Multiple sequence alignment - TraesCS1A01G017400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G017400 chr1A 100.000 2783 0 0 1 2783 9193490 9196272 0.000000e+00 5140.0
1 TraesCS1A01G017400 chr1A 97.603 1961 43 2 805 2764 9156162 9158119 0.000000e+00 3358.0
2 TraesCS1A01G017400 chr1A 86.420 405 36 7 1 391 9130312 9130711 2.560000e-115 425.0
3 TraesCS1A01G017400 chr1A 86.441 295 37 3 513 806 9105577 9105285 1.240000e-83 320.0
4 TraesCS1A01G017400 chr1A 84.112 214 25 4 529 735 9130726 9130937 6.080000e-47 198.0
5 TraesCS1A01G017400 chr1A 90.210 143 11 2 2221 2363 568341170 568341031 1.700000e-42 183.0
6 TraesCS1A01G017400 chrUn 98.929 1960 21 0 805 2764 276780498 276778539 0.000000e+00 3504.0
7 TraesCS1A01G017400 chrUn 98.926 1862 20 0 903 2764 278893720 278891859 0.000000e+00 3328.0
8 TraesCS1A01G017400 chrUn 100.000 806 0 0 1 806 276781867 276781062 0.000000e+00 1489.0
9 TraesCS1A01G017400 chrUn 96.774 62 2 0 394 455 29767380 29767319 1.360000e-18 104.0
10 TraesCS1A01G017400 chr1D 96.383 1963 63 5 805 2764 7693896 7695853 0.000000e+00 3225.0
11 TraesCS1A01G017400 chr1D 93.310 1166 73 3 805 1969 7039804 7038643 0.000000e+00 1716.0
12 TraesCS1A01G017400 chr1D 83.546 784 115 11 1260 2036 7755938 7756714 0.000000e+00 721.0
13 TraesCS1A01G017400 chr1D 84.401 359 44 9 455 806 7041143 7040790 2.650000e-90 342.0
14 TraesCS1A01G017400 chr1D 84.459 296 37 4 455 743 7692663 7692956 1.630000e-72 283.0
15 TraesCS1A01G017400 chr1D 83.275 287 40 5 513 795 7042487 7042205 9.890000e-65 257.0
16 TraesCS1A01G017400 chr1D 83.446 296 27 10 513 806 7411886 7411611 3.560000e-64 255.0
17 TraesCS1A01G017400 chr1D 95.522 67 2 1 390 455 204510955 204510889 3.790000e-19 106.0
18 TraesCS1A01G017400 chr1D 91.803 61 5 0 331 391 7692615 7692675 4.940000e-13 86.1
19 TraesCS1A01G017400 chr1B 92.367 1166 81 4 805 1969 9715924 9714766 0.000000e+00 1653.0
20 TraesCS1A01G017400 chr1B 90.633 822 75 2 1149 1969 9673023 9672203 0.000000e+00 1090.0
21 TraesCS1A01G017400 chr1B 85.488 758 101 5 995 1745 9845459 9846214 0.000000e+00 782.0
22 TraesCS1A01G017400 chr1B 82.769 325 50 3 482 806 9843810 9844128 4.540000e-73 285.0
23 TraesCS1A01G017400 chr2B 91.613 155 11 2 2221 2373 523078491 523078337 2.170000e-51 213.0
24 TraesCS1A01G017400 chr2A 88.398 181 13 6 2220 2393 497259511 497259332 7.810000e-51 211.0
25 TraesCS1A01G017400 chr2A 87.778 180 15 7 2221 2393 497257244 497257065 1.310000e-48 204.0
26 TraesCS1A01G017400 chr7B 92.254 142 11 0 2221 2362 697059785 697059926 4.700000e-48 202.0
27 TraesCS1A01G017400 chr7B 91.549 142 12 0 2221 2362 697057707 697057848 2.190000e-46 196.0
28 TraesCS1A01G017400 chr7B 84.940 166 22 2 2220 2385 748666988 748666826 6.170000e-37 165.0
29 TraesCS1A01G017400 chr6B 90.667 150 12 2 2220 2369 706024433 706024580 6.080000e-47 198.0
30 TraesCS1A01G017400 chr6B 90.667 150 12 2 2220 2369 706025225 706025372 6.080000e-47 198.0
31 TraesCS1A01G017400 chr6B 90.667 150 12 2 2220 2369 706230373 706230520 6.080000e-47 198.0
32 TraesCS1A01G017400 chr5D 90.132 152 12 2 2221 2372 545672277 545672425 7.860000e-46 195.0
33 TraesCS1A01G017400 chr5D 92.771 83 6 0 2221 2303 13169397 13169315 1.350000e-23 121.0
34 TraesCS1A01G017400 chr3B 78.541 233 45 4 1073 1304 720178147 720177919 6.210000e-32 148.0
35 TraesCS1A01G017400 chr4B 96.970 66 2 0 390 455 190180712 190180647 8.150000e-21 111.0
36 TraesCS1A01G017400 chr6D 96.721 61 2 0 392 452 456792684 456792744 4.900000e-18 102.0
37 TraesCS1A01G017400 chr3D 95.312 64 3 0 392 455 42769821 42769758 4.900000e-18 102.0
38 TraesCS1A01G017400 chr2D 95.385 65 2 1 391 455 324997835 324997898 4.900000e-18 102.0
39 TraesCS1A01G017400 chr7D 92.754 69 4 1 388 455 185191546 185191614 6.340000e-17 99.0
40 TraesCS1A01G017400 chr6A 87.097 93 5 5 362 452 435338355 435338442 6.340000e-17 99.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G017400 chr1A 9193490 9196272 2782 False 5140.000000 5140 100.000000 1 2783 1 chr1A.!!$F2 2782
1 TraesCS1A01G017400 chr1A 9156162 9158119 1957 False 3358.000000 3358 97.603000 805 2764 1 chr1A.!!$F1 1959
2 TraesCS1A01G017400 chr1A 9130312 9130937 625 False 311.500000 425 85.266000 1 735 2 chr1A.!!$F3 734
3 TraesCS1A01G017400 chrUn 278891859 278893720 1861 True 3328.000000 3328 98.926000 903 2764 1 chrUn.!!$R2 1861
4 TraesCS1A01G017400 chrUn 276778539 276781867 3328 True 2496.500000 3504 99.464500 1 2764 2 chrUn.!!$R3 2763
5 TraesCS1A01G017400 chr1D 7692615 7695853 3238 False 1198.033333 3225 90.881667 331 2764 3 chr1D.!!$F2 2433
6 TraesCS1A01G017400 chr1D 7038643 7042487 3844 True 771.666667 1716 86.995333 455 1969 3 chr1D.!!$R3 1514
7 TraesCS1A01G017400 chr1D 7755938 7756714 776 False 721.000000 721 83.546000 1260 2036 1 chr1D.!!$F1 776
8 TraesCS1A01G017400 chr1B 9714766 9715924 1158 True 1653.000000 1653 92.367000 805 1969 1 chr1B.!!$R2 1164
9 TraesCS1A01G017400 chr1B 9672203 9673023 820 True 1090.000000 1090 90.633000 1149 1969 1 chr1B.!!$R1 820
10 TraesCS1A01G017400 chr1B 9843810 9846214 2404 False 533.500000 782 84.128500 482 1745 2 chr1B.!!$F1 1263
11 TraesCS1A01G017400 chr2A 497257065 497259511 2446 True 207.500000 211 88.088000 2220 2393 2 chr2A.!!$R1 173

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
456 471 0.249322 GATGCATGTGGCCATCTTGC 60.249 55.0 25.6 25.6 43.89 4.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1985 4397 0.401105 CCACCCTCCCTCTCCATGAT 60.401 60.0 0.0 0.0 0.0 2.45 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
456 471 0.249322 GATGCATGTGGCCATCTTGC 60.249 55.000 25.60 25.60 43.89 4.01
487 1425 9.143631 GTTTCTAAATTAGCTGAATGTGCAAAT 57.856 29.630 0.00 0.00 0.00 2.32
901 3281 4.482030 TGCATTGTTATTGCCTCCCATAT 58.518 39.130 0.00 0.00 39.39 1.78
1901 4312 1.531149 GTGTCCCTGTCAAACATGTCG 59.469 52.381 0.00 0.00 0.00 4.35
2000 4415 2.021262 TGCTATCATGGAGAGGGAGG 57.979 55.000 0.00 0.00 0.00 4.30
2424 7114 1.005924 AGTGGGCTGTTTTAGATGGGG 59.994 52.381 0.00 0.00 0.00 4.96
2498 7188 5.674933 AAGCATTAGATTAGCGCCTAAAC 57.325 39.130 2.29 1.26 29.35 2.01
2503 7193 2.662700 AGATTAGCGCCTAAACGATCG 58.337 47.619 14.88 14.88 31.83 3.69
2766 7456 1.794512 GCAAATTGTTTGATGCCGGT 58.205 45.000 1.90 0.00 43.26 5.28
2767 7457 2.142319 GCAAATTGTTTGATGCCGGTT 58.858 42.857 1.90 0.00 43.26 4.44
2768 7458 2.547634 GCAAATTGTTTGATGCCGGTTT 59.452 40.909 1.90 0.00 43.26 3.27
2769 7459 3.363871 GCAAATTGTTTGATGCCGGTTTC 60.364 43.478 1.90 0.37 43.26 2.78
2770 7460 2.741759 ATTGTTTGATGCCGGTTTCC 57.258 45.000 1.90 0.00 0.00 3.13
2771 7461 0.676736 TTGTTTGATGCCGGTTTCCC 59.323 50.000 1.90 0.00 0.00 3.97
2772 7462 0.468214 TGTTTGATGCCGGTTTCCCA 60.468 50.000 1.90 0.00 0.00 4.37
2773 7463 0.894835 GTTTGATGCCGGTTTCCCAT 59.105 50.000 1.90 0.00 0.00 4.00
2774 7464 2.096248 GTTTGATGCCGGTTTCCCATA 58.904 47.619 1.90 0.00 0.00 2.74
2775 7465 2.693074 GTTTGATGCCGGTTTCCCATAT 59.307 45.455 1.90 0.00 0.00 1.78
2776 7466 2.746279 TGATGCCGGTTTCCCATATT 57.254 45.000 1.90 0.00 0.00 1.28
2777 7467 3.866703 TGATGCCGGTTTCCCATATTA 57.133 42.857 1.90 0.00 0.00 0.98
2778 7468 4.171878 TGATGCCGGTTTCCCATATTAA 57.828 40.909 1.90 0.00 0.00 1.40
2779 7469 3.886505 TGATGCCGGTTTCCCATATTAAC 59.113 43.478 1.90 0.00 0.00 2.01
2780 7470 2.657143 TGCCGGTTTCCCATATTAACC 58.343 47.619 1.90 0.00 38.33 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
456 471 7.484007 CACATTCAGCTAATTTAGAAACAGCAG 59.516 37.037 7.63 5.38 33.83 4.24
901 3281 6.659824 TGAGCGTGGAGTGATATATATAGGA 58.340 40.000 0.00 0.00 0.00 2.94
1901 4312 8.292448 CCTTATTCAGTACAATATTCCATGCAC 58.708 37.037 0.00 0.00 0.00 4.57
1985 4397 0.401105 CCACCCTCCCTCTCCATGAT 60.401 60.000 0.00 0.00 0.00 2.45
2000 4415 2.048127 GTGTGCTCTCGGACCACC 60.048 66.667 0.00 0.00 0.00 4.61
2111 4526 7.473511 GCCACAGAGGAGTTATATATCAAAGGT 60.474 40.741 0.00 0.00 41.22 3.50
2289 4706 2.890945 GGATTGGTGTACAAGGCAAGTT 59.109 45.455 0.00 0.00 43.48 2.66
2491 7181 0.997196 AAAGTCGCGATCGTTTAGGC 59.003 50.000 14.06 7.68 36.96 3.93
2498 7188 0.793861 TTGGGAAAAAGTCGCGATCG 59.206 50.000 14.06 11.69 42.09 3.69
2503 7193 1.810755 CCTACCTTGGGAAAAAGTCGC 59.189 52.381 0.00 0.00 39.63 5.19


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.