702564 343703067 503 False 719 719 92.460 5324 5826 1 chrUn.!!$F1 502
5 TraesCS1A01G023000 chr7A 254424249 254424752 503 True 717 717 92.475 5324 5824 1 chr7A.!!$R1 500
6 TraesCS1A01G023000 chr7A 621822433 621822937 504 False 713 713 92.292 5324 5825 1 chr7A.!!$F1 501
7 TraesCS1A01G023000 chr1D 485643561 485644064 503 False 702 702 91.897 5324 5825 1 chr1D.!!$F1 501
8 TraesCS1A01G023000 chr2A 773227707 773228209 502 True 673 673 90.855 5324 5825 1 chr2A.!!$R1 501


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
360 361 0.107831 TCCTTTGAGAACCCACACGG 59.892 55.0 0.00 0.0 37.81 4.94 F
1735 1736 0.032952 TCTCGGGACCGTTTTGACTG 59.967 55.0 10.90 0.0 40.74 3.51 F
1802 1803 0.032952 ACCGTGTAGTGAATGCGTGT 59.967 50.0 0.00 0.0 0.00 4.49 F
3295 3296 0.032952 TCGTTGTGTCTGTGCCCTAC 59.967 55.0 0.00 0.0 0.00 3.18 F
4235 4236 0.030235 AAGGCGGCACTTTCGTTTTC 59.970 50.0 13.08 0.0 0.00 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1716 1717 0.032952 CAGTCAAAACGGTCCCGAGA 59.967 55.0 13.54 2.11 42.83 4.04 R
3276 3277 0.032952 GTAGGGCACAGACACAACGA 59.967 55.0 0.00 0.00 0.00 3.85 R
3518 3519 0.039911 AGTCCCGCTAGGTTGACTCT 59.960 55.0 0.00 0.00 35.11 3.24 R
4501 4502 0.033366 TATGCGCGATGTGGCAGTAT 59.967 50.0 12.10 0.00 43.27 2.12 R
5094 5095 0.106719 CCTGGACCAATACGCCCAAT 60.107 55.0 0.00 0.00 0.00 3.16 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 7.865706 GTCACCTTTGTAGATCCAATGTATT 57.134 36.000 0.00 0.00 0.00 1.89
25 26 8.958119 GTCACCTTTGTAGATCCAATGTATTA 57.042 34.615 0.00 0.00 0.00 0.98
26 27 9.561069 GTCACCTTTGTAGATCCAATGTATTAT 57.439 33.333 0.00 0.00 0.00 1.28
27 28 9.559732 TCACCTTTGTAGATCCAATGTATTATG 57.440 33.333 0.00 0.00 0.00 1.90
28 29 9.559732 CACCTTTGTAGATCCAATGTATTATGA 57.440 33.333 0.00 0.00 0.00 2.15
49 50 6.515272 TGATAATTTCCAACTGAGAAAGCC 57.485 37.500 0.00 0.00 36.71 4.35
50 51 5.418840 TGATAATTTCCAACTGAGAAAGCCC 59.581 40.000 0.00 0.00 36.71 5.19
51 52 1.995376 TTTCCAACTGAGAAAGCCCC 58.005 50.000 0.00 0.00 0.00 5.80
52 53 1.149101 TTCCAACTGAGAAAGCCCCT 58.851 50.000 0.00 0.00 0.00 4.79
53 54 2.038863 TCCAACTGAGAAAGCCCCTA 57.961 50.000 0.00 0.00 0.00 3.53
54 55 1.909302 TCCAACTGAGAAAGCCCCTAG 59.091 52.381 0.00 0.00 0.00 3.02
55 56 1.680249 CCAACTGAGAAAGCCCCTAGC 60.680 57.143 0.00 0.00 44.25 3.42
67 68 3.510388 GCCCCTAGCAAAGATTTTGTC 57.490 47.619 3.77 0.00 42.97 3.18
68 69 2.159379 GCCCCTAGCAAAGATTTTGTCG 60.159 50.000 3.77 0.00 42.97 4.35
69 70 2.159379 CCCCTAGCAAAGATTTTGTCGC 60.159 50.000 3.77 0.00 0.00 5.19
70 71 2.159379 CCCTAGCAAAGATTTTGTCGCC 60.159 50.000 3.77 0.00 0.00 5.54
71 72 2.159379 CCTAGCAAAGATTTTGTCGCCC 60.159 50.000 3.77 0.00 0.00 6.13
72 73 1.620822 AGCAAAGATTTTGTCGCCCT 58.379 45.000 3.77 0.00 0.00 5.19
73 74 1.963515 AGCAAAGATTTTGTCGCCCTT 59.036 42.857 3.77 0.00 0.00 3.95
74 75 2.061028 GCAAAGATTTTGTCGCCCTTG 58.939 47.619 3.77 0.00 0.00 3.61
75 76 2.288152 GCAAAGATTTTGTCGCCCTTGA 60.288 45.455 3.77 0.00 0.00 3.02
76 77 3.614870 GCAAAGATTTTGTCGCCCTTGAT 60.615 43.478 3.77 0.00 0.00 2.57
77 78 4.559153 CAAAGATTTTGTCGCCCTTGATT 58.441 39.130 0.00 0.00 0.00 2.57
78 79 5.708948 CAAAGATTTTGTCGCCCTTGATTA 58.291 37.500 0.00 0.00 0.00 1.75
79 80 6.332630 CAAAGATTTTGTCGCCCTTGATTAT 58.667 36.000 0.00 0.00 0.00 1.28
80 81 5.757850 AGATTTTGTCGCCCTTGATTATC 57.242 39.130 0.00 0.00 0.00 1.75
81 82 5.192927 AGATTTTGTCGCCCTTGATTATCA 58.807 37.500 0.00 0.00 0.00 2.15
82 83 4.963276 TTTTGTCGCCCTTGATTATCAG 57.037 40.909 0.00 0.00 0.00 2.90
83 84 2.620251 TGTCGCCCTTGATTATCAGG 57.380 50.000 0.00 0.00 0.00 3.86
84 85 1.837439 TGTCGCCCTTGATTATCAGGT 59.163 47.619 3.71 0.00 0.00 4.00
85 86 2.213499 GTCGCCCTTGATTATCAGGTG 58.787 52.381 7.48 7.48 0.00 4.00
86 87 2.115427 TCGCCCTTGATTATCAGGTGA 58.885 47.619 11.23 11.23 31.42 4.02
87 88 2.503765 TCGCCCTTGATTATCAGGTGAA 59.496 45.455 12.43 0.45 31.10 3.18
88 89 3.136443 TCGCCCTTGATTATCAGGTGAAT 59.864 43.478 12.43 0.00 31.10 2.57
89 90 3.251729 CGCCCTTGATTATCAGGTGAATG 59.748 47.826 7.93 0.00 27.26 2.67
90 91 4.210331 GCCCTTGATTATCAGGTGAATGT 58.790 43.478 3.71 0.00 0.00 2.71
91 92 4.646492 GCCCTTGATTATCAGGTGAATGTT 59.354 41.667 3.71 0.00 0.00 2.71
92 93 5.221126 GCCCTTGATTATCAGGTGAATGTTC 60.221 44.000 3.71 0.00 0.00 3.18
93 94 5.887598 CCCTTGATTATCAGGTGAATGTTCA 59.112 40.000 3.71 0.00 34.20 3.18
94 95 6.548622 CCCTTGATTATCAGGTGAATGTTCAT 59.451 38.462 3.71 0.00 39.73 2.57
95 96 7.720957 CCCTTGATTATCAGGTGAATGTTCATA 59.279 37.037 3.71 0.00 39.73 2.15
96 97 9.123902 CCTTGATTATCAGGTGAATGTTCATAA 57.876 33.333 3.71 0.00 39.73 1.90
97 98 9.941664 CTTGATTATCAGGTGAATGTTCATAAC 57.058 33.333 0.00 0.00 39.73 1.89
98 99 8.450578 TGATTATCAGGTGAATGTTCATAACC 57.549 34.615 0.00 8.59 39.73 2.85
99 100 6.918892 TTATCAGGTGAATGTTCATAACCG 57.081 37.500 0.00 7.15 39.73 4.44
100 101 3.006940 TCAGGTGAATGTTCATAACCGC 58.993 45.455 0.00 0.00 39.73 5.68
101 102 2.746904 CAGGTGAATGTTCATAACCGCA 59.253 45.455 0.00 0.00 39.73 5.69
102 103 3.190327 CAGGTGAATGTTCATAACCGCAA 59.810 43.478 0.00 0.00 39.73 4.85
103 104 3.823873 AGGTGAATGTTCATAACCGCAAA 59.176 39.130 0.00 0.00 39.73 3.68
104 105 3.917985 GGTGAATGTTCATAACCGCAAAC 59.082 43.478 0.00 0.00 39.73 2.93
105 106 4.541779 GTGAATGTTCATAACCGCAAACA 58.458 39.130 0.00 0.00 39.73 2.83
106 107 4.979197 GTGAATGTTCATAACCGCAAACAA 59.021 37.500 0.00 0.00 39.73 2.83
107 108 5.460419 GTGAATGTTCATAACCGCAAACAAA 59.540 36.000 0.00 0.00 39.73 2.83
108 109 6.019479 GTGAATGTTCATAACCGCAAACAAAA 60.019 34.615 0.00 0.00 39.73 2.44
109 110 6.199908 TGAATGTTCATAACCGCAAACAAAAG 59.800 34.615 0.00 0.00 35.46 2.27
110 111 5.000012 TGTTCATAACCGCAAACAAAAGT 58.000 34.783 0.00 0.00 0.00 2.66
111 112 5.038033 TGTTCATAACCGCAAACAAAAGTC 58.962 37.500 0.00 0.00 0.00 3.01
112 113 4.902443 TCATAACCGCAAACAAAAGTCA 57.098 36.364 0.00 0.00 0.00 3.41
113 114 5.446143 TCATAACCGCAAACAAAAGTCAT 57.554 34.783 0.00 0.00 0.00 3.06
114 115 5.218885 TCATAACCGCAAACAAAAGTCATG 58.781 37.500 0.00 0.00 0.00 3.07
115 116 3.791973 AACCGCAAACAAAAGTCATGA 57.208 38.095 0.00 0.00 0.00 3.07
116 117 3.078594 ACCGCAAACAAAAGTCATGAC 57.921 42.857 18.47 18.47 0.00 3.06
117 118 2.425312 ACCGCAAACAAAAGTCATGACA 59.575 40.909 27.02 0.00 0.00 3.58
118 119 3.044986 CCGCAAACAAAAGTCATGACAG 58.955 45.455 27.02 15.56 0.00 3.51
119 120 3.243035 CCGCAAACAAAAGTCATGACAGA 60.243 43.478 27.02 0.00 0.00 3.41
120 121 4.539870 CGCAAACAAAAGTCATGACAGAT 58.460 39.130 27.02 10.51 0.00 2.90
121 122 4.380678 CGCAAACAAAAGTCATGACAGATG 59.619 41.667 27.02 21.71 0.00 2.90
122 123 4.682860 GCAAACAAAAGTCATGACAGATGG 59.317 41.667 27.02 14.29 0.00 3.51
123 124 5.507817 GCAAACAAAAGTCATGACAGATGGA 60.508 40.000 27.02 0.00 0.00 3.41
124 125 6.506147 CAAACAAAAGTCATGACAGATGGAA 58.494 36.000 27.02 0.00 0.00 3.53
125 126 6.713762 AACAAAAGTCATGACAGATGGAAA 57.286 33.333 27.02 0.00 0.00 3.13
126 127 6.713762 ACAAAAGTCATGACAGATGGAAAA 57.286 33.333 27.02 0.00 0.00 2.29
127 128 7.294017 ACAAAAGTCATGACAGATGGAAAAT 57.706 32.000 27.02 0.00 0.00 1.82
128 129 7.373493 ACAAAAGTCATGACAGATGGAAAATC 58.627 34.615 27.02 0.00 0.00 2.17
129 130 6.521151 AAAGTCATGACAGATGGAAAATCC 57.479 37.500 27.02 0.00 36.96 3.01
142 143 5.574891 TGGAAAATCCACATGAATTACCG 57.425 39.130 0.00 0.00 42.67 4.02
143 144 4.400884 TGGAAAATCCACATGAATTACCGG 59.599 41.667 0.00 0.00 42.67 5.28
144 145 4.202111 GGAAAATCCACATGAATTACCGGG 60.202 45.833 6.32 0.00 36.28 5.73
145 146 1.981256 ATCCACATGAATTACCGGGC 58.019 50.000 6.32 0.00 0.00 6.13
146 147 0.916086 TCCACATGAATTACCGGGCT 59.084 50.000 6.32 0.00 0.00 5.19
147 148 1.024271 CCACATGAATTACCGGGCTG 58.976 55.000 6.32 0.00 0.00 4.85
148 149 1.024271 CACATGAATTACCGGGCTGG 58.976 55.000 11.83 11.83 46.41 4.85
149 150 0.751643 ACATGAATTACCGGGCTGGC 60.752 55.000 13.63 0.00 43.94 4.85
150 151 1.152756 ATGAATTACCGGGCTGGCC 60.153 57.895 13.63 10.75 43.94 5.36
151 152 1.645402 ATGAATTACCGGGCTGGCCT 61.645 55.000 18.81 2.75 43.94 5.19
152 153 1.823899 GAATTACCGGGCTGGCCTG 60.824 63.158 18.81 14.44 43.94 4.85
153 154 2.265467 GAATTACCGGGCTGGCCTGA 62.265 60.000 20.78 2.54 45.10 3.86
154 155 1.858739 AATTACCGGGCTGGCCTGAA 61.859 55.000 20.78 9.19 45.10 3.02
155 156 2.270874 ATTACCGGGCTGGCCTGAAG 62.271 60.000 20.78 8.35 45.10 3.02
156 157 3.916438 TACCGGGCTGGCCTGAAGA 62.916 63.158 20.78 3.77 45.10 2.87
157 158 4.479993 CCGGGCTGGCCTGAAGAG 62.480 72.222 20.78 0.00 45.10 2.85
159 160 3.726144 GGGCTGGCCTGAAGAGCT 61.726 66.667 14.77 0.00 36.10 4.09
160 161 2.354343 GGCTGGCCTGAAGAGCTT 59.646 61.111 14.77 0.00 33.03 3.74
161 162 1.748500 GGCTGGCCTGAAGAGCTTC 60.749 63.158 14.77 3.32 39.91 3.86
162 163 1.748500 GCTGGCCTGAAGAGCTTCC 60.749 63.158 14.77 0.00 38.77 3.46
163 164 1.989620 CTGGCCTGAAGAGCTTCCT 59.010 57.895 3.32 0.00 38.77 3.36
164 165 1.198713 CTGGCCTGAAGAGCTTCCTA 58.801 55.000 3.32 0.00 38.77 2.94
165 166 1.556911 CTGGCCTGAAGAGCTTCCTAA 59.443 52.381 3.32 0.00 38.77 2.69
166 167 1.556911 TGGCCTGAAGAGCTTCCTAAG 59.443 52.381 3.32 0.00 38.77 2.18
167 168 1.134250 GGCCTGAAGAGCTTCCTAAGG 60.134 57.143 7.69 8.74 38.77 2.69
168 169 1.745484 GCCTGAAGAGCTTCCTAAGGC 60.745 57.143 18.45 18.45 43.93 4.35
169 170 1.472376 CCTGAAGAGCTTCCTAAGGCG 60.472 57.143 7.69 0.00 38.77 5.52
170 171 1.205893 CTGAAGAGCTTCCTAAGGCGT 59.794 52.381 7.69 0.00 38.77 5.68
171 172 1.204941 TGAAGAGCTTCCTAAGGCGTC 59.795 52.381 7.69 0.00 38.77 5.19
172 173 0.537653 AAGAGCTTCCTAAGGCGTCC 59.462 55.000 0.00 0.00 0.00 4.79
173 174 1.144276 GAGCTTCCTAAGGCGTCCC 59.856 63.158 0.00 0.00 0.00 4.46
174 175 1.306226 AGCTTCCTAAGGCGTCCCT 60.306 57.895 0.00 0.00 45.77 4.20
182 183 2.348998 AGGCGTCCCTTGCAGAAG 59.651 61.111 0.00 0.00 38.74 2.85
183 184 3.435186 GGCGTCCCTTGCAGAAGC 61.435 66.667 4.17 4.17 42.57 3.86
184 185 2.359230 GCGTCCCTTGCAGAAGCT 60.359 61.111 5.34 0.00 42.74 3.74
185 186 1.968540 GCGTCCCTTGCAGAAGCTT 60.969 57.895 0.00 0.00 42.74 3.74
186 187 0.673644 GCGTCCCTTGCAGAAGCTTA 60.674 55.000 0.00 0.00 42.74 3.09
187 188 1.079503 CGTCCCTTGCAGAAGCTTAC 58.920 55.000 0.00 0.00 42.74 2.34
188 189 1.338200 CGTCCCTTGCAGAAGCTTACT 60.338 52.381 0.00 0.00 42.74 2.24
189 190 2.784347 GTCCCTTGCAGAAGCTTACTT 58.216 47.619 0.00 0.00 42.74 2.24
212 213 4.115279 GCAGCTAGCGCAGAATCA 57.885 55.556 21.32 0.00 39.10 2.57
213 214 1.640604 GCAGCTAGCGCAGAATCAC 59.359 57.895 21.32 0.00 39.10 3.06
214 215 1.922903 CAGCTAGCGCAGAATCACG 59.077 57.895 11.47 0.00 39.10 4.35
215 216 1.227089 AGCTAGCGCAGAATCACGG 60.227 57.895 11.47 0.00 39.10 4.94
216 217 2.240500 GCTAGCGCAGAATCACGGG 61.241 63.158 11.47 0.00 35.78 5.28
217 218 2.202878 TAGCGCAGAATCACGGGC 60.203 61.111 11.47 4.06 41.08 6.13
218 219 2.906182 CTAGCGCAGAATCACGGGCA 62.906 60.000 11.47 1.15 43.03 5.36
219 220 2.514510 TAGCGCAGAATCACGGGCAA 62.515 55.000 11.47 0.00 43.03 4.52
220 221 2.976840 GCGCAGAATCACGGGCAAA 61.977 57.895 0.30 0.00 40.52 3.68
221 222 1.154225 CGCAGAATCACGGGCAAAC 60.154 57.895 0.00 0.00 0.00 2.93
222 223 1.577328 CGCAGAATCACGGGCAAACT 61.577 55.000 0.00 0.00 0.00 2.66
223 224 0.598065 GCAGAATCACGGGCAAACTT 59.402 50.000 0.00 0.00 0.00 2.66
224 225 1.666888 GCAGAATCACGGGCAAACTTG 60.667 52.381 0.00 0.00 0.00 3.16
225 226 1.608590 CAGAATCACGGGCAAACTTGT 59.391 47.619 0.00 0.00 0.00 3.16
226 227 2.034558 CAGAATCACGGGCAAACTTGTT 59.965 45.455 0.00 0.00 0.00 2.83
227 228 2.693074 AGAATCACGGGCAAACTTGTTT 59.307 40.909 0.00 0.00 0.00 2.83
228 229 2.507339 ATCACGGGCAAACTTGTTTG 57.493 45.000 18.60 18.60 35.15 2.93
229 230 0.457851 TCACGGGCAAACTTGTTTGG 59.542 50.000 22.52 11.90 32.78 3.28
230 231 0.174617 CACGGGCAAACTTGTTTGGT 59.825 50.000 22.52 12.41 32.78 3.67
231 232 0.174617 ACGGGCAAACTTGTTTGGTG 59.825 50.000 22.52 4.31 32.78 4.17
232 233 0.529555 CGGGCAAACTTGTTTGGTGG 60.530 55.000 22.52 3.41 32.78 4.61
233 234 0.827368 GGGCAAACTTGTTTGGTGGA 59.173 50.000 22.52 0.00 32.78 4.02
234 235 1.208293 GGGCAAACTTGTTTGGTGGAA 59.792 47.619 22.52 0.00 32.78 3.53
235 236 2.158827 GGGCAAACTTGTTTGGTGGAAT 60.159 45.455 22.52 0.00 32.78 3.01
236 237 2.871633 GGCAAACTTGTTTGGTGGAATG 59.128 45.455 22.52 1.83 32.78 2.67
237 238 2.871633 GCAAACTTGTTTGGTGGAATGG 59.128 45.455 22.52 0.69 32.78 3.16
238 239 3.431486 GCAAACTTGTTTGGTGGAATGGA 60.431 43.478 22.52 0.00 32.78 3.41
239 240 4.764172 CAAACTTGTTTGGTGGAATGGAA 58.236 39.130 16.00 0.00 0.00 3.53
240 241 5.367302 CAAACTTGTTTGGTGGAATGGAAT 58.633 37.500 16.00 0.00 0.00 3.01
241 242 4.605640 ACTTGTTTGGTGGAATGGAATG 57.394 40.909 0.00 0.00 0.00 2.67
242 243 3.324556 ACTTGTTTGGTGGAATGGAATGG 59.675 43.478 0.00 0.00 0.00 3.16
243 244 3.251016 TGTTTGGTGGAATGGAATGGA 57.749 42.857 0.00 0.00 0.00 3.41
244 245 3.581101 TGTTTGGTGGAATGGAATGGAA 58.419 40.909 0.00 0.00 0.00 3.53
245 246 3.969976 TGTTTGGTGGAATGGAATGGAAA 59.030 39.130 0.00 0.00 0.00 3.13
246 247 4.202305 TGTTTGGTGGAATGGAATGGAAAC 60.202 41.667 0.00 0.00 0.00 2.78
247 248 3.541242 TGGTGGAATGGAATGGAAACT 57.459 42.857 0.00 0.00 0.00 2.66
248 249 4.666412 TGGTGGAATGGAATGGAAACTA 57.334 40.909 0.00 0.00 0.00 2.24
249 250 5.205517 TGGTGGAATGGAATGGAAACTAT 57.794 39.130 0.00 0.00 0.00 2.12
250 251 4.955450 TGGTGGAATGGAATGGAAACTATG 59.045 41.667 0.00 0.00 0.00 2.23
251 252 4.202151 GGTGGAATGGAATGGAAACTATGC 60.202 45.833 0.00 0.00 0.00 3.14
252 253 4.402155 GTGGAATGGAATGGAAACTATGCA 59.598 41.667 0.00 0.00 0.00 3.96
253 254 5.022122 TGGAATGGAATGGAAACTATGCAA 58.978 37.500 0.00 0.00 30.96 4.08
254 255 5.127519 TGGAATGGAATGGAAACTATGCAAG 59.872 40.000 0.00 0.00 30.96 4.01
255 256 4.660789 ATGGAATGGAAACTATGCAAGC 57.339 40.909 0.00 0.00 30.96 4.01
256 257 3.429492 TGGAATGGAAACTATGCAAGCA 58.571 40.909 0.00 0.00 30.96 3.91
257 258 3.831333 TGGAATGGAAACTATGCAAGCAA 59.169 39.130 0.00 0.00 30.96 3.91
258 259 4.282957 TGGAATGGAAACTATGCAAGCAAA 59.717 37.500 0.00 0.00 30.96 3.68
259 260 4.627035 GGAATGGAAACTATGCAAGCAAAC 59.373 41.667 0.00 0.00 30.96 2.93
260 261 4.870123 ATGGAAACTATGCAAGCAAACA 57.130 36.364 0.00 0.00 30.96 2.83
261 262 4.870123 TGGAAACTATGCAAGCAAACAT 57.130 36.364 0.00 0.00 0.00 2.71
262 263 4.558178 TGGAAACTATGCAAGCAAACATG 58.442 39.130 0.00 0.00 0.00 3.21
263 264 3.368843 GGAAACTATGCAAGCAAACATGC 59.631 43.478 0.00 0.00 40.89 4.06
264 265 2.660189 ACTATGCAAGCAAACATGCC 57.340 45.000 0.00 0.00 39.76 4.40
265 266 1.205417 ACTATGCAAGCAAACATGCCC 59.795 47.619 0.00 0.00 39.76 5.36
266 267 1.205179 CTATGCAAGCAAACATGCCCA 59.795 47.619 0.00 0.00 39.76 5.36
267 268 0.320946 ATGCAAGCAAACATGCCCAC 60.321 50.000 0.00 0.00 39.76 4.61
268 269 1.069427 GCAAGCAAACATGCCCACA 59.931 52.632 0.00 0.00 34.44 4.17
269 270 0.320946 GCAAGCAAACATGCCCACAT 60.321 50.000 0.00 0.00 34.44 3.21
270 271 1.717194 CAAGCAAACATGCCCACATC 58.283 50.000 0.00 0.00 32.87 3.06
271 272 0.609662 AAGCAAACATGCCCACATCC 59.390 50.000 0.00 0.00 32.87 3.51
272 273 0.251922 AGCAAACATGCCCACATCCT 60.252 50.000 0.00 0.00 32.87 3.24
273 274 0.609662 GCAAACATGCCCACATCCTT 59.390 50.000 0.00 0.00 32.87 3.36
274 275 1.002315 GCAAACATGCCCACATCCTTT 59.998 47.619 0.00 0.00 32.87 3.11
275 276 2.233431 GCAAACATGCCCACATCCTTTA 59.767 45.455 0.00 0.00 32.87 1.85
276 277 3.306641 GCAAACATGCCCACATCCTTTAA 60.307 43.478 0.00 0.00 32.87 1.52
277 278 4.802248 GCAAACATGCCCACATCCTTTAAA 60.802 41.667 0.00 0.00 32.87 1.52
278 279 5.490159 CAAACATGCCCACATCCTTTAAAT 58.510 37.500 0.00 0.00 32.87 1.40
279 280 5.760484 AACATGCCCACATCCTTTAAATT 57.240 34.783 0.00 0.00 32.87 1.82
280 281 5.343307 ACATGCCCACATCCTTTAAATTC 57.657 39.130 0.00 0.00 32.87 2.17
281 282 4.776837 ACATGCCCACATCCTTTAAATTCA 59.223 37.500 0.00 0.00 32.87 2.57
282 283 5.105228 ACATGCCCACATCCTTTAAATTCAG 60.105 40.000 0.00 0.00 32.87 3.02
283 284 3.195396 TGCCCACATCCTTTAAATTCAGC 59.805 43.478 0.00 0.00 0.00 4.26
284 285 3.448660 GCCCACATCCTTTAAATTCAGCT 59.551 43.478 0.00 0.00 0.00 4.24
285 286 4.081476 GCCCACATCCTTTAAATTCAGCTT 60.081 41.667 0.00 0.00 0.00 3.74
286 287 5.654497 CCCACATCCTTTAAATTCAGCTTC 58.346 41.667 0.00 0.00 0.00 3.86
287 288 5.394553 CCCACATCCTTTAAATTCAGCTTCC 60.395 44.000 0.00 0.00 0.00 3.46
288 289 5.420104 CCACATCCTTTAAATTCAGCTTCCT 59.580 40.000 0.00 0.00 0.00 3.36
289 290 6.071165 CCACATCCTTTAAATTCAGCTTCCTT 60.071 38.462 0.00 0.00 0.00 3.36
290 291 7.122650 CCACATCCTTTAAATTCAGCTTCCTTA 59.877 37.037 0.00 0.00 0.00 2.69
291 292 8.186821 CACATCCTTTAAATTCAGCTTCCTTAG 58.813 37.037 0.00 0.00 0.00 2.18
292 293 8.109634 ACATCCTTTAAATTCAGCTTCCTTAGA 58.890 33.333 0.00 0.00 0.00 2.10
293 294 8.960591 CATCCTTTAAATTCAGCTTCCTTAGAA 58.039 33.333 0.00 0.00 0.00 2.10
294 295 8.934023 TCCTTTAAATTCAGCTTCCTTAGAAA 57.066 30.769 0.00 0.00 0.00 2.52
295 296 9.533831 TCCTTTAAATTCAGCTTCCTTAGAAAT 57.466 29.630 0.00 0.00 0.00 2.17
299 300 7.888250 AAATTCAGCTTCCTTAGAAATAGGG 57.112 36.000 0.00 0.00 33.41 3.53
300 301 6.831664 ATTCAGCTTCCTTAGAAATAGGGA 57.168 37.500 0.00 0.00 33.41 4.20
301 302 5.878406 TCAGCTTCCTTAGAAATAGGGAG 57.122 43.478 0.00 0.00 40.80 4.30
306 307 6.096673 CTTCCTTAGAAATAGGGAGCTCTC 57.903 45.833 14.64 10.30 31.72 3.20
307 308 5.144159 TCCTTAGAAATAGGGAGCTCTCA 57.856 43.478 17.82 1.88 33.41 3.27
308 309 5.144100 TCCTTAGAAATAGGGAGCTCTCAG 58.856 45.833 17.82 0.96 33.41 3.35
309 310 4.283212 CCTTAGAAATAGGGAGCTCTCAGG 59.717 50.000 17.82 7.18 0.00 3.86
310 311 2.688477 AGAAATAGGGAGCTCTCAGGG 58.312 52.381 17.82 0.00 0.00 4.45
311 312 1.696884 GAAATAGGGAGCTCTCAGGGG 59.303 57.143 17.82 0.00 0.00 4.79
312 313 0.644937 AATAGGGAGCTCTCAGGGGT 59.355 55.000 17.82 0.00 0.00 4.95
313 314 0.644937 ATAGGGAGCTCTCAGGGGTT 59.355 55.000 17.82 0.00 0.00 4.11
314 315 0.325671 TAGGGAGCTCTCAGGGGTTG 60.326 60.000 17.82 0.00 0.00 3.77
315 316 1.613630 GGGAGCTCTCAGGGGTTGA 60.614 63.158 14.64 0.00 0.00 3.18
321 322 4.386413 CTCAGGGGTTGAGTGCAC 57.614 61.111 9.40 9.40 46.77 4.57
322 323 1.669115 CTCAGGGGTTGAGTGCACG 60.669 63.158 12.01 0.00 46.77 5.34
323 324 2.669569 CAGGGGTTGAGTGCACGG 60.670 66.667 12.01 0.00 0.00 4.94
324 325 4.643387 AGGGGTTGAGTGCACGGC 62.643 66.667 12.01 8.53 0.00 5.68
326 327 4.947147 GGGTTGAGTGCACGGCCA 62.947 66.667 12.01 8.33 0.00 5.36
327 328 3.357079 GGTTGAGTGCACGGCCAG 61.357 66.667 12.01 0.00 0.00 4.85
328 329 3.357079 GTTGAGTGCACGGCCAGG 61.357 66.667 12.01 0.00 0.00 4.45
329 330 3.872603 TTGAGTGCACGGCCAGGT 61.873 61.111 12.01 0.00 0.00 4.00
330 331 3.825160 TTGAGTGCACGGCCAGGTC 62.825 63.158 12.01 1.85 0.00 3.85
331 332 4.314440 GAGTGCACGGCCAGGTCA 62.314 66.667 12.01 0.00 0.00 4.02
332 333 3.825160 GAGTGCACGGCCAGGTCAA 62.825 63.158 12.01 0.00 0.00 3.18
333 334 3.357079 GTGCACGGCCAGGTCAAG 61.357 66.667 2.24 0.00 0.00 3.02
334 335 3.872603 TGCACGGCCAGGTCAAGT 61.873 61.111 2.24 0.00 0.00 3.16
335 336 3.050275 GCACGGCCAGGTCAAGTC 61.050 66.667 2.24 0.00 0.00 3.01
336 337 2.425592 CACGGCCAGGTCAAGTCA 59.574 61.111 2.24 0.00 0.00 3.41
337 338 1.227823 CACGGCCAGGTCAAGTCAA 60.228 57.895 2.24 0.00 0.00 3.18
338 339 1.227853 ACGGCCAGGTCAAGTCAAC 60.228 57.895 2.24 0.00 0.00 3.18
339 340 2.317609 CGGCCAGGTCAAGTCAACG 61.318 63.158 2.24 0.00 0.00 4.10
340 341 1.227853 GGCCAGGTCAAGTCAACGT 60.228 57.895 0.00 0.00 0.00 3.99
341 342 0.818040 GGCCAGGTCAAGTCAACGTT 60.818 55.000 0.00 0.00 0.00 3.99
342 343 0.586802 GCCAGGTCAAGTCAACGTTC 59.413 55.000 0.00 0.00 0.00 3.95
343 344 1.226746 CCAGGTCAAGTCAACGTTCC 58.773 55.000 0.00 0.00 0.00 3.62
344 345 1.202651 CCAGGTCAAGTCAACGTTCCT 60.203 52.381 0.00 0.00 0.00 3.36
345 346 2.561569 CAGGTCAAGTCAACGTTCCTT 58.438 47.619 0.00 0.30 0.00 3.36
346 347 2.943033 CAGGTCAAGTCAACGTTCCTTT 59.057 45.455 0.00 0.00 0.00 3.11
347 348 2.943033 AGGTCAAGTCAACGTTCCTTTG 59.057 45.455 0.00 3.36 0.00 2.77
348 349 2.940410 GGTCAAGTCAACGTTCCTTTGA 59.060 45.455 0.00 5.82 0.00 2.69
349 350 3.002348 GGTCAAGTCAACGTTCCTTTGAG 59.998 47.826 14.60 3.62 33.63 3.02
350 351 3.869246 GTCAAGTCAACGTTCCTTTGAGA 59.131 43.478 14.60 5.40 33.63 3.27
351 352 4.331717 GTCAAGTCAACGTTCCTTTGAGAA 59.668 41.667 14.60 0.00 33.63 2.87
352 353 4.331717 TCAAGTCAACGTTCCTTTGAGAAC 59.668 41.667 0.00 0.00 42.25 3.01
353 354 3.203716 AGTCAACGTTCCTTTGAGAACC 58.796 45.455 0.00 0.00 42.63 3.62
354 355 2.289820 GTCAACGTTCCTTTGAGAACCC 59.710 50.000 0.00 0.00 42.63 4.11
355 356 2.092861 TCAACGTTCCTTTGAGAACCCA 60.093 45.455 0.00 0.00 42.63 4.51
356 357 1.963172 ACGTTCCTTTGAGAACCCAC 58.037 50.000 0.00 0.00 42.63 4.61
357 358 1.210967 ACGTTCCTTTGAGAACCCACA 59.789 47.619 0.00 0.00 42.63 4.17
358 359 1.602377 CGTTCCTTTGAGAACCCACAC 59.398 52.381 0.00 0.00 42.63 3.82
359 360 1.602377 GTTCCTTTGAGAACCCACACG 59.398 52.381 0.00 0.00 40.25 4.49
360 361 0.107831 TCCTTTGAGAACCCACACGG 59.892 55.000 0.00 0.00 37.81 4.94
368 369 4.408378 ACCCACACGGTAATTGCC 57.592 55.556 1.83 1.83 45.97 4.52
369 370 1.765074 ACCCACACGGTAATTGCCT 59.235 52.632 11.07 0.00 45.97 4.75
370 371 0.985760 ACCCACACGGTAATTGCCTA 59.014 50.000 11.07 0.00 45.97 3.93
371 372 1.562475 ACCCACACGGTAATTGCCTAT 59.438 47.619 11.07 0.00 45.97 2.57
372 373 2.218603 CCCACACGGTAATTGCCTATC 58.781 52.381 11.07 0.00 0.00 2.08
373 374 2.158813 CCCACACGGTAATTGCCTATCT 60.159 50.000 11.07 0.00 0.00 1.98
374 375 3.541632 CCACACGGTAATTGCCTATCTT 58.458 45.455 11.07 0.00 0.00 2.40
375 376 3.945285 CCACACGGTAATTGCCTATCTTT 59.055 43.478 11.07 0.00 0.00 2.52
376 377 4.398044 CCACACGGTAATTGCCTATCTTTT 59.602 41.667 11.07 0.00 0.00 2.27
377 378 5.105917 CCACACGGTAATTGCCTATCTTTTT 60.106 40.000 11.07 0.00 0.00 1.94
394 395 3.598019 TTTTTAGTCGGGCTCATACGT 57.402 42.857 0.00 0.00 0.00 3.57
395 396 4.717233 TTTTTAGTCGGGCTCATACGTA 57.283 40.909 0.00 0.00 0.00 3.57
396 397 4.924305 TTTTAGTCGGGCTCATACGTAT 57.076 40.909 1.14 1.14 0.00 3.06
397 398 4.924305 TTTAGTCGGGCTCATACGTATT 57.076 40.909 5.03 0.00 0.00 1.89
398 399 4.924305 TTAGTCGGGCTCATACGTATTT 57.076 40.909 5.03 0.00 0.00 1.40
399 400 3.093717 AGTCGGGCTCATACGTATTTG 57.906 47.619 5.03 2.84 0.00 2.32
400 401 2.429610 AGTCGGGCTCATACGTATTTGT 59.570 45.455 5.03 0.00 0.00 2.83
401 402 3.118884 AGTCGGGCTCATACGTATTTGTT 60.119 43.478 5.03 0.00 0.00 2.83
402 403 3.619929 GTCGGGCTCATACGTATTTGTTT 59.380 43.478 5.03 0.00 0.00 2.83
403 404 4.093850 GTCGGGCTCATACGTATTTGTTTT 59.906 41.667 5.03 0.00 0.00 2.43
404 405 4.093703 TCGGGCTCATACGTATTTGTTTTG 59.906 41.667 5.03 0.00 0.00 2.44
405 406 4.668289 GGGCTCATACGTATTTGTTTTGG 58.332 43.478 5.03 0.00 0.00 3.28
406 407 4.157105 GGGCTCATACGTATTTGTTTTGGT 59.843 41.667 5.03 0.00 0.00 3.67
407 408 5.092781 GGCTCATACGTATTTGTTTTGGTG 58.907 41.667 5.03 0.00 0.00 4.17
408 409 5.092781 GCTCATACGTATTTGTTTTGGTGG 58.907 41.667 5.03 0.00 0.00 4.61
409 410 5.106475 GCTCATACGTATTTGTTTTGGTGGA 60.106 40.000 5.03 0.00 0.00 4.02
410 411 6.568844 GCTCATACGTATTTGTTTTGGTGGAA 60.569 38.462 5.03 0.00 0.00 3.53
411 412 7.455641 TCATACGTATTTGTTTTGGTGGAAT 57.544 32.000 5.03 0.00 0.00 3.01
412 413 7.309177 TCATACGTATTTGTTTTGGTGGAATG 58.691 34.615 5.03 0.00 0.00 2.67
413 414 4.877282 ACGTATTTGTTTTGGTGGAATGG 58.123 39.130 0.00 0.00 0.00 3.16
414 415 4.585162 ACGTATTTGTTTTGGTGGAATGGA 59.415 37.500 0.00 0.00 0.00 3.41
415 416 5.069251 ACGTATTTGTTTTGGTGGAATGGAA 59.931 36.000 0.00 0.00 0.00 3.53
416 417 5.404066 CGTATTTGTTTTGGTGGAATGGAAC 59.596 40.000 0.00 0.00 0.00 3.62
417 418 3.828875 TTGTTTTGGTGGAATGGAACC 57.171 42.857 0.00 0.00 36.96 3.62
418 419 2.043227 TGTTTTGGTGGAATGGAACCC 58.957 47.619 0.00 0.00 35.44 4.11
419 420 2.043227 GTTTTGGTGGAATGGAACCCA 58.957 47.619 0.00 0.00 38.19 4.51
423 424 4.811206 TGGAATGGAACCCACACG 57.189 55.556 0.00 0.00 35.80 4.49
424 425 1.602323 TGGAATGGAACCCACACGC 60.602 57.895 0.00 0.00 35.80 5.34
425 426 1.303317 GGAATGGAACCCACACGCT 60.303 57.895 0.00 0.00 35.80 5.07
426 427 1.305930 GGAATGGAACCCACACGCTC 61.306 60.000 0.00 0.00 35.80 5.03
427 428 1.303317 AATGGAACCCACACGCTCC 60.303 57.895 0.00 0.00 35.80 4.70
428 429 2.764637 AATGGAACCCACACGCTCCC 62.765 60.000 0.00 0.00 35.80 4.30
429 430 3.637273 GGAACCCACACGCTCCCT 61.637 66.667 0.00 0.00 0.00 4.20
430 431 2.358737 GAACCCACACGCTCCCTG 60.359 66.667 0.00 0.00 0.00 4.45
431 432 3.168528 AACCCACACGCTCCCTGT 61.169 61.111 0.00 0.00 0.00 4.00
432 433 2.676163 GAACCCACACGCTCCCTGTT 62.676 60.000 0.00 0.00 0.00 3.16
433 434 2.669569 CCCACACGCTCCCTGTTG 60.670 66.667 0.00 0.00 0.00 3.33
434 435 2.111043 CCACACGCTCCCTGTTGT 59.889 61.111 0.00 0.00 0.00 3.32
435 436 2.253758 CCACACGCTCCCTGTTGTG 61.254 63.158 0.00 0.00 38.28 3.33
436 437 1.523711 CACACGCTCCCTGTTGTGT 60.524 57.895 0.00 0.00 45.79 3.72
437 438 1.095228 CACACGCTCCCTGTTGTGTT 61.095 55.000 0.00 0.00 42.53 3.32
438 439 0.393808 ACACGCTCCCTGTTGTGTTT 60.394 50.000 0.00 0.00 42.53 2.83
439 440 0.307760 CACGCTCCCTGTTGTGTTTC 59.692 55.000 0.00 0.00 0.00 2.78
440 441 0.180406 ACGCTCCCTGTTGTGTTTCT 59.820 50.000 0.00 0.00 0.00 2.52
441 442 0.588252 CGCTCCCTGTTGTGTTTCTG 59.412 55.000 0.00 0.00 0.00 3.02
442 443 0.312102 GCTCCCTGTTGTGTTTCTGC 59.688 55.000 0.00 0.00 0.00 4.26
443 444 0.954452 CTCCCTGTTGTGTTTCTGCC 59.046 55.000 0.00 0.00 0.00 4.85
444 445 0.817634 TCCCTGTTGTGTTTCTGCCG 60.818 55.000 0.00 0.00 0.00 5.69
445 446 1.008538 CCTGTTGTGTTTCTGCCGC 60.009 57.895 0.00 0.00 0.00 6.53
446 447 1.369209 CTGTTGTGTTTCTGCCGCG 60.369 57.895 0.00 0.00 0.00 6.46
447 448 2.047151 CTGTTGTGTTTCTGCCGCGT 62.047 55.000 4.92 0.00 0.00 6.01
448 449 1.063488 GTTGTGTTTCTGCCGCGTT 59.937 52.632 4.92 0.00 0.00 4.84
449 450 1.063327 TTGTGTTTCTGCCGCGTTG 59.937 52.632 4.92 0.00 0.00 4.10
450 451 1.649390 TTGTGTTTCTGCCGCGTTGT 61.649 50.000 4.92 0.00 0.00 3.32
451 452 1.063488 GTGTTTCTGCCGCGTTGTT 59.937 52.632 4.92 0.00 0.00 2.83
452 453 1.063327 TGTTTCTGCCGCGTTGTTG 59.937 52.632 4.92 0.00 0.00 3.33
453 454 1.657181 GTTTCTGCCGCGTTGTTGG 60.657 57.895 4.92 0.00 0.00 3.77
454 455 2.115911 TTTCTGCCGCGTTGTTGGT 61.116 52.632 4.92 0.00 0.00 3.67
455 456 1.658686 TTTCTGCCGCGTTGTTGGTT 61.659 50.000 4.92 0.00 0.00 3.67
456 457 2.329678 TTCTGCCGCGTTGTTGGTTG 62.330 55.000 4.92 0.00 0.00 3.77
457 458 2.824489 TGCCGCGTTGTTGGTTGA 60.824 55.556 4.92 0.00 0.00 3.18
458 459 2.329678 CTGCCGCGTTGTTGGTTGAA 62.330 55.000 4.92 0.00 0.00 2.69
459 460 1.007849 GCCGCGTTGTTGGTTGAAT 60.008 52.632 4.92 0.00 0.00 2.57
460 461 1.274798 GCCGCGTTGTTGGTTGAATG 61.275 55.000 4.92 0.00 0.00 2.67
461 462 1.274798 CCGCGTTGTTGGTTGAATGC 61.275 55.000 4.92 0.00 0.00 3.56
462 463 0.593518 CGCGTTGTTGGTTGAATGCA 60.594 50.000 0.00 0.00 34.35 3.96
463 464 0.852136 GCGTTGTTGGTTGAATGCAC 59.148 50.000 0.00 0.00 34.75 4.57
464 465 1.119635 CGTTGTTGGTTGAATGCACG 58.880 50.000 0.00 0.00 0.00 5.34
465 466 1.486439 GTTGTTGGTTGAATGCACGG 58.514 50.000 0.00 0.00 0.00 4.94
466 467 0.249238 TTGTTGGTTGAATGCACGGC 60.249 50.000 0.00 0.00 0.00 5.68
467 468 1.372872 GTTGGTTGAATGCACGGCC 60.373 57.895 0.00 0.00 0.00 6.13
468 469 1.829970 TTGGTTGAATGCACGGCCA 60.830 52.632 2.24 0.00 0.00 5.36
469 470 1.804396 TTGGTTGAATGCACGGCCAG 61.804 55.000 2.24 0.00 0.00 4.85
470 471 2.568090 GTTGAATGCACGGCCAGG 59.432 61.111 2.24 0.00 0.00 4.45
471 472 2.115052 TTGAATGCACGGCCAGGT 59.885 55.556 2.24 0.00 0.00 4.00
472 473 1.971167 TTGAATGCACGGCCAGGTC 60.971 57.895 2.24 0.00 0.00 3.85
473 474 2.359850 GAATGCACGGCCAGGTCA 60.360 61.111 2.24 0.00 0.00 4.02
474 475 1.971167 GAATGCACGGCCAGGTCAA 60.971 57.895 2.24 0.00 0.00 3.18
475 476 1.926511 GAATGCACGGCCAGGTCAAG 61.927 60.000 2.24 0.00 0.00 3.02
476 477 2.410322 AATGCACGGCCAGGTCAAGA 62.410 55.000 2.24 0.00 0.00 3.02
477 478 3.050275 GCACGGCCAGGTCAAGAC 61.050 66.667 2.24 0.00 0.00 3.01
478 479 2.425592 CACGGCCAGGTCAAGACA 59.574 61.111 2.24 0.00 0.00 3.41
479 480 1.227823 CACGGCCAGGTCAAGACAA 60.228 57.895 2.24 0.00 0.00 3.18
480 481 1.227853 ACGGCCAGGTCAAGACAAC 60.228 57.895 2.24 0.00 0.00 3.32
481 482 2.317609 CGGCCAGGTCAAGACAACG 61.318 63.158 2.24 0.00 0.00 4.10
482 483 1.227853 GGCCAGGTCAAGACAACGT 60.228 57.895 0.00 0.00 0.00 3.99
483 484 0.818040 GGCCAGGTCAAGACAACGTT 60.818 55.000 0.00 0.00 0.00 3.99
484 485 1.021968 GCCAGGTCAAGACAACGTTT 58.978 50.000 0.00 0.00 0.00 3.60
485 486 1.002792 GCCAGGTCAAGACAACGTTTC 60.003 52.381 0.00 0.00 0.00 2.78
486 487 2.561569 CCAGGTCAAGACAACGTTTCT 58.438 47.619 0.00 2.50 0.00 2.52
487 488 2.943033 CCAGGTCAAGACAACGTTTCTT 59.057 45.455 15.47 15.47 33.38 2.52
488 489 3.002348 CCAGGTCAAGACAACGTTTCTTC 59.998 47.826 17.29 7.66 30.56 2.87
489 490 2.864343 AGGTCAAGACAACGTTTCTTCG 59.136 45.455 17.29 14.06 30.56 3.79
490 491 2.861935 GGTCAAGACAACGTTTCTTCGA 59.138 45.455 17.29 15.38 30.56 3.71
491 492 3.060473 GGTCAAGACAACGTTTCTTCGAG 60.060 47.826 17.29 10.44 30.56 4.04
492 493 3.795101 GTCAAGACAACGTTTCTTCGAGA 59.205 43.478 17.29 11.92 30.56 4.04
493 494 4.266976 GTCAAGACAACGTTTCTTCGAGAA 59.733 41.667 17.29 0.00 30.56 2.87
494 495 4.266976 TCAAGACAACGTTTCTTCGAGAAC 59.733 41.667 17.29 0.00 33.26 3.01
495 496 3.121544 AGACAACGTTTCTTCGAGAACC 58.878 45.455 0.00 0.00 33.26 3.62
496 497 2.207590 ACAACGTTTCTTCGAGAACCC 58.792 47.619 0.00 0.00 33.26 4.11
497 498 2.206750 CAACGTTTCTTCGAGAACCCA 58.793 47.619 0.00 0.00 33.26 4.51
498 499 2.806244 CAACGTTTCTTCGAGAACCCAT 59.194 45.455 0.00 0.00 33.26 4.00
499 500 3.947910 ACGTTTCTTCGAGAACCCATA 57.052 42.857 0.00 0.00 33.26 2.74
500 501 4.467198 ACGTTTCTTCGAGAACCCATAT 57.533 40.909 0.00 0.00 33.26 1.78
501 502 4.181578 ACGTTTCTTCGAGAACCCATATG 58.818 43.478 0.00 0.00 33.26 1.78
502 503 3.555956 CGTTTCTTCGAGAACCCATATGG 59.444 47.826 15.41 15.41 33.26 2.74
503 504 2.910688 TCTTCGAGAACCCATATGGC 57.089 50.000 16.97 2.85 37.83 4.40
504 505 2.115427 TCTTCGAGAACCCATATGGCA 58.885 47.619 16.97 0.00 37.83 4.92
505 506 2.503765 TCTTCGAGAACCCATATGGCAA 59.496 45.455 16.97 0.00 37.83 4.52
506 507 3.136443 TCTTCGAGAACCCATATGGCAAT 59.864 43.478 16.97 4.03 37.83 3.56
507 508 3.576078 TCGAGAACCCATATGGCAATT 57.424 42.857 16.97 9.81 37.83 2.32
508 509 3.213506 TCGAGAACCCATATGGCAATTG 58.786 45.455 16.97 0.00 37.83 2.32
509 510 2.287788 CGAGAACCCATATGGCAATTGC 60.288 50.000 22.47 22.47 37.83 3.56
525 526 5.266242 GCAATTGCCTATCTGTTTAAGTCG 58.734 41.667 20.06 0.00 34.31 4.18
526 527 5.730568 GCAATTGCCTATCTGTTTAAGTCGG 60.731 44.000 20.06 0.00 34.31 4.79
527 528 3.536956 TGCCTATCTGTTTAAGTCGGG 57.463 47.619 0.00 0.00 0.00 5.14
528 529 2.210961 GCCTATCTGTTTAAGTCGGGC 58.789 52.381 0.00 0.00 0.00 6.13
529 530 2.158943 GCCTATCTGTTTAAGTCGGGCT 60.159 50.000 0.00 0.00 34.38 5.19
530 531 3.718815 CCTATCTGTTTAAGTCGGGCTC 58.281 50.000 0.00 0.00 0.00 4.70
531 532 3.132289 CCTATCTGTTTAAGTCGGGCTCA 59.868 47.826 0.00 0.00 0.00 4.26
532 533 3.914426 ATCTGTTTAAGTCGGGCTCAT 57.086 42.857 0.00 0.00 0.00 2.90
533 534 2.972625 TCTGTTTAAGTCGGGCTCATG 58.027 47.619 0.00 0.00 0.00 3.07
534 535 1.398390 CTGTTTAAGTCGGGCTCATGC 59.602 52.381 0.00 0.00 38.76 4.06
535 536 1.271108 TGTTTAAGTCGGGCTCATGCA 60.271 47.619 0.00 0.00 41.91 3.96
536 537 1.130561 GTTTAAGTCGGGCTCATGCAC 59.869 52.381 0.00 0.00 41.91 4.57
537 538 0.613260 TTAAGTCGGGCTCATGCACT 59.387 50.000 0.00 0.00 41.26 4.40
538 539 0.613260 TAAGTCGGGCTCATGCACTT 59.387 50.000 0.00 0.00 41.26 3.16
539 540 0.250901 AAGTCGGGCTCATGCACTTT 60.251 50.000 0.00 0.00 41.26 2.66
540 541 0.250901 AGTCGGGCTCATGCACTTTT 60.251 50.000 0.00 0.00 41.26 2.27
541 542 0.598065 GTCGGGCTCATGCACTTTTT 59.402 50.000 0.00 0.00 41.26 1.94
568 569 7.936496 TGTGCTAGATCCAATTTACAATTCA 57.064 32.000 0.00 0.00 0.00 2.57
569 570 8.347004 TGTGCTAGATCCAATTTACAATTCAA 57.653 30.769 0.00 0.00 0.00 2.69
570 571 8.243426 TGTGCTAGATCCAATTTACAATTCAAC 58.757 33.333 0.00 0.00 0.00 3.18
571 572 8.243426 GTGCTAGATCCAATTTACAATTCAACA 58.757 33.333 0.00 0.00 0.00 3.33
572 573 8.801299 TGCTAGATCCAATTTACAATTCAACAA 58.199 29.630 0.00 0.00 0.00 2.83
573 574 9.807649 GCTAGATCCAATTTACAATTCAACAAT 57.192 29.630 0.00 0.00 0.00 2.71
597 598 9.651913 AATATAACAAAAGGTAAATTGCAGTGG 57.348 29.630 0.00 0.00 0.00 4.00
598 599 5.351948 AACAAAAGGTAAATTGCAGTGGT 57.648 34.783 0.00 0.00 0.00 4.16
599 600 6.472686 AACAAAAGGTAAATTGCAGTGGTA 57.527 33.333 0.00 0.00 0.00 3.25
600 601 6.084326 ACAAAAGGTAAATTGCAGTGGTAG 57.916 37.500 0.00 0.00 0.00 3.18
601 602 5.596772 ACAAAAGGTAAATTGCAGTGGTAGT 59.403 36.000 0.00 0.00 0.00 2.73
602 603 5.959618 AAAGGTAAATTGCAGTGGTAGTC 57.040 39.130 0.00 0.00 0.00 2.59
603 604 4.910458 AGGTAAATTGCAGTGGTAGTCT 57.090 40.909 0.00 0.00 0.00 3.24
604 605 5.242795 AGGTAAATTGCAGTGGTAGTCTT 57.757 39.130 0.00 0.00 0.00 3.01
605 606 5.631119 AGGTAAATTGCAGTGGTAGTCTTT 58.369 37.500 0.00 0.00 0.00 2.52
606 607 6.068670 AGGTAAATTGCAGTGGTAGTCTTTT 58.931 36.000 0.00 0.00 0.00 2.27
607 608 6.016276 AGGTAAATTGCAGTGGTAGTCTTTTG 60.016 38.462 0.00 0.00 0.00 2.44
608 609 5.852282 AAATTGCAGTGGTAGTCTTTTGT 57.148 34.783 0.00 0.00 0.00 2.83
609 610 5.438761 AATTGCAGTGGTAGTCTTTTGTC 57.561 39.130 0.00 0.00 0.00 3.18
610 611 2.846193 TGCAGTGGTAGTCTTTTGTCC 58.154 47.619 0.00 0.00 0.00 4.02
611 612 2.171659 TGCAGTGGTAGTCTTTTGTCCA 59.828 45.455 0.00 0.00 0.00 4.02
612 613 3.211045 GCAGTGGTAGTCTTTTGTCCAA 58.789 45.455 0.00 0.00 0.00 3.53
613 614 3.003378 GCAGTGGTAGTCTTTTGTCCAAC 59.997 47.826 0.00 0.00 0.00 3.77
614 615 4.196193 CAGTGGTAGTCTTTTGTCCAACA 58.804 43.478 0.00 0.00 0.00 3.33
615 616 4.638421 CAGTGGTAGTCTTTTGTCCAACAA 59.362 41.667 0.00 0.00 36.11 2.83
616 617 4.638865 AGTGGTAGTCTTTTGTCCAACAAC 59.361 41.667 0.00 0.00 37.90 3.32
617 618 4.638865 GTGGTAGTCTTTTGTCCAACAACT 59.361 41.667 0.00 0.00 37.90 3.16
618 619 4.879545 TGGTAGTCTTTTGTCCAACAACTC 59.120 41.667 0.00 0.00 37.90 3.01
619 620 5.123936 GGTAGTCTTTTGTCCAACAACTCT 58.876 41.667 0.00 0.00 37.90 3.24
620 621 5.236695 GGTAGTCTTTTGTCCAACAACTCTC 59.763 44.000 0.00 0.00 37.90 3.20
621 622 4.843728 AGTCTTTTGTCCAACAACTCTCA 58.156 39.130 0.00 0.00 37.90 3.27
622 623 5.253330 AGTCTTTTGTCCAACAACTCTCAA 58.747 37.500 0.00 0.00 37.90 3.02
623 624 5.710099 AGTCTTTTGTCCAACAACTCTCAAA 59.290 36.000 0.00 0.00 37.90 2.69
624 625 5.800438 GTCTTTTGTCCAACAACTCTCAAAC 59.200 40.000 0.00 0.00 37.90 2.93
625 626 5.710099 TCTTTTGTCCAACAACTCTCAAACT 59.290 36.000 0.00 0.00 37.90 2.66
626 627 6.882140 TCTTTTGTCCAACAACTCTCAAACTA 59.118 34.615 0.00 0.00 37.90 2.24
627 628 7.556275 TCTTTTGTCCAACAACTCTCAAACTAT 59.444 33.333 0.00 0.00 37.90 2.12
628 629 8.740123 TTTTGTCCAACAACTCTCAAACTATA 57.260 30.769 0.00 0.00 37.90 1.31
629 630 7.724305 TTGTCCAACAACTCTCAAACTATAC 57.276 36.000 0.00 0.00 32.34 1.47
630 631 7.062749 TGTCCAACAACTCTCAAACTATACT 57.937 36.000 0.00 0.00 0.00 2.12
631 632 7.506114 TGTCCAACAACTCTCAAACTATACTT 58.494 34.615 0.00 0.00 0.00 2.24
632 633 7.441157 TGTCCAACAACTCTCAAACTATACTTG 59.559 37.037 0.00 0.00 0.00 3.16
633 634 7.441458 GTCCAACAACTCTCAAACTATACTTGT 59.559 37.037 0.00 0.00 0.00 3.16
634 635 8.644216 TCCAACAACTCTCAAACTATACTTGTA 58.356 33.333 0.00 0.00 0.00 2.41
635 636 9.436957 CCAACAACTCTCAAACTATACTTGTAT 57.563 33.333 0.00 0.00 0.00 2.29
653 654 6.816140 ACTTGTATAAAGAGAGAAGCTTCAGC 59.184 38.462 27.57 18.43 42.49 4.26
654 655 6.286240 TGTATAAAGAGAGAAGCTTCAGCA 57.714 37.500 27.57 6.33 45.16 4.41
655 656 6.701340 TGTATAAAGAGAGAAGCTTCAGCAA 58.299 36.000 27.57 7.19 45.16 3.91
656 657 6.815641 TGTATAAAGAGAGAAGCTTCAGCAAG 59.184 38.462 27.57 0.00 45.16 4.01
667 668 3.374220 CTTCAGCAAGCCAAACAATCA 57.626 42.857 0.00 0.00 0.00 2.57
668 669 2.798976 TCAGCAAGCCAAACAATCAC 57.201 45.000 0.00 0.00 0.00 3.06
669 670 1.340889 TCAGCAAGCCAAACAATCACC 59.659 47.619 0.00 0.00 0.00 4.02
670 671 1.068895 CAGCAAGCCAAACAATCACCA 59.931 47.619 0.00 0.00 0.00 4.17
671 672 1.342174 AGCAAGCCAAACAATCACCAG 59.658 47.619 0.00 0.00 0.00 4.00
672 673 1.787012 CAAGCCAAACAATCACCAGC 58.213 50.000 0.00 0.00 0.00 4.85
673 674 1.068895 CAAGCCAAACAATCACCAGCA 59.931 47.619 0.00 0.00 0.00 4.41
674 675 0.963962 AGCCAAACAATCACCAGCAG 59.036 50.000 0.00 0.00 0.00 4.24
675 676 0.668401 GCCAAACAATCACCAGCAGC 60.668 55.000 0.00 0.00 0.00 5.25
676 677 0.675083 CCAAACAATCACCAGCAGCA 59.325 50.000 0.00 0.00 0.00 4.41
677 678 1.603678 CCAAACAATCACCAGCAGCAC 60.604 52.381 0.00 0.00 0.00 4.40
678 679 1.067364 CAAACAATCACCAGCAGCACA 59.933 47.619 0.00 0.00 0.00 4.57
679 680 1.401761 AACAATCACCAGCAGCACAA 58.598 45.000 0.00 0.00 0.00 3.33
680 681 0.670162 ACAATCACCAGCAGCACAAC 59.330 50.000 0.00 0.00 0.00 3.32
681 682 0.956633 CAATCACCAGCAGCACAACT 59.043 50.000 0.00 0.00 0.00 3.16
685 686 3.677648 CCAGCAGCACAACTGGCC 61.678 66.667 0.00 0.00 46.50 5.36
701 702 2.748251 CCGGCCGGCAAACACATA 60.748 61.111 34.96 0.00 0.00 2.29
702 703 2.336478 CCGGCCGGCAAACACATAA 61.336 57.895 34.96 0.00 0.00 1.90
703 704 1.154112 CGGCCGGCAAACACATAAC 60.154 57.895 30.85 5.23 0.00 1.89
704 705 1.214325 GGCCGGCAAACACATAACC 59.786 57.895 30.85 1.22 0.00 2.85
705 706 1.214325 GCCGGCAAACACATAACCC 59.786 57.895 24.80 0.00 0.00 4.11
706 707 1.504446 CCGGCAAACACATAACCCG 59.496 57.895 0.00 0.00 35.74 5.28
707 708 0.956410 CCGGCAAACACATAACCCGA 60.956 55.000 0.00 0.00 38.04 5.14
708 709 0.446222 CGGCAAACACATAACCCGAG 59.554 55.000 0.00 0.00 38.04 4.63
709 710 0.170339 GGCAAACACATAACCCGAGC 59.830 55.000 0.00 0.00 0.00 5.03
710 711 0.878416 GCAAACACATAACCCGAGCA 59.122 50.000 0.00 0.00 0.00 4.26
711 712 1.135689 GCAAACACATAACCCGAGCAG 60.136 52.381 0.00 0.00 0.00 4.24
712 713 1.468520 CAAACACATAACCCGAGCAGG 59.531 52.381 0.00 0.00 40.63 4.85
721 722 2.108566 CCGAGCAGGGATGAGCTG 59.891 66.667 0.00 0.00 42.04 4.24
722 723 2.108566 CGAGCAGGGATGAGCTGG 59.891 66.667 0.00 0.00 42.04 4.85
723 724 2.729479 CGAGCAGGGATGAGCTGGT 61.729 63.158 0.00 0.00 42.04 4.00
724 725 1.145819 GAGCAGGGATGAGCTGGTC 59.854 63.158 0.00 0.00 42.04 4.02
725 726 1.306825 AGCAGGGATGAGCTGGTCT 60.307 57.895 8.47 0.00 40.13 3.85
726 727 0.913451 AGCAGGGATGAGCTGGTCTT 60.913 55.000 8.47 1.39 40.13 3.01
727 728 0.463474 GCAGGGATGAGCTGGTCTTC 60.463 60.000 12.71 12.71 0.00 2.87
728 729 0.907486 CAGGGATGAGCTGGTCTTCA 59.093 55.000 19.95 0.00 32.08 3.02
729 730 1.134461 CAGGGATGAGCTGGTCTTCAG 60.134 57.143 19.95 8.93 46.03 3.02
739 740 2.157738 CTGGTCTTCAGCTTTCAAGGG 58.842 52.381 0.00 0.00 36.60 3.95
740 741 0.884514 GGTCTTCAGCTTTCAAGGGC 59.115 55.000 0.00 0.00 0.00 5.19
741 742 1.609208 GTCTTCAGCTTTCAAGGGCA 58.391 50.000 0.00 0.00 0.00 5.36
742 743 2.165998 GTCTTCAGCTTTCAAGGGCAT 58.834 47.619 0.00 0.00 0.00 4.40
743 744 2.094854 GTCTTCAGCTTTCAAGGGCATG 60.095 50.000 0.00 0.00 0.00 4.06
744 745 1.891150 CTTCAGCTTTCAAGGGCATGT 59.109 47.619 0.00 0.00 0.00 3.21
745 746 1.250328 TCAGCTTTCAAGGGCATGTG 58.750 50.000 0.00 0.00 0.00 3.21
746 747 0.245539 CAGCTTTCAAGGGCATGTGG 59.754 55.000 0.00 0.00 0.00 4.17
747 748 0.112995 AGCTTTCAAGGGCATGTGGA 59.887 50.000 0.00 0.00 0.00 4.02
748 749 0.968405 GCTTTCAAGGGCATGTGGAA 59.032 50.000 0.00 0.00 0.00 3.53
749 750 1.344114 GCTTTCAAGGGCATGTGGAAA 59.656 47.619 0.00 0.00 0.00 3.13
750 751 2.611224 GCTTTCAAGGGCATGTGGAAAG 60.611 50.000 13.47 13.47 44.39 2.62
751 752 0.968405 TTCAAGGGCATGTGGAAAGC 59.032 50.000 0.00 0.00 0.00 3.51
762 763 1.374947 TGGAAAGCCAACGAGGAGG 59.625 57.895 2.86 0.00 42.49 4.30
763 764 1.125093 TGGAAAGCCAACGAGGAGGA 61.125 55.000 2.86 0.00 42.49 3.71
764 765 0.391793 GGAAAGCCAACGAGGAGGAG 60.392 60.000 2.86 0.00 41.22 3.69
765 766 0.608640 GAAAGCCAACGAGGAGGAGA 59.391 55.000 2.86 0.00 41.22 3.71
766 767 0.321996 AAAGCCAACGAGGAGGAGAC 59.678 55.000 2.86 0.00 41.22 3.36
767 768 1.545706 AAGCCAACGAGGAGGAGACC 61.546 60.000 2.86 0.00 41.22 3.85
768 769 1.985116 GCCAACGAGGAGGAGACCT 60.985 63.158 2.86 0.00 43.64 3.85
769 770 1.545706 GCCAACGAGGAGGAGACCTT 61.546 60.000 2.86 0.00 40.73 3.50
770 771 1.848652 CCAACGAGGAGGAGACCTTA 58.151 55.000 0.00 0.00 40.73 2.69
771 772 1.477295 CCAACGAGGAGGAGACCTTAC 59.523 57.143 0.00 0.00 40.73 2.34
772 773 1.477295 CAACGAGGAGGAGACCTTACC 59.523 57.143 0.00 0.00 40.73 2.85
773 774 0.394080 ACGAGGAGGAGACCTTACCG 60.394 60.000 0.00 0.00 40.73 4.02
774 775 1.726533 CGAGGAGGAGACCTTACCGC 61.727 65.000 0.00 0.00 40.73 5.68
775 776 1.381463 AGGAGGAGACCTTACCGCC 60.381 63.158 0.00 0.00 44.48 6.13
776 777 2.783288 GGAGGAGACCTTACCGCCG 61.783 68.421 0.00 0.00 36.52 6.46
777 778 2.036890 AGGAGACCTTACCGCCGT 59.963 61.111 0.00 0.00 0.00 5.68
778 779 2.002509 GAGGAGACCTTACCGCCGTC 62.003 65.000 0.00 0.00 31.76 4.79
779 780 2.101770 GAGACCTTACCGCCGTCG 59.898 66.667 0.00 0.00 0.00 5.12
780 781 2.360350 AGACCTTACCGCCGTCGA 60.360 61.111 0.00 0.00 38.10 4.20
781 782 2.202531 GACCTTACCGCCGTCGAC 60.203 66.667 5.18 5.18 38.10 4.20
782 783 2.981560 GACCTTACCGCCGTCGACA 61.982 63.158 17.16 0.00 38.10 4.35
783 784 2.505557 CCTTACCGCCGTCGACAC 60.506 66.667 17.16 5.91 38.10 3.67
784 785 2.505557 CTTACCGCCGTCGACACC 60.506 66.667 17.16 4.32 38.10 4.16
785 786 3.271706 CTTACCGCCGTCGACACCA 62.272 63.158 17.16 0.00 38.10 4.17
786 787 2.552585 CTTACCGCCGTCGACACCAT 62.553 60.000 17.16 0.00 38.10 3.55
787 788 2.822418 TTACCGCCGTCGACACCATG 62.822 60.000 17.16 2.00 38.10 3.66
800 801 2.111878 CCATGGGGTGAGCGATCC 59.888 66.667 2.85 0.00 0.00 3.36
801 802 2.446848 CCATGGGGTGAGCGATCCT 61.447 63.158 2.85 0.00 0.00 3.24
802 803 1.070445 CATGGGGTGAGCGATCCTC 59.930 63.158 0.00 4.71 41.15 3.71
809 810 3.766644 TGAGCGATCCTCACCATTG 57.233 52.632 0.00 0.00 45.44 2.82
810 811 0.178767 TGAGCGATCCTCACCATTGG 59.821 55.000 0.00 0.00 45.44 3.16
811 812 0.465705 GAGCGATCCTCACCATTGGA 59.534 55.000 10.37 0.00 40.45 3.53
812 813 0.467384 AGCGATCCTCACCATTGGAG 59.533 55.000 10.37 0.83 35.63 3.86
813 814 0.465705 GCGATCCTCACCATTGGAGA 59.534 55.000 10.37 6.14 35.63 3.71
814 815 1.071385 GCGATCCTCACCATTGGAGAT 59.929 52.381 10.37 5.91 35.63 2.75
815 816 2.869636 GCGATCCTCACCATTGGAGATC 60.870 54.545 10.37 13.05 35.63 2.75
816 817 2.366590 CGATCCTCACCATTGGAGATCA 59.633 50.000 10.37 0.00 34.09 2.92
817 818 3.737850 GATCCTCACCATTGGAGATCAC 58.262 50.000 10.37 0.00 35.63 3.06
818 819 1.839994 TCCTCACCATTGGAGATCACC 59.160 52.381 10.37 1.62 34.24 4.02
819 820 1.842562 CCTCACCATTGGAGATCACCT 59.157 52.381 10.37 0.00 34.24 4.00
820 821 2.158842 CCTCACCATTGGAGATCACCTC 60.159 54.545 10.37 0.00 41.22 3.85
821 822 1.482182 TCACCATTGGAGATCACCTCG 59.518 52.381 10.37 0.00 42.89 4.63
822 823 1.482182 CACCATTGGAGATCACCTCGA 59.518 52.381 10.37 0.00 42.89 4.04
823 824 1.759445 ACCATTGGAGATCACCTCGAG 59.241 52.381 10.37 5.13 42.89 4.04
824 825 1.539929 CCATTGGAGATCACCTCGAGC 60.540 57.143 6.99 0.00 42.89 5.03
825 826 0.387202 ATTGGAGATCACCTCGAGCG 59.613 55.000 6.99 2.92 42.89 5.03
826 827 0.679960 TTGGAGATCACCTCGAGCGA 60.680 55.000 6.99 6.05 42.89 4.93
827 828 1.098129 TGGAGATCACCTCGAGCGAG 61.098 60.000 6.99 12.66 42.89 5.03
828 829 0.816018 GGAGATCACCTCGAGCGAGA 60.816 60.000 20.41 4.48 44.53 4.04
829 830 1.234821 GAGATCACCTCGAGCGAGAT 58.765 55.000 20.41 9.43 44.53 2.75
830 831 1.196808 GAGATCACCTCGAGCGAGATC 59.803 57.143 20.41 22.14 44.53 2.75
831 832 1.202758 AGATCACCTCGAGCGAGATCT 60.203 52.381 24.64 24.64 44.53 2.75
832 833 1.606668 GATCACCTCGAGCGAGATCTT 59.393 52.381 20.41 3.68 44.53 2.40
833 834 1.018148 TCACCTCGAGCGAGATCTTC 58.982 55.000 20.41 0.00 44.53 2.87
834 835 0.735471 CACCTCGAGCGAGATCTTCA 59.265 55.000 20.41 0.00 44.53 3.02
835 836 1.133216 CACCTCGAGCGAGATCTTCAA 59.867 52.381 20.41 0.00 44.53 2.69
836 837 2.028130 ACCTCGAGCGAGATCTTCAAT 58.972 47.619 20.41 0.00 44.53 2.57
837 838 2.223688 ACCTCGAGCGAGATCTTCAATG 60.224 50.000 20.41 3.84 44.53 2.82
838 839 2.033927 CCTCGAGCGAGATCTTCAATGA 59.966 50.000 20.41 0.00 44.53 2.57
839 840 3.299162 CTCGAGCGAGATCTTCAATGAG 58.701 50.000 14.28 0.00 44.53 2.90
840 841 2.685388 TCGAGCGAGATCTTCAATGAGT 59.315 45.455 0.00 0.00 0.00 3.41
841 842 2.788233 CGAGCGAGATCTTCAATGAGTG 59.212 50.000 0.00 0.00 0.00 3.51
842 843 2.539274 GAGCGAGATCTTCAATGAGTGC 59.461 50.000 0.00 0.00 0.00 4.40
843 844 1.596727 GCGAGATCTTCAATGAGTGCC 59.403 52.381 0.00 0.00 0.00 5.01
844 845 2.897436 CGAGATCTTCAATGAGTGCCA 58.103 47.619 0.00 0.00 0.00 4.92
845 846 3.464907 CGAGATCTTCAATGAGTGCCAT 58.535 45.455 0.00 0.00 36.99 4.40
846 847 3.247886 CGAGATCTTCAATGAGTGCCATG 59.752 47.826 0.00 0.00 35.24 3.66
847 848 4.197750 GAGATCTTCAATGAGTGCCATGT 58.802 43.478 0.00 0.00 35.24 3.21
848 849 5.363101 GAGATCTTCAATGAGTGCCATGTA 58.637 41.667 0.00 0.00 35.24 2.29
849 850 5.748402 AGATCTTCAATGAGTGCCATGTAA 58.252 37.500 0.00 0.00 35.24 2.41
850 851 6.182627 AGATCTTCAATGAGTGCCATGTAAA 58.817 36.000 0.00 0.00 35.24 2.01
851 852 6.660521 AGATCTTCAATGAGTGCCATGTAAAA 59.339 34.615 0.00 0.00 35.24 1.52
852 853 6.647334 TCTTCAATGAGTGCCATGTAAAAA 57.353 33.333 0.00 0.00 35.24 1.94
853 854 6.680810 TCTTCAATGAGTGCCATGTAAAAAG 58.319 36.000 0.00 0.00 35.24 2.27
854 855 6.489700 TCTTCAATGAGTGCCATGTAAAAAGA 59.510 34.615 0.00 0.00 35.24 2.52
855 856 6.647334 TCAATGAGTGCCATGTAAAAAGAA 57.353 33.333 0.00 0.00 35.24 2.52
856 857 7.048629 TCAATGAGTGCCATGTAAAAAGAAA 57.951 32.000 0.00 0.00 35.24 2.52
857 858 7.669427 TCAATGAGTGCCATGTAAAAAGAAAT 58.331 30.769 0.00 0.00 35.24 2.17
858 859 7.814107 TCAATGAGTGCCATGTAAAAAGAAATC 59.186 33.333 0.00 0.00 35.24 2.17
859 860 6.899393 TGAGTGCCATGTAAAAAGAAATCT 57.101 33.333 0.00 0.00 0.00 2.40
860 861 6.913170 TGAGTGCCATGTAAAAAGAAATCTC 58.087 36.000 0.00 0.00 0.00 2.75
861 862 6.489700 TGAGTGCCATGTAAAAAGAAATCTCA 59.510 34.615 0.00 0.00 0.00 3.27
862 863 7.014134 TGAGTGCCATGTAAAAAGAAATCTCAA 59.986 33.333 0.00 0.00 0.00 3.02
863 864 7.899973 AGTGCCATGTAAAAAGAAATCTCAAT 58.100 30.769 0.00 0.00 0.00 2.57
864 865 8.370182 AGTGCCATGTAAAAAGAAATCTCAATT 58.630 29.630 0.00 0.00 0.00 2.32
865 866 8.992073 GTGCCATGTAAAAAGAAATCTCAATTT 58.008 29.630 0.00 0.00 37.80 1.82
891 892 9.617523 TCTCTGAATCAATTTATGCTACAATGA 57.382 29.630 0.00 0.00 0.00 2.57
904 905 9.797642 TTATGCTACAATGATCATATGGTTTCT 57.202 29.630 9.04 0.00 0.00 2.52
906 907 8.607441 TGCTACAATGATCATATGGTTTCTAC 57.393 34.615 9.04 0.00 0.00 2.59
907 908 7.384932 TGCTACAATGATCATATGGTTTCTACG 59.615 37.037 9.04 0.00 0.00 3.51
908 909 7.598869 GCTACAATGATCATATGGTTTCTACGA 59.401 37.037 9.04 0.00 0.00 3.43
909 910 9.645059 CTACAATGATCATATGGTTTCTACGAT 57.355 33.333 9.04 0.00 0.00 3.73
910 911 8.908786 ACAATGATCATATGGTTTCTACGATT 57.091 30.769 9.04 0.00 0.00 3.34
911 912 9.342308 ACAATGATCATATGGTTTCTACGATTT 57.658 29.630 9.04 0.00 0.00 2.17
914 915 7.639039 TGATCATATGGTTTCTACGATTTTGC 58.361 34.615 2.13 0.00 0.00 3.68
915 916 7.498900 TGATCATATGGTTTCTACGATTTTGCT 59.501 33.333 2.13 0.00 0.00 3.91
916 917 7.624360 TCATATGGTTTCTACGATTTTGCTT 57.376 32.000 2.13 0.00 0.00 3.91
917 918 8.725405 TCATATGGTTTCTACGATTTTGCTTA 57.275 30.769 2.13 0.00 0.00 3.09
918 919 8.609176 TCATATGGTTTCTACGATTTTGCTTAC 58.391 33.333 2.13 0.00 0.00 2.34
919 920 6.811253 ATGGTTTCTACGATTTTGCTTACA 57.189 33.333 0.00 0.00 0.00 2.41
920 921 5.992729 TGGTTTCTACGATTTTGCTTACAC 58.007 37.500 0.00 0.00 0.00 2.90
921 922 5.761234 TGGTTTCTACGATTTTGCTTACACT 59.239 36.000 0.00 0.00 0.00 3.55
922 923 6.261381 TGGTTTCTACGATTTTGCTTACACTT 59.739 34.615 0.00 0.00 0.00 3.16
923 924 6.795593 GGTTTCTACGATTTTGCTTACACTTC 59.204 38.462 0.00 0.00 0.00 3.01
924 925 6.476243 TTCTACGATTTTGCTTACACTTCC 57.524 37.500 0.00 0.00 0.00 3.46
925 926 5.790593 TCTACGATTTTGCTTACACTTCCT 58.209 37.500 0.00 0.00 0.00 3.36
926 927 6.927416 TCTACGATTTTGCTTACACTTCCTA 58.073 36.000 0.00 0.00 0.00 2.94
927 928 5.857822 ACGATTTTGCTTACACTTCCTAC 57.142 39.130 0.00 0.00 0.00 3.18
928 929 5.548406 ACGATTTTGCTTACACTTCCTACT 58.452 37.500 0.00 0.00 0.00 2.57
929 930 5.638234 ACGATTTTGCTTACACTTCCTACTC 59.362 40.000 0.00 0.00 0.00 2.59
930 931 5.869888 CGATTTTGCTTACACTTCCTACTCT 59.130 40.000 0.00 0.00 0.00 3.24
931 932 6.183360 CGATTTTGCTTACACTTCCTACTCTG 60.183 42.308 0.00 0.00 0.00 3.35
932 933 5.801531 TTTGCTTACACTTCCTACTCTGA 57.198 39.130 0.00 0.00 0.00 3.27
933 934 6.360370 TTTGCTTACACTTCCTACTCTGAT 57.640 37.500 0.00 0.00 0.00 2.90
934 935 5.584253 TGCTTACACTTCCTACTCTGATC 57.416 43.478 0.00 0.00 0.00 2.92
935 936 5.016831 TGCTTACACTTCCTACTCTGATCA 58.983 41.667 0.00 0.00 0.00 2.92
936 937 5.105716 TGCTTACACTTCCTACTCTGATCAC 60.106 44.000 0.00 0.00 0.00 3.06
937 938 5.680151 GCTTACACTTCCTACTCTGATCACC 60.680 48.000 0.00 0.00 0.00 4.02
938 939 3.100671 ACACTTCCTACTCTGATCACCC 58.899 50.000 0.00 0.00 0.00 4.61
939 940 3.245803 ACACTTCCTACTCTGATCACCCT 60.246 47.826 0.00 0.00 0.00 4.34
940 941 3.131933 CACTTCCTACTCTGATCACCCTG 59.868 52.174 0.00 0.00 0.00 4.45
941 942 3.011821 ACTTCCTACTCTGATCACCCTGA 59.988 47.826 0.00 0.00 0.00 3.86
942 943 3.981516 TCCTACTCTGATCACCCTGAT 57.018 47.619 0.00 0.00 40.34 2.90
943 944 4.271807 TCCTACTCTGATCACCCTGATT 57.728 45.455 0.00 0.00 37.20 2.57
944 945 5.403558 TCCTACTCTGATCACCCTGATTA 57.596 43.478 0.00 0.00 37.20 1.75
945 946 5.777449 TCCTACTCTGATCACCCTGATTAA 58.223 41.667 0.00 0.00 37.20 1.40
946 947 6.385443 TCCTACTCTGATCACCCTGATTAAT 58.615 40.000 0.00 0.00 37.20 1.40
947 948 6.268617 TCCTACTCTGATCACCCTGATTAATG 59.731 42.308 0.00 0.00 37.20 1.90
948 949 4.712476 ACTCTGATCACCCTGATTAATGC 58.288 43.478 0.00 0.00 37.20 3.56
949 950 3.732212 TCTGATCACCCTGATTAATGCG 58.268 45.455 0.00 0.00 37.20 4.73
950 951 2.221169 TGATCACCCTGATTAATGCGC 58.779 47.619 0.00 0.00 37.20 6.09
951 952 2.221169 GATCACCCTGATTAATGCGCA 58.779 47.619 14.96 14.96 37.20 6.09
952 953 1.667236 TCACCCTGATTAATGCGCAG 58.333 50.000 18.32 0.24 0.00 5.18
953 954 0.664761 CACCCTGATTAATGCGCAGG 59.335 55.000 18.32 11.62 46.83 4.85
954 955 1.103398 ACCCTGATTAATGCGCAGGC 61.103 55.000 18.32 3.43 46.11 4.85
963 964 3.774528 TGCGCAGGCAGAGGTAGG 61.775 66.667 5.66 0.00 46.21 3.18
969 970 2.689034 GGCAGAGGTAGGCCCAGT 60.689 66.667 0.00 0.00 44.53 4.00
970 971 2.301738 GGCAGAGGTAGGCCCAGTT 61.302 63.158 0.00 0.00 44.53 3.16
971 972 1.222113 GCAGAGGTAGGCCCAGTTC 59.778 63.158 0.00 0.00 34.66 3.01
972 973 1.553690 GCAGAGGTAGGCCCAGTTCA 61.554 60.000 0.00 0.00 34.66 3.18
973 974 0.250513 CAGAGGTAGGCCCAGTTCAC 59.749 60.000 0.00 0.00 34.66 3.18
974 975 0.910088 AGAGGTAGGCCCAGTTCACC 60.910 60.000 0.00 0.00 34.66 4.02
975 976 0.910088 GAGGTAGGCCCAGTTCACCT 60.910 60.000 0.00 2.47 42.29 4.00
976 977 1.201429 AGGTAGGCCCAGTTCACCTG 61.201 60.000 0.00 0.00 38.20 4.00
977 978 1.377333 GTAGGCCCAGTTCACCTGC 60.377 63.158 0.00 0.00 40.06 4.85
978 979 1.845664 TAGGCCCAGTTCACCTGCA 60.846 57.895 0.00 0.00 40.06 4.41
979 980 1.422977 TAGGCCCAGTTCACCTGCAA 61.423 55.000 0.00 0.00 40.06 4.08
980 981 2.270986 GGCCCAGTTCACCTGCAAG 61.271 63.158 0.00 0.00 40.06 4.01
981 982 2.924105 GCCCAGTTCACCTGCAAGC 61.924 63.158 0.00 0.00 40.06 4.01
982 983 2.620112 CCCAGTTCACCTGCAAGCG 61.620 63.158 0.00 0.00 40.06 4.68
983 984 2.620112 CCAGTTCACCTGCAAGCGG 61.620 63.158 0.00 0.00 40.06 5.52
985 986 3.365265 GTTCACCTGCAAGCGGGG 61.365 66.667 22.93 12.67 46.47 5.73
986 987 3.565214 TTCACCTGCAAGCGGGGA 61.565 61.111 22.93 13.31 46.47 4.81
987 988 3.842925 TTCACCTGCAAGCGGGGAC 62.843 63.158 22.93 0.00 46.47 4.46
988 989 4.641645 CACCTGCAAGCGGGGACA 62.642 66.667 22.93 0.00 46.47 4.02
989 990 3.650950 ACCTGCAAGCGGGGACAT 61.651 61.111 22.93 0.00 46.47 3.06
990 991 2.297895 ACCTGCAAGCGGGGACATA 61.298 57.895 22.93 0.00 46.47 2.29
991 992 1.819632 CCTGCAAGCGGGGACATAC 60.820 63.158 12.16 0.00 38.78 2.39
992 993 1.078497 CTGCAAGCGGGGACATACA 60.078 57.895 0.00 0.00 0.00 2.29
993 994 1.369091 CTGCAAGCGGGGACATACAC 61.369 60.000 0.00 0.00 0.00 2.90
994 995 2.112815 GCAAGCGGGGACATACACC 61.113 63.158 0.00 0.00 39.03 4.16
995 996 1.602237 CAAGCGGGGACATACACCT 59.398 57.895 0.00 0.00 40.56 4.00
996 997 0.744414 CAAGCGGGGACATACACCTG 60.744 60.000 0.00 0.00 40.56 4.00
998 999 2.189521 CGGGGACATACACCTGCC 59.810 66.667 0.00 0.00 40.56 4.85
999 1000 2.189521 GGGGACATACACCTGCCG 59.810 66.667 0.00 0.00 39.39 5.69
1000 1001 2.363975 GGGGACATACACCTGCCGA 61.364 63.158 0.00 0.00 39.39 5.54
1001 1002 1.696097 GGGGACATACACCTGCCGAT 61.696 60.000 0.00 0.00 39.39 4.18
1002 1003 0.532862 GGGACATACACCTGCCGATG 60.533 60.000 0.00 0.00 0.00 3.84
1003 1004 0.532862 GGACATACACCTGCCGATGG 60.533 60.000 0.00 0.00 0.00 3.51
1004 1005 0.178068 GACATACACCTGCCGATGGT 59.822 55.000 0.00 0.00 38.53 3.55
1005 1006 0.618458 ACATACACCTGCCGATGGTT 59.382 50.000 0.00 0.00 35.28 3.67
1006 1007 1.016627 CATACACCTGCCGATGGTTG 58.983 55.000 0.00 0.00 35.28 3.77
1007 1008 0.908910 ATACACCTGCCGATGGTTGA 59.091 50.000 0.00 0.00 35.28 3.18
1008 1009 0.036765 TACACCTGCCGATGGTTGAC 60.037 55.000 0.00 0.00 35.28 3.18
1009 1010 2.040544 CACCTGCCGATGGTTGACC 61.041 63.158 0.00 0.00 35.28 4.02
1010 1011 2.224159 ACCTGCCGATGGTTGACCT 61.224 57.895 1.34 0.00 33.34 3.85
1011 1012 0.907704 ACCTGCCGATGGTTGACCTA 60.908 55.000 1.34 0.00 33.34 3.08
1012 1013 0.179073 CCTGCCGATGGTTGACCTAG 60.179 60.000 1.34 0.00 36.82 3.02
1013 1014 0.824109 CTGCCGATGGTTGACCTAGA 59.176 55.000 1.34 0.00 36.82 2.43
1014 1015 1.207089 CTGCCGATGGTTGACCTAGAA 59.793 52.381 1.34 0.00 36.82 2.10
1015 1016 1.626321 TGCCGATGGTTGACCTAGAAA 59.374 47.619 1.34 0.00 36.82 2.52
1016 1017 2.280628 GCCGATGGTTGACCTAGAAAG 58.719 52.381 1.34 0.00 36.82 2.62
1017 1018 2.354805 GCCGATGGTTGACCTAGAAAGT 60.355 50.000 1.34 0.00 36.82 2.66
1018 1019 3.522553 CCGATGGTTGACCTAGAAAGTC 58.477 50.000 1.34 0.00 36.82 3.01
1019 1020 3.195825 CCGATGGTTGACCTAGAAAGTCT 59.804 47.826 1.34 0.00 35.21 3.24
1020 1021 4.177026 CGATGGTTGACCTAGAAAGTCTG 58.823 47.826 1.34 0.00 35.21 3.51
1021 1022 4.508662 GATGGTTGACCTAGAAAGTCTGG 58.491 47.826 1.34 0.00 35.21 3.86
1022 1023 3.583228 TGGTTGACCTAGAAAGTCTGGA 58.417 45.455 1.34 0.00 35.21 3.86
1023 1024 3.971305 TGGTTGACCTAGAAAGTCTGGAA 59.029 43.478 1.34 0.00 35.21 3.53
1024 1025 4.597507 TGGTTGACCTAGAAAGTCTGGAAT 59.402 41.667 1.34 0.00 35.21 3.01
1025 1026 5.073144 TGGTTGACCTAGAAAGTCTGGAATT 59.927 40.000 1.34 0.00 35.21 2.17
1026 1027 6.004574 GGTTGACCTAGAAAGTCTGGAATTT 58.995 40.000 0.00 0.00 35.21 1.82
1027 1028 6.149640 GGTTGACCTAGAAAGTCTGGAATTTC 59.850 42.308 13.42 13.42 43.37 2.17
1028 1029 6.433847 TGACCTAGAAAGTCTGGAATTTCA 57.566 37.500 20.35 9.46 44.87 2.69
1029 1030 7.020827 TGACCTAGAAAGTCTGGAATTTCAT 57.979 36.000 20.35 11.14 44.87 2.57
1030 1031 7.461749 TGACCTAGAAAGTCTGGAATTTCATT 58.538 34.615 20.35 7.90 44.87 2.57
1031 1032 7.944554 TGACCTAGAAAGTCTGGAATTTCATTT 59.055 33.333 20.35 7.35 44.87 2.32
1032 1033 8.341892 ACCTAGAAAGTCTGGAATTTCATTTC 57.658 34.615 20.35 3.89 44.87 2.17
1033 1034 7.119846 ACCTAGAAAGTCTGGAATTTCATTTCG 59.880 37.037 20.35 9.09 44.87 3.46
1034 1035 7.334421 CCTAGAAAGTCTGGAATTTCATTTCGA 59.666 37.037 20.35 1.53 44.87 3.71
1035 1036 7.510549 AGAAAGTCTGGAATTTCATTTCGAA 57.489 32.000 20.35 0.00 44.87 3.71
1036 1037 7.588512 AGAAAGTCTGGAATTTCATTTCGAAG 58.411 34.615 20.35 0.00 44.87 3.79
1037 1038 7.445402 AGAAAGTCTGGAATTTCATTTCGAAGA 59.555 33.333 20.35 0.00 44.87 2.87
1038 1039 7.693969 AAGTCTGGAATTTCATTTCGAAGAT 57.306 32.000 0.00 0.00 35.04 2.40
1039 1040 7.081526 AGTCTGGAATTTCATTTCGAAGATG 57.918 36.000 0.00 6.02 35.04 2.90
1040 1041 6.881065 AGTCTGGAATTTCATTTCGAAGATGA 59.119 34.615 14.83 14.83 35.04 2.92
1041 1042 7.065563 AGTCTGGAATTTCATTTCGAAGATGAG 59.934 37.037 16.85 8.74 35.17 2.90
1042 1043 6.317140 TCTGGAATTTCATTTCGAAGATGAGG 59.683 38.462 16.85 0.00 35.17 3.86
1043 1044 6.179756 TGGAATTTCATTTCGAAGATGAGGA 58.820 36.000 16.85 12.68 35.17 3.71
1044 1045 6.830324 TGGAATTTCATTTCGAAGATGAGGAT 59.170 34.615 16.85 13.76 35.17 3.24
1045 1046 7.340232 TGGAATTTCATTTCGAAGATGAGGATT 59.660 33.333 16.85 18.23 35.17 3.01
1046 1047 8.840321 GGAATTTCATTTCGAAGATGAGGATTA 58.160 33.333 16.85 5.78 35.17 1.75
1047 1048 9.657121 GAATTTCATTTCGAAGATGAGGATTAC 57.343 33.333 16.85 12.73 35.17 1.89
1048 1049 7.553881 TTTCATTTCGAAGATGAGGATTACC 57.446 36.000 16.85 0.00 35.17 2.85
1049 1050 6.233905 TCATTTCGAAGATGAGGATTACCA 57.766 37.500 14.83 0.00 35.53 3.25
1050 1051 6.649155 TCATTTCGAAGATGAGGATTACCAA 58.351 36.000 14.83 0.00 35.53 3.67
1051 1052 6.538742 TCATTTCGAAGATGAGGATTACCAAC 59.461 38.462 14.83 0.00 35.53 3.77
1052 1053 5.414789 TTCGAAGATGAGGATTACCAACA 57.585 39.130 0.00 0.00 35.53 3.33
1053 1054 5.011090 TCGAAGATGAGGATTACCAACAG 57.989 43.478 0.00 0.00 38.94 3.16
1054 1055 4.122776 CGAAGATGAGGATTACCAACAGG 58.877 47.826 0.00 0.00 38.94 4.00
1055 1056 4.141937 CGAAGATGAGGATTACCAACAGGA 60.142 45.833 0.00 0.00 38.94 3.86
1056 1057 5.626809 CGAAGATGAGGATTACCAACAGGAA 60.627 44.000 0.00 0.00 38.94 3.36
1057 1058 5.779241 AGATGAGGATTACCAACAGGAAA 57.221 39.130 0.00 0.00 38.94 3.13
1058 1059 6.139679 AGATGAGGATTACCAACAGGAAAA 57.860 37.500 0.00 0.00 38.94 2.29
1059 1060 6.183347 AGATGAGGATTACCAACAGGAAAAG 58.817 40.000 0.00 0.00 38.94 2.27
1060 1061 4.662278 TGAGGATTACCAACAGGAAAAGG 58.338 43.478 0.00 0.00 38.94 3.11
1061 1062 4.017126 GAGGATTACCAACAGGAAAAGGG 58.983 47.826 0.00 0.00 38.94 3.95
1062 1063 2.496070 GGATTACCAACAGGAAAAGGGC 59.504 50.000 0.00 0.00 35.97 5.19
1063 1064 2.757894 TTACCAACAGGAAAAGGGCA 57.242 45.000 0.00 0.00 0.00 5.36
1064 1065 2.990740 TACCAACAGGAAAAGGGCAT 57.009 45.000 0.00 0.00 0.00 4.40
1065 1066 2.101640 ACCAACAGGAAAAGGGCATT 57.898 45.000 0.00 0.00 0.00 3.56
1066 1067 1.970640 ACCAACAGGAAAAGGGCATTC 59.029 47.619 0.00 0.00 0.00 2.67
1067 1068 1.969923 CCAACAGGAAAAGGGCATTCA 59.030 47.619 0.00 0.00 0.00 2.57
1068 1069 2.368221 CCAACAGGAAAAGGGCATTCAA 59.632 45.455 0.00 0.00 0.00 2.69
1069 1070 3.392882 CAACAGGAAAAGGGCATTCAAC 58.607 45.455 0.00 0.00 0.00 3.18
1070 1071 2.676748 ACAGGAAAAGGGCATTCAACA 58.323 42.857 0.00 0.00 0.00 3.33
1071 1072 3.037549 ACAGGAAAAGGGCATTCAACAA 58.962 40.909 0.00 0.00 0.00 2.83
1072 1073 3.647590 ACAGGAAAAGGGCATTCAACAAT 59.352 39.130 0.00 0.00 0.00 2.71
1073 1074 4.102996 ACAGGAAAAGGGCATTCAACAATT 59.897 37.500 0.00 0.00 0.00 2.32
1074 1075 4.692155 CAGGAAAAGGGCATTCAACAATTC 59.308 41.667 0.00 0.00 0.00 2.17
1075 1076 4.002982 GGAAAAGGGCATTCAACAATTCC 58.997 43.478 0.00 0.00 0.00 3.01
1076 1077 3.317603 AAAGGGCATTCAACAATTCCG 57.682 42.857 0.00 0.00 0.00 4.30
1077 1078 1.923356 AGGGCATTCAACAATTCCGT 58.077 45.000 0.00 0.00 0.00 4.69
1078 1079 3.080300 AGGGCATTCAACAATTCCGTA 57.920 42.857 0.00 0.00 0.00 4.02
1079 1080 3.631250 AGGGCATTCAACAATTCCGTAT 58.369 40.909 0.00 0.00 0.00 3.06
1080 1081 3.632145 AGGGCATTCAACAATTCCGTATC 59.368 43.478 0.00 0.00 0.00 2.24
1081 1082 3.548014 GGGCATTCAACAATTCCGTATCG 60.548 47.826 0.00 0.00 0.00 2.92
1082 1083 3.311322 GGCATTCAACAATTCCGTATCGA 59.689 43.478 0.00 0.00 0.00 3.59
1083 1084 4.024048 GGCATTCAACAATTCCGTATCGAT 60.024 41.667 2.16 2.16 0.00 3.59
1084 1085 4.905866 GCATTCAACAATTCCGTATCGATG 59.094 41.667 8.54 0.00 0.00 3.84
1085 1086 5.277297 GCATTCAACAATTCCGTATCGATGA 60.277 40.000 8.54 0.00 0.00 2.92
1086 1087 6.566564 GCATTCAACAATTCCGTATCGATGAT 60.567 38.462 8.54 0.00 0.00 2.45
1087 1088 5.905480 TCAACAATTCCGTATCGATGATG 57.095 39.130 8.54 0.00 0.00 3.07
1088 1089 5.596845 TCAACAATTCCGTATCGATGATGA 58.403 37.500 8.54 0.00 0.00 2.92
1089 1090 6.223120 TCAACAATTCCGTATCGATGATGAT 58.777 36.000 8.54 0.00 0.00 2.45
1090 1091 6.705825 TCAACAATTCCGTATCGATGATGATT 59.294 34.615 8.54 0.00 0.00 2.57
1091 1092 7.870445 TCAACAATTCCGTATCGATGATGATTA 59.130 33.333 8.54 0.00 0.00 1.75
1092 1093 8.659491 CAACAATTCCGTATCGATGATGATTAT 58.341 33.333 8.54 0.00 0.00 1.28
1093 1094 8.777865 ACAATTCCGTATCGATGATGATTATT 57.222 30.769 8.54 0.00 0.00 1.40
1094 1095 8.659491 ACAATTCCGTATCGATGATGATTATTG 58.341 33.333 8.54 10.93 0.00 1.90
1095 1096 8.659491 CAATTCCGTATCGATGATGATTATTGT 58.341 33.333 8.54 0.00 0.00 2.71
1096 1097 9.869757 AATTCCGTATCGATGATGATTATTGTA 57.130 29.630 8.54 0.00 0.00 2.41
1097 1098 9.869757 ATTCCGTATCGATGATGATTATTGTAA 57.130 29.630 8.54 0.00 0.00 2.41
1098 1099 9.699703 TTCCGTATCGATGATGATTATTGTAAA 57.300 29.630 8.54 0.00 0.00 2.01
1099 1100 9.353999 TCCGTATCGATGATGATTATTGTAAAG 57.646 33.333 8.54 0.00 0.00 1.85
1100 1101 9.140286 CCGTATCGATGATGATTATTGTAAAGT 57.860 33.333 8.54 0.00 0.00 2.66
1101 1102 9.943465 CGTATCGATGATGATTATTGTAAAGTG 57.057 33.333 8.54 0.00 0.00 3.16
1112 1113 9.559732 TGATTATTGTAAAGTGTATGATCCAGG 57.440 33.333 0.00 0.00 0.00 4.45
1113 1114 9.778741 GATTATTGTAAAGTGTATGATCCAGGA 57.221 33.333 0.00 0.00 0.00 3.86
1115 1116 9.778741 TTATTGTAAAGTGTATGATCCAGGATC 57.221 33.333 21.42 21.42 39.31 3.36
1124 1125 2.837947 TGATCCAGGATCACTCAAGGT 58.162 47.619 26.17 0.00 43.11 3.50
1125 1126 3.994317 TGATCCAGGATCACTCAAGGTA 58.006 45.455 26.17 2.25 43.11 3.08
1126 1127 4.361783 TGATCCAGGATCACTCAAGGTAA 58.638 43.478 26.17 1.51 43.11 2.85
1127 1128 4.782691 TGATCCAGGATCACTCAAGGTAAA 59.217 41.667 26.17 0.99 43.11 2.01
1128 1129 5.429762 TGATCCAGGATCACTCAAGGTAAAT 59.570 40.000 26.17 0.00 43.11 1.40
1129 1130 5.359194 TCCAGGATCACTCAAGGTAAATC 57.641 43.478 0.00 0.00 0.00 2.17
1130 1131 5.032846 TCCAGGATCACTCAAGGTAAATCT 58.967 41.667 0.00 0.00 0.00 2.40
1131 1132 5.488919 TCCAGGATCACTCAAGGTAAATCTT 59.511 40.000 0.00 0.00 0.00 2.40
1132 1133 6.012508 TCCAGGATCACTCAAGGTAAATCTTT 60.013 38.462 0.00 0.00 0.00 2.52
1133 1134 6.660949 CCAGGATCACTCAAGGTAAATCTTTT 59.339 38.462 0.00 0.00 0.00 2.27
1134 1135 7.829211 CCAGGATCACTCAAGGTAAATCTTTTA 59.171 37.037 0.00 0.00 0.00 1.52
1135 1136 8.669243 CAGGATCACTCAAGGTAAATCTTTTAC 58.331 37.037 0.00 2.27 0.00 2.01
1136 1137 7.829706 AGGATCACTCAAGGTAAATCTTTTACC 59.170 37.037 17.54 17.54 43.61 2.85
1137 1138 7.610305 GGATCACTCAAGGTAAATCTTTTACCA 59.390 37.037 23.93 8.85 45.23 3.25
1138 1139 8.934023 ATCACTCAAGGTAAATCTTTTACCAA 57.066 30.769 23.93 12.39 45.23 3.67
1139 1140 8.754991 TCACTCAAGGTAAATCTTTTACCAAA 57.245 30.769 23.93 12.13 45.23 3.28
1140 1141 9.362151 TCACTCAAGGTAAATCTTTTACCAAAT 57.638 29.630 23.93 11.76 45.23 2.32
1141 1142 9.981114 CACTCAAGGTAAATCTTTTACCAAATT 57.019 29.630 23.93 11.86 45.23 1.82
1151 1152 9.875691 AAATCTTTTACCAAATTAAGCAGATCC 57.124 29.630 0.00 0.00 0.00 3.36
1152 1153 8.593945 ATCTTTTACCAAATTAAGCAGATCCA 57.406 30.769 0.00 0.00 0.00 3.41
1153 1154 8.593945 TCTTTTACCAAATTAAGCAGATCCAT 57.406 30.769 0.00 0.00 0.00 3.41
1154 1155 9.693739 TCTTTTACCAAATTAAGCAGATCCATA 57.306 29.630 0.00 0.00 0.00 2.74
1155 1156 9.736023 CTTTTACCAAATTAAGCAGATCCATAC 57.264 33.333 0.00 0.00 0.00 2.39
1156 1157 7.817418 TTACCAAATTAAGCAGATCCATACC 57.183 36.000 0.00 0.00 0.00 2.73
1157 1158 4.821805 ACCAAATTAAGCAGATCCATACCG 59.178 41.667 0.00 0.00 0.00 4.02
1158 1159 4.216257 CCAAATTAAGCAGATCCATACCGG 59.784 45.833 0.00 0.00 0.00 5.28
1159 1160 4.706842 AATTAAGCAGATCCATACCGGT 57.293 40.909 13.98 13.98 35.57 5.28
1160 1161 3.469008 TTAAGCAGATCCATACCGGTG 57.531 47.619 19.93 0.00 35.57 4.94
1161 1162 1.204146 AAGCAGATCCATACCGGTGT 58.796 50.000 19.93 8.05 35.57 4.16
1162 1163 1.204146 AGCAGATCCATACCGGTGTT 58.796 50.000 19.93 0.69 35.57 3.32
1163 1164 1.559682 AGCAGATCCATACCGGTGTTT 59.440 47.619 19.93 0.00 35.57 2.83
1164 1165 1.670811 GCAGATCCATACCGGTGTTTG 59.329 52.381 19.93 12.08 35.57 2.93
1165 1166 2.939640 GCAGATCCATACCGGTGTTTGT 60.940 50.000 19.93 0.00 35.57 2.83
1166 1167 3.343617 CAGATCCATACCGGTGTTTGTT 58.656 45.455 19.93 0.00 35.57 2.83
1167 1168 3.756434 CAGATCCATACCGGTGTTTGTTT 59.244 43.478 19.93 1.78 35.57 2.83
1168 1169 4.938832 CAGATCCATACCGGTGTTTGTTTA 59.061 41.667 19.93 0.00 35.57 2.01
1169 1170 5.064707 CAGATCCATACCGGTGTTTGTTTAG 59.935 44.000 19.93 0.00 35.57 1.85
1170 1171 4.620589 TCCATACCGGTGTTTGTTTAGA 57.379 40.909 19.93 2.32 35.57 2.10
1171 1172 5.168647 TCCATACCGGTGTTTGTTTAGAT 57.831 39.130 19.93 0.00 35.57 1.98
1172 1173 5.562635 TCCATACCGGTGTTTGTTTAGATT 58.437 37.500 19.93 0.00 35.57 2.40
1173 1174 5.644636 TCCATACCGGTGTTTGTTTAGATTC 59.355 40.000 19.93 0.00 35.57 2.52
1174 1175 5.646360 CCATACCGGTGTTTGTTTAGATTCT 59.354 40.000 19.93 0.00 0.00 2.40
1175 1176 6.150474 CCATACCGGTGTTTGTTTAGATTCTT 59.850 38.462 19.93 0.00 0.00 2.52
1176 1177 5.684550 ACCGGTGTTTGTTTAGATTCTTC 57.315 39.130 6.12 0.00 0.00 2.87
1177 1178 5.127491 ACCGGTGTTTGTTTAGATTCTTCA 58.873 37.500 6.12 0.00 0.00 3.02
1178 1179 5.008316 ACCGGTGTTTGTTTAGATTCTTCAC 59.992 40.000 6.12 0.00 0.00 3.18
1179 1180 5.238650 CCGGTGTTTGTTTAGATTCTTCACT 59.761 40.000 0.00 0.00 0.00 3.41
1180 1181 6.425721 CCGGTGTTTGTTTAGATTCTTCACTA 59.574 38.462 0.00 0.00 0.00 2.74
1181 1182 7.288672 CGGTGTTTGTTTAGATTCTTCACTAC 58.711 38.462 0.00 0.00 0.00 2.73
1182 1183 7.570691 CGGTGTTTGTTTAGATTCTTCACTACC 60.571 40.741 0.00 0.00 0.00 3.18
1183 1184 7.444487 GGTGTTTGTTTAGATTCTTCACTACCT 59.556 37.037 0.00 0.00 0.00 3.08
1184 1185 8.283291 GTGTTTGTTTAGATTCTTCACTACCTG 58.717 37.037 0.00 0.00 0.00 4.00
1185 1186 8.208224 TGTTTGTTTAGATTCTTCACTACCTGA 58.792 33.333 0.00 0.00 0.00 3.86
1186 1187 8.496751 GTTTGTTTAGATTCTTCACTACCTGAC 58.503 37.037 0.00 0.00 0.00 3.51
1187 1188 7.297936 TGTTTAGATTCTTCACTACCTGACA 57.702 36.000 0.00 0.00 0.00 3.58
1188 1189 7.907389 TGTTTAGATTCTTCACTACCTGACAT 58.093 34.615 0.00 0.00 0.00 3.06
1189 1190 9.031537 TGTTTAGATTCTTCACTACCTGACATA 57.968 33.333 0.00 0.00 0.00 2.29
1190 1191 9.522804 GTTTAGATTCTTCACTACCTGACATAG 57.477 37.037 0.00 0.00 0.00 2.23
1191 1192 9.475620 TTTAGATTCTTCACTACCTGACATAGA 57.524 33.333 0.00 0.00 0.00 1.98
1192 1193 7.962995 AGATTCTTCACTACCTGACATAGAA 57.037 36.000 0.00 0.00 30.98 2.10
1193 1194 8.367660 AGATTCTTCACTACCTGACATAGAAA 57.632 34.615 0.00 0.00 30.46 2.52
1194 1195 8.816894 AGATTCTTCACTACCTGACATAGAAAA 58.183 33.333 0.00 0.00 30.46 2.29
1195 1196 9.606631 GATTCTTCACTACCTGACATAGAAAAT 57.393 33.333 0.00 0.00 30.46 1.82
1196 1197 9.606631 ATTCTTCACTACCTGACATAGAAAATC 57.393 33.333 0.00 0.00 30.46 2.17
1197 1198 7.258441 TCTTCACTACCTGACATAGAAAATCG 58.742 38.462 0.00 0.00 0.00 3.34
1198 1199 6.769134 TCACTACCTGACATAGAAAATCGA 57.231 37.500 0.00 0.00 0.00 3.59
1199 1200 7.165460 TCACTACCTGACATAGAAAATCGAA 57.835 36.000 0.00 0.00 0.00 3.71
1200 1201 7.782049 TCACTACCTGACATAGAAAATCGAAT 58.218 34.615 0.00 0.00 0.00 3.34
1201 1202 8.909923 TCACTACCTGACATAGAAAATCGAATA 58.090 33.333 0.00 0.00 0.00 1.75
1202 1203 9.698309 CACTACCTGACATAGAAAATCGAATAT 57.302 33.333 0.00 0.00 0.00 1.28
1206 1207 9.877178 ACCTGACATAGAAAATCGAATATATCC 57.123 33.333 0.00 0.00 0.00 2.59
1207 1208 9.025020 CCTGACATAGAAAATCGAATATATCCG 57.975 37.037 0.00 0.00 0.00 4.18
1208 1209 8.407457 TGACATAGAAAATCGAATATATCCGC 57.593 34.615 0.00 0.00 0.00 5.54
1209 1210 8.032451 TGACATAGAAAATCGAATATATCCGCA 58.968 33.333 0.00 0.00 0.00 5.69
1210 1211 8.186178 ACATAGAAAATCGAATATATCCGCAC 57.814 34.615 0.00 0.00 0.00 5.34
1211 1212 7.277981 ACATAGAAAATCGAATATATCCGCACC 59.722 37.037 0.00 0.00 0.00 5.01
1212 1213 5.547465 AGAAAATCGAATATATCCGCACCA 58.453 37.500 0.00 0.00 0.00 4.17
1213 1214 6.173339 AGAAAATCGAATATATCCGCACCAT 58.827 36.000 0.00 0.00 0.00 3.55
1214 1215 7.327975 AGAAAATCGAATATATCCGCACCATA 58.672 34.615 0.00 0.00 0.00 2.74
1215 1216 7.987458 AGAAAATCGAATATATCCGCACCATAT 59.013 33.333 0.00 0.00 0.00 1.78
1216 1217 9.256477 GAAAATCGAATATATCCGCACCATATA 57.744 33.333 0.00 0.00 0.00 0.86
1217 1218 9.778741 AAAATCGAATATATCCGCACCATATAT 57.221 29.630 0.00 0.00 32.82 0.86
1218 1219 8.988064 AATCGAATATATCCGCACCATATATC 57.012 34.615 0.00 0.00 31.01 1.63
1219 1220 7.761038 TCGAATATATCCGCACCATATATCT 57.239 36.000 0.00 0.00 31.01 1.98
1220 1221 7.817641 TCGAATATATCCGCACCATATATCTC 58.182 38.462 0.00 0.00 31.01 2.75
1221 1222 7.665974 TCGAATATATCCGCACCATATATCTCT 59.334 37.037 0.00 0.00 31.01 3.10
1222 1223 7.752686 CGAATATATCCGCACCATATATCTCTG 59.247 40.741 0.00 0.00 31.01 3.35
1223 1224 8.484214 AATATATCCGCACCATATATCTCTGT 57.516 34.615 0.00 0.00 31.01 3.41
1224 1225 9.588096 AATATATCCGCACCATATATCTCTGTA 57.412 33.333 0.00 0.00 31.01 2.74
1225 1226 7.898014 ATATCCGCACCATATATCTCTGTAA 57.102 36.000 0.00 0.00 0.00 2.41
1226 1227 5.644977 TCCGCACCATATATCTCTGTAAG 57.355 43.478 0.00 0.00 0.00 2.34
1227 1228 4.462834 TCCGCACCATATATCTCTGTAAGG 59.537 45.833 0.00 0.00 0.00 2.69
1228 1229 4.462834 CCGCACCATATATCTCTGTAAGGA 59.537 45.833 0.00 0.00 0.00 3.36
1229 1230 5.403246 CGCACCATATATCTCTGTAAGGAC 58.597 45.833 0.00 0.00 0.00 3.85
1230 1231 5.403246 GCACCATATATCTCTGTAAGGACG 58.597 45.833 0.00 0.00 0.00 4.79
1231 1232 5.047943 GCACCATATATCTCTGTAAGGACGT 60.048 44.000 0.00 0.00 0.00 4.34
1232 1233 6.516860 GCACCATATATCTCTGTAAGGACGTT 60.517 42.308 0.00 0.00 0.00 3.99
1233 1234 6.863645 CACCATATATCTCTGTAAGGACGTTG 59.136 42.308 0.00 0.00 0.00 4.10
1234 1235 6.776116 ACCATATATCTCTGTAAGGACGTTGA 59.224 38.462 0.00 0.00 0.00 3.18
1235 1236 7.287005 ACCATATATCTCTGTAAGGACGTTGAA 59.713 37.037 0.00 0.00 0.00 2.69
1236 1237 8.141909 CCATATATCTCTGTAAGGACGTTGAAA 58.858 37.037 0.00 0.00 0.00 2.69
1237 1238 9.698309 CATATATCTCTGTAAGGACGTTGAAAT 57.302 33.333 0.00 0.00 0.00 2.17
1242 1243 8.251750 TCTCTGTAAGGACGTTGAAATTAATG 57.748 34.615 0.00 0.00 0.00 1.90
1243 1244 6.837992 TCTGTAAGGACGTTGAAATTAATGC 58.162 36.000 0.00 0.00 0.00 3.56
1244 1245 5.945155 TGTAAGGACGTTGAAATTAATGCC 58.055 37.500 0.00 0.00 0.00 4.40
1245 1246 5.708230 TGTAAGGACGTTGAAATTAATGCCT 59.292 36.000 0.00 0.00 0.00 4.75
1246 1247 6.879993 TGTAAGGACGTTGAAATTAATGCCTA 59.120 34.615 0.00 0.00 0.00 3.93
1247 1248 6.827586 AAGGACGTTGAAATTAATGCCTAA 57.172 33.333 0.00 0.00 0.00 2.69
1248 1249 7.404671 AAGGACGTTGAAATTAATGCCTAAT 57.595 32.000 0.00 0.00 0.00 1.73
1249 1250 7.027778 AGGACGTTGAAATTAATGCCTAATC 57.972 36.000 0.00 0.00 29.44 1.75
1250 1251 6.039382 AGGACGTTGAAATTAATGCCTAATCC 59.961 38.462 0.00 0.00 29.44 3.01
1251 1252 6.039382 GGACGTTGAAATTAATGCCTAATCCT 59.961 38.462 0.00 0.00 29.44 3.24
1252 1253 6.795399 ACGTTGAAATTAATGCCTAATCCTG 58.205 36.000 0.00 0.00 29.44 3.86
1253 1254 6.377146 ACGTTGAAATTAATGCCTAATCCTGT 59.623 34.615 0.00 0.00 29.44 4.00
1254 1255 6.692681 CGTTGAAATTAATGCCTAATCCTGTG 59.307 38.462 0.00 0.00 29.44 3.66
1255 1256 7.415095 CGTTGAAATTAATGCCTAATCCTGTGA 60.415 37.037 0.00 0.00 29.44 3.58
1256 1257 8.416329 GTTGAAATTAATGCCTAATCCTGTGAT 58.584 33.333 0.00 0.00 29.44 3.06
1257 1258 9.639563 TTGAAATTAATGCCTAATCCTGTGATA 57.360 29.630 0.00 0.00 29.44 2.15
1258 1259 9.812347 TGAAATTAATGCCTAATCCTGTGATAT 57.188 29.630 0.00 0.00 29.44 1.63
1260 1261 9.592196 AAATTAATGCCTAATCCTGTGATATGT 57.408 29.630 0.00 0.00 29.44 2.29
1261 1262 7.984422 TTAATGCCTAATCCTGTGATATGTG 57.016 36.000 0.00 0.00 0.00 3.21
1262 1263 4.356405 TGCCTAATCCTGTGATATGTGG 57.644 45.455 0.00 0.00 0.00 4.17
1263 1264 3.077359 GCCTAATCCTGTGATATGTGGC 58.923 50.000 0.00 0.00 0.00 5.01
1264 1265 3.329386 CCTAATCCTGTGATATGTGGCG 58.671 50.000 0.00 0.00 0.00 5.69
1265 1266 2.260844 AATCCTGTGATATGTGGCGG 57.739 50.000 0.00 0.00 0.00 6.13
1266 1267 1.423584 ATCCTGTGATATGTGGCGGA 58.576 50.000 0.00 0.00 0.00 5.54
1267 1268 1.199615 TCCTGTGATATGTGGCGGAA 58.800 50.000 0.00 0.00 0.00 4.30
1268 1269 1.134521 TCCTGTGATATGTGGCGGAAC 60.135 52.381 0.00 0.00 0.00 3.62
1269 1270 1.406751 CCTGTGATATGTGGCGGAACA 60.407 52.381 0.00 0.00 0.00 3.18
1270 1271 1.935873 CTGTGATATGTGGCGGAACAG 59.064 52.381 0.00 0.00 32.52 3.16
1271 1272 1.299541 GTGATATGTGGCGGAACAGG 58.700 55.000 0.00 0.00 32.52 4.00
1272 1273 1.134521 GTGATATGTGGCGGAACAGGA 60.135 52.381 0.00 0.00 32.52 3.86
1273 1274 1.557371 TGATATGTGGCGGAACAGGAA 59.443 47.619 0.00 0.00 32.52 3.36
1274 1275 2.026729 TGATATGTGGCGGAACAGGAAA 60.027 45.455 0.00 0.00 32.52 3.13
1275 1276 2.799126 TATGTGGCGGAACAGGAAAT 57.201 45.000 0.00 0.00 32.52 2.17
1276 1277 1.463674 ATGTGGCGGAACAGGAAATC 58.536 50.000 0.00 0.00 32.52 2.17
1277 1278 0.608035 TGTGGCGGAACAGGAAATCC 60.608 55.000 0.00 0.00 0.00 3.01
1278 1279 0.608035 GTGGCGGAACAGGAAATCCA 60.608 55.000 1.67 0.00 38.89 3.41
1279 1280 0.111446 TGGCGGAACAGGAAATCCAA 59.889 50.000 1.67 0.00 38.89 3.53
1280 1281 0.526211 GGCGGAACAGGAAATCCAAC 59.474 55.000 1.67 0.00 38.89 3.77
1281 1282 0.526211 GCGGAACAGGAAATCCAACC 59.474 55.000 1.67 0.00 38.89 3.77
1282 1283 1.904287 CGGAACAGGAAATCCAACCA 58.096 50.000 1.67 0.00 38.89 3.67
1283 1284 2.235016 CGGAACAGGAAATCCAACCAA 58.765 47.619 1.67 0.00 38.89 3.67
1284 1285 2.825532 CGGAACAGGAAATCCAACCAAT 59.174 45.455 1.67 0.00 38.89 3.16
1285 1286 3.258123 CGGAACAGGAAATCCAACCAATT 59.742 43.478 1.67 0.00 38.89 2.32
1286 1287 4.568956 GGAACAGGAAATCCAACCAATTG 58.431 43.478 1.67 0.00 38.89 2.32
1287 1288 3.683365 ACAGGAAATCCAACCAATTGC 57.317 42.857 0.00 0.00 38.89 3.56
1288 1289 3.242011 ACAGGAAATCCAACCAATTGCT 58.758 40.909 0.00 0.00 38.89 3.91
1289 1290 4.415596 ACAGGAAATCCAACCAATTGCTA 58.584 39.130 0.00 0.00 38.89 3.49
1290 1291 4.463891 ACAGGAAATCCAACCAATTGCTAG 59.536 41.667 0.00 0.00 38.89 3.42
1291 1292 3.448660 AGGAAATCCAACCAATTGCTAGC 59.551 43.478 8.10 8.10 38.89 3.42
1292 1293 3.430790 GGAAATCCAACCAATTGCTAGCC 60.431 47.826 13.29 0.00 34.17 3.93
1293 1294 2.530460 ATCCAACCAATTGCTAGCCA 57.470 45.000 13.29 0.19 34.17 4.75
1294 1295 1.544724 TCCAACCAATTGCTAGCCAC 58.455 50.000 13.29 0.00 34.17 5.01
1295 1296 0.171007 CCAACCAATTGCTAGCCACG 59.829 55.000 13.29 0.00 34.17 4.94
1296 1297 1.164411 CAACCAATTGCTAGCCACGA 58.836 50.000 13.29 0.00 0.00 4.35
1297 1298 1.745087 CAACCAATTGCTAGCCACGAT 59.255 47.619 13.29 0.00 0.00 3.73
1298 1299 2.128771 ACCAATTGCTAGCCACGATT 57.871 45.000 13.29 4.70 0.00 3.34
1299 1300 2.017049 ACCAATTGCTAGCCACGATTC 58.983 47.619 13.29 0.00 0.00 2.52
1300 1301 2.292267 CCAATTGCTAGCCACGATTCT 58.708 47.619 13.29 0.00 0.00 2.40
1301 1302 3.118408 ACCAATTGCTAGCCACGATTCTA 60.118 43.478 13.29 0.00 0.00 2.10
1302 1303 3.876914 CCAATTGCTAGCCACGATTCTAA 59.123 43.478 13.29 0.00 0.00 2.10
1303 1304 4.335315 CCAATTGCTAGCCACGATTCTAAA 59.665 41.667 13.29 0.00 0.00 1.85
1304 1305 5.504665 CCAATTGCTAGCCACGATTCTAAAG 60.505 44.000 13.29 0.00 0.00 1.85
1305 1306 4.465632 TTGCTAGCCACGATTCTAAAGA 57.534 40.909 13.29 0.00 0.00 2.52
1306 1307 4.046938 TGCTAGCCACGATTCTAAAGAG 57.953 45.455 13.29 0.00 0.00 2.85
1307 1308 2.797719 GCTAGCCACGATTCTAAAGAGC 59.202 50.000 2.29 0.00 0.00 4.09
1308 1309 2.317530 AGCCACGATTCTAAAGAGCC 57.682 50.000 0.00 0.00 0.00 4.70
1309 1310 1.834263 AGCCACGATTCTAAAGAGCCT 59.166 47.619 0.00 0.00 0.00 4.58
1310 1311 1.936547 GCCACGATTCTAAAGAGCCTG 59.063 52.381 0.00 0.00 0.00 4.85
1311 1312 2.555199 CCACGATTCTAAAGAGCCTGG 58.445 52.381 0.00 0.00 0.00 4.45
1312 1313 2.093447 CCACGATTCTAAAGAGCCTGGT 60.093 50.000 0.00 0.00 0.00 4.00
1313 1314 3.190874 CACGATTCTAAAGAGCCTGGTC 58.809 50.000 0.00 0.00 0.00 4.02
1314 1315 2.168728 ACGATTCTAAAGAGCCTGGTCC 59.831 50.000 0.00 0.00 0.00 4.46
1315 1316 2.168521 CGATTCTAAAGAGCCTGGTCCA 59.831 50.000 0.00 0.00 0.00 4.02
1316 1317 3.739519 CGATTCTAAAGAGCCTGGTCCAG 60.740 52.174 12.40 12.40 0.00 3.86
1324 1325 4.039092 CCTGGTCCAGGCCCAGTG 62.039 72.222 25.31 3.34 45.13 3.66
1325 1326 2.930019 CTGGTCCAGGCCCAGTGA 60.930 66.667 8.56 0.00 43.73 3.41
1326 1327 2.449518 TGGTCCAGGCCCAGTGAA 60.450 61.111 0.00 0.00 0.00 3.18
1327 1328 2.352805 GGTCCAGGCCCAGTGAAG 59.647 66.667 0.00 0.00 0.00 3.02
1328 1329 2.352805 GTCCAGGCCCAGTGAAGG 59.647 66.667 0.00 0.00 0.00 3.46
1329 1330 2.121963 TCCAGGCCCAGTGAAGGT 60.122 61.111 0.00 0.00 0.00 3.50
1330 1331 1.159905 TCCAGGCCCAGTGAAGGTA 59.840 57.895 0.00 0.00 0.00 3.08
1331 1332 0.474854 TCCAGGCCCAGTGAAGGTAA 60.475 55.000 0.00 0.00 0.00 2.85
1332 1333 0.404040 CCAGGCCCAGTGAAGGTAAA 59.596 55.000 0.00 0.00 0.00 2.01
1333 1334 1.534729 CAGGCCCAGTGAAGGTAAAC 58.465 55.000 0.00 0.00 0.00 2.01
1334 1335 0.404426 AGGCCCAGTGAAGGTAAACC 59.596 55.000 0.00 0.00 0.00 3.27
1348 1349 5.262588 AGGTAAACCTTGAAACAAAGCTG 57.737 39.130 0.00 0.00 46.09 4.24
1349 1350 4.709886 AGGTAAACCTTGAAACAAAGCTGT 59.290 37.500 0.00 0.00 46.09 4.40
1350 1351 4.803613 GGTAAACCTTGAAACAAAGCTGTG 59.196 41.667 1.09 1.09 35.37 3.66
1351 1352 4.799564 AAACCTTGAAACAAAGCTGTGA 57.200 36.364 11.93 0.00 35.37 3.58
1352 1353 5.343307 AAACCTTGAAACAAAGCTGTGAT 57.657 34.783 11.93 0.00 35.37 3.06
1353 1354 5.343307 AACCTTGAAACAAAGCTGTGATT 57.657 34.783 11.93 4.67 35.37 2.57
1354 1355 4.685924 ACCTTGAAACAAAGCTGTGATTG 58.314 39.130 11.93 2.13 35.37 2.67
1355 1356 4.160252 ACCTTGAAACAAAGCTGTGATTGT 59.840 37.500 11.93 2.88 41.31 2.71
1363 1364 6.833342 ACAAAGCTGTGATTGTTTTGATTC 57.167 33.333 11.93 0.00 36.39 2.52
1364 1365 6.576185 ACAAAGCTGTGATTGTTTTGATTCT 58.424 32.000 11.93 0.00 36.39 2.40
1365 1366 7.043565 ACAAAGCTGTGATTGTTTTGATTCTT 58.956 30.769 11.93 0.00 36.39 2.52
1366 1367 7.223387 ACAAAGCTGTGATTGTTTTGATTCTTC 59.777 33.333 11.93 0.00 36.39 2.87
1367 1368 6.645790 AGCTGTGATTGTTTTGATTCTTCT 57.354 33.333 0.00 0.00 0.00 2.85
1368 1369 6.675987 AGCTGTGATTGTTTTGATTCTTCTC 58.324 36.000 0.00 0.00 0.00 2.87
1369 1370 6.489361 AGCTGTGATTGTTTTGATTCTTCTCT 59.511 34.615 0.00 0.00 0.00 3.10
1370 1371 7.663081 AGCTGTGATTGTTTTGATTCTTCTCTA 59.337 33.333 0.00 0.00 0.00 2.43
1371 1372 8.292448 GCTGTGATTGTTTTGATTCTTCTCTAA 58.708 33.333 0.00 0.00 0.00 2.10
1372 1373 9.604626 CTGTGATTGTTTTGATTCTTCTCTAAC 57.395 33.333 0.00 0.00 0.00 2.34
1373 1374 9.342308 TGTGATTGTTTTGATTCTTCTCTAACT 57.658 29.630 0.00 0.00 0.00 2.24
1374 1375 9.604626 GTGATTGTTTTGATTCTTCTCTAACTG 57.395 33.333 0.00 0.00 0.00 3.16
1375 1376 8.292448 TGATTGTTTTGATTCTTCTCTAACTGC 58.708 33.333 0.00 0.00 0.00 4.40
1376 1377 6.560253 TGTTTTGATTCTTCTCTAACTGCC 57.440 37.500 0.00 0.00 0.00 4.85
1377 1378 5.179368 TGTTTTGATTCTTCTCTAACTGCCG 59.821 40.000 0.00 0.00 0.00 5.69
1378 1379 4.537135 TTGATTCTTCTCTAACTGCCGT 57.463 40.909 0.00 0.00 0.00 5.68
1379 1380 5.654603 TTGATTCTTCTCTAACTGCCGTA 57.345 39.130 0.00 0.00 0.00 4.02
1380 1381 5.250235 TGATTCTTCTCTAACTGCCGTAG 57.750 43.478 0.00 0.00 0.00 3.51
1381 1382 4.948004 TGATTCTTCTCTAACTGCCGTAGA 59.052 41.667 0.00 0.00 0.00 2.59
1382 1383 5.417894 TGATTCTTCTCTAACTGCCGTAGAA 59.582 40.000 0.00 0.00 0.00 2.10
1383 1384 5.717078 TTCTTCTCTAACTGCCGTAGAAA 57.283 39.130 0.00 0.00 0.00 2.52
1384 1385 5.717078 TCTTCTCTAACTGCCGTAGAAAA 57.283 39.130 0.00 0.00 0.00 2.29
1385 1386 6.282199 TCTTCTCTAACTGCCGTAGAAAAT 57.718 37.500 0.00 0.00 0.00 1.82
1386 1387 6.331061 TCTTCTCTAACTGCCGTAGAAAATC 58.669 40.000 0.00 0.00 0.00 2.17
1387 1388 4.669318 TCTCTAACTGCCGTAGAAAATCG 58.331 43.478 0.00 0.00 0.00 3.34
1388 1389 3.184541 TCTAACTGCCGTAGAAAATCGC 58.815 45.455 0.00 0.00 0.00 4.58
1389 1390 1.803334 AACTGCCGTAGAAAATCGCA 58.197 45.000 0.00 0.00 0.00 5.10
1390 1391 2.024176 ACTGCCGTAGAAAATCGCAT 57.976 45.000 0.00 0.00 0.00 4.73
1391 1392 3.173668 ACTGCCGTAGAAAATCGCATA 57.826 42.857 0.00 0.00 0.00 3.14
1392 1393 3.728845 ACTGCCGTAGAAAATCGCATAT 58.271 40.909 0.00 0.00 0.00 1.78
1393 1394 4.878439 ACTGCCGTAGAAAATCGCATATA 58.122 39.130 0.00 0.00 0.00 0.86
1394 1395 5.479306 ACTGCCGTAGAAAATCGCATATAT 58.521 37.500 0.00 0.00 0.00 0.86
1395 1396 5.348724 ACTGCCGTAGAAAATCGCATATATG 59.651 40.000 8.45 8.45 0.00 1.78
1420 1421 9.311916 TGCCCTCAAAAATAATAATGAAAATCG 57.688 29.630 0.00 0.00 0.00 3.34
1421 1422 8.275632 GCCCTCAAAAATAATAATGAAAATCGC 58.724 33.333 0.00 0.00 0.00 4.58
1422 1423 9.311916 CCCTCAAAAATAATAATGAAAATCGCA 57.688 29.630 0.00 0.00 0.00 5.10
1438 1439 3.911989 GCATATATCTGCGCCATGC 57.088 52.632 4.18 6.68 46.70 4.06
1447 1448 2.427320 GCGCCATGCATCTCCCTA 59.573 61.111 0.00 0.00 45.45 3.53
1448 1449 1.227943 GCGCCATGCATCTCCCTAA 60.228 57.895 0.00 0.00 45.45 2.69
1449 1450 1.233285 GCGCCATGCATCTCCCTAAG 61.233 60.000 0.00 0.00 45.45 2.18
1450 1451 0.604780 CGCCATGCATCTCCCTAAGG 60.605 60.000 0.00 0.00 0.00 2.69
1451 1452 0.767375 GCCATGCATCTCCCTAAGGA 59.233 55.000 0.00 0.00 41.08 3.36
1452 1453 1.353694 GCCATGCATCTCCCTAAGGAT 59.646 52.381 0.00 0.00 42.93 3.24
1453 1454 2.573462 GCCATGCATCTCCCTAAGGATA 59.427 50.000 0.00 0.00 42.93 2.59
1454 1455 3.201708 GCCATGCATCTCCCTAAGGATAT 59.798 47.826 0.00 0.00 42.93 1.63
1455 1456 4.410228 GCCATGCATCTCCCTAAGGATATA 59.590 45.833 0.00 0.00 42.93 0.86
1456 1457 5.072872 GCCATGCATCTCCCTAAGGATATAT 59.927 44.000 0.00 0.00 42.93 0.86
1457 1458 6.531923 CCATGCATCTCCCTAAGGATATATG 58.468 44.000 0.00 0.00 42.93 1.78
1458 1459 6.100859 CCATGCATCTCCCTAAGGATATATGT 59.899 42.308 0.00 0.00 42.93 2.29
1459 1460 7.366281 CCATGCATCTCCCTAAGGATATATGTT 60.366 40.741 0.00 0.00 42.93 2.71
1460 1461 6.950842 TGCATCTCCCTAAGGATATATGTTG 58.049 40.000 0.00 0.00 42.93 3.33
1461 1462 6.730507 TGCATCTCCCTAAGGATATATGTTGA 59.269 38.462 0.00 0.00 42.93 3.18
1462 1463 7.237471 TGCATCTCCCTAAGGATATATGTTGAA 59.763 37.037 0.00 0.00 42.93 2.69
1463 1464 8.103305 GCATCTCCCTAAGGATATATGTTGAAA 58.897 37.037 0.00 0.00 42.93 2.69
1467 1468 9.892130 CTCCCTAAGGATATATGTTGAAATACC 57.108 37.037 0.00 0.00 42.93 2.73
1468 1469 9.629649 TCCCTAAGGATATATGTTGAAATACCT 57.370 33.333 0.00 0.00 37.19 3.08
1481 1482 8.712285 TGTTGAAATACCTAATCCTTTACGAG 57.288 34.615 0.00 0.00 0.00 4.18
1482 1483 8.533657 TGTTGAAATACCTAATCCTTTACGAGA 58.466 33.333 0.00 0.00 0.00 4.04
1483 1484 9.543783 GTTGAAATACCTAATCCTTTACGAGAT 57.456 33.333 0.00 0.00 0.00 2.75
1491 1492 8.979534 ACCTAATCCTTTACGAGATTTTACTCT 58.020 33.333 0.00 0.00 34.60 3.24
1498 1499 8.809478 CCTTTACGAGATTTTACTCTAGAAAGC 58.191 37.037 0.00 0.00 35.06 3.51
1499 1500 9.355215 CTTTACGAGATTTTACTCTAGAAAGCA 57.645 33.333 0.00 0.00 35.06 3.91
1500 1501 8.684973 TTACGAGATTTTACTCTAGAAAGCAC 57.315 34.615 0.00 0.00 35.06 4.40
1501 1502 6.926313 ACGAGATTTTACTCTAGAAAGCACT 58.074 36.000 0.00 0.00 35.06 4.40
1502 1503 8.053026 ACGAGATTTTACTCTAGAAAGCACTA 57.947 34.615 0.00 0.00 35.06 2.74
1503 1504 8.185505 ACGAGATTTTACTCTAGAAAGCACTAG 58.814 37.037 0.00 0.00 40.59 2.57
1504 1505 8.399425 CGAGATTTTACTCTAGAAAGCACTAGA 58.601 37.037 0.00 12.36 44.13 2.43
1550 1551 3.168773 ACGGAAGTGTTGCAACTGT 57.831 47.368 28.61 14.07 46.97 3.55
1551 1552 1.459450 ACGGAAGTGTTGCAACTGTT 58.541 45.000 28.61 21.04 46.97 3.16
1552 1553 1.132262 ACGGAAGTGTTGCAACTGTTG 59.868 47.619 28.61 15.98 46.97 3.33
1553 1554 1.400142 CGGAAGTGTTGCAACTGTTGA 59.600 47.619 28.61 6.80 0.00 3.18
1554 1555 2.539547 CGGAAGTGTTGCAACTGTTGAG 60.540 50.000 28.61 13.32 0.00 3.02
1555 1556 2.682856 GGAAGTGTTGCAACTGTTGAGA 59.317 45.455 28.61 8.30 0.00 3.27
1556 1557 3.128589 GGAAGTGTTGCAACTGTTGAGAA 59.871 43.478 28.61 12.17 0.00 2.87
1557 1558 4.380444 GGAAGTGTTGCAACTGTTGAGAAA 60.380 41.667 28.61 11.34 0.00 2.52
1558 1559 4.782019 AGTGTTGCAACTGTTGAGAAAA 57.218 36.364 28.61 7.93 0.00 2.29
1559 1560 5.329035 AGTGTTGCAACTGTTGAGAAAAT 57.671 34.783 28.61 3.07 0.00 1.82
1560 1561 5.343249 AGTGTTGCAACTGTTGAGAAAATC 58.657 37.500 28.61 5.05 0.00 2.17
1561 1562 4.204978 GTGTTGCAACTGTTGAGAAAATCG 59.795 41.667 28.61 0.00 0.00 3.34
1562 1563 3.624326 TGCAACTGTTGAGAAAATCGG 57.376 42.857 23.81 0.00 0.00 4.18
1563 1564 2.287547 TGCAACTGTTGAGAAAATCGGC 60.288 45.455 23.81 5.08 0.00 5.54
1564 1565 2.287547 GCAACTGTTGAGAAAATCGGCA 60.288 45.455 23.81 0.00 0.00 5.69
1565 1566 3.558505 CAACTGTTGAGAAAATCGGCAG 58.441 45.455 15.26 0.00 37.91 4.85
1566 1567 1.537202 ACTGTTGAGAAAATCGGCAGC 59.463 47.619 0.00 0.00 36.39 5.25
1567 1568 0.881118 TGTTGAGAAAATCGGCAGCC 59.119 50.000 0.00 0.00 0.00 4.85
1568 1569 0.881118 GTTGAGAAAATCGGCAGCCA 59.119 50.000 13.30 0.00 0.00 4.75
1569 1570 0.881118 TTGAGAAAATCGGCAGCCAC 59.119 50.000 13.30 0.00 0.00 5.01
1570 1571 1.298157 TGAGAAAATCGGCAGCCACG 61.298 55.000 13.30 0.00 0.00 4.94
1571 1572 1.298859 GAGAAAATCGGCAGCCACGT 61.299 55.000 13.30 0.00 0.00 4.49
1572 1573 0.036765 AGAAAATCGGCAGCCACGTA 60.037 50.000 13.30 0.00 0.00 3.57
1573 1574 0.373716 GAAAATCGGCAGCCACGTAG 59.626 55.000 13.30 0.00 0.00 3.51
1574 1575 1.024579 AAAATCGGCAGCCACGTAGG 61.025 55.000 13.30 0.00 41.84 3.18
1585 1586 2.121116 CCACGTAGGCGATGAACTAG 57.879 55.000 0.00 0.00 42.00 2.57
1586 1587 1.674441 CCACGTAGGCGATGAACTAGA 59.326 52.381 0.00 0.00 42.00 2.43
1587 1588 2.098607 CCACGTAGGCGATGAACTAGAA 59.901 50.000 0.00 0.00 42.00 2.10
1588 1589 3.364062 CACGTAGGCGATGAACTAGAAG 58.636 50.000 0.00 0.00 42.00 2.85
1589 1590 3.015327 ACGTAGGCGATGAACTAGAAGT 58.985 45.455 0.00 0.00 42.00 3.01
1590 1591 3.442977 ACGTAGGCGATGAACTAGAAGTT 59.557 43.478 0.00 0.00 40.47 2.66
1591 1592 4.637534 ACGTAGGCGATGAACTAGAAGTTA 59.362 41.667 0.00 0.00 38.97 2.24
1592 1593 5.206299 CGTAGGCGATGAACTAGAAGTTAG 58.794 45.833 0.00 0.00 38.34 2.34
1593 1594 4.048241 AGGCGATGAACTAGAAGTTAGC 57.952 45.455 0.00 0.00 38.80 3.09
1594 1595 3.447586 AGGCGATGAACTAGAAGTTAGCA 59.552 43.478 0.00 0.00 38.80 3.49
1595 1596 3.552294 GGCGATGAACTAGAAGTTAGCAC 59.448 47.826 0.00 0.00 38.80 4.40
1596 1597 3.240861 GCGATGAACTAGAAGTTAGCACG 59.759 47.826 0.00 0.00 38.80 5.34
1597 1598 4.659088 CGATGAACTAGAAGTTAGCACGA 58.341 43.478 0.00 0.00 38.80 4.35
1598 1599 4.496183 CGATGAACTAGAAGTTAGCACGAC 59.504 45.833 0.00 0.00 38.80 4.34
1599 1600 4.170292 TGAACTAGAAGTTAGCACGACC 57.830 45.455 0.00 0.00 38.80 4.79
1600 1601 3.570975 TGAACTAGAAGTTAGCACGACCA 59.429 43.478 0.00 0.00 38.80 4.02
1601 1602 3.572604 ACTAGAAGTTAGCACGACCAC 57.427 47.619 0.00 0.00 0.00 4.16
1602 1603 2.095364 ACTAGAAGTTAGCACGACCACG 60.095 50.000 0.00 0.00 45.75 4.94
1603 1604 0.956633 AGAAGTTAGCACGACCACGA 59.043 50.000 0.00 0.00 42.66 4.35
1604 1605 1.058404 GAAGTTAGCACGACCACGAC 58.942 55.000 0.00 0.00 42.66 4.34
1605 1606 0.386476 AAGTTAGCACGACCACGACA 59.614 50.000 0.00 0.00 42.66 4.35
1606 1607 0.318445 AGTTAGCACGACCACGACAC 60.318 55.000 0.00 0.00 42.66 3.67
1607 1608 1.370778 TTAGCACGACCACGACACG 60.371 57.895 0.00 0.00 42.66 4.49
1608 1609 2.736343 TTAGCACGACCACGACACGG 62.736 60.000 0.00 0.00 42.66 4.94
1609 1610 4.634133 GCACGACCACGACACGGA 62.634 66.667 0.00 0.00 42.66 4.69
1610 1611 2.728383 CACGACCACGACACGGAC 60.728 66.667 0.00 0.00 42.66 4.79
1611 1612 4.318021 ACGACCACGACACGGACG 62.318 66.667 0.00 0.00 45.29 4.79
1615 1616 3.740397 CCACGACACGGACGGCTA 61.740 66.667 0.00 0.00 34.93 3.93
1616 1617 2.202440 CACGACACGGACGGCTAG 60.202 66.667 0.00 0.00 34.93 3.42
1617 1618 4.112341 ACGACACGGACGGCTAGC 62.112 66.667 6.04 6.04 34.93 3.42
1618 1619 3.812019 CGACACGGACGGCTAGCT 61.812 66.667 15.72 0.00 0.00 3.32
1619 1620 2.572284 GACACGGACGGCTAGCTT 59.428 61.111 15.72 1.31 0.00 3.74
1620 1621 1.080025 GACACGGACGGCTAGCTTT 60.080 57.895 15.72 0.89 0.00 3.51
1621 1622 1.077089 GACACGGACGGCTAGCTTTC 61.077 60.000 15.72 10.88 0.00 2.62
1622 1623 1.810030 CACGGACGGCTAGCTTTCC 60.810 63.158 15.72 18.16 0.00 3.13
1627 1628 3.795638 CGGCTAGCTTTCCGGAAC 58.204 61.111 18.64 6.53 41.82 3.62
1628 1629 1.814169 CGGCTAGCTTTCCGGAACC 60.814 63.158 18.64 12.83 41.82 3.62
1629 1630 1.451567 GGCTAGCTTTCCGGAACCC 60.452 63.158 18.64 10.85 0.00 4.11
1630 1631 1.602771 GCTAGCTTTCCGGAACCCT 59.397 57.895 18.64 17.74 0.00 4.34
1631 1632 0.744771 GCTAGCTTTCCGGAACCCTG 60.745 60.000 18.64 8.76 0.00 4.45
1632 1633 0.744771 CTAGCTTTCCGGAACCCTGC 60.745 60.000 18.64 17.97 0.00 4.85
1633 1634 1.198759 TAGCTTTCCGGAACCCTGCT 61.199 55.000 25.75 25.75 0.00 4.24
1634 1635 1.198759 AGCTTTCCGGAACCCTGCTA 61.199 55.000 18.64 0.00 0.00 3.49
1635 1636 0.107165 GCTTTCCGGAACCCTGCTAT 60.107 55.000 18.64 0.00 0.00 2.97
1636 1637 1.668419 CTTTCCGGAACCCTGCTATG 58.332 55.000 18.64 0.00 0.00 2.23
1637 1638 0.988832 TTTCCGGAACCCTGCTATGT 59.011 50.000 18.64 0.00 0.00 2.29
1638 1639 0.988832 TTCCGGAACCCTGCTATGTT 59.011 50.000 14.35 0.00 0.00 2.71
1639 1640 0.539986 TCCGGAACCCTGCTATGTTC 59.460 55.000 0.00 0.00 40.06 3.18
1640 1641 0.251916 CCGGAACCCTGCTATGTTCA 59.748 55.000 0.00 0.00 42.04 3.18
1641 1642 1.339631 CCGGAACCCTGCTATGTTCAA 60.340 52.381 0.00 0.00 42.04 2.69
1642 1643 2.643551 CGGAACCCTGCTATGTTCAAT 58.356 47.619 12.55 0.00 42.04 2.57
1643 1644 3.016736 CGGAACCCTGCTATGTTCAATT 58.983 45.455 12.55 0.00 42.04 2.32
1644 1645 3.065371 CGGAACCCTGCTATGTTCAATTC 59.935 47.826 12.55 0.00 42.04 2.17
1645 1646 4.016444 GGAACCCTGCTATGTTCAATTCA 58.984 43.478 12.55 0.00 42.04 2.57
1646 1647 4.096984 GGAACCCTGCTATGTTCAATTCAG 59.903 45.833 12.55 0.00 42.04 3.02
1647 1648 4.574674 ACCCTGCTATGTTCAATTCAGA 57.425 40.909 0.00 0.00 0.00 3.27
1648 1649 4.265073 ACCCTGCTATGTTCAATTCAGAC 58.735 43.478 0.00 0.00 0.00 3.51
1649 1650 4.263462 ACCCTGCTATGTTCAATTCAGACA 60.263 41.667 0.00 0.00 0.00 3.41
1650 1651 4.701651 CCCTGCTATGTTCAATTCAGACAA 59.298 41.667 0.00 0.00 0.00 3.18
1651 1652 5.183713 CCCTGCTATGTTCAATTCAGACAAA 59.816 40.000 0.00 0.00 0.00 2.83
1652 1653 6.294675 CCCTGCTATGTTCAATTCAGACAAAA 60.295 38.462 0.00 0.00 0.00 2.44
1653 1654 6.805271 CCTGCTATGTTCAATTCAGACAAAAG 59.195 38.462 0.00 0.00 0.00 2.27
1654 1655 6.151691 TGCTATGTTCAATTCAGACAAAAGC 58.848 36.000 11.88 11.88 0.00 3.51
1655 1656 6.151691 GCTATGTTCAATTCAGACAAAAGCA 58.848 36.000 12.95 0.00 0.00 3.91
1656 1657 6.088616 GCTATGTTCAATTCAGACAAAAGCAC 59.911 38.462 12.95 0.00 0.00 4.40
1657 1658 5.581126 TGTTCAATTCAGACAAAAGCACT 57.419 34.783 0.00 0.00 0.00 4.40
1658 1659 6.691754 TGTTCAATTCAGACAAAAGCACTA 57.308 33.333 0.00 0.00 0.00 2.74
1659 1660 6.728200 TGTTCAATTCAGACAAAAGCACTAG 58.272 36.000 0.00 0.00 0.00 2.57
1660 1661 6.318648 TGTTCAATTCAGACAAAAGCACTAGT 59.681 34.615 0.00 0.00 0.00 2.57
1661 1662 7.497579 TGTTCAATTCAGACAAAAGCACTAGTA 59.502 33.333 0.00 0.00 0.00 1.82
1662 1663 7.421530 TCAATTCAGACAAAAGCACTAGTAC 57.578 36.000 0.00 0.00 0.00 2.73
1663 1664 6.989759 TCAATTCAGACAAAAGCACTAGTACA 59.010 34.615 0.00 0.00 0.00 2.90
1664 1665 7.171508 TCAATTCAGACAAAAGCACTAGTACAG 59.828 37.037 0.00 0.00 0.00 2.74
1665 1666 4.883083 TCAGACAAAAGCACTAGTACAGG 58.117 43.478 0.00 0.00 0.00 4.00
1666 1667 4.587262 TCAGACAAAAGCACTAGTACAGGA 59.413 41.667 0.00 0.00 0.00 3.86
1667 1668 5.069914 TCAGACAAAAGCACTAGTACAGGAA 59.930 40.000 0.00 0.00 0.00 3.36
1668 1669 5.758296 CAGACAAAAGCACTAGTACAGGAAA 59.242 40.000 0.00 0.00 0.00 3.13
1669 1670 5.758784 AGACAAAAGCACTAGTACAGGAAAC 59.241 40.000 0.00 0.00 0.00 2.78
1670 1671 5.681639 ACAAAAGCACTAGTACAGGAAACT 58.318 37.500 0.00 0.00 46.44 2.66
1671 1672 6.823497 ACAAAAGCACTAGTACAGGAAACTA 58.177 36.000 0.00 0.00 40.21 2.24
1672 1673 7.450903 ACAAAAGCACTAGTACAGGAAACTAT 58.549 34.615 0.00 0.00 40.21 2.12
1673 1674 8.591072 ACAAAAGCACTAGTACAGGAAACTATA 58.409 33.333 0.00 0.00 40.21 1.31
1674 1675 9.431887 CAAAAGCACTAGTACAGGAAACTATAA 57.568 33.333 0.00 0.00 40.21 0.98
1678 1679 9.819267 AGCACTAGTACAGGAAACTATAAATTC 57.181 33.333 0.00 0.00 40.21 2.17
1679 1680 9.595823 GCACTAGTACAGGAAACTATAAATTCA 57.404 33.333 0.00 0.00 40.21 2.57
1687 1688 9.457436 ACAGGAAACTATAAATTCATTTACCGT 57.543 29.630 0.00 0.00 40.21 4.83
1688 1689 9.716507 CAGGAAACTATAAATTCATTTACCGTG 57.283 33.333 0.00 0.00 40.21 4.94
1689 1690 9.457436 AGGAAACTATAAATTCATTTACCGTGT 57.543 29.630 0.00 0.00 40.61 4.49
1701 1702 7.837202 TCATTTACCGTGTAGTAAAAGATGG 57.163 36.000 1.41 0.00 43.44 3.51
1702 1703 7.388437 TCATTTACCGTGTAGTAAAAGATGGT 58.612 34.615 1.41 0.00 43.44 3.55
1703 1704 7.332430 TCATTTACCGTGTAGTAAAAGATGGTG 59.668 37.037 1.41 0.00 43.44 4.17
1704 1705 3.332034 ACCGTGTAGTAAAAGATGGTGC 58.668 45.455 0.00 0.00 31.16 5.01
1705 1706 2.347452 CCGTGTAGTAAAAGATGGTGCG 59.653 50.000 0.00 0.00 0.00 5.34
1706 1707 2.991190 CGTGTAGTAAAAGATGGTGCGT 59.009 45.455 0.00 0.00 0.00 5.24
1707 1708 3.430895 CGTGTAGTAAAAGATGGTGCGTT 59.569 43.478 0.00 0.00 0.00 4.84
1708 1709 4.433805 CGTGTAGTAAAAGATGGTGCGTTC 60.434 45.833 0.00 0.00 0.00 3.95
1709 1710 4.449743 GTGTAGTAAAAGATGGTGCGTTCA 59.550 41.667 0.00 0.00 0.00 3.18
1710 1711 5.121768 GTGTAGTAAAAGATGGTGCGTTCAT 59.878 40.000 0.00 0.00 0.00 2.57
1711 1712 5.703592 TGTAGTAAAAGATGGTGCGTTCATT 59.296 36.000 0.00 0.00 0.00 2.57
1712 1713 5.296813 AGTAAAAGATGGTGCGTTCATTC 57.703 39.130 0.00 0.00 0.00 2.67
1713 1714 5.003804 AGTAAAAGATGGTGCGTTCATTCT 58.996 37.500 0.00 0.00 0.00 2.40
1714 1715 3.837213 AAAGATGGTGCGTTCATTCTG 57.163 42.857 0.00 0.00 0.00 3.02
1715 1716 1.089920 AGATGGTGCGTTCATTCTGC 58.910 50.000 0.00 0.00 0.00 4.26
1716 1717 1.089920 GATGGTGCGTTCATTCTGCT 58.910 50.000 0.00 0.00 0.00 4.24
1717 1718 1.063174 GATGGTGCGTTCATTCTGCTC 59.937 52.381 0.00 0.00 0.00 4.26
1718 1719 0.035317 TGGTGCGTTCATTCTGCTCT 59.965 50.000 0.00 0.00 0.00 4.09
1719 1720 0.723981 GGTGCGTTCATTCTGCTCTC 59.276 55.000 0.00 0.00 0.00 3.20
1720 1721 0.368227 GTGCGTTCATTCTGCTCTCG 59.632 55.000 0.00 0.00 0.00 4.04
1721 1722 0.737367 TGCGTTCATTCTGCTCTCGG 60.737 55.000 0.00 0.00 0.00 4.63
1722 1723 1.424493 GCGTTCATTCTGCTCTCGGG 61.424 60.000 0.00 0.00 0.00 5.14
1723 1724 0.173481 CGTTCATTCTGCTCTCGGGA 59.827 55.000 0.00 0.00 0.00 5.14
1724 1725 1.646189 GTTCATTCTGCTCTCGGGAC 58.354 55.000 0.00 0.00 0.00 4.46
1725 1726 0.537188 TTCATTCTGCTCTCGGGACC 59.463 55.000 0.00 0.00 0.00 4.46
1726 1727 1.227089 CATTCTGCTCTCGGGACCG 60.227 63.158 3.96 3.96 41.35 4.79
1727 1728 1.682684 ATTCTGCTCTCGGGACCGT 60.683 57.895 10.90 0.00 40.74 4.83
1728 1729 1.258445 ATTCTGCTCTCGGGACCGTT 61.258 55.000 10.90 0.00 40.74 4.44
1729 1730 1.469335 TTCTGCTCTCGGGACCGTTT 61.469 55.000 10.90 0.00 40.74 3.60
1730 1731 1.004918 CTGCTCTCGGGACCGTTTT 60.005 57.895 10.90 0.00 40.74 2.43
1731 1732 1.291877 CTGCTCTCGGGACCGTTTTG 61.292 60.000 10.90 1.67 40.74 2.44
1732 1733 1.005394 GCTCTCGGGACCGTTTTGA 60.005 57.895 10.90 4.83 40.74 2.69
1733 1734 1.289800 GCTCTCGGGACCGTTTTGAC 61.290 60.000 10.90 0.00 40.74 3.18
1734 1735 0.317479 CTCTCGGGACCGTTTTGACT 59.683 55.000 10.90 0.00 40.74 3.41
1735 1736 0.032952 TCTCGGGACCGTTTTGACTG 59.967 55.000 10.90 0.00 40.74 3.51
1736 1737 0.949105 CTCGGGACCGTTTTGACTGG 60.949 60.000 10.90 0.00 40.74 4.00
1737 1738 1.227734 CGGGACCGTTTTGACTGGT 60.228 57.895 1.86 0.00 39.12 4.00
1738 1739 1.503818 CGGGACCGTTTTGACTGGTG 61.504 60.000 1.86 0.00 35.75 4.17
1739 1740 1.652563 GGACCGTTTTGACTGGTGC 59.347 57.895 0.00 0.00 35.75 5.01
1740 1741 0.818040 GGACCGTTTTGACTGGTGCT 60.818 55.000 0.00 0.00 40.54 4.40
1741 1742 0.586802 GACCGTTTTGACTGGTGCTC 59.413 55.000 0.00 0.00 35.75 4.26
1742 1743 0.818040 ACCGTTTTGACTGGTGCTCC 60.818 55.000 0.00 0.00 33.91 4.70
1743 1744 0.535102 CCGTTTTGACTGGTGCTCCT 60.535 55.000 6.34 0.00 34.23 3.69
1744 1745 0.868406 CGTTTTGACTGGTGCTCCTC 59.132 55.000 6.34 0.00 34.23 3.71
1745 1746 0.868406 GTTTTGACTGGTGCTCCTCG 59.132 55.000 6.34 0.00 34.23 4.63
1746 1747 0.250295 TTTTGACTGGTGCTCCTCGG 60.250 55.000 6.34 0.00 34.23 4.63
1747 1748 2.111999 TTTGACTGGTGCTCCTCGGG 62.112 60.000 6.34 0.00 34.23 5.14
1748 1749 2.680352 GACTGGTGCTCCTCGGGA 60.680 66.667 6.34 0.00 34.23 5.14
1760 1761 2.801859 CTCGGGAGGAAGAGGAGAC 58.198 63.158 0.00 0.00 0.00 3.36
1761 1762 0.753848 CTCGGGAGGAAGAGGAGACC 60.754 65.000 0.00 0.00 0.00 3.85
1762 1763 2.122167 CGGGAGGAAGAGGAGACCG 61.122 68.421 0.00 0.00 0.00 4.79
1763 1764 1.758906 GGGAGGAAGAGGAGACCGG 60.759 68.421 0.00 0.00 0.00 5.28
1764 1765 2.428085 GGAGGAAGAGGAGACCGGC 61.428 68.421 0.00 0.00 0.00 6.13
1765 1766 1.682684 GAGGAAGAGGAGACCGGCA 60.683 63.158 0.00 0.00 0.00 5.69
1766 1767 1.671901 GAGGAAGAGGAGACCGGCAG 61.672 65.000 0.00 0.00 0.00 4.85
1767 1768 1.985116 GGAAGAGGAGACCGGCAGT 60.985 63.158 0.00 0.00 0.00 4.40
1768 1769 1.513622 GAAGAGGAGACCGGCAGTC 59.486 63.158 0.00 0.00 46.71 3.51
1775 1776 3.399181 GACCGGCAGTCCATCCCA 61.399 66.667 0.00 0.00 39.84 4.37
1776 1777 3.391665 GACCGGCAGTCCATCCCAG 62.392 68.421 0.00 0.00 39.84 4.45
1777 1778 4.864334 CCGGCAGTCCATCCCAGC 62.864 72.222 0.00 0.00 0.00 4.85
1778 1779 3.790437 CGGCAGTCCATCCCAGCT 61.790 66.667 0.00 0.00 0.00 4.24
1779 1780 2.191641 GGCAGTCCATCCCAGCTC 59.808 66.667 0.00 0.00 0.00 4.09
1780 1781 2.373707 GGCAGTCCATCCCAGCTCT 61.374 63.158 0.00 0.00 0.00 4.09
1781 1782 1.145819 GCAGTCCATCCCAGCTCTC 59.854 63.158 0.00 0.00 0.00 3.20
1782 1783 1.828768 CAGTCCATCCCAGCTCTCC 59.171 63.158 0.00 0.00 0.00 3.71
1783 1784 0.979709 CAGTCCATCCCAGCTCTCCA 60.980 60.000 0.00 0.00 0.00 3.86
1784 1785 0.980231 AGTCCATCCCAGCTCTCCAC 60.980 60.000 0.00 0.00 0.00 4.02
1785 1786 1.690633 TCCATCCCAGCTCTCCACC 60.691 63.158 0.00 0.00 0.00 4.61
1786 1787 2.503061 CATCCCAGCTCTCCACCG 59.497 66.667 0.00 0.00 0.00 4.94
1787 1788 2.039624 ATCCCAGCTCTCCACCGT 59.960 61.111 0.00 0.00 0.00 4.83
1788 1789 2.362369 ATCCCAGCTCTCCACCGTG 61.362 63.158 0.00 0.00 0.00 4.94
1789 1790 3.314331 CCCAGCTCTCCACCGTGT 61.314 66.667 0.00 0.00 0.00 4.49
1790 1791 1.982395 CCCAGCTCTCCACCGTGTA 60.982 63.158 0.00 0.00 0.00 2.90
1791 1792 1.513158 CCAGCTCTCCACCGTGTAG 59.487 63.158 0.00 0.00 0.00 2.74
1792 1793 1.251527 CCAGCTCTCCACCGTGTAGT 61.252 60.000 0.00 0.00 0.00 2.73
1793 1794 0.109086 CAGCTCTCCACCGTGTAGTG 60.109 60.000 0.00 0.00 37.51 2.74
1794 1795 0.251209 AGCTCTCCACCGTGTAGTGA 60.251 55.000 0.00 0.00 40.34 3.41
1795 1796 0.601558 GCTCTCCACCGTGTAGTGAA 59.398 55.000 0.00 0.00 40.34 3.18
1796 1797 1.204941 GCTCTCCACCGTGTAGTGAAT 59.795 52.381 0.00 0.00 40.34 2.57
1797 1798 2.881074 CTCTCCACCGTGTAGTGAATG 58.119 52.381 0.00 0.00 40.34 2.67
1798 1799 1.067142 TCTCCACCGTGTAGTGAATGC 60.067 52.381 0.00 0.00 40.34 3.56
1799 1800 0.389296 TCCACCGTGTAGTGAATGCG 60.389 55.000 0.00 0.00 40.34 4.73
1800 1801 0.669318 CCACCGTGTAGTGAATGCGT 60.669 55.000 0.00 0.00 40.34 5.24
1801 1802 0.438445 CACCGTGTAGTGAATGCGTG 59.562 55.000 0.00 0.00 40.34 5.34
1802 1803 0.032952 ACCGTGTAGTGAATGCGTGT 59.967 50.000 0.00 0.00 0.00 4.49
1803 1804 1.270274 ACCGTGTAGTGAATGCGTGTA 59.730 47.619 0.00 0.00 0.00 2.90
1804 1805 1.917955 CCGTGTAGTGAATGCGTGTAG 59.082 52.381 0.00 0.00 0.00 2.74
1805 1806 2.592194 CGTGTAGTGAATGCGTGTAGT 58.408 47.619 0.00 0.00 0.00 2.73
1806 1807 2.341464 CGTGTAGTGAATGCGTGTAGTG 59.659 50.000 0.00 0.00 0.00 2.74
1807 1808 3.571571 GTGTAGTGAATGCGTGTAGTGA 58.428 45.455 0.00 0.00 0.00 3.41
1808 1809 3.985279 GTGTAGTGAATGCGTGTAGTGAA 59.015 43.478 0.00 0.00 0.00 3.18
1809 1810 4.625742 GTGTAGTGAATGCGTGTAGTGAAT 59.374 41.667 0.00 0.00 0.00 2.57
1810 1811 5.120208 GTGTAGTGAATGCGTGTAGTGAATT 59.880 40.000 0.00 0.00 0.00 2.17
1811 1812 4.928661 AGTGAATGCGTGTAGTGAATTC 57.071 40.909 0.00 0.00 0.00 2.17
1812 1813 4.569943 AGTGAATGCGTGTAGTGAATTCT 58.430 39.130 7.05 0.00 0.00 2.40
1813 1814 4.627467 AGTGAATGCGTGTAGTGAATTCTC 59.373 41.667 7.05 2.93 0.00 2.87
1814 1815 3.612423 TGAATGCGTGTAGTGAATTCTCG 59.388 43.478 7.05 3.76 0.00 4.04
1815 1816 2.717580 TGCGTGTAGTGAATTCTCGT 57.282 45.000 7.05 0.00 0.00 4.18
1816 1817 2.324860 TGCGTGTAGTGAATTCTCGTG 58.675 47.619 7.05 0.00 0.00 4.35
1817 1818 1.654105 GCGTGTAGTGAATTCTCGTGG 59.346 52.381 7.05 0.00 0.00 4.94
1818 1819 2.259618 CGTGTAGTGAATTCTCGTGGG 58.740 52.381 7.05 0.00 0.00 4.61
1819 1820 2.000447 GTGTAGTGAATTCTCGTGGGC 59.000 52.381 7.05 0.00 0.00 5.36
1820 1821 1.066430 TGTAGTGAATTCTCGTGGGCC 60.066 52.381 7.05 0.00 0.00 5.80
1821 1822 0.174845 TAGTGAATTCTCGTGGGCCG 59.825 55.000 7.05 0.00 38.13 6.13
1822 1823 2.106683 GTGAATTCTCGTGGGCCGG 61.107 63.158 7.05 0.00 37.11 6.13
1823 1824 2.513897 GAATTCTCGTGGGCCGGG 60.514 66.667 2.18 0.00 38.86 5.73
1824 1825 3.006728 AATTCTCGTGGGCCGGGA 61.007 61.111 2.18 0.00 46.54 5.14
1850 1851 4.007644 CCTCTGCACCGCACTCCA 62.008 66.667 0.00 0.00 33.79 3.86
1851 1852 2.740055 CTCTGCACCGCACTCCAC 60.740 66.667 0.00 0.00 33.79 4.02
1852 1853 4.662961 TCTGCACCGCACTCCACG 62.663 66.667 0.00 0.00 33.79 4.94
1856 1857 4.969196 CACCGCACTCCACGCTGT 62.969 66.667 0.00 0.00 0.00 4.40
1857 1858 4.235762 ACCGCACTCCACGCTGTT 62.236 61.111 0.00 0.00 0.00 3.16
1858 1859 3.414700 CCGCACTCCACGCTGTTC 61.415 66.667 0.00 0.00 0.00 3.18
1859 1860 3.414700 CGCACTCCACGCTGTTCC 61.415 66.667 0.00 0.00 0.00 3.62
1860 1861 2.031163 GCACTCCACGCTGTTCCT 59.969 61.111 0.00 0.00 0.00 3.36
1861 1862 2.320587 GCACTCCACGCTGTTCCTG 61.321 63.158 0.00 0.00 0.00 3.86
1862 1863 1.669115 CACTCCACGCTGTTCCTGG 60.669 63.158 0.00 0.00 0.00 4.45
1863 1864 2.743928 CTCCACGCTGTTCCTGGC 60.744 66.667 0.00 0.00 0.00 4.85
1870 1871 4.335647 CTGTTCCTGGCGCCCACT 62.336 66.667 26.77 0.00 0.00 4.00
1871 1872 4.329545 TGTTCCTGGCGCCCACTC 62.330 66.667 26.77 11.25 0.00 3.51
1876 1877 4.767255 CTGGCGCCCACTCCTGTC 62.767 72.222 26.77 0.00 0.00 3.51
1878 1879 4.767255 GGCGCCCACTCCTGTCAG 62.767 72.222 18.11 0.00 0.00 3.51
1879 1880 3.695606 GCGCCCACTCCTGTCAGA 61.696 66.667 0.00 0.00 0.00 3.27
1880 1881 2.262915 CGCCCACTCCTGTCAGAC 59.737 66.667 0.00 0.00 0.00 3.51
1881 1882 2.665603 GCCCACTCCTGTCAGACC 59.334 66.667 0.00 0.00 0.00 3.85
1882 1883 2.217038 GCCCACTCCTGTCAGACCA 61.217 63.158 0.00 0.00 0.00 4.02
1883 1884 1.768684 GCCCACTCCTGTCAGACCAA 61.769 60.000 0.00 0.00 0.00 3.67
1884 1885 0.035458 CCCACTCCTGTCAGACCAAC 59.965 60.000 0.00 0.00 0.00 3.77
1885 1886 1.051812 CCACTCCTGTCAGACCAACT 58.948 55.000 0.00 0.00 0.00 3.16
1886 1887 1.001406 CCACTCCTGTCAGACCAACTC 59.999 57.143 0.00 0.00 0.00 3.01
1887 1888 1.001406 CACTCCTGTCAGACCAACTCC 59.999 57.143 0.00 0.00 0.00 3.85
1888 1889 1.133009 ACTCCTGTCAGACCAACTCCT 60.133 52.381 0.00 0.00 0.00 3.69
1889 1890 1.548269 CTCCTGTCAGACCAACTCCTC 59.452 57.143 0.00 0.00 0.00 3.71
1890 1891 1.133167 TCCTGTCAGACCAACTCCTCA 60.133 52.381 0.00 0.00 0.00 3.86
1891 1892 1.001406 CCTGTCAGACCAACTCCTCAC 59.999 57.143 0.00 0.00 0.00 3.51
1892 1893 1.688735 CTGTCAGACCAACTCCTCACA 59.311 52.381 0.00 0.00 0.00 3.58
1893 1894 2.103094 CTGTCAGACCAACTCCTCACAA 59.897 50.000 0.00 0.00 0.00 3.33
1894 1895 2.503765 TGTCAGACCAACTCCTCACAAA 59.496 45.455 0.00 0.00 0.00 2.83
1895 1896 3.054728 TGTCAGACCAACTCCTCACAAAA 60.055 43.478 0.00 0.00 0.00 2.44
1896 1897 3.945285 GTCAGACCAACTCCTCACAAAAA 59.055 43.478 0.00 0.00 0.00 1.94
1914 1915 2.664402 AAAAGGCATGTCAGACCACT 57.336 45.000 0.00 0.00 0.00 4.00
1915 1916 1.901591 AAAGGCATGTCAGACCACTG 58.098 50.000 0.00 0.00 44.66 3.66
1924 1925 2.452116 CAGACCACTGAACCCCTCA 58.548 57.895 0.00 0.00 46.03 3.86
1925 1926 0.764890 CAGACCACTGAACCCCTCAA 59.235 55.000 0.00 0.00 46.03 3.02
1926 1927 1.059913 AGACCACTGAACCCCTCAAG 58.940 55.000 0.00 0.00 32.17 3.02
1927 1928 1.056660 GACCACTGAACCCCTCAAGA 58.943 55.000 0.00 0.00 32.17 3.02
1928 1929 1.420138 GACCACTGAACCCCTCAAGAA 59.580 52.381 0.00 0.00 32.17 2.52
1929 1930 1.850345 ACCACTGAACCCCTCAAGAAA 59.150 47.619 0.00 0.00 32.17 2.52
1930 1931 2.243736 ACCACTGAACCCCTCAAGAAAA 59.756 45.455 0.00 0.00 32.17 2.29
1931 1932 3.295973 CCACTGAACCCCTCAAGAAAAA 58.704 45.455 0.00 0.00 32.17 1.94
1956 1957 2.281539 TCAGACCACTGACTAACCGA 57.718 50.000 0.00 0.00 46.55 4.69
1957 1958 2.160205 TCAGACCACTGACTAACCGAG 58.840 52.381 0.00 0.00 46.55 4.63
1958 1959 1.202582 CAGACCACTGACTAACCGAGG 59.797 57.143 0.00 0.00 46.03 4.63
1959 1960 1.203025 AGACCACTGACTAACCGAGGT 60.203 52.381 0.00 0.00 30.77 3.85
1960 1961 0.966920 ACCACTGACTAACCGAGGTG 59.033 55.000 0.00 0.00 0.00 4.00
1961 1962 0.966920 CCACTGACTAACCGAGGTGT 59.033 55.000 0.00 0.00 0.00 4.16
1962 1963 1.343465 CCACTGACTAACCGAGGTGTT 59.657 52.381 0.00 0.00 0.00 3.32
1963 1964 2.404215 CACTGACTAACCGAGGTGTTG 58.596 52.381 0.00 0.00 0.00 3.33
1964 1965 2.037144 ACTGACTAACCGAGGTGTTGT 58.963 47.619 0.00 0.00 0.00 3.32
1965 1966 3.005050 CACTGACTAACCGAGGTGTTGTA 59.995 47.826 0.00 0.00 0.00 2.41
1966 1967 3.830755 ACTGACTAACCGAGGTGTTGTAT 59.169 43.478 0.00 0.00 0.00 2.29
1967 1968 4.282703 ACTGACTAACCGAGGTGTTGTATT 59.717 41.667 0.00 0.00 0.00 1.89
1968 1969 4.813027 TGACTAACCGAGGTGTTGTATTC 58.187 43.478 0.00 0.00 0.00 1.75
1969 1970 4.525487 TGACTAACCGAGGTGTTGTATTCT 59.475 41.667 0.00 0.00 0.00 2.40
1970 1971 5.011329 TGACTAACCGAGGTGTTGTATTCTT 59.989 40.000 0.00 0.00 0.00 2.52
1971 1972 5.235516 ACTAACCGAGGTGTTGTATTCTTG 58.764 41.667 0.00 0.00 0.00 3.02
1972 1973 3.053831 ACCGAGGTGTTGTATTCTTGG 57.946 47.619 0.00 0.00 36.95 3.61
1973 1974 2.290071 ACCGAGGTGTTGTATTCTTGGG 60.290 50.000 0.00 0.00 35.59 4.12
1974 1975 2.290071 CCGAGGTGTTGTATTCTTGGGT 60.290 50.000 0.00 0.00 0.00 4.51
1975 1976 3.408634 CGAGGTGTTGTATTCTTGGGTT 58.591 45.455 0.00 0.00 0.00 4.11
1976 1977 4.563993 CCGAGGTGTTGTATTCTTGGGTTA 60.564 45.833 0.00 0.00 0.00 2.85
1977 1978 4.998672 CGAGGTGTTGTATTCTTGGGTTAA 59.001 41.667 0.00 0.00 0.00 2.01
1978 1979 5.646360 CGAGGTGTTGTATTCTTGGGTTAAT 59.354 40.000 0.00 0.00 0.00 1.40
1979 1980 6.403200 CGAGGTGTTGTATTCTTGGGTTAATG 60.403 42.308 0.00 0.00 0.00 1.90
1980 1981 6.311735 AGGTGTTGTATTCTTGGGTTAATGT 58.688 36.000 0.00 0.00 0.00 2.71
1981 1982 6.780522 AGGTGTTGTATTCTTGGGTTAATGTT 59.219 34.615 0.00 0.00 0.00 2.71
1982 1983 7.289084 AGGTGTTGTATTCTTGGGTTAATGTTT 59.711 33.333 0.00 0.00 0.00 2.83
1983 1984 7.597369 GGTGTTGTATTCTTGGGTTAATGTTTC 59.403 37.037 0.00 0.00 0.00 2.78
1984 1985 8.138712 GTGTTGTATTCTTGGGTTAATGTTTCA 58.861 33.333 0.00 0.00 0.00 2.69
1985 1986 8.696374 TGTTGTATTCTTGGGTTAATGTTTCAA 58.304 29.630 0.00 0.00 0.00 2.69
1986 1987 9.191995 GTTGTATTCTTGGGTTAATGTTTCAAG 57.808 33.333 0.00 0.00 36.95 3.02
1987 1988 7.891561 TGTATTCTTGGGTTAATGTTTCAAGG 58.108 34.615 0.00 0.00 36.45 3.61
1988 1989 6.994421 ATTCTTGGGTTAATGTTTCAAGGT 57.006 33.333 0.00 0.00 36.45 3.50
1989 1990 6.800072 TTCTTGGGTTAATGTTTCAAGGTT 57.200 33.333 0.00 0.00 36.45 3.50
1990 1991 6.399639 TCTTGGGTTAATGTTTCAAGGTTC 57.600 37.500 0.00 0.00 36.45 3.62
1991 1992 5.894393 TCTTGGGTTAATGTTTCAAGGTTCA 59.106 36.000 0.00 0.00 36.45 3.18
1992 1993 5.782893 TGGGTTAATGTTTCAAGGTTCAG 57.217 39.130 0.00 0.00 0.00 3.02
1993 1994 5.205056 TGGGTTAATGTTTCAAGGTTCAGT 58.795 37.500 0.00 0.00 0.00 3.41
1994 1995 5.659079 TGGGTTAATGTTTCAAGGTTCAGTT 59.341 36.000 0.00 0.00 0.00 3.16
1995 1996 6.834451 TGGGTTAATGTTTCAAGGTTCAGTTA 59.166 34.615 0.00 0.00 0.00 2.24
1996 1997 7.507616 TGGGTTAATGTTTCAAGGTTCAGTTAT 59.492 33.333 0.00 0.00 0.00 1.89
1997 1998 8.027189 GGGTTAATGTTTCAAGGTTCAGTTATC 58.973 37.037 0.00 0.00 0.00 1.75
1998 1999 8.027189 GGTTAATGTTTCAAGGTTCAGTTATCC 58.973 37.037 0.00 0.00 0.00 2.59
1999 2000 8.573035 GTTAATGTTTCAAGGTTCAGTTATCCA 58.427 33.333 0.00 0.00 0.00 3.41
2000 2001 7.595819 AATGTTTCAAGGTTCAGTTATCCAA 57.404 32.000 0.00 0.00 0.00 3.53
2001 2002 6.385649 TGTTTCAAGGTTCAGTTATCCAAC 57.614 37.500 0.00 0.00 34.67 3.77
2002 2003 5.008217 TGTTTCAAGGTTCAGTTATCCAACG 59.992 40.000 0.00 0.00 39.78 4.10
2003 2004 3.670625 TCAAGGTTCAGTTATCCAACGG 58.329 45.455 0.00 0.00 39.78 4.44
2004 2005 3.071892 TCAAGGTTCAGTTATCCAACGGT 59.928 43.478 0.00 0.00 39.78 4.83
2005 2006 3.053831 AGGTTCAGTTATCCAACGGTG 57.946 47.619 0.00 0.00 39.78 4.94
2016 2017 2.471255 CAACGGTGGAGATGAAGGC 58.529 57.895 0.00 0.00 0.00 4.35
2017 2018 1.079127 AACGGTGGAGATGAAGGCG 60.079 57.895 0.00 0.00 0.00 5.52
2018 2019 2.202932 CGGTGGAGATGAAGGCGG 60.203 66.667 0.00 0.00 0.00 6.13
2019 2020 2.990479 GGTGGAGATGAAGGCGGT 59.010 61.111 0.00 0.00 0.00 5.68
2020 2021 1.672854 CGGTGGAGATGAAGGCGGTA 61.673 60.000 0.00 0.00 0.00 4.02
2021 2022 0.539986 GGTGGAGATGAAGGCGGTAA 59.460 55.000 0.00 0.00 0.00 2.85
2022 2023 1.065709 GGTGGAGATGAAGGCGGTAAA 60.066 52.381 0.00 0.00 0.00 2.01
2023 2024 2.617021 GGTGGAGATGAAGGCGGTAAAA 60.617 50.000 0.00 0.00 0.00 1.52
2024 2025 3.279434 GTGGAGATGAAGGCGGTAAAAT 58.721 45.455 0.00 0.00 0.00 1.82
2025 2026 4.448210 GTGGAGATGAAGGCGGTAAAATA 58.552 43.478 0.00 0.00 0.00 1.40
2026 2027 4.879545 GTGGAGATGAAGGCGGTAAAATAA 59.120 41.667 0.00 0.00 0.00 1.40
2027 2028 5.007724 GTGGAGATGAAGGCGGTAAAATAAG 59.992 44.000 0.00 0.00 0.00 1.73
2028 2029 5.104693 TGGAGATGAAGGCGGTAAAATAAGA 60.105 40.000 0.00 0.00 0.00 2.10
2029 2030 5.998363 GGAGATGAAGGCGGTAAAATAAGAT 59.002 40.000 0.00 0.00 0.00 2.40
2030 2031 6.147985 GGAGATGAAGGCGGTAAAATAAGATC 59.852 42.308 0.00 0.00 0.00 2.75
2031 2032 5.696724 AGATGAAGGCGGTAAAATAAGATCG 59.303 40.000 0.00 0.00 0.00 3.69
2032 2033 5.013568 TGAAGGCGGTAAAATAAGATCGA 57.986 39.130 0.00 0.00 0.00 3.59
2033 2034 5.421277 TGAAGGCGGTAAAATAAGATCGAA 58.579 37.500 0.00 0.00 0.00 3.71
2034 2035 6.053005 TGAAGGCGGTAAAATAAGATCGAAT 58.947 36.000 0.00 0.00 0.00 3.34
2035 2036 5.924475 AGGCGGTAAAATAAGATCGAATG 57.076 39.130 0.00 0.00 0.00 2.67
2036 2037 4.755123 AGGCGGTAAAATAAGATCGAATGG 59.245 41.667 0.00 0.00 0.00 3.16
2037 2038 4.464112 GCGGTAAAATAAGATCGAATGGC 58.536 43.478 0.00 0.00 0.00 4.40
2038 2039 4.213482 GCGGTAAAATAAGATCGAATGGCT 59.787 41.667 0.00 0.00 0.00 4.75
2039 2040 5.277828 GCGGTAAAATAAGATCGAATGGCTT 60.278 40.000 0.00 0.00 0.00 4.35
2040 2041 6.363473 CGGTAAAATAAGATCGAATGGCTTC 58.637 40.000 0.00 0.00 0.00 3.86
2041 2042 6.565999 CGGTAAAATAAGATCGAATGGCTTCC 60.566 42.308 0.00 0.00 0.00 3.46
2042 2043 6.486993 GGTAAAATAAGATCGAATGGCTTCCT 59.513 38.462 0.00 0.00 0.00 3.36
2043 2044 7.660208 GGTAAAATAAGATCGAATGGCTTCCTA 59.340 37.037 0.00 0.00 0.00 2.94
2044 2045 7.497925 AAAATAAGATCGAATGGCTTCCTAC 57.502 36.000 0.00 0.00 0.00 3.18
2045 2046 2.802787 AGATCGAATGGCTTCCTACG 57.197 50.000 0.00 0.00 0.00 3.51
2046 2047 2.307768 AGATCGAATGGCTTCCTACGA 58.692 47.619 0.00 0.00 0.00 3.43
2047 2048 2.894126 AGATCGAATGGCTTCCTACGAT 59.106 45.455 0.00 0.00 41.83 3.73
2048 2049 3.322254 AGATCGAATGGCTTCCTACGATT 59.678 43.478 0.00 0.00 39.83 3.34
2049 2050 4.523173 AGATCGAATGGCTTCCTACGATTA 59.477 41.667 0.00 0.00 39.83 1.75
2050 2051 3.973657 TCGAATGGCTTCCTACGATTAC 58.026 45.455 0.00 0.00 0.00 1.89
2051 2052 3.057734 CGAATGGCTTCCTACGATTACC 58.942 50.000 0.00 0.00 0.00 2.85
2052 2053 3.243771 CGAATGGCTTCCTACGATTACCT 60.244 47.826 0.00 0.00 0.00 3.08
2053 2054 4.022589 CGAATGGCTTCCTACGATTACCTA 60.023 45.833 0.00 0.00 0.00 3.08
2054 2055 5.508489 CGAATGGCTTCCTACGATTACCTAA 60.508 44.000 0.00 0.00 0.00 2.69
2055 2056 5.881923 ATGGCTTCCTACGATTACCTAAA 57.118 39.130 0.00 0.00 0.00 1.85
2056 2057 5.014808 TGGCTTCCTACGATTACCTAAAC 57.985 43.478 0.00 0.00 0.00 2.01
2057 2058 4.141869 TGGCTTCCTACGATTACCTAAACC 60.142 45.833 0.00 0.00 0.00 3.27
2058 2059 4.100653 GGCTTCCTACGATTACCTAAACCT 59.899 45.833 0.00 0.00 0.00 3.50
2059 2060 5.288015 GCTTCCTACGATTACCTAAACCTC 58.712 45.833 0.00 0.00 0.00 3.85
2060 2061 5.738495 GCTTCCTACGATTACCTAAACCTCC 60.738 48.000 0.00 0.00 0.00 4.30
2061 2062 3.885297 TCCTACGATTACCTAAACCTCCG 59.115 47.826 0.00 0.00 0.00 4.63
2062 2063 3.005155 CCTACGATTACCTAAACCTCCGG 59.995 52.174 0.00 0.00 0.00 5.14
2063 2064 1.137675 ACGATTACCTAAACCTCCGGC 59.862 52.381 0.00 0.00 0.00 6.13
2064 2065 1.539712 CGATTACCTAAACCTCCGGCC 60.540 57.143 0.00 0.00 0.00 6.13
2065 2066 0.841961 ATTACCTAAACCTCCGGCCC 59.158 55.000 0.00 0.00 0.00 5.80
2066 2067 0.547229 TTACCTAAACCTCCGGCCCA 60.547 55.000 0.00 0.00 0.00 5.36
2067 2068 0.979187 TACCTAAACCTCCGGCCCAG 60.979 60.000 0.00 0.00 0.00 4.45
2068 2069 2.298661 CCTAAACCTCCGGCCCAGT 61.299 63.158 0.00 0.00 0.00 4.00
2069 2070 1.078426 CTAAACCTCCGGCCCAGTG 60.078 63.158 0.00 0.00 0.00 3.66
2070 2071 1.536907 TAAACCTCCGGCCCAGTGA 60.537 57.895 0.00 0.00 0.00 3.41
2071 2072 1.833787 TAAACCTCCGGCCCAGTGAC 61.834 60.000 0.00 0.00 0.00 3.67
2072 2073 4.640690 ACCTCCGGCCCAGTGACT 62.641 66.667 0.00 0.00 0.00 3.41
2073 2074 3.322466 CCTCCGGCCCAGTGACTT 61.322 66.667 0.00 0.00 0.00 3.01
2074 2075 2.750350 CTCCGGCCCAGTGACTTT 59.250 61.111 0.00 0.00 0.00 2.66
2075 2076 1.376037 CTCCGGCCCAGTGACTTTC 60.376 63.158 0.00 0.00 0.00 2.62
2076 2077 2.359975 CCGGCCCAGTGACTTTCC 60.360 66.667 0.00 0.00 0.00 3.13
2077 2078 2.742372 CGGCCCAGTGACTTTCCG 60.742 66.667 0.00 3.18 0.00 4.30
2078 2079 2.747686 GGCCCAGTGACTTTCCGA 59.252 61.111 0.00 0.00 0.00 4.55
2079 2080 1.299976 GGCCCAGTGACTTTCCGAT 59.700 57.895 0.00 0.00 0.00 4.18
2080 2081 0.744771 GGCCCAGTGACTTTCCGATC 60.745 60.000 0.00 0.00 0.00 3.69
2081 2082 0.036388 GCCCAGTGACTTTCCGATCA 60.036 55.000 0.00 0.00 0.00 2.92
2082 2083 1.610624 GCCCAGTGACTTTCCGATCAA 60.611 52.381 0.00 0.00 0.00 2.57
2083 2084 2.778299 CCCAGTGACTTTCCGATCAAA 58.222 47.619 0.00 0.00 0.00 2.69
2084 2085 3.146066 CCCAGTGACTTTCCGATCAAAA 58.854 45.455 0.00 0.00 0.00 2.44
2085 2086 3.058224 CCCAGTGACTTTCCGATCAAAAC 60.058 47.826 0.00 0.00 0.00 2.43
2086 2087 3.563808 CCAGTGACTTTCCGATCAAAACA 59.436 43.478 0.00 0.00 0.00 2.83
2087 2088 4.527564 CAGTGACTTTCCGATCAAAACAC 58.472 43.478 0.00 0.00 0.00 3.32
2088 2089 4.035091 CAGTGACTTTCCGATCAAAACACA 59.965 41.667 0.00 4.47 31.04 3.72
2089 2090 4.035208 AGTGACTTTCCGATCAAAACACAC 59.965 41.667 0.00 11.90 31.04 3.82
2090 2091 3.942115 TGACTTTCCGATCAAAACACACA 59.058 39.130 0.00 0.00 0.00 3.72
2091 2092 4.201871 TGACTTTCCGATCAAAACACACAC 60.202 41.667 0.00 0.00 0.00 3.82
2092 2093 3.692101 ACTTTCCGATCAAAACACACACA 59.308 39.130 0.00 0.00 0.00 3.72
2093 2094 3.684103 TTCCGATCAAAACACACACAC 57.316 42.857 0.00 0.00 0.00 3.82
2094 2095 2.633488 TCCGATCAAAACACACACACA 58.367 42.857 0.00 0.00 0.00 3.72
2095 2096 3.010420 TCCGATCAAAACACACACACAA 58.990 40.909 0.00 0.00 0.00 3.33
2096 2097 3.105203 CCGATCAAAACACACACACAAC 58.895 45.455 0.00 0.00 0.00 3.32
2097 2098 3.105203 CGATCAAAACACACACACAACC 58.895 45.455 0.00 0.00 0.00 3.77
2098 2099 3.181501 CGATCAAAACACACACACAACCT 60.182 43.478 0.00 0.00 0.00 3.50
2099 2100 4.674101 CGATCAAAACACACACACAACCTT 60.674 41.667 0.00 0.00 0.00 3.50
2100 2101 4.592485 TCAAAACACACACACAACCTTT 57.408 36.364 0.00 0.00 0.00 3.11
2101 2102 4.950050 TCAAAACACACACACAACCTTTT 58.050 34.783 0.00 0.00 0.00 2.27
2102 2103 5.360591 TCAAAACACACACACAACCTTTTT 58.639 33.333 0.00 0.00 0.00 1.94
2103 2104 5.463724 TCAAAACACACACACAACCTTTTTC 59.536 36.000 0.00 0.00 0.00 2.29
2104 2105 4.592485 AACACACACACAACCTTTTTCA 57.408 36.364 0.00 0.00 0.00 2.69
2105 2106 4.799564 ACACACACACAACCTTTTTCAT 57.200 36.364 0.00 0.00 0.00 2.57
2106 2107 5.146010 ACACACACACAACCTTTTTCATT 57.854 34.783 0.00 0.00 0.00 2.57
2107 2108 5.546526 ACACACACACAACCTTTTTCATTT 58.453 33.333 0.00 0.00 0.00 2.32
2108 2109 5.994668 ACACACACACAACCTTTTTCATTTT 59.005 32.000 0.00 0.00 0.00 1.82
2109 2110 6.073331 ACACACACACAACCTTTTTCATTTTG 60.073 34.615 0.00 0.00 0.00 2.44
2110 2111 6.146837 CACACACACAACCTTTTTCATTTTGA 59.853 34.615 0.00 0.00 0.00 2.69
2111 2112 6.368516 ACACACACAACCTTTTTCATTTTGAG 59.631 34.615 0.00 0.00 0.00 3.02
2112 2113 6.589523 CACACACAACCTTTTTCATTTTGAGA 59.410 34.615 0.00 0.00 0.00 3.27
2113 2114 7.117523 CACACACAACCTTTTTCATTTTGAGAA 59.882 33.333 0.00 0.00 0.00 2.87
2114 2115 7.823799 ACACACAACCTTTTTCATTTTGAGAAT 59.176 29.630 0.00 0.00 0.00 2.40
2115 2116 8.667463 CACACAACCTTTTTCATTTTGAGAATT 58.333 29.630 0.00 0.00 0.00 2.17
2116 2117 9.883142 ACACAACCTTTTTCATTTTGAGAATTA 57.117 25.926 0.00 0.00 0.00 1.40
2139 2140 1.686355 AAAAACACACATCCGGCTCA 58.314 45.000 0.00 0.00 0.00 4.26
2140 2141 0.951558 AAAACACACATCCGGCTCAC 59.048 50.000 0.00 0.00 0.00 3.51
2141 2142 0.889186 AAACACACATCCGGCTCACC 60.889 55.000 0.00 0.00 0.00 4.02
2142 2143 1.768684 AACACACATCCGGCTCACCT 61.769 55.000 0.00 0.00 0.00 4.00
2143 2144 0.902984 ACACACATCCGGCTCACCTA 60.903 55.000 0.00 0.00 0.00 3.08
2144 2145 0.460284 CACACATCCGGCTCACCTAC 60.460 60.000 0.00 0.00 0.00 3.18
2145 2146 0.902984 ACACATCCGGCTCACCTACA 60.903 55.000 0.00 0.00 0.00 2.74
2146 2147 0.460284 CACATCCGGCTCACCTACAC 60.460 60.000 0.00 0.00 0.00 2.90
2147 2148 1.144057 CATCCGGCTCACCTACACC 59.856 63.158 0.00 0.00 0.00 4.16
2148 2149 1.001760 ATCCGGCTCACCTACACCT 59.998 57.895 0.00 0.00 0.00 4.00
2149 2150 0.260816 ATCCGGCTCACCTACACCTA 59.739 55.000 0.00 0.00 0.00 3.08
2150 2151 0.395311 TCCGGCTCACCTACACCTAG 60.395 60.000 0.00 0.00 0.00 3.02
2151 2152 1.437986 CGGCTCACCTACACCTAGC 59.562 63.158 0.00 0.00 0.00 3.42
2152 2153 1.823976 GGCTCACCTACACCTAGCC 59.176 63.158 0.00 0.00 45.37 3.93
2153 2154 1.687297 GGCTCACCTACACCTAGCCC 61.687 65.000 0.00 0.00 45.69 5.19
2154 2155 0.976073 GCTCACCTACACCTAGCCCA 60.976 60.000 0.00 0.00 0.00 5.36
2155 2156 1.568504 CTCACCTACACCTAGCCCAA 58.431 55.000 0.00 0.00 0.00 4.12
2156 2157 1.906574 CTCACCTACACCTAGCCCAAA 59.093 52.381 0.00 0.00 0.00 3.28
2157 2158 1.626825 TCACCTACACCTAGCCCAAAC 59.373 52.381 0.00 0.00 0.00 2.93
2158 2159 0.611714 ACCTACACCTAGCCCAAACG 59.388 55.000 0.00 0.00 0.00 3.60
2159 2160 0.743345 CCTACACCTAGCCCAAACGC 60.743 60.000 0.00 0.00 0.00 4.84
2160 2161 0.743345 CTACACCTAGCCCAAACGCC 60.743 60.000 0.00 0.00 0.00 5.68
2161 2162 1.196104 TACACCTAGCCCAAACGCCT 61.196 55.000 0.00 0.00 0.00 5.52
2162 2163 2.040544 CACCTAGCCCAAACGCCTG 61.041 63.158 0.00 0.00 0.00 4.85
2163 2164 2.438434 CCTAGCCCAAACGCCTGG 60.438 66.667 0.00 0.00 36.10 4.45
2164 2165 3.134127 CTAGCCCAAACGCCTGGC 61.134 66.667 9.11 9.11 45.70 4.85
2167 2168 4.133796 GCCCAAACGCCTGGCATC 62.134 66.667 20.29 0.00 44.70 3.91
2168 2169 3.451894 CCCAAACGCCTGGCATCC 61.452 66.667 20.29 0.00 34.88 3.51
2169 2170 3.451894 CCAAACGCCTGGCATCCC 61.452 66.667 20.29 0.00 0.00 3.85
2170 2171 2.361610 CAAACGCCTGGCATCCCT 60.362 61.111 20.29 0.00 0.00 4.20
2171 2172 2.044946 AAACGCCTGGCATCCCTC 60.045 61.111 20.29 0.00 0.00 4.30
2172 2173 2.905996 AAACGCCTGGCATCCCTCA 61.906 57.895 20.29 0.00 0.00 3.86
2173 2174 2.424842 AAACGCCTGGCATCCCTCAA 62.425 55.000 20.29 0.00 0.00 3.02
2174 2175 2.045045 CGCCTGGCATCCCTCAAA 60.045 61.111 20.29 0.00 0.00 2.69
2175 2176 2.409870 CGCCTGGCATCCCTCAAAC 61.410 63.158 20.29 0.00 0.00 2.93
2176 2177 2.054453 GCCTGGCATCCCTCAAACC 61.054 63.158 15.17 0.00 0.00 3.27
2177 2178 1.380380 CCTGGCATCCCTCAAACCC 60.380 63.158 0.00 0.00 0.00 4.11
2178 2179 1.383799 CTGGCATCCCTCAAACCCA 59.616 57.895 0.00 0.00 0.00 4.51
2179 2180 0.251742 CTGGCATCCCTCAAACCCAA 60.252 55.000 0.00 0.00 0.00 4.12
2180 2181 0.413037 TGGCATCCCTCAAACCCAAT 59.587 50.000 0.00 0.00 0.00 3.16
2181 2182 1.114627 GGCATCCCTCAAACCCAATC 58.885 55.000 0.00 0.00 0.00 2.67
2182 2183 1.114627 GCATCCCTCAAACCCAATCC 58.885 55.000 0.00 0.00 0.00 3.01
2183 2184 1.780503 CATCCCTCAAACCCAATCCC 58.219 55.000 0.00 0.00 0.00 3.85
2184 2185 1.006998 CATCCCTCAAACCCAATCCCA 59.993 52.381 0.00 0.00 0.00 4.37
2185 2186 1.392407 TCCCTCAAACCCAATCCCAT 58.608 50.000 0.00 0.00 0.00 4.00
2186 2187 2.579100 TCCCTCAAACCCAATCCCATA 58.421 47.619 0.00 0.00 0.00 2.74
2187 2188 2.243736 TCCCTCAAACCCAATCCCATAC 59.756 50.000 0.00 0.00 0.00 2.39
2188 2189 2.024464 CCCTCAAACCCAATCCCATACA 60.024 50.000 0.00 0.00 0.00 2.29
2189 2190 3.374098 CCCTCAAACCCAATCCCATACAT 60.374 47.826 0.00 0.00 0.00 2.29
2190 2191 4.141041 CCCTCAAACCCAATCCCATACATA 60.141 45.833 0.00 0.00 0.00 2.29
2191 2192 5.454062 CCTCAAACCCAATCCCATACATAA 58.546 41.667 0.00 0.00 0.00 1.90
2192 2193 5.536161 CCTCAAACCCAATCCCATACATAAG 59.464 44.000 0.00 0.00 0.00 1.73
2193 2194 5.454062 TCAAACCCAATCCCATACATAAGG 58.546 41.667 0.00 0.00 0.00 2.69
2194 2195 5.043732 TCAAACCCAATCCCATACATAAGGT 60.044 40.000 0.00 0.00 0.00 3.50
2195 2196 4.453480 ACCCAATCCCATACATAAGGTG 57.547 45.455 0.00 0.00 0.00 4.00
2196 2197 3.140144 ACCCAATCCCATACATAAGGTGG 59.860 47.826 0.00 0.00 0.00 4.61
2197 2198 3.397618 CCCAATCCCATACATAAGGTGGA 59.602 47.826 0.00 0.00 34.94 4.02
2198 2199 4.044571 CCCAATCCCATACATAAGGTGGAT 59.955 45.833 0.00 0.00 32.67 3.41
2199 2200 5.256474 CCAATCCCATACATAAGGTGGATC 58.744 45.833 0.00 0.00 30.68 3.36
2200 2201 5.222109 CCAATCCCATACATAAGGTGGATCA 60.222 44.000 0.00 0.00 30.68 2.92
2201 2202 6.306199 CAATCCCATACATAAGGTGGATCAA 58.694 40.000 0.00 0.00 30.68 2.57
2202 2203 5.985175 TCCCATACATAAGGTGGATCAAA 57.015 39.130 0.00 0.00 34.94 2.69
2203 2204 6.529084 TCCCATACATAAGGTGGATCAAAT 57.471 37.500 0.00 0.00 34.94 2.32
2204 2205 7.640577 TCCCATACATAAGGTGGATCAAATA 57.359 36.000 0.00 0.00 34.94 1.40
2205 2206 8.230848 TCCCATACATAAGGTGGATCAAATAT 57.769 34.615 0.00 0.00 34.94 1.28
2206 2207 8.677871 TCCCATACATAAGGTGGATCAAATATT 58.322 33.333 0.00 0.00 34.94 1.28
2207 2208 8.960591 CCCATACATAAGGTGGATCAAATATTC 58.039 37.037 0.00 0.00 34.94 1.75
2208 2209 9.745018 CCATACATAAGGTGGATCAAATATTCT 57.255 33.333 0.00 0.00 34.94 2.40
2210 2211 7.969536 ACATAAGGTGGATCAAATATTCTCG 57.030 36.000 0.00 0.00 0.00 4.04
2211 2212 6.936900 ACATAAGGTGGATCAAATATTCTCGG 59.063 38.462 0.00 0.00 0.00 4.63
2212 2213 5.630415 AAGGTGGATCAAATATTCTCGGA 57.370 39.130 0.00 0.00 0.00 4.55
2213 2214 4.962155 AGGTGGATCAAATATTCTCGGAC 58.038 43.478 0.00 0.00 0.00 4.79
2214 2215 4.408921 AGGTGGATCAAATATTCTCGGACA 59.591 41.667 0.00 0.00 0.00 4.02
2215 2216 4.511826 GGTGGATCAAATATTCTCGGACAC 59.488 45.833 0.00 0.00 0.00 3.67
2216 2217 5.360591 GTGGATCAAATATTCTCGGACACT 58.639 41.667 0.00 0.00 0.00 3.55
2217 2218 5.235186 GTGGATCAAATATTCTCGGACACTG 59.765 44.000 0.00 0.00 0.00 3.66
2218 2219 4.212214 GGATCAAATATTCTCGGACACTGC 59.788 45.833 0.00 0.00 0.00 4.40
2219 2220 3.531538 TCAAATATTCTCGGACACTGCC 58.468 45.455 0.00 0.00 0.00 4.85
2220 2221 2.614057 CAAATATTCTCGGACACTGCCC 59.386 50.000 0.00 0.00 0.00 5.36
2221 2222 0.759346 ATATTCTCGGACACTGCCCC 59.241 55.000 0.00 0.00 0.00 5.80
2222 2223 0.616395 TATTCTCGGACACTGCCCCA 60.616 55.000 0.00 0.00 0.00 4.96
2223 2224 2.185310 ATTCTCGGACACTGCCCCAC 62.185 60.000 0.00 0.00 0.00 4.61
2224 2225 4.742201 CTCGGACACTGCCCCACG 62.742 72.222 0.00 0.00 0.00 4.94
2228 2229 4.295119 GACACTGCCCCACGTCGT 62.295 66.667 0.00 0.00 0.00 4.34
2229 2230 2.913578 ACACTGCCCCACGTCGTA 60.914 61.111 0.00 0.00 0.00 3.43
2230 2231 2.126071 CACTGCCCCACGTCGTAG 60.126 66.667 0.00 0.00 0.00 3.51
2231 2232 4.065281 ACTGCCCCACGTCGTAGC 62.065 66.667 0.00 2.21 0.00 3.58
2232 2233 4.063967 CTGCCCCACGTCGTAGCA 62.064 66.667 14.02 14.02 0.00 3.49
2233 2234 3.989698 CTGCCCCACGTCGTAGCAG 62.990 68.421 22.11 22.11 44.31 4.24
2235 2236 4.814294 CCCCACGTCGTAGCAGCC 62.814 72.222 0.00 0.00 0.00 4.85
2236 2237 4.814294 CCCACGTCGTAGCAGCCC 62.814 72.222 0.00 0.00 0.00 5.19
2237 2238 4.063967 CCACGTCGTAGCAGCCCA 62.064 66.667 0.00 0.00 0.00 5.36
2238 2239 2.184322 CACGTCGTAGCAGCCCAT 59.816 61.111 0.00 0.00 0.00 4.00
2239 2240 2.167219 CACGTCGTAGCAGCCCATG 61.167 63.158 0.00 0.00 0.00 3.66
2251 2252 4.928140 CCCATGCTGGCCCATCCC 62.928 72.222 0.00 0.00 35.79 3.85
2262 2263 4.489771 CCATCCCGCCCTCACCAC 62.490 72.222 0.00 0.00 0.00 4.16
2263 2264 4.838152 CATCCCGCCCTCACCACG 62.838 72.222 0.00 0.00 0.00 4.94
2270 2271 4.135153 CCCTCACCACGCTCCGAG 62.135 72.222 0.00 0.00 0.00 4.63
2271 2272 3.062466 CCTCACCACGCTCCGAGA 61.062 66.667 0.00 0.00 0.00 4.04
2272 2273 2.636412 CCTCACCACGCTCCGAGAA 61.636 63.158 0.00 0.00 0.00 2.87
2273 2274 1.289066 CTCACCACGCTCCGAGAAA 59.711 57.895 0.00 0.00 0.00 2.52
2274 2275 0.319555 CTCACCACGCTCCGAGAAAA 60.320 55.000 0.00 0.00 0.00 2.29
2275 2276 0.105224 TCACCACGCTCCGAGAAAAA 59.895 50.000 0.00 0.00 0.00 1.94
2276 2277 0.234884 CACCACGCTCCGAGAAAAAC 59.765 55.000 0.00 0.00 0.00 2.43
2277 2278 0.883370 ACCACGCTCCGAGAAAAACC 60.883 55.000 0.00 0.00 0.00 3.27
2278 2279 1.574702 CCACGCTCCGAGAAAAACCC 61.575 60.000 0.00 0.00 0.00 4.11
2279 2280 1.302271 ACGCTCCGAGAAAAACCCC 60.302 57.895 0.00 0.00 0.00 4.95
2280 2281 1.302192 CGCTCCGAGAAAAACCCCA 60.302 57.895 0.00 0.00 0.00 4.96
2281 2282 1.574702 CGCTCCGAGAAAAACCCCAC 61.575 60.000 0.00 0.00 0.00 4.61
2282 2283 1.241990 GCTCCGAGAAAAACCCCACC 61.242 60.000 0.00 0.00 0.00 4.61
2283 2284 0.608308 CTCCGAGAAAAACCCCACCC 60.608 60.000 0.00 0.00 0.00 4.61
2284 2285 1.605451 CCGAGAAAAACCCCACCCC 60.605 63.158 0.00 0.00 0.00 4.95
2285 2286 1.151908 CGAGAAAAACCCCACCCCA 59.848 57.895 0.00 0.00 0.00 4.96
2286 2287 0.251608 CGAGAAAAACCCCACCCCAT 60.252 55.000 0.00 0.00 0.00 4.00
2287 2288 1.557099 GAGAAAAACCCCACCCCATC 58.443 55.000 0.00 0.00 0.00 3.51
2288 2289 0.251608 AGAAAAACCCCACCCCATCG 60.252 55.000 0.00 0.00 0.00 3.84
2289 2290 1.229051 AAAAACCCCACCCCATCGG 60.229 57.895 0.00 0.00 37.81 4.18
2299 2300 3.314331 CCCATCGGGCGAGGCTAT 61.314 66.667 0.00 0.00 35.35 2.97
2300 2301 2.047844 CCATCGGGCGAGGCTATG 60.048 66.667 0.00 1.77 0.00 2.23
2301 2302 2.740055 CATCGGGCGAGGCTATGC 60.740 66.667 2.74 2.74 0.00 3.14
2302 2303 4.363990 ATCGGGCGAGGCTATGCG 62.364 66.667 5.27 0.00 0.00 4.73
2308 2309 2.587194 CGAGGCTATGCGCTGCTT 60.587 61.111 9.73 6.97 39.13 3.91
2309 2310 1.300156 CGAGGCTATGCGCTGCTTA 60.300 57.895 9.73 0.00 39.13 3.09
2310 2311 0.668706 CGAGGCTATGCGCTGCTTAT 60.669 55.000 9.73 0.00 39.13 1.73
2311 2312 1.517242 GAGGCTATGCGCTGCTTATT 58.483 50.000 9.73 0.00 39.13 1.40
2312 2313 1.196354 GAGGCTATGCGCTGCTTATTG 59.804 52.381 9.73 0.00 39.13 1.90
2313 2314 0.386478 GGCTATGCGCTGCTTATTGC 60.386 55.000 9.73 5.72 39.13 3.56
2319 2320 3.501396 GCTGCTTATTGCGAGGCA 58.499 55.556 0.00 0.00 46.63 4.75
2320 2321 1.063166 GCTGCTTATTGCGAGGCAC 59.937 57.895 0.00 0.00 46.63 5.01
2321 2322 1.647545 GCTGCTTATTGCGAGGCACA 61.648 55.000 0.00 0.00 46.63 4.57
2322 2323 1.019673 CTGCTTATTGCGAGGCACAT 58.980 50.000 0.00 0.00 46.63 3.21
2323 2324 0.734309 TGCTTATTGCGAGGCACATG 59.266 50.000 0.00 0.00 46.63 3.21
2324 2325 1.016627 GCTTATTGCGAGGCACATGA 58.983 50.000 0.00 0.00 38.71 3.07
2325 2326 1.268234 GCTTATTGCGAGGCACATGAC 60.268 52.381 0.00 0.00 38.71 3.06
2326 2327 2.009051 CTTATTGCGAGGCACATGACA 58.991 47.619 0.00 0.00 38.71 3.58
2327 2328 1.655484 TATTGCGAGGCACATGACAG 58.345 50.000 0.00 0.00 38.71 3.51
2328 2329 1.651240 ATTGCGAGGCACATGACAGC 61.651 55.000 0.00 0.00 38.71 4.40
2334 2335 3.503363 GCACATGACAGCCTCGCC 61.503 66.667 0.00 0.00 0.00 5.54
2335 2336 2.267006 CACATGACAGCCTCGCCT 59.733 61.111 0.00 0.00 0.00 5.52
2336 2337 1.517361 CACATGACAGCCTCGCCTA 59.483 57.895 0.00 0.00 0.00 3.93
2337 2338 0.105593 CACATGACAGCCTCGCCTAT 59.894 55.000 0.00 0.00 0.00 2.57
2338 2339 1.341209 CACATGACAGCCTCGCCTATA 59.659 52.381 0.00 0.00 0.00 1.31
2339 2340 1.615883 ACATGACAGCCTCGCCTATAG 59.384 52.381 0.00 0.00 0.00 1.31
2340 2341 1.067283 CATGACAGCCTCGCCTATAGG 60.067 57.143 15.01 15.01 37.17 2.57
2341 2342 0.827925 TGACAGCCTCGCCTATAGGG 60.828 60.000 20.58 10.51 34.46 3.53
2352 2353 2.276732 CCTATAGGGCATGGTTGTGG 57.723 55.000 11.33 0.00 0.00 4.17
2353 2354 1.202927 CCTATAGGGCATGGTTGTGGG 60.203 57.143 11.33 0.00 0.00 4.61
2354 2355 0.184933 TATAGGGCATGGTTGTGGGC 59.815 55.000 0.00 0.00 0.00 5.36
2355 2356 1.583784 ATAGGGCATGGTTGTGGGCT 61.584 55.000 0.00 0.00 0.00 5.19
2356 2357 2.497792 TAGGGCATGGTTGTGGGCTG 62.498 60.000 0.00 0.00 0.00 4.85
2357 2358 3.384532 GGCATGGTTGTGGGCTGG 61.385 66.667 0.00 0.00 0.00 4.85
2358 2359 4.073200 GCATGGTTGTGGGCTGGC 62.073 66.667 0.00 0.00 0.00 4.85
2359 2360 3.384532 CATGGTTGTGGGCTGGCC 61.385 66.667 14.23 14.23 0.00 5.36
2373 2374 2.193248 GGCCCACTAGGACATGGC 59.807 66.667 0.00 0.00 46.95 4.40
2374 2375 2.679342 GGCCCACTAGGACATGGCA 61.679 63.158 0.00 0.00 46.95 4.92
2375 2376 1.533711 GCCCACTAGGACATGGCAT 59.466 57.895 0.00 0.00 41.76 4.40
2376 2377 0.820891 GCCCACTAGGACATGGCATG 60.821 60.000 25.31 25.31 41.76 4.06
2378 2379 1.064463 CCCACTAGGACATGGCATGTT 60.064 52.381 31.83 20.43 45.03 2.71
2379 2380 2.292267 CCACTAGGACATGGCATGTTC 58.708 52.381 31.83 29.89 45.03 3.18
2380 2381 2.292267 CACTAGGACATGGCATGTTCC 58.708 52.381 31.83 29.24 45.03 3.62
2381 2382 2.092753 CACTAGGACATGGCATGTTCCT 60.093 50.000 33.68 33.68 45.03 3.36
2382 2383 2.171448 ACTAGGACATGGCATGTTCCTC 59.829 50.000 34.52 23.67 45.03 3.71
2383 2384 0.994247 AGGACATGGCATGTTCCTCA 59.006 50.000 31.83 0.00 45.03 3.86
2384 2385 1.098050 GGACATGGCATGTTCCTCAC 58.902 55.000 31.83 18.44 45.03 3.51
2385 2386 1.614051 GGACATGGCATGTTCCTCACA 60.614 52.381 31.83 0.00 45.03 3.58
2387 2388 2.756760 GACATGGCATGTTCCTCACATT 59.243 45.455 31.83 7.09 44.40 2.71
2388 2389 3.167485 ACATGGCATGTTCCTCACATTT 58.833 40.909 26.78 0.00 44.40 2.32
2389 2390 4.343231 ACATGGCATGTTCCTCACATTTA 58.657 39.130 26.78 0.00 44.40 1.40
2390 2391 4.957954 ACATGGCATGTTCCTCACATTTAT 59.042 37.500 26.78 0.00 44.40 1.40
2391 2392 5.422970 ACATGGCATGTTCCTCACATTTATT 59.577 36.000 26.78 0.00 44.40 1.40
2392 2393 5.999205 TGGCATGTTCCTCACATTTATTT 57.001 34.783 0.00 0.00 44.40 1.40
2393 2394 6.357579 TGGCATGTTCCTCACATTTATTTT 57.642 33.333 0.00 0.00 44.40 1.82
2394 2395 6.164876 TGGCATGTTCCTCACATTTATTTTG 58.835 36.000 0.00 0.00 44.40 2.44
2395 2396 6.165577 GGCATGTTCCTCACATTTATTTTGT 58.834 36.000 0.00 0.00 44.40 2.83
2396 2397 7.039434 TGGCATGTTCCTCACATTTATTTTGTA 60.039 33.333 0.00 0.00 44.40 2.41
2397 2398 7.275560 GGCATGTTCCTCACATTTATTTTGTAC 59.724 37.037 0.00 0.00 44.40 2.90
2398 2399 8.028938 GCATGTTCCTCACATTTATTTTGTACT 58.971 33.333 0.00 0.00 44.40 2.73
2399 2400 9.912634 CATGTTCCTCACATTTATTTTGTACTT 57.087 29.630 0.00 0.00 44.40 2.24
2434 2435 9.975218 ATTTTTAACACATATAGTCCAGGAACT 57.025 29.630 0.00 0.00 43.88 3.01
2435 2436 9.802039 TTTTTAACACATATAGTCCAGGAACTT 57.198 29.630 0.00 0.00 34.60 2.66
2440 2441 9.975218 AACACATATAGTCCAGGAACTTAAATT 57.025 29.630 0.00 0.00 34.60 1.82
2441 2442 9.975218 ACACATATAGTCCAGGAACTTAAATTT 57.025 29.630 0.00 0.00 34.60 1.82
2501 2502 7.700505 ACCTAGTATAAAAATTTGGTTAGCGC 58.299 34.615 0.00 0.00 0.00 5.92
2502 2503 7.337436 ACCTAGTATAAAAATTTGGTTAGCGCA 59.663 33.333 11.47 0.00 0.00 6.09
2503 2504 8.185505 CCTAGTATAAAAATTTGGTTAGCGCAA 58.814 33.333 11.47 0.00 0.00 4.85
2504 2505 9.730420 CTAGTATAAAAATTTGGTTAGCGCAAT 57.270 29.630 11.47 0.00 0.00 3.56
2505 2506 8.996024 AGTATAAAAATTTGGTTAGCGCAATT 57.004 26.923 11.47 2.29 0.00 2.32
2506 2507 9.430623 AGTATAAAAATTTGGTTAGCGCAATTT 57.569 25.926 11.47 9.13 0.00 1.82
2510 2511 8.775220 AAAAATTTGGTTAGCGCAATTTTAAC 57.225 26.923 20.23 14.63 0.00 2.01
2511 2512 7.484035 AAATTTGGTTAGCGCAATTTTAACA 57.516 28.000 11.47 0.00 0.00 2.41
2512 2513 6.704512 ATTTGGTTAGCGCAATTTTAACAG 57.295 33.333 11.47 0.00 0.00 3.16
2513 2514 5.440234 TTGGTTAGCGCAATTTTAACAGA 57.560 34.783 11.47 0.00 0.00 3.41
2514 2515 5.440234 TGGTTAGCGCAATTTTAACAGAA 57.560 34.783 11.47 0.00 0.00 3.02
2515 2516 6.019779 TGGTTAGCGCAATTTTAACAGAAT 57.980 33.333 11.47 0.00 0.00 2.40
2516 2517 5.861251 TGGTTAGCGCAATTTTAACAGAATG 59.139 36.000 11.47 0.00 46.00 2.67
2540 2541 8.628630 TGTTGACAACTTCATATAAATGTCCA 57.371 30.769 18.73 0.00 37.07 4.02
2541 2542 9.241919 TGTTGACAACTTCATATAAATGTCCAT 57.758 29.630 18.73 0.00 37.07 3.41
2544 2545 9.337396 TGACAACTTCATATAAATGTCCATACC 57.663 33.333 0.00 0.00 37.07 2.73
2545 2546 9.337396 GACAACTTCATATAAATGTCCATACCA 57.663 33.333 0.00 0.00 34.50 3.25
2546 2547 9.693739 ACAACTTCATATAAATGTCCATACCAA 57.306 29.630 0.00 0.00 34.50 3.67
2558 2559 8.776376 AATGTCCATACCAATGAAAAATGTTC 57.224 30.769 0.00 0.00 34.84 3.18
2559 2560 6.696411 TGTCCATACCAATGAAAAATGTTCC 58.304 36.000 0.00 0.00 34.84 3.62
2560 2561 6.106003 GTCCATACCAATGAAAAATGTTCCC 58.894 40.000 0.00 0.00 34.84 3.97
2561 2562 5.782331 TCCATACCAATGAAAAATGTTCCCA 59.218 36.000 0.00 0.00 34.84 4.37
2562 2563 6.443206 TCCATACCAATGAAAAATGTTCCCAT 59.557 34.615 0.00 0.00 34.84 4.00
2563 2564 6.539464 CCATACCAATGAAAAATGTTCCCATG 59.461 38.462 0.00 0.00 34.84 3.66
2564 2565 5.565455 ACCAATGAAAAATGTTCCCATGT 57.435 34.783 0.00 0.00 0.00 3.21
2565 2566 5.939447 ACCAATGAAAAATGTTCCCATGTT 58.061 33.333 0.00 0.00 29.30 2.71
2566 2567 6.363882 ACCAATGAAAAATGTTCCCATGTTT 58.636 32.000 0.00 0.00 40.48 2.83
2585 2586 6.856135 TGTTTCAAAACAATGCATGCATAA 57.144 29.167 32.36 18.32 45.17 1.90
2586 2587 6.656945 TGTTTCAAAACAATGCATGCATAAC 58.343 32.000 32.36 26.64 45.17 1.89
2587 2588 6.482641 TGTTTCAAAACAATGCATGCATAACT 59.517 30.769 32.36 15.49 45.17 2.24
2588 2589 7.012138 TGTTTCAAAACAATGCATGCATAACTT 59.988 29.630 32.36 21.15 45.17 2.66
2589 2590 7.493743 TTCAAAACAATGCATGCATAACTTT 57.506 28.000 32.36 24.90 35.31 2.66
2590 2591 8.599055 TTCAAAACAATGCATGCATAACTTTA 57.401 26.923 32.36 14.28 35.31 1.85
2591 2592 8.599055 TCAAAACAATGCATGCATAACTTTAA 57.401 26.923 32.36 15.08 35.31 1.52
2592 2593 9.049523 TCAAAACAATGCATGCATAACTTTAAA 57.950 25.926 32.36 17.76 35.31 1.52
2593 2594 9.320406 CAAAACAATGCATGCATAACTTTAAAG 57.680 29.630 32.36 13.76 35.31 1.85
2594 2595 8.606040 AAACAATGCATGCATAACTTTAAAGT 57.394 26.923 32.36 15.22 36.87 2.66
2595 2596 9.703892 AAACAATGCATGCATAACTTTAAAGTA 57.296 25.926 32.36 10.00 35.24 2.24
2596 2597 9.874205 AACAATGCATGCATAACTTTAAAGTAT 57.126 25.926 32.36 10.13 35.24 2.12
2597 2598 9.304731 ACAATGCATGCATAACTTTAAAGTATG 57.695 29.630 32.36 22.49 35.24 2.39
2598 2599 9.304731 CAATGCATGCATAACTTTAAAGTATGT 57.695 29.630 32.36 9.00 35.24 2.29
2599 2600 8.861033 ATGCATGCATAACTTTAAAGTATGTG 57.139 30.769 31.35 18.44 38.57 3.21
2600 2601 7.825681 TGCATGCATAACTTTAAAGTATGTGT 58.174 30.769 20.83 7.90 38.57 3.72
2601 2602 7.754475 TGCATGCATAACTTTAAAGTATGTGTG 59.246 33.333 20.83 20.90 38.57 3.82
2602 2603 7.754924 GCATGCATAACTTTAAAGTATGTGTGT 59.245 33.333 20.83 6.50 38.57 3.72
2605 2606 9.274206 TGCATAACTTTAAAGTATGTGTGTACA 57.726 29.630 20.83 12.48 38.57 2.90
2606 2607 9.755064 GCATAACTTTAAAGTATGTGTGTACAG 57.245 33.333 20.83 6.20 38.11 2.74
2609 2610 8.726870 AACTTTAAAGTATGTGTGTACAGTGT 57.273 30.769 20.83 0.00 38.11 3.55
2610 2611 9.820725 AACTTTAAAGTATGTGTGTACAGTGTA 57.179 29.630 20.83 0.00 38.11 2.90
2611 2612 9.820725 ACTTTAAAGTATGTGTGTACAGTGTAA 57.179 29.630 19.26 0.00 40.79 2.41
2616 2617 8.671384 AAGTATGTGTGTACAGTGTAATTTGT 57.329 30.769 4.11 0.00 40.79 2.83
2617 2618 8.671384 AGTATGTGTGTACAGTGTAATTTGTT 57.329 30.769 4.11 0.00 40.79 2.83
2618 2619 9.116067 AGTATGTGTGTACAGTGTAATTTGTTT 57.884 29.630 4.11 0.00 40.79 2.83
2619 2620 9.724839 GTATGTGTGTACAGTGTAATTTGTTTT 57.275 29.630 4.11 0.00 40.79 2.43
2621 2622 8.454293 TGTGTGTACAGTGTAATTTGTTTTTG 57.546 30.769 4.11 0.00 31.91 2.44
2622 2623 7.062371 TGTGTGTACAGTGTAATTTGTTTTTGC 59.938 33.333 4.11 0.00 31.91 3.68
2623 2624 7.062371 GTGTGTACAGTGTAATTTGTTTTTGCA 59.938 33.333 4.11 0.00 0.00 4.08
2624 2625 7.761704 TGTGTACAGTGTAATTTGTTTTTGCAT 59.238 29.630 4.11 0.00 0.00 3.96
2625 2626 9.239002 GTGTACAGTGTAATTTGTTTTTGCATA 57.761 29.630 4.11 0.00 0.00 3.14
2626 2627 9.803315 TGTACAGTGTAATTTGTTTTTGCATAA 57.197 25.926 4.11 0.00 0.00 1.90
2629 2630 9.762933 ACAGTGTAATTTGTTTTTGCATAATCT 57.237 25.926 0.00 0.00 0.00 2.40
2688 2689 9.807649 ATTTATCTTAACATGCAAGAATTCCAC 57.192 29.630 12.81 0.00 35.73 4.02
2689 2690 5.295431 TCTTAACATGCAAGAATTCCACG 57.705 39.130 0.65 0.00 0.00 4.94
2690 2691 4.759693 TCTTAACATGCAAGAATTCCACGT 59.240 37.500 0.65 0.00 0.00 4.49
2691 2692 3.559238 AACATGCAAGAATTCCACGTC 57.441 42.857 0.65 0.00 0.00 4.34
2692 2693 2.503331 ACATGCAAGAATTCCACGTCA 58.497 42.857 0.65 0.00 0.00 4.35
2693 2694 3.084039 ACATGCAAGAATTCCACGTCAT 58.916 40.909 0.65 0.00 0.00 3.06
2694 2695 3.127548 ACATGCAAGAATTCCACGTCATC 59.872 43.478 0.65 0.00 0.00 2.92
2695 2696 2.777094 TGCAAGAATTCCACGTCATCA 58.223 42.857 0.65 0.00 0.00 3.07
2696 2697 3.346315 TGCAAGAATTCCACGTCATCAT 58.654 40.909 0.65 0.00 0.00 2.45
2697 2698 4.512484 TGCAAGAATTCCACGTCATCATA 58.488 39.130 0.65 0.00 0.00 2.15
2698 2699 4.332543 TGCAAGAATTCCACGTCATCATAC 59.667 41.667 0.65 0.00 0.00 2.39
2699 2700 4.332543 GCAAGAATTCCACGTCATCATACA 59.667 41.667 0.65 0.00 0.00 2.29
2700 2701 5.163764 GCAAGAATTCCACGTCATCATACAA 60.164 40.000 0.65 0.00 0.00 2.41
2701 2702 6.458751 GCAAGAATTCCACGTCATCATACAAT 60.459 38.462 0.65 0.00 0.00 2.71
2702 2703 7.475015 CAAGAATTCCACGTCATCATACAATT 58.525 34.615 0.65 0.00 0.00 2.32
2703 2704 8.611757 CAAGAATTCCACGTCATCATACAATTA 58.388 33.333 0.65 0.00 0.00 1.40
2704 2705 8.908786 AGAATTCCACGTCATCATACAATTAT 57.091 30.769 0.65 0.00 0.00 1.28
2705 2706 8.777413 AGAATTCCACGTCATCATACAATTATG 58.223 33.333 0.65 0.00 37.08 1.90
2706 2707 6.859420 TTCCACGTCATCATACAATTATGG 57.141 37.500 0.00 0.00 36.47 2.74
2707 2708 6.168270 TCCACGTCATCATACAATTATGGA 57.832 37.500 0.00 0.00 36.47 3.41
2708 2709 6.768483 TCCACGTCATCATACAATTATGGAT 58.232 36.000 0.00 0.00 36.47 3.41
2723 2724 8.598041 ACAATTATGGATGAGATAAGGACTACC 58.402 37.037 0.00 0.00 0.00 3.18
2735 2736 3.059352 AGGACTACCTCAACATGCAAC 57.941 47.619 0.00 0.00 44.13 4.17
2736 2737 2.084546 GGACTACCTCAACATGCAACC 58.915 52.381 0.00 0.00 0.00 3.77
2737 2738 2.552155 GGACTACCTCAACATGCAACCA 60.552 50.000 0.00 0.00 0.00 3.67
2738 2739 3.347216 GACTACCTCAACATGCAACCAT 58.653 45.455 0.00 0.00 0.00 3.55
2755 2756 6.791887 CAACCATGCATCTATCGTTCTATT 57.208 37.500 0.00 0.00 0.00 1.73
2756 2757 7.194607 CAACCATGCATCTATCGTTCTATTT 57.805 36.000 0.00 0.00 0.00 1.40
2757 2758 8.310406 CAACCATGCATCTATCGTTCTATTTA 57.690 34.615 0.00 0.00 0.00 1.40
2758 2759 8.939929 CAACCATGCATCTATCGTTCTATTTAT 58.060 33.333 0.00 0.00 0.00 1.40
2801 2802 7.675270 AACAACACATAATCGAGTATACGTC 57.325 36.000 4.87 0.00 34.70 4.34
2802 2803 6.788243 ACAACACATAATCGAGTATACGTCA 58.212 36.000 4.87 0.00 34.70 4.35
2803 2804 7.423199 ACAACACATAATCGAGTATACGTCAT 58.577 34.615 4.87 0.00 34.70 3.06
2804 2805 8.562052 ACAACACATAATCGAGTATACGTCATA 58.438 33.333 4.87 0.00 34.70 2.15
2805 2806 9.556030 CAACACATAATCGAGTATACGTCATAT 57.444 33.333 4.87 0.00 34.70 1.78
2806 2807 9.556030 AACACATAATCGAGTATACGTCATATG 57.444 33.333 4.87 0.00 34.32 1.78
2807 2808 8.727910 ACACATAATCGAGTATACGTCATATGT 58.272 33.333 4.87 13.66 37.57 2.29
2897 2898 5.622770 AATATATTTCAACCGATTCCCGC 57.377 39.130 0.00 0.00 36.84 6.13
2898 2899 2.404923 TATTTCAACCGATTCCCGCA 57.595 45.000 0.00 0.00 36.84 5.69
2899 2900 1.094785 ATTTCAACCGATTCCCGCAG 58.905 50.000 0.00 0.00 36.84 5.18
2900 2901 0.035598 TTTCAACCGATTCCCGCAGA 59.964 50.000 0.00 0.00 36.84 4.26
2901 2902 0.035598 TTCAACCGATTCCCGCAGAA 59.964 50.000 0.00 0.00 39.32 3.02
2902 2903 0.672401 TCAACCGATTCCCGCAGAAC 60.672 55.000 0.00 0.00 37.29 3.01
2903 2904 1.740296 AACCGATTCCCGCAGAACG 60.740 57.895 0.00 0.00 37.29 3.95
2904 2905 3.564027 CCGATTCCCGCAGAACGC 61.564 66.667 0.00 0.00 41.76 4.84
2913 2914 3.486263 GCAGAACGCGCAGGTATT 58.514 55.556 5.73 0.00 0.00 1.89
2914 2915 2.673074 GCAGAACGCGCAGGTATTA 58.327 52.632 5.73 0.00 0.00 0.98
2915 2916 1.217882 GCAGAACGCGCAGGTATTAT 58.782 50.000 5.73 0.00 0.00 1.28
2916 2917 1.192534 GCAGAACGCGCAGGTATTATC 59.807 52.381 5.73 0.00 0.00 1.75
2917 2918 2.743938 CAGAACGCGCAGGTATTATCT 58.256 47.619 5.73 0.00 0.00 1.98
2918 2919 3.855895 GCAGAACGCGCAGGTATTATCTA 60.856 47.826 5.73 0.00 0.00 1.98
2919 2920 3.914966 CAGAACGCGCAGGTATTATCTAG 59.085 47.826 5.73 0.00 0.00 2.43
2920 2921 3.568853 AGAACGCGCAGGTATTATCTAGT 59.431 43.478 5.73 0.00 0.00 2.57
2921 2922 3.284323 ACGCGCAGGTATTATCTAGTG 57.716 47.619 5.73 0.00 0.00 2.74
2922 2923 2.621998 ACGCGCAGGTATTATCTAGTGT 59.378 45.455 5.73 0.00 0.00 3.55
2923 2924 3.817084 ACGCGCAGGTATTATCTAGTGTA 59.183 43.478 5.73 0.00 0.00 2.90
2924 2925 4.276678 ACGCGCAGGTATTATCTAGTGTAA 59.723 41.667 5.73 0.00 0.00 2.41
2925 2926 5.217393 CGCGCAGGTATTATCTAGTGTAAA 58.783 41.667 8.75 0.00 0.00 2.01
2926 2927 5.688621 CGCGCAGGTATTATCTAGTGTAAAA 59.311 40.000 8.75 0.00 0.00 1.52
2927 2928 6.199531 CGCGCAGGTATTATCTAGTGTAAAAA 59.800 38.462 8.75 0.00 0.00 1.94
2959 2960 9.504708 TTCGTACCATTAAAGAAAATTAGGTGA 57.495 29.630 0.00 0.00 0.00 4.02
2960 2961 9.504708 TCGTACCATTAAAGAAAATTAGGTGAA 57.495 29.630 0.00 0.00 0.00 3.18
2979 2980 7.996385 AGGTGAAACTTTATGGAAATATTCCG 58.004 34.615 4.78 0.00 45.37 4.30
2980 2981 7.614192 AGGTGAAACTTTATGGAAATATTCCGT 59.386 33.333 8.75 8.75 45.37 4.69
2981 2982 7.700656 GGTGAAACTTTATGGAAATATTCCGTG 59.299 37.037 12.94 1.00 45.37 4.94
2993 2994 8.836959 GGAAATATTCCGTGTTTCAAATAGAC 57.163 34.615 0.00 0.00 40.59 2.59
2994 2995 8.455682 GGAAATATTCCGTGTTTCAAATAGACA 58.544 33.333 0.00 0.00 40.59 3.41
3065 3066 7.597643 TTTGCGTAGTTTAAAGAAAATGTCG 57.402 32.000 0.00 0.00 0.00 4.35
3066 3067 6.528014 TGCGTAGTTTAAAGAAAATGTCGA 57.472 33.333 0.00 0.00 0.00 4.20
3067 3068 7.124347 TGCGTAGTTTAAAGAAAATGTCGAT 57.876 32.000 0.00 0.00 0.00 3.59
3068 3069 7.577979 TGCGTAGTTTAAAGAAAATGTCGATT 58.422 30.769 0.00 0.00 0.00 3.34
3069 3070 8.071368 TGCGTAGTTTAAAGAAAATGTCGATTT 58.929 29.630 0.00 0.00 32.87 2.17
3070 3071 8.564766 GCGTAGTTTAAAGAAAATGTCGATTTC 58.435 33.333 2.41 2.41 37.11 2.17
3071 3072 9.047871 CGTAGTTTAAAGAAAATGTCGATTTCC 57.952 33.333 6.40 0.00 37.47 3.13
3072 3073 9.047871 GTAGTTTAAAGAAAATGTCGATTTCCG 57.952 33.333 6.40 0.00 37.47 4.30
3073 3074 7.645402 AGTTTAAAGAAAATGTCGATTTCCGT 58.355 30.769 6.40 0.00 37.47 4.69
3074 3075 8.776470 AGTTTAAAGAAAATGTCGATTTCCGTA 58.224 29.630 6.40 0.00 37.47 4.02
3075 3076 9.384682 GTTTAAAGAAAATGTCGATTTCCGTAA 57.615 29.630 6.40 3.70 37.47 3.18
3076 3077 9.947669 TTTAAAGAAAATGTCGATTTCCGTAAA 57.052 25.926 6.40 8.22 37.47 2.01
3077 3078 9.947669 TTAAAGAAAATGTCGATTTCCGTAAAA 57.052 25.926 6.40 0.00 37.47 1.52
3078 3079 8.859517 AAAGAAAATGTCGATTTCCGTAAAAA 57.140 26.923 6.40 0.00 37.47 1.94
3110 3111 8.459521 TGTGGCATTTTAAAGAAATAATCACG 57.540 30.769 0.00 0.00 0.00 4.35
3111 3112 8.085296 TGTGGCATTTTAAAGAAATAATCACGT 58.915 29.630 0.00 0.00 0.00 4.49
3112 3113 8.372521 GTGGCATTTTAAAGAAATAATCACGTG 58.627 33.333 9.94 9.94 0.00 4.49
3113 3114 8.085296 TGGCATTTTAAAGAAATAATCACGTGT 58.915 29.630 16.51 0.00 0.00 4.49
3114 3115 8.921670 GGCATTTTAAAGAAATAATCACGTGTT 58.078 29.630 16.51 11.56 0.00 3.32
3118 3119 8.716619 TTTAAAGAAATAATCACGTGTTTCCG 57.283 30.769 19.79 0.00 32.43 4.30
3119 3120 4.939509 AGAAATAATCACGTGTTTCCGG 57.060 40.909 19.79 0.00 32.43 5.14
3120 3121 3.126343 AGAAATAATCACGTGTTTCCGGC 59.874 43.478 19.79 8.91 32.43 6.13
3121 3122 2.102070 ATAATCACGTGTTTCCGGCA 57.898 45.000 16.51 0.00 0.00 5.69
3122 3123 1.434555 TAATCACGTGTTTCCGGCAG 58.565 50.000 16.51 0.00 0.00 4.85
3123 3124 0.250124 AATCACGTGTTTCCGGCAGA 60.250 50.000 16.51 0.00 0.00 4.26
3124 3125 0.036388 ATCACGTGTTTCCGGCAGAT 60.036 50.000 16.51 0.00 0.00 2.90
3125 3126 0.948623 TCACGTGTTTCCGGCAGATG 60.949 55.000 16.51 0.00 0.00 2.90
3126 3127 0.948623 CACGTGTTTCCGGCAGATGA 60.949 55.000 7.58 0.00 0.00 2.92
3127 3128 0.949105 ACGTGTTTCCGGCAGATGAC 60.949 55.000 0.00 0.00 0.00 3.06
3128 3129 1.635663 CGTGTTTCCGGCAGATGACC 61.636 60.000 0.00 0.00 0.00 4.02
3129 3130 1.002624 TGTTTCCGGCAGATGACCC 60.003 57.895 0.00 0.00 0.00 4.46
3130 3131 1.299976 GTTTCCGGCAGATGACCCT 59.700 57.895 0.00 0.00 0.00 4.34
3131 3132 1.026718 GTTTCCGGCAGATGACCCTG 61.027 60.000 0.00 0.00 37.23 4.45
3132 3133 1.198094 TTTCCGGCAGATGACCCTGA 61.198 55.000 0.00 0.00 36.29 3.86
3133 3134 1.198094 TTCCGGCAGATGACCCTGAA 61.198 55.000 0.00 0.00 36.29 3.02
3134 3135 1.198094 TCCGGCAGATGACCCTGAAA 61.198 55.000 0.00 0.00 36.29 2.69
3135 3136 0.107017 CCGGCAGATGACCCTGAAAT 60.107 55.000 0.00 0.00 36.29 2.17
3136 3137 1.683011 CCGGCAGATGACCCTGAAATT 60.683 52.381 0.00 0.00 36.29 1.82
3137 3138 2.094675 CGGCAGATGACCCTGAAATTT 58.905 47.619 0.00 0.00 36.29 1.82
3138 3139 2.493278 CGGCAGATGACCCTGAAATTTT 59.507 45.455 0.00 0.00 36.29 1.82
3139 3140 3.056607 CGGCAGATGACCCTGAAATTTTT 60.057 43.478 0.00 0.00 36.29 1.94
3140 3141 4.248058 GGCAGATGACCCTGAAATTTTTG 58.752 43.478 0.00 0.00 36.29 2.44
3141 3142 4.021192 GGCAGATGACCCTGAAATTTTTGA 60.021 41.667 0.00 0.00 36.29 2.69
3142 3143 5.511202 GGCAGATGACCCTGAAATTTTTGAA 60.511 40.000 0.00 0.00 36.29 2.69
3143 3144 5.990996 GCAGATGACCCTGAAATTTTTGAAA 59.009 36.000 0.00 0.00 36.29 2.69
3144 3145 6.482973 GCAGATGACCCTGAAATTTTTGAAAA 59.517 34.615 0.00 0.00 36.29 2.29
3145 3146 7.012232 GCAGATGACCCTGAAATTTTTGAAAAA 59.988 33.333 5.47 5.47 36.29 1.94
3146 3147 9.059260 CAGATGACCCTGAAATTTTTGAAAAAT 57.941 29.630 9.92 9.92 36.29 1.82
3147 3148 9.059260 AGATGACCCTGAAATTTTTGAAAAATG 57.941 29.630 15.79 5.78 0.00 2.32
3148 3149 8.750515 ATGACCCTGAAATTTTTGAAAAATGT 57.249 26.923 15.79 10.96 0.00 2.71
3149 3150 8.572855 TGACCCTGAAATTTTTGAAAAATGTT 57.427 26.923 15.79 11.87 0.00 2.71
3150 3151 9.018582 TGACCCTGAAATTTTTGAAAAATGTTT 57.981 25.926 15.79 8.81 0.00 2.83
3192 3193 6.741448 TGTTTGCGTAGTTTAGAAAAATGC 57.259 33.333 0.00 0.00 0.00 3.56
3193 3194 6.500041 TGTTTGCGTAGTTTAGAAAAATGCT 58.500 32.000 0.00 0.00 0.00 3.79
3194 3195 6.975772 TGTTTGCGTAGTTTAGAAAAATGCTT 59.024 30.769 0.00 0.00 0.00 3.91
3195 3196 7.489757 TGTTTGCGTAGTTTAGAAAAATGCTTT 59.510 29.630 0.00 0.00 0.00 3.51
3196 3197 8.960075 GTTTGCGTAGTTTAGAAAAATGCTTTA 58.040 29.630 0.00 0.00 0.00 1.85
3197 3198 9.685828 TTTGCGTAGTTTAGAAAAATGCTTTAT 57.314 25.926 0.00 0.00 0.00 1.40
3198 3199 9.685828 TTGCGTAGTTTAGAAAAATGCTTTATT 57.314 25.926 0.00 0.00 0.00 1.40
3199 3200 9.123709 TGCGTAGTTTAGAAAAATGCTTTATTG 57.876 29.630 0.00 0.00 0.00 1.90
3200 3201 8.102112 GCGTAGTTTAGAAAAATGCTTTATTGC 58.898 33.333 0.00 0.00 0.00 3.56
3203 3204 8.310406 AGTTTAGAAAAATGCTTTATTGCACC 57.690 30.769 0.00 0.00 46.33 5.01
3204 3205 7.387673 AGTTTAGAAAAATGCTTTATTGCACCC 59.612 33.333 0.00 0.00 46.33 4.61
3205 3206 4.578871 AGAAAAATGCTTTATTGCACCCC 58.421 39.130 0.00 0.00 46.33 4.95
3206 3207 3.348647 AAAATGCTTTATTGCACCCCC 57.651 42.857 0.00 0.00 46.33 5.40
3207 3208 1.949799 AATGCTTTATTGCACCCCCA 58.050 45.000 0.00 0.00 46.33 4.96
3208 3209 1.949799 ATGCTTTATTGCACCCCCAA 58.050 45.000 0.00 0.00 46.33 4.12
3209 3210 1.722034 TGCTTTATTGCACCCCCAAA 58.278 45.000 0.00 0.00 38.12 3.28
3210 3211 2.050144 TGCTTTATTGCACCCCCAAAA 58.950 42.857 0.00 0.00 38.12 2.44
3211 3212 2.439507 TGCTTTATTGCACCCCCAAAAA 59.560 40.909 0.00 0.00 38.12 1.94
3212 3213 3.073650 TGCTTTATTGCACCCCCAAAAAT 59.926 39.130 0.00 0.00 38.12 1.82
3213 3214 3.439825 GCTTTATTGCACCCCCAAAAATG 59.560 43.478 0.00 0.00 0.00 2.32
3214 3215 4.650734 CTTTATTGCACCCCCAAAAATGT 58.349 39.130 0.00 0.00 0.00 2.71
3215 3216 5.799213 CTTTATTGCACCCCCAAAAATGTA 58.201 37.500 0.00 0.00 0.00 2.29
3216 3217 3.694043 ATTGCACCCCCAAAAATGTAC 57.306 42.857 0.00 0.00 0.00 2.90
3217 3218 2.088104 TGCACCCCCAAAAATGTACA 57.912 45.000 0.00 0.00 0.00 2.90
3218 3219 2.398588 TGCACCCCCAAAAATGTACAA 58.601 42.857 0.00 0.00 0.00 2.41
3219 3220 2.103263 TGCACCCCCAAAAATGTACAAC 59.897 45.455 0.00 0.00 0.00 3.32
3220 3221 2.864489 GCACCCCCAAAAATGTACAACG 60.864 50.000 0.00 0.00 0.00 4.10
3221 3222 2.362717 CACCCCCAAAAATGTACAACGT 59.637 45.455 0.00 0.00 0.00 3.99
3222 3223 2.362717 ACCCCCAAAAATGTACAACGTG 59.637 45.455 0.00 0.00 0.00 4.49
3223 3224 2.362717 CCCCCAAAAATGTACAACGTGT 59.637 45.455 0.00 0.00 0.00 4.49
3224 3225 3.568853 CCCCCAAAAATGTACAACGTGTA 59.431 43.478 0.00 0.00 0.00 2.90
3225 3226 4.218852 CCCCCAAAAATGTACAACGTGTAT 59.781 41.667 0.00 0.00 35.05 2.29
3226 3227 5.279056 CCCCCAAAAATGTACAACGTGTATT 60.279 40.000 0.00 0.00 35.05 1.89
3227 3228 6.217294 CCCCAAAAATGTACAACGTGTATTT 58.783 36.000 0.00 0.00 35.05 1.40
3228 3229 6.363896 CCCCAAAAATGTACAACGTGTATTTC 59.636 38.462 0.00 0.00 35.05 2.17
3229 3230 6.087028 CCCAAAAATGTACAACGTGTATTTCG 59.913 38.462 0.00 0.00 35.05 3.46
3230 3231 6.633634 CCAAAAATGTACAACGTGTATTTCGT 59.366 34.615 0.00 0.00 43.45 3.85
3231 3232 7.797587 CCAAAAATGTACAACGTGTATTTCGTA 59.202 33.333 0.00 0.00 40.69 3.43
3232 3233 9.156156 CAAAAATGTACAACGTGTATTTCGTAA 57.844 29.630 0.00 0.00 40.69 3.18
3233 3234 9.713740 AAAAATGTACAACGTGTATTTCGTAAA 57.286 25.926 0.00 0.00 40.69 2.01
3234 3235 9.881529 AAAATGTACAACGTGTATTTCGTAAAT 57.118 25.926 0.00 0.00 40.69 1.40
3235 3236 8.868744 AATGTACAACGTGTATTTCGTAAATG 57.131 30.769 0.00 0.00 40.69 2.32
3236 3237 7.405469 TGTACAACGTGTATTTCGTAAATGT 57.595 32.000 0.00 0.00 40.69 2.71
3237 3238 7.849496 TGTACAACGTGTATTTCGTAAATGTT 58.151 30.769 0.00 0.00 40.69 2.71
3238 3239 8.972349 TGTACAACGTGTATTTCGTAAATGTTA 58.028 29.630 0.00 0.00 40.69 2.41
3239 3240 9.238477 GTACAACGTGTATTTCGTAAATGTTAC 57.762 33.333 0.00 0.00 40.69 2.50
3240 3241 7.290118 ACAACGTGTATTTCGTAAATGTTACC 58.710 34.615 0.00 0.00 40.69 2.85
3241 3242 6.081536 ACGTGTATTTCGTAAATGTTACCG 57.918 37.500 0.00 0.00 39.78 4.02
3242 3243 5.633182 ACGTGTATTTCGTAAATGTTACCGT 59.367 36.000 0.00 0.00 39.78 4.83
3243 3244 5.947519 CGTGTATTTCGTAAATGTTACCGTG 59.052 40.000 0.00 0.00 32.38 4.94
3244 3245 6.399880 CGTGTATTTCGTAAATGTTACCGTGT 60.400 38.462 0.00 0.00 32.38 4.49
3245 3246 7.201308 CGTGTATTTCGTAAATGTTACCGTGTA 60.201 37.037 0.00 0.00 32.38 2.90
3246 3247 8.594687 GTGTATTTCGTAAATGTTACCGTGTAT 58.405 33.333 0.00 0.00 32.38 2.29
3247 3248 9.149225 TGTATTTCGTAAATGTTACCGTGTATT 57.851 29.630 0.00 0.00 32.38 1.89
3248 3249 9.623687 GTATTTCGTAAATGTTACCGTGTATTC 57.376 33.333 0.00 0.00 32.38 1.75
3249 3250 5.930310 TCGTAAATGTTACCGTGTATTCG 57.070 39.130 0.00 0.00 0.00 3.34
3250 3251 5.635866 TCGTAAATGTTACCGTGTATTCGA 58.364 37.500 0.00 0.00 0.00 3.71
3251 3252 6.089476 TCGTAAATGTTACCGTGTATTCGAA 58.911 36.000 0.00 0.00 0.00 3.71
3252 3253 6.584184 TCGTAAATGTTACCGTGTATTCGAAA 59.416 34.615 0.00 0.00 0.00 3.46
3253 3254 7.115520 TCGTAAATGTTACCGTGTATTCGAAAA 59.884 33.333 0.00 0.00 0.00 2.29
3254 3255 7.739477 CGTAAATGTTACCGTGTATTCGAAAAA 59.261 33.333 0.00 0.00 0.00 1.94
3255 3256 9.043678 GTAAATGTTACCGTGTATTCGAAAAAG 57.956 33.333 0.00 0.00 0.00 2.27
3256 3257 6.790285 ATGTTACCGTGTATTCGAAAAAGT 57.210 33.333 0.00 0.00 0.00 2.66
3257 3258 5.976586 TGTTACCGTGTATTCGAAAAAGTG 58.023 37.500 0.00 0.00 0.00 3.16
3258 3259 5.523188 TGTTACCGTGTATTCGAAAAAGTGT 59.477 36.000 0.00 0.00 0.00 3.55
3259 3260 6.036953 TGTTACCGTGTATTCGAAAAAGTGTT 59.963 34.615 0.00 0.00 0.00 3.32
3260 3261 5.086888 ACCGTGTATTCGAAAAAGTGTTC 57.913 39.130 0.00 0.00 0.00 3.18
3261 3262 4.571580 ACCGTGTATTCGAAAAAGTGTTCA 59.428 37.500 0.00 0.00 0.00 3.18
3262 3263 5.064962 ACCGTGTATTCGAAAAAGTGTTCAA 59.935 36.000 0.00 0.00 0.00 2.69
3263 3264 5.966503 CCGTGTATTCGAAAAAGTGTTCAAA 59.033 36.000 0.00 0.00 0.00 2.69
3264 3265 6.075780 CCGTGTATTCGAAAAAGTGTTCAAAC 60.076 38.462 0.00 0.00 0.00 2.93
3265 3266 6.466413 CGTGTATTCGAAAAAGTGTTCAAACA 59.534 34.615 0.00 0.00 36.38 2.83
3266 3267 7.304622 CGTGTATTCGAAAAAGTGTTCAAACAG 60.305 37.037 0.00 0.00 40.05 3.16
3267 3268 7.694784 GTGTATTCGAAAAAGTGTTCAAACAGA 59.305 33.333 0.00 0.00 40.05 3.41
3268 3269 8.402472 TGTATTCGAAAAAGTGTTCAAACAGAT 58.598 29.630 0.00 0.00 40.05 2.90
3269 3270 7.684062 ATTCGAAAAAGTGTTCAAACAGATG 57.316 32.000 0.00 0.00 40.05 2.90
3270 3271 6.429791 TCGAAAAAGTGTTCAAACAGATGA 57.570 33.333 0.00 0.00 40.05 2.92
3271 3272 6.847400 TCGAAAAAGTGTTCAAACAGATGAA 58.153 32.000 0.00 0.00 40.05 2.57
3280 3281 5.766150 TTCAAACAGATGAACCAATCGTT 57.234 34.783 0.00 0.00 34.50 3.85
3281 3282 5.107109 TCAAACAGATGAACCAATCGTTG 57.893 39.130 0.00 0.00 33.74 4.10
3282 3283 4.578516 TCAAACAGATGAACCAATCGTTGT 59.421 37.500 0.00 0.00 33.74 3.32
3283 3284 4.488126 AACAGATGAACCAATCGTTGTG 57.512 40.909 0.00 0.00 33.74 3.33
3284 3285 3.476552 ACAGATGAACCAATCGTTGTGT 58.523 40.909 0.00 0.00 33.74 3.72
3285 3286 3.498397 ACAGATGAACCAATCGTTGTGTC 59.502 43.478 0.00 0.00 33.74 3.67
3286 3287 3.748048 CAGATGAACCAATCGTTGTGTCT 59.252 43.478 0.00 0.00 33.74 3.41
3287 3288 3.748048 AGATGAACCAATCGTTGTGTCTG 59.252 43.478 0.00 0.00 33.74 3.51
3288 3289 2.912771 TGAACCAATCGTTGTGTCTGT 58.087 42.857 0.00 0.00 33.74 3.41
3289 3290 2.611751 TGAACCAATCGTTGTGTCTGTG 59.388 45.455 0.00 0.00 33.74 3.66
3290 3291 0.944386 ACCAATCGTTGTGTCTGTGC 59.056 50.000 0.00 0.00 0.00 4.57
3291 3292 0.238289 CCAATCGTTGTGTCTGTGCC 59.762 55.000 0.00 0.00 0.00 5.01
3292 3293 0.238289 CAATCGTTGTGTCTGTGCCC 59.762 55.000 0.00 0.00 0.00 5.36
3293 3294 0.108585 AATCGTTGTGTCTGTGCCCT 59.891 50.000 0.00 0.00 0.00 5.19
3294 3295 0.973632 ATCGTTGTGTCTGTGCCCTA 59.026 50.000 0.00 0.00 0.00 3.53
3295 3296 0.032952 TCGTTGTGTCTGTGCCCTAC 59.967 55.000 0.00 0.00 0.00 3.18
3296 3297 0.949105 CGTTGTGTCTGTGCCCTACC 60.949 60.000 0.00 0.00 0.00 3.18
3297 3298 0.107831 GTTGTGTCTGTGCCCTACCA 59.892 55.000 0.00 0.00 0.00 3.25
3298 3299 1.064003 TTGTGTCTGTGCCCTACCAT 58.936 50.000 0.00 0.00 0.00 3.55
3299 3300 1.064003 TGTGTCTGTGCCCTACCATT 58.936 50.000 0.00 0.00 0.00 3.16
3300 3301 2.261729 TGTGTCTGTGCCCTACCATTA 58.738 47.619 0.00 0.00 0.00 1.90
3301 3302 2.027561 TGTGTCTGTGCCCTACCATTAC 60.028 50.000 0.00 0.00 0.00 1.89
3302 3303 2.027561 GTGTCTGTGCCCTACCATTACA 60.028 50.000 0.00 0.00 0.00 2.41
3303 3304 2.843730 TGTCTGTGCCCTACCATTACAT 59.156 45.455 0.00 0.00 0.00 2.29
3304 3305 3.118408 TGTCTGTGCCCTACCATTACATC 60.118 47.826 0.00 0.00 0.00 3.06
3305 3306 3.134804 GTCTGTGCCCTACCATTACATCT 59.865 47.826 0.00 0.00 0.00 2.90
3306 3307 3.388024 TCTGTGCCCTACCATTACATCTC 59.612 47.826 0.00 0.00 0.00 2.75
3307 3308 3.111484 TGTGCCCTACCATTACATCTCA 58.889 45.455 0.00 0.00 0.00 3.27
3308 3309 3.716353 TGTGCCCTACCATTACATCTCAT 59.284 43.478 0.00 0.00 0.00 2.90
3309 3310 4.202357 TGTGCCCTACCATTACATCTCATC 60.202 45.833 0.00 0.00 0.00 2.92
3310 3311 4.040952 GTGCCCTACCATTACATCTCATCT 59.959 45.833 0.00 0.00 0.00 2.90
3311 3312 4.660303 TGCCCTACCATTACATCTCATCTT 59.340 41.667 0.00 0.00 0.00 2.40
3312 3313 5.132648 TGCCCTACCATTACATCTCATCTTT 59.867 40.000 0.00 0.00 0.00 2.52
3313 3314 5.471456 GCCCTACCATTACATCTCATCTTTG 59.529 44.000 0.00 0.00 0.00 2.77
3314 3315 6.000219 CCCTACCATTACATCTCATCTTTGG 59.000 44.000 0.00 0.00 0.00 3.28
3315 3316 6.000219 CCTACCATTACATCTCATCTTTGGG 59.000 44.000 0.00 0.00 0.00 4.12
3316 3317 5.715439 ACCATTACATCTCATCTTTGGGA 57.285 39.130 0.00 0.00 36.59 4.37
3317 3318 6.271585 ACCATTACATCTCATCTTTGGGAT 57.728 37.500 0.00 0.00 44.19 3.85
3318 3319 6.676558 ACCATTACATCTCATCTTTGGGATT 58.323 36.000 0.00 0.00 40.28 3.01
3319 3320 6.548622 ACCATTACATCTCATCTTTGGGATTG 59.451 38.462 0.00 0.00 40.28 2.67
3320 3321 6.015688 CCATTACATCTCATCTTTGGGATTGG 60.016 42.308 0.00 0.00 40.28 3.16
3321 3322 4.598036 ACATCTCATCTTTGGGATTGGT 57.402 40.909 0.00 0.00 40.28 3.67
3322 3323 4.275810 ACATCTCATCTTTGGGATTGGTG 58.724 43.478 0.00 0.00 40.28 4.17
3323 3324 4.018141 ACATCTCATCTTTGGGATTGGTGA 60.018 41.667 0.00 0.00 40.28 4.02
3324 3325 4.226427 TCTCATCTTTGGGATTGGTGAG 57.774 45.455 0.00 0.00 31.27 3.51
3325 3326 3.054139 TCTCATCTTTGGGATTGGTGAGG 60.054 47.826 0.00 0.00 31.27 3.86
3326 3327 2.918934 TCATCTTTGGGATTGGTGAGGA 59.081 45.455 0.00 0.00 31.27 3.71
3327 3328 2.879103 TCTTTGGGATTGGTGAGGAC 57.121 50.000 0.00 0.00 0.00 3.85
3328 3329 1.354368 TCTTTGGGATTGGTGAGGACC 59.646 52.381 0.00 0.00 43.48 4.46
3329 3330 0.407918 TTTGGGATTGGTGAGGACCC 59.592 55.000 0.00 0.00 42.34 4.46
3330 3331 0.477597 TTGGGATTGGTGAGGACCCT 60.478 55.000 0.00 0.00 42.34 4.34
3331 3332 0.419865 TGGGATTGGTGAGGACCCTA 59.580 55.000 0.00 0.00 42.34 3.53
3332 3333 1.010793 TGGGATTGGTGAGGACCCTAT 59.989 52.381 0.00 0.00 42.34 2.57
3333 3334 1.421646 GGGATTGGTGAGGACCCTATG 59.578 57.143 0.00 0.00 42.34 2.23
3334 3335 2.408565 GGATTGGTGAGGACCCTATGA 58.591 52.381 0.00 0.00 42.34 2.15
3335 3336 2.982488 GGATTGGTGAGGACCCTATGAT 59.018 50.000 0.00 0.00 42.34 2.45
3336 3337 3.244700 GGATTGGTGAGGACCCTATGATG 60.245 52.174 0.00 0.00 42.34 3.07
3337 3338 1.131638 TGGTGAGGACCCTATGATGC 58.868 55.000 0.00 0.00 42.34 3.91
3338 3339 1.344393 TGGTGAGGACCCTATGATGCT 60.344 52.381 0.00 0.00 42.34 3.79
3339 3340 1.346068 GGTGAGGACCCTATGATGCTC 59.654 57.143 0.00 0.00 36.03 4.26
3340 3341 1.346068 GTGAGGACCCTATGATGCTCC 59.654 57.143 0.00 0.00 32.66 4.70
3341 3342 1.062198 TGAGGACCCTATGATGCTCCA 60.062 52.381 0.00 0.00 32.66 3.86
3342 3343 1.346068 GAGGACCCTATGATGCTCCAC 59.654 57.143 0.00 0.00 0.00 4.02
3343 3344 1.131638 GGACCCTATGATGCTCCACA 58.868 55.000 0.00 0.00 0.00 4.17
3344 3345 1.701847 GGACCCTATGATGCTCCACAT 59.298 52.381 0.00 0.00 43.54 3.21
3360 3361 2.795231 ACATCACTGTGGCTGCTAAT 57.205 45.000 8.11 0.00 33.22 1.73
3361 3362 2.636830 ACATCACTGTGGCTGCTAATC 58.363 47.619 8.11 0.00 33.22 1.75
3362 3363 2.026915 ACATCACTGTGGCTGCTAATCA 60.027 45.455 8.11 0.00 33.22 2.57
3363 3364 2.857186 TCACTGTGGCTGCTAATCAA 57.143 45.000 8.11 0.00 0.00 2.57
3364 3365 3.138884 TCACTGTGGCTGCTAATCAAA 57.861 42.857 8.11 0.00 0.00 2.69
3365 3366 3.485394 TCACTGTGGCTGCTAATCAAAA 58.515 40.909 8.11 0.00 0.00 2.44
3366 3367 4.081406 TCACTGTGGCTGCTAATCAAAAT 58.919 39.130 8.11 0.00 0.00 1.82
3367 3368 4.082625 TCACTGTGGCTGCTAATCAAAATG 60.083 41.667 8.11 0.00 0.00 2.32
3368 3369 3.194116 ACTGTGGCTGCTAATCAAAATGG 59.806 43.478 0.00 0.00 0.00 3.16
3369 3370 2.496871 TGTGGCTGCTAATCAAAATGGG 59.503 45.455 0.00 0.00 0.00 4.00
3370 3371 2.109774 TGGCTGCTAATCAAAATGGGG 58.890 47.619 0.00 0.00 0.00 4.96
3371 3372 2.110578 GGCTGCTAATCAAAATGGGGT 58.889 47.619 0.00 0.00 0.00 4.95
3372 3373 2.101415 GGCTGCTAATCAAAATGGGGTC 59.899 50.000 0.00 0.00 0.00 4.46
3373 3374 2.760092 GCTGCTAATCAAAATGGGGTCA 59.240 45.455 0.00 0.00 0.00 4.02
3374 3375 3.195396 GCTGCTAATCAAAATGGGGTCAA 59.805 43.478 0.00 0.00 0.00 3.18
3375 3376 4.678840 GCTGCTAATCAAAATGGGGTCAAG 60.679 45.833 0.00 0.00 0.00 3.02
3376 3377 3.768757 TGCTAATCAAAATGGGGTCAAGG 59.231 43.478 0.00 0.00 0.00 3.61
3377 3378 3.430790 GCTAATCAAAATGGGGTCAAGGC 60.431 47.826 0.00 0.00 0.00 4.35
3378 3379 1.571955 ATCAAAATGGGGTCAAGGCC 58.428 50.000 0.00 0.00 0.00 5.19
3379 3380 0.189574 TCAAAATGGGGTCAAGGCCA 59.810 50.000 5.01 0.00 0.00 5.36
3380 3381 1.203288 TCAAAATGGGGTCAAGGCCAT 60.203 47.619 5.01 0.00 0.00 4.40
3381 3382 2.043664 TCAAAATGGGGTCAAGGCCATA 59.956 45.455 5.01 0.00 0.00 2.74
3382 3383 2.836981 CAAAATGGGGTCAAGGCCATAA 59.163 45.455 5.01 0.00 0.00 1.90
3383 3384 3.419732 AAATGGGGTCAAGGCCATAAT 57.580 42.857 5.01 0.00 0.00 1.28
3384 3385 2.386829 ATGGGGTCAAGGCCATAATG 57.613 50.000 5.01 0.00 0.00 1.90
3385 3386 1.303898 TGGGGTCAAGGCCATAATGA 58.696 50.000 5.01 0.25 0.00 2.57
3386 3387 1.858910 TGGGGTCAAGGCCATAATGAT 59.141 47.619 5.01 0.00 0.00 2.45
3387 3388 2.247111 TGGGGTCAAGGCCATAATGATT 59.753 45.455 5.01 0.00 0.00 2.57
3388 3389 2.893489 GGGGTCAAGGCCATAATGATTC 59.107 50.000 5.01 1.21 0.00 2.52
3389 3390 3.565307 GGGTCAAGGCCATAATGATTCA 58.435 45.455 5.01 0.00 0.00 2.57
3390 3391 4.154942 GGGTCAAGGCCATAATGATTCAT 58.845 43.478 5.01 0.00 0.00 2.57
3391 3392 5.324409 GGGTCAAGGCCATAATGATTCATA 58.676 41.667 5.01 0.00 0.00 2.15
3392 3393 5.954150 GGGTCAAGGCCATAATGATTCATAT 59.046 40.000 5.01 0.00 0.00 1.78
3393 3394 6.438425 GGGTCAAGGCCATAATGATTCATATT 59.562 38.462 5.01 0.00 0.00 1.28
3394 3395 7.318141 GGTCAAGGCCATAATGATTCATATTG 58.682 38.462 5.01 1.21 0.00 1.90
3395 3396 7.039504 GGTCAAGGCCATAATGATTCATATTGT 60.040 37.037 5.01 0.00 0.00 2.71
3396 3397 8.025445 GTCAAGGCCATAATGATTCATATTGTC 58.975 37.037 5.01 0.00 0.00 3.18
3397 3398 7.946219 TCAAGGCCATAATGATTCATATTGTCT 59.054 33.333 5.01 0.00 0.00 3.41
3398 3399 7.698506 AGGCCATAATGATTCATATTGTCTG 57.301 36.000 5.01 0.00 0.00 3.51
3399 3400 6.662234 AGGCCATAATGATTCATATTGTCTGG 59.338 38.462 5.01 0.00 0.00 3.86
3400 3401 6.127535 GGCCATAATGATTCATATTGTCTGGG 60.128 42.308 0.00 0.00 0.00 4.45
3401 3402 6.660521 GCCATAATGATTCATATTGTCTGGGA 59.339 38.462 0.00 0.00 0.00 4.37
3402 3403 7.177216 GCCATAATGATTCATATTGTCTGGGAA 59.823 37.037 0.00 0.00 0.00 3.97
3403 3404 9.081204 CCATAATGATTCATATTGTCTGGGAAA 57.919 33.333 0.00 0.00 0.00 3.13
3407 3408 7.812690 TGATTCATATTGTCTGGGAAATCTG 57.187 36.000 0.00 0.00 0.00 2.90
3408 3409 6.774170 TGATTCATATTGTCTGGGAAATCTGG 59.226 38.462 0.00 0.00 0.00 3.86
3409 3410 4.464008 TCATATTGTCTGGGAAATCTGGC 58.536 43.478 0.00 0.00 0.00 4.85
3410 3411 4.166725 TCATATTGTCTGGGAAATCTGGCT 59.833 41.667 0.00 0.00 0.00 4.75
3411 3412 2.205022 TTGTCTGGGAAATCTGGCTG 57.795 50.000 0.00 0.00 0.00 4.85
3412 3413 0.329261 TGTCTGGGAAATCTGGCTGG 59.671 55.000 0.00 0.00 0.00 4.85
3413 3414 0.394899 GTCTGGGAAATCTGGCTGGG 60.395 60.000 0.00 0.00 0.00 4.45
3414 3415 0.549902 TCTGGGAAATCTGGCTGGGA 60.550 55.000 0.00 0.00 0.00 4.37
3415 3416 0.394899 CTGGGAAATCTGGCTGGGAC 60.395 60.000 0.00 0.00 0.00 4.46
3416 3417 1.452108 GGGAAATCTGGCTGGGACG 60.452 63.158 0.00 0.00 0.00 4.79
3417 3418 1.299976 GGAAATCTGGCTGGGACGT 59.700 57.895 0.00 0.00 0.00 4.34
3418 3419 0.322546 GGAAATCTGGCTGGGACGTT 60.323 55.000 0.00 0.00 0.00 3.99
3419 3420 1.065709 GGAAATCTGGCTGGGACGTTA 60.066 52.381 0.00 0.00 0.00 3.18
3420 3421 2.421529 GGAAATCTGGCTGGGACGTTAT 60.422 50.000 0.00 0.00 0.00 1.89
3421 3422 3.181458 GGAAATCTGGCTGGGACGTTATA 60.181 47.826 0.00 0.00 0.00 0.98
3422 3423 3.753294 AATCTGGCTGGGACGTTATAG 57.247 47.619 0.00 0.00 0.00 1.31
3423 3424 2.447408 TCTGGCTGGGACGTTATAGA 57.553 50.000 0.00 0.00 0.00 1.98
3424 3425 2.958818 TCTGGCTGGGACGTTATAGAT 58.041 47.619 0.00 0.00 0.00 1.98
3425 3426 2.628178 TCTGGCTGGGACGTTATAGATG 59.372 50.000 0.00 0.00 0.00 2.90
3426 3427 1.691976 TGGCTGGGACGTTATAGATGG 59.308 52.381 0.00 0.00 0.00 3.51
3427 3428 1.968493 GGCTGGGACGTTATAGATGGA 59.032 52.381 0.00 0.00 0.00 3.41
3428 3429 2.567615 GGCTGGGACGTTATAGATGGAT 59.432 50.000 0.00 0.00 0.00 3.41
3429 3430 3.368531 GGCTGGGACGTTATAGATGGATC 60.369 52.174 0.00 0.00 0.00 3.36
3430 3431 3.511934 GCTGGGACGTTATAGATGGATCT 59.488 47.826 0.00 0.00 40.86 2.75
3431 3432 4.021016 GCTGGGACGTTATAGATGGATCTT 60.021 45.833 0.00 0.00 38.32 2.40
3432 3433 5.715070 CTGGGACGTTATAGATGGATCTTC 58.285 45.833 0.00 0.00 38.32 2.87
3433 3434 5.144832 TGGGACGTTATAGATGGATCTTCA 58.855 41.667 0.00 0.00 38.32 3.02
3434 3435 5.600898 TGGGACGTTATAGATGGATCTTCAA 59.399 40.000 0.00 0.00 38.32 2.69
3435 3436 6.159988 GGGACGTTATAGATGGATCTTCAAG 58.840 44.000 0.00 0.00 38.32 3.02
3436 3437 6.015350 GGGACGTTATAGATGGATCTTCAAGA 60.015 42.308 0.00 0.00 38.32 3.02
3437 3438 7.087639 GGACGTTATAGATGGATCTTCAAGAG 58.912 42.308 0.00 0.00 38.32 2.85
3438 3439 7.255660 GGACGTTATAGATGGATCTTCAAGAGT 60.256 40.741 0.00 0.00 38.32 3.24
3439 3440 8.693120 ACGTTATAGATGGATCTTCAAGAGTA 57.307 34.615 0.00 0.00 38.32 2.59
3440 3441 9.132923 ACGTTATAGATGGATCTTCAAGAGTAA 57.867 33.333 0.00 0.00 38.32 2.24
3447 3448 8.986991 AGATGGATCTTCAAGAGTAATACTTGT 58.013 33.333 0.00 0.00 43.30 3.16
3448 3449 9.606631 GATGGATCTTCAAGAGTAATACTTGTT 57.393 33.333 0.00 0.00 43.30 2.83
3451 3452 9.036671 GGATCTTCAAGAGTAATACTTGTTAGC 57.963 37.037 0.00 0.00 43.30 3.09
3452 3453 8.950208 ATCTTCAAGAGTAATACTTGTTAGCC 57.050 34.615 0.00 0.00 43.30 3.93
3453 3454 8.135382 TCTTCAAGAGTAATACTTGTTAGCCT 57.865 34.615 0.00 0.00 43.30 4.58
3454 3455 8.251721 TCTTCAAGAGTAATACTTGTTAGCCTC 58.748 37.037 0.00 0.00 43.30 4.70
3455 3456 7.719871 TCAAGAGTAATACTTGTTAGCCTCT 57.280 36.000 0.00 0.00 43.30 3.69
3456 3457 7.548097 TCAAGAGTAATACTTGTTAGCCTCTG 58.452 38.462 0.00 0.00 43.30 3.35
3457 3458 5.908341 AGAGTAATACTTGTTAGCCTCTGC 58.092 41.667 0.00 0.00 37.95 4.26
3458 3459 5.024785 AGTAATACTTGTTAGCCTCTGCC 57.975 43.478 0.00 0.00 38.69 4.85
3459 3460 2.604046 ATACTTGTTAGCCTCTGCCG 57.396 50.000 0.00 0.00 38.69 5.69
3460 3461 0.108329 TACTTGTTAGCCTCTGCCGC 60.108 55.000 0.00 0.00 38.69 6.53
3461 3462 1.078848 CTTGTTAGCCTCTGCCGCT 60.079 57.895 0.00 0.00 40.45 5.52
3462 3463 1.079127 TTGTTAGCCTCTGCCGCTC 60.079 57.895 0.00 0.00 37.79 5.03
3463 3464 2.583593 GTTAGCCTCTGCCGCTCG 60.584 66.667 0.00 0.00 37.79 5.03
3464 3465 4.514577 TTAGCCTCTGCCGCTCGC 62.515 66.667 0.00 0.00 37.79 5.03
3474 3475 3.782244 CCGCTCGCAGTTGCTCAC 61.782 66.667 2.29 0.00 39.32 3.51
3475 3476 2.736236 CGCTCGCAGTTGCTCACT 60.736 61.111 2.29 0.00 39.32 3.41
3476 3477 2.313172 CGCTCGCAGTTGCTCACTT 61.313 57.895 2.29 0.00 39.32 3.16
3477 3478 1.835483 CGCTCGCAGTTGCTCACTTT 61.835 55.000 2.29 0.00 39.32 2.66
3478 3479 0.110464 GCTCGCAGTTGCTCACTTTC 60.110 55.000 2.29 0.00 39.32 2.62
3479 3480 0.162507 CTCGCAGTTGCTCACTTTCG 59.837 55.000 2.29 0.00 39.32 3.46
3480 3481 0.529773 TCGCAGTTGCTCACTTTCGT 60.530 50.000 2.29 0.00 39.32 3.85
3481 3482 0.383491 CGCAGTTGCTCACTTTCGTG 60.383 55.000 2.29 0.00 39.32 4.35
3482 3483 2.718452 CGCAGTTGCTCACTTTCGTGA 61.718 52.381 2.29 0.00 46.69 4.35
3493 3494 5.147330 TCACTTTCGTGATAACATGAGGT 57.853 39.130 0.00 0.00 44.85 3.85
3494 3495 4.929211 TCACTTTCGTGATAACATGAGGTG 59.071 41.667 16.69 16.69 44.85 4.00
3495 3496 3.684788 ACTTTCGTGATAACATGAGGTGC 59.315 43.478 0.00 0.00 42.04 5.01
3496 3497 3.326836 TTCGTGATAACATGAGGTGCA 57.673 42.857 0.00 0.00 42.04 4.57
3497 3498 3.541996 TCGTGATAACATGAGGTGCAT 57.458 42.857 0.00 0.00 37.16 3.96
3511 3512 7.592885 ATGAGGTGCATGAAATTAAGCTATT 57.407 32.000 0.00 0.00 35.42 1.73
3512 3513 7.031226 TGAGGTGCATGAAATTAAGCTATTC 57.969 36.000 0.00 0.00 0.00 1.75
3513 3514 6.830324 TGAGGTGCATGAAATTAAGCTATTCT 59.170 34.615 0.00 0.00 0.00 2.40
3514 3515 7.012704 TGAGGTGCATGAAATTAAGCTATTCTC 59.987 37.037 0.00 0.00 0.00 2.87
3515 3516 7.059156 AGGTGCATGAAATTAAGCTATTCTCT 58.941 34.615 0.00 0.00 0.00 3.10
3516 3517 8.213679 AGGTGCATGAAATTAAGCTATTCTCTA 58.786 33.333 0.00 0.00 0.00 2.43
3517 3518 8.286097 GGTGCATGAAATTAAGCTATTCTCTAC 58.714 37.037 0.00 0.00 0.00 2.59
3518 3519 8.830580 GTGCATGAAATTAAGCTATTCTCTACA 58.169 33.333 0.00 0.00 0.00 2.74
3519 3520 9.049523 TGCATGAAATTAAGCTATTCTCTACAG 57.950 33.333 0.00 0.00 0.00 2.74
3520 3521 9.265901 GCATGAAATTAAGCTATTCTCTACAGA 57.734 33.333 0.00 0.00 0.00 3.41
3526 3527 9.810545 AATTAAGCTATTCTCTACAGAGTCAAC 57.189 33.333 6.16 0.00 42.60 3.18
3527 3528 5.845391 AGCTATTCTCTACAGAGTCAACC 57.155 43.478 6.16 0.00 42.60 3.77
3528 3529 5.515106 AGCTATTCTCTACAGAGTCAACCT 58.485 41.667 6.16 0.00 42.60 3.50
3529 3530 6.664714 AGCTATTCTCTACAGAGTCAACCTA 58.335 40.000 6.16 0.00 42.60 3.08
3530 3531 6.770785 AGCTATTCTCTACAGAGTCAACCTAG 59.229 42.308 6.16 0.00 42.60 3.02
3531 3532 5.845391 ATTCTCTACAGAGTCAACCTAGC 57.155 43.478 6.16 0.00 42.60 3.42
3532 3533 3.271729 TCTCTACAGAGTCAACCTAGCG 58.728 50.000 6.16 0.00 42.60 4.26
3533 3534 2.356382 CTCTACAGAGTCAACCTAGCGG 59.644 54.545 0.00 0.00 37.40 5.52
3534 3535 1.405821 CTACAGAGTCAACCTAGCGGG 59.594 57.143 0.00 0.00 41.89 6.13
3535 3536 0.251653 ACAGAGTCAACCTAGCGGGA 60.252 55.000 5.79 0.00 38.76 5.14
3536 3537 0.173708 CAGAGTCAACCTAGCGGGAC 59.826 60.000 5.79 0.00 38.76 4.46
3537 3538 0.039911 AGAGTCAACCTAGCGGGACT 59.960 55.000 5.79 7.79 42.90 3.85
3538 3539 0.173708 GAGTCAACCTAGCGGGACTG 59.826 60.000 11.60 3.33 40.48 3.51
3539 3540 1.218316 GTCAACCTAGCGGGACTGG 59.782 63.158 5.79 0.00 38.76 4.00
3540 3541 2.125106 CAACCTAGCGGGACTGGC 60.125 66.667 5.79 0.00 38.76 4.85
3541 3542 2.606519 AACCTAGCGGGACTGGCA 60.607 61.111 5.79 0.00 38.76 4.92
3542 3543 2.221299 AACCTAGCGGGACTGGCAA 61.221 57.895 5.79 0.00 38.76 4.52
3543 3544 2.185310 AACCTAGCGGGACTGGCAAG 62.185 60.000 5.79 0.00 38.76 4.01
3544 3545 2.512515 CTAGCGGGACTGGCAAGC 60.513 66.667 0.00 0.00 0.00 4.01
3545 3546 4.096003 TAGCGGGACTGGCAAGCC 62.096 66.667 3.61 3.61 0.00 4.35
3553 3554 4.659172 CTGGCAAGCCCCGTCCAA 62.659 66.667 8.89 0.00 34.56 3.53
3554 3555 3.944250 CTGGCAAGCCCCGTCCAAT 62.944 63.158 8.89 0.00 34.56 3.16
3555 3556 3.140814 GGCAAGCCCCGTCCAATC 61.141 66.667 0.00 0.00 0.00 2.67
3556 3557 2.044946 GCAAGCCCCGTCCAATCT 60.045 61.111 0.00 0.00 0.00 2.40
3557 3558 2.115291 GCAAGCCCCGTCCAATCTC 61.115 63.158 0.00 0.00 0.00 2.75
3558 3559 1.299648 CAAGCCCCGTCCAATCTCA 59.700 57.895 0.00 0.00 0.00 3.27
3559 3560 0.322456 CAAGCCCCGTCCAATCTCAA 60.322 55.000 0.00 0.00 0.00 3.02
3560 3561 0.404040 AAGCCCCGTCCAATCTCAAA 59.596 50.000 0.00 0.00 0.00 2.69
3561 3562 0.404040 AGCCCCGTCCAATCTCAAAA 59.596 50.000 0.00 0.00 0.00 2.44
3562 3563 1.005924 AGCCCCGTCCAATCTCAAAAT 59.994 47.619 0.00 0.00 0.00 1.82
3563 3564 1.405463 GCCCCGTCCAATCTCAAAATC 59.595 52.381 0.00 0.00 0.00 2.17
3564 3565 1.670811 CCCCGTCCAATCTCAAAATCG 59.329 52.381 0.00 0.00 0.00 3.34
3565 3566 2.627945 CCCGTCCAATCTCAAAATCGA 58.372 47.619 0.00 0.00 0.00 3.59
3566 3567 3.206150 CCCGTCCAATCTCAAAATCGAT 58.794 45.455 0.00 0.00 0.00 3.59
3567 3568 3.248602 CCCGTCCAATCTCAAAATCGATC 59.751 47.826 0.00 0.00 0.00 3.69
3568 3569 4.122776 CCGTCCAATCTCAAAATCGATCT 58.877 43.478 0.00 0.00 0.00 2.75
3569 3570 4.572389 CCGTCCAATCTCAAAATCGATCTT 59.428 41.667 0.00 0.00 0.00 2.40
3570 3571 5.496387 CGTCCAATCTCAAAATCGATCTTG 58.504 41.667 5.04 5.04 0.00 3.02
3571 3572 5.269313 GTCCAATCTCAAAATCGATCTTGC 58.731 41.667 6.59 0.00 0.00 4.01
3572 3573 5.065731 GTCCAATCTCAAAATCGATCTTGCT 59.934 40.000 6.59 0.00 0.00 3.91
3573 3574 6.258727 GTCCAATCTCAAAATCGATCTTGCTA 59.741 38.462 6.59 0.00 0.00 3.49
3574 3575 6.258727 TCCAATCTCAAAATCGATCTTGCTAC 59.741 38.462 6.59 0.00 0.00 3.58
3575 3576 6.037500 CCAATCTCAAAATCGATCTTGCTACA 59.962 38.462 6.59 0.00 0.00 2.74
3576 3577 7.255035 CCAATCTCAAAATCGATCTTGCTACAT 60.255 37.037 6.59 0.00 0.00 2.29
3577 3578 8.768019 CAATCTCAAAATCGATCTTGCTACATA 58.232 33.333 6.59 0.00 0.00 2.29
3578 3579 9.499479 AATCTCAAAATCGATCTTGCTACATAT 57.501 29.630 6.59 0.00 0.00 1.78
3579 3580 8.893219 TCTCAAAATCGATCTTGCTACATATT 57.107 30.769 6.59 0.00 0.00 1.28
3580 3581 9.330063 TCTCAAAATCGATCTTGCTACATATTT 57.670 29.630 6.59 0.00 0.00 1.40
3586 3587 8.764524 ATCGATCTTGCTACATATTTACTTCC 57.235 34.615 0.00 0.00 0.00 3.46
3587 3588 7.952671 TCGATCTTGCTACATATTTACTTCCT 58.047 34.615 0.00 0.00 0.00 3.36
3588 3589 7.867909 TCGATCTTGCTACATATTTACTTCCTG 59.132 37.037 0.00 0.00 0.00 3.86
3589 3590 7.867909 CGATCTTGCTACATATTTACTTCCTGA 59.132 37.037 0.00 0.00 0.00 3.86
3590 3591 9.547753 GATCTTGCTACATATTTACTTCCTGAA 57.452 33.333 0.00 0.00 0.00 3.02
3591 3592 9.905713 ATCTTGCTACATATTTACTTCCTGAAA 57.094 29.630 0.00 0.00 0.00 2.69
3592 3593 9.733556 TCTTGCTACATATTTACTTCCTGAAAA 57.266 29.630 0.00 0.00 0.00 2.29
3593 3594 9.774742 CTTGCTACATATTTACTTCCTGAAAAC 57.225 33.333 0.00 0.00 0.00 2.43
3594 3595 8.276252 TGCTACATATTTACTTCCTGAAAACC 57.724 34.615 0.00 0.00 0.00 3.27
3595 3596 7.885922 TGCTACATATTTACTTCCTGAAAACCA 59.114 33.333 0.00 0.00 0.00 3.67
3596 3597 8.903820 GCTACATATTTACTTCCTGAAAACCAT 58.096 33.333 0.00 0.00 0.00 3.55
3599 3600 8.960591 ACATATTTACTTCCTGAAAACCATCTG 58.039 33.333 0.00 0.00 0.00 2.90
3600 3601 8.960591 CATATTTACTTCCTGAAAACCATCTGT 58.039 33.333 0.00 0.00 0.00 3.41
3601 3602 7.839680 ATTTACTTCCTGAAAACCATCTGTT 57.160 32.000 0.00 0.00 39.43 3.16
3603 3604 8.754991 TTTACTTCCTGAAAACCATCTGTTTA 57.245 30.769 0.00 0.00 46.39 2.01
3604 3605 6.884280 ACTTCCTGAAAACCATCTGTTTAG 57.116 37.500 0.00 0.00 46.39 1.85
3605 3606 6.601332 ACTTCCTGAAAACCATCTGTTTAGA 58.399 36.000 0.00 0.00 46.39 2.10
3606 3607 7.060421 ACTTCCTGAAAACCATCTGTTTAGAA 58.940 34.615 0.00 0.00 46.39 2.10
3607 3608 7.725844 ACTTCCTGAAAACCATCTGTTTAGAAT 59.274 33.333 0.00 0.00 46.39 2.40
3608 3609 7.452880 TCCTGAAAACCATCTGTTTAGAATG 57.547 36.000 0.00 0.00 46.39 2.67
3609 3610 7.004086 TCCTGAAAACCATCTGTTTAGAATGT 58.996 34.615 0.00 0.00 46.39 2.71
3610 3611 7.505585 TCCTGAAAACCATCTGTTTAGAATGTT 59.494 33.333 0.00 0.00 46.39 2.71
3611 3612 7.809806 CCTGAAAACCATCTGTTTAGAATGTTC 59.190 37.037 0.00 0.00 46.39 3.18
3612 3613 8.231692 TGAAAACCATCTGTTTAGAATGTTCA 57.768 30.769 0.00 0.00 46.39 3.18
3613 3614 8.690884 TGAAAACCATCTGTTTAGAATGTTCAA 58.309 29.630 0.00 0.00 46.39 2.69
3614 3615 9.696917 GAAAACCATCTGTTTAGAATGTTCAAT 57.303 29.630 0.00 0.00 46.39 2.57
3616 3617 9.480053 AAACCATCTGTTTAGAATGTTCAATTG 57.520 29.630 0.00 0.00 45.28 2.32
3617 3618 8.408043 ACCATCTGTTTAGAATGTTCAATTGA 57.592 30.769 3.38 3.38 36.32 2.57
3618 3619 8.859090 ACCATCTGTTTAGAATGTTCAATTGAA 58.141 29.630 16.91 16.91 36.32 2.69
3619 3620 9.350357 CCATCTGTTTAGAATGTTCAATTGAAG 57.650 33.333 21.05 5.18 36.32 3.02
3629 3630 9.657419 AGAATGTTCAATTGAAGAAAACAAGTT 57.343 25.926 21.05 9.15 33.92 2.66
3644 3645 9.614792 AGAAAACAAGTTATGACTAGTTTGTCT 57.385 29.630 8.43 0.00 37.79 3.41
3645 3646 9.865484 GAAAACAAGTTATGACTAGTTTGTCTC 57.135 33.333 8.43 5.82 37.79 3.36
3646 3647 7.964604 AACAAGTTATGACTAGTTTGTCTCC 57.035 36.000 8.43 0.00 37.79 3.71
3647 3648 7.304497 ACAAGTTATGACTAGTTTGTCTCCT 57.696 36.000 0.00 0.00 37.79 3.69
3648 3649 8.418597 ACAAGTTATGACTAGTTTGTCTCCTA 57.581 34.615 0.00 0.00 37.79 2.94
3649 3650 8.867097 ACAAGTTATGACTAGTTTGTCTCCTAA 58.133 33.333 0.00 0.00 37.79 2.69
3650 3651 9.706691 CAAGTTATGACTAGTTTGTCTCCTAAA 57.293 33.333 0.00 0.00 37.79 1.85
3656 3657 8.190326 TGACTAGTTTGTCTCCTAAAATCTGA 57.810 34.615 0.00 0.00 37.79 3.27
3657 3658 8.088981 TGACTAGTTTGTCTCCTAAAATCTGAC 58.911 37.037 0.00 0.00 37.79 3.51
3658 3659 7.963532 ACTAGTTTGTCTCCTAAAATCTGACA 58.036 34.615 0.00 0.00 36.10 3.58
3659 3660 8.429641 ACTAGTTTGTCTCCTAAAATCTGACAA 58.570 33.333 0.00 0.00 43.17 3.18
3666 3667 9.965824 TGTCTCCTAAAATCTGACAAAAATTTC 57.034 29.630 0.00 0.00 35.15 2.17
3667 3668 9.118236 GTCTCCTAAAATCTGACAAAAATTTCG 57.882 33.333 0.00 0.00 0.00 3.46
3668 3669 8.846211 TCTCCTAAAATCTGACAAAAATTTCGT 58.154 29.630 0.00 0.00 0.00 3.85
3669 3670 9.463443 CTCCTAAAATCTGACAAAAATTTCGTT 57.537 29.630 0.00 0.00 0.00 3.85
3670 3671 9.243637 TCCTAAAATCTGACAAAAATTTCGTTG 57.756 29.630 0.00 0.00 0.00 4.10
3671 3672 8.003784 CCTAAAATCTGACAAAAATTTCGTTGC 58.996 33.333 3.08 0.00 0.00 4.17
3672 3673 5.559694 AATCTGACAAAAATTTCGTTGCG 57.440 34.783 3.08 0.00 0.00 4.85
3673 3674 4.022464 TCTGACAAAAATTTCGTTGCGT 57.978 36.364 3.08 0.00 0.00 5.24
3674 3675 4.416620 TCTGACAAAAATTTCGTTGCGTT 58.583 34.783 3.08 0.00 0.00 4.84
3675 3676 4.859798 TCTGACAAAAATTTCGTTGCGTTT 59.140 33.333 3.08 0.00 0.00 3.60
3676 3677 4.875697 TGACAAAAATTTCGTTGCGTTTG 58.124 34.783 3.08 0.00 33.31 2.93
3677 3678 4.201628 TGACAAAAATTTCGTTGCGTTTGG 60.202 37.500 3.08 0.00 31.75 3.28
3678 3679 3.062774 ACAAAAATTTCGTTGCGTTTGGG 59.937 39.130 3.08 0.00 31.75 4.12
3679 3680 1.213491 AAATTTCGTTGCGTTTGGGC 58.787 45.000 0.00 0.00 0.00 5.36
3680 3681 0.387565 AATTTCGTTGCGTTTGGGCT 59.612 45.000 0.00 0.00 0.00 5.19
3681 3682 1.240256 ATTTCGTTGCGTTTGGGCTA 58.760 45.000 0.00 0.00 0.00 3.93
3682 3683 1.022735 TTTCGTTGCGTTTGGGCTAA 58.977 45.000 0.00 0.00 0.00 3.09
3683 3684 1.240256 TTCGTTGCGTTTGGGCTAAT 58.760 45.000 0.00 0.00 0.00 1.73
3684 3685 2.096220 TCGTTGCGTTTGGGCTAATA 57.904 45.000 0.00 0.00 0.00 0.98
3685 3686 2.424557 TCGTTGCGTTTGGGCTAATAA 58.575 42.857 0.00 0.00 0.00 1.40
3686 3687 2.812591 TCGTTGCGTTTGGGCTAATAAA 59.187 40.909 0.00 0.00 0.00 1.40
3687 3688 2.912345 CGTTGCGTTTGGGCTAATAAAC 59.088 45.455 0.00 0.00 34.35 2.01
3688 3689 3.609644 CGTTGCGTTTGGGCTAATAAACA 60.610 43.478 0.00 0.00 36.77 2.83
3689 3690 3.840890 TGCGTTTGGGCTAATAAACAG 57.159 42.857 0.00 0.00 36.77 3.16
3690 3691 2.094957 TGCGTTTGGGCTAATAAACAGC 60.095 45.455 0.00 0.00 36.77 4.40
3691 3692 2.163613 GCGTTTGGGCTAATAAACAGCT 59.836 45.455 0.00 0.00 39.09 4.24
3692 3693 3.366985 GCGTTTGGGCTAATAAACAGCTT 60.367 43.478 0.00 0.00 39.09 3.74
3693 3694 4.142556 GCGTTTGGGCTAATAAACAGCTTA 60.143 41.667 0.00 0.00 39.09 3.09
3694 3695 5.449999 GCGTTTGGGCTAATAAACAGCTTAT 60.450 40.000 0.00 0.00 39.09 1.73
3695 3696 5.971202 CGTTTGGGCTAATAAACAGCTTATG 59.029 40.000 0.00 0.00 39.09 1.90
3696 3697 6.183360 CGTTTGGGCTAATAAACAGCTTATGA 60.183 38.462 0.00 0.00 39.09 2.15
3697 3698 6.693315 TTGGGCTAATAAACAGCTTATGAC 57.307 37.500 0.00 0.00 39.09 3.06
3698 3699 5.750524 TGGGCTAATAAACAGCTTATGACA 58.249 37.500 0.00 0.00 39.09 3.58
3699 3700 6.364701 TGGGCTAATAAACAGCTTATGACAT 58.635 36.000 0.00 0.00 39.09 3.06
3700 3701 6.486657 TGGGCTAATAAACAGCTTATGACATC 59.513 38.462 0.00 0.00 39.09 3.06
3701 3702 6.486657 GGGCTAATAAACAGCTTATGACATCA 59.