Multiple sequence alignment - TraesCS1A01G012900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G012900 chr1A 100.000 3857 0 0 1 3857 7276250 7280106 0.000000e+00 7123.0
1 TraesCS1A01G012900 chr1D 85.804 796 104 7 888 1677 6135829 6136621 0.000000e+00 835.0
2 TraesCS1A01G012900 chr1D 85.470 117 17 0 1810 1926 29551583 29551467 5.230000e-24 122.0
3 TraesCS1A01G012900 chr5A 97.436 117 3 0 3741 3857 589355992 589355876 2.350000e-47 200.0
4 TraesCS1A01G012900 chr5A 97.368 38 1 0 3702 3739 589356187 589356150 8.940000e-07 65.8
5 TraesCS1A01G012900 chr5A 90.476 42 1 3 2291 2329 8245245 8245204 7.000000e-03 52.8
6 TraesCS1A01G012900 chr2A 97.436 117 3 0 3741 3857 118234293 118234177 2.350000e-47 200.0
7 TraesCS1A01G012900 chr2A 94.017 117 7 0 3741 3857 118245799 118245915 1.100000e-40 178.0
8 TraesCS1A01G012900 chr2A 100.000 42 0 0 3698 3739 118245600 118245641 1.150000e-10 78.7
9 TraesCS1A01G012900 chr2A 100.000 40 0 0 3700 3739 118234490 118234451 1.490000e-09 75.0
10 TraesCS1A01G012900 chr2A 93.478 46 2 1 1825 1870 738037915 738037871 2.490000e-07 67.6
11 TraesCS1A01G012900 chr2A 94.872 39 2 0 3698 3736 714027839 714027801 1.160000e-05 62.1
12 TraesCS1A01G012900 chr7B 78.715 249 48 5 162 406 549360023 549359776 1.110000e-35 161.0
13 TraesCS1A01G012900 chr3A 78.214 280 32 14 420 696 614608203 614607950 6.670000e-33 152.0
14 TraesCS1A01G012900 chr4B 86.885 122 16 0 241 362 617326090 617326211 1.870000e-28 137.0
15 TraesCS1A01G012900 chr2B 83.871 124 13 6 3741 3857 37296566 37296689 1.130000e-20 111.0
16 TraesCS1A01G012900 chr6D 77.483 151 24 6 1810 1956 47947097 47947241 8.880000e-12 82.4
17 TraesCS1A01G012900 chr6B 100.000 42 0 0 3698 3739 697734360 697734319 1.150000e-10 78.7
18 TraesCS1A01G012900 chr3B 97.561 41 1 0 3699 3739 809342192 809342152 1.920000e-08 71.3
19 TraesCS1A01G012900 chr3B 92.857 42 3 0 3698 3739 37243056 37243097 1.160000e-05 62.1
20 TraesCS1A01G012900 chr5B 95.122 41 2 0 3699 3739 36549817 36549777 8.940000e-07 65.8
21 TraesCS1A01G012900 chr1B 97.368 38 1 0 3699 3736 678869205 678869242 8.940000e-07 65.8
22 TraesCS1A01G012900 chr3D 100.000 29 0 0 1825 1853 600639906 600639878 2.000000e-03 54.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G012900 chr1A 7276250 7280106 3856 False 7123 7123 100.000 1 3857 1 chr1A.!!$F1 3856
1 TraesCS1A01G012900 chr1D 6135829 6136621 792 False 835 835 85.804 888 1677 1 chr1D.!!$F1 789


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
399 400 0.032912 ATGGCATGCCTCCAATGTCA 60.033 50.0 35.53 14.13 37.13 3.58 F
1050 1054 0.036010 ATGGCTTCTTGGTCCTCACG 60.036 55.0 0.00 0.00 0.00 4.35 F
2312 2316 0.107993 TGAAATCGGCAGAGCTCCTG 60.108 55.0 10.93 9.35 45.67 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2237 2241 0.037303 TCACGTCCTAGTCGAGGGTT 59.963 55.0 10.69 0.0 46.7 4.11 R
2450 2454 0.036164 AACAGAAGTGGCCGCACATA 59.964 50.0 20.59 0.0 0.0 2.29 R
3539 3543 0.028770 CGTCACACATGGTTGCGTTT 59.971 50.0 0.00 0.0 0.0 3.60 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 4.577834 TCTGAGTCACGTCATTGTTACA 57.422 40.909 0.00 0.00 0.00 2.41
25 26 5.134202 TCTGAGTCACGTCATTGTTACAT 57.866 39.130 0.00 0.00 0.00 2.29
26 27 5.538118 TCTGAGTCACGTCATTGTTACATT 58.462 37.500 0.00 0.00 0.00 2.71
27 28 5.633601 TCTGAGTCACGTCATTGTTACATTC 59.366 40.000 0.00 0.00 0.00 2.67
28 29 5.293560 TGAGTCACGTCATTGTTACATTCA 58.706 37.500 0.00 0.00 0.00 2.57
29 30 5.931724 TGAGTCACGTCATTGTTACATTCAT 59.068 36.000 0.00 0.00 0.00 2.57
30 31 6.090763 TGAGTCACGTCATTGTTACATTCATC 59.909 38.462 0.00 0.00 0.00 2.92
31 32 6.166279 AGTCACGTCATTGTTACATTCATCT 58.834 36.000 0.00 0.00 0.00 2.90
32 33 6.650807 AGTCACGTCATTGTTACATTCATCTT 59.349 34.615 0.00 0.00 0.00 2.40
33 34 6.955963 GTCACGTCATTGTTACATTCATCTTC 59.044 38.462 0.00 0.00 0.00 2.87
34 35 6.092122 TCACGTCATTGTTACATTCATCTTCC 59.908 38.462 0.00 0.00 0.00 3.46
35 36 6.092670 CACGTCATTGTTACATTCATCTTCCT 59.907 38.462 0.00 0.00 0.00 3.36
36 37 6.313905 ACGTCATTGTTACATTCATCTTCCTC 59.686 38.462 0.00 0.00 0.00 3.71
37 38 6.536582 CGTCATTGTTACATTCATCTTCCTCT 59.463 38.462 0.00 0.00 0.00 3.69
38 39 7.065085 CGTCATTGTTACATTCATCTTCCTCTT 59.935 37.037 0.00 0.00 0.00 2.85
39 40 8.734386 GTCATTGTTACATTCATCTTCCTCTTT 58.266 33.333 0.00 0.00 0.00 2.52
40 41 9.300681 TCATTGTTACATTCATCTTCCTCTTTT 57.699 29.630 0.00 0.00 0.00 2.27
41 42 9.918630 CATTGTTACATTCATCTTCCTCTTTTT 57.081 29.630 0.00 0.00 0.00 1.94
42 43 9.918630 ATTGTTACATTCATCTTCCTCTTTTTG 57.081 29.630 0.00 0.00 0.00 2.44
43 44 8.463930 TGTTACATTCATCTTCCTCTTTTTGT 57.536 30.769 0.00 0.00 0.00 2.83
44 45 9.567776 TGTTACATTCATCTTCCTCTTTTTGTA 57.432 29.630 0.00 0.00 0.00 2.41
86 87 9.461312 AAAATCTGTATGTAATTTGTCTAGCCA 57.539 29.630 0.00 0.00 0.00 4.75
87 88 9.632638 AAATCTGTATGTAATTTGTCTAGCCAT 57.367 29.630 0.00 0.00 0.00 4.40
148 149 7.724305 AGTATTCGTCTAAAAAGCTGTTTGA 57.276 32.000 12.37 4.95 0.00 2.69
149 150 8.324163 AGTATTCGTCTAAAAAGCTGTTTGAT 57.676 30.769 12.37 0.10 0.00 2.57
150 151 9.431887 AGTATTCGTCTAAAAAGCTGTTTGATA 57.568 29.630 12.37 0.00 0.00 2.15
151 152 9.474249 GTATTCGTCTAAAAAGCTGTTTGATAC 57.526 33.333 12.37 6.36 0.00 2.24
152 153 7.724305 TTCGTCTAAAAAGCTGTTTGATACT 57.276 32.000 12.37 0.00 0.00 2.12
153 154 7.724305 TCGTCTAAAAAGCTGTTTGATACTT 57.276 32.000 12.37 0.00 0.00 2.24
154 155 8.821147 TCGTCTAAAAAGCTGTTTGATACTTA 57.179 30.769 12.37 0.00 0.00 2.24
155 156 9.431887 TCGTCTAAAAAGCTGTTTGATACTTAT 57.568 29.630 12.37 0.00 0.00 1.73
170 171 9.826574 TTTGATACTTATATAACCTTTGAGCGT 57.173 29.630 0.00 0.00 0.00 5.07
171 172 8.812147 TGATACTTATATAACCTTTGAGCGTG 57.188 34.615 0.00 0.00 0.00 5.34
172 173 7.870954 TGATACTTATATAACCTTTGAGCGTGG 59.129 37.037 0.00 0.00 0.00 4.94
173 174 6.229936 ACTTATATAACCTTTGAGCGTGGA 57.770 37.500 0.00 0.00 0.00 4.02
174 175 6.281405 ACTTATATAACCTTTGAGCGTGGAG 58.719 40.000 0.00 0.00 0.00 3.86
175 176 2.403252 ATAACCTTTGAGCGTGGAGG 57.597 50.000 0.00 0.00 35.39 4.30
176 177 0.323629 TAACCTTTGAGCGTGGAGGG 59.676 55.000 4.65 0.00 33.51 4.30
177 178 2.045926 CCTTTGAGCGTGGAGGGG 60.046 66.667 0.00 0.00 0.00 4.79
178 179 2.747855 CTTTGAGCGTGGAGGGGC 60.748 66.667 0.00 0.00 0.00 5.80
179 180 3.551496 CTTTGAGCGTGGAGGGGCA 62.551 63.158 0.00 0.00 0.00 5.36
180 181 3.551496 TTTGAGCGTGGAGGGGCAG 62.551 63.158 0.00 0.00 0.00 4.85
185 186 4.697756 CGTGGAGGGGCAGCGAAA 62.698 66.667 0.00 0.00 0.00 3.46
186 187 2.747855 GTGGAGGGGCAGCGAAAG 60.748 66.667 0.00 0.00 0.00 2.62
187 188 4.033776 TGGAGGGGCAGCGAAAGG 62.034 66.667 0.00 0.00 0.00 3.11
188 189 4.803908 GGAGGGGCAGCGAAAGGG 62.804 72.222 0.00 0.00 0.00 3.95
189 190 3.717294 GAGGGGCAGCGAAAGGGA 61.717 66.667 0.00 0.00 0.00 4.20
190 191 3.978571 GAGGGGCAGCGAAAGGGAC 62.979 68.421 0.00 0.00 0.00 4.46
192 193 4.344865 GGGCAGCGAAAGGGACCA 62.345 66.667 0.00 0.00 0.00 4.02
193 194 2.282180 GGCAGCGAAAGGGACCAA 60.282 61.111 0.00 0.00 0.00 3.67
194 195 1.901464 GGCAGCGAAAGGGACCAAA 60.901 57.895 0.00 0.00 0.00 3.28
195 196 1.460273 GGCAGCGAAAGGGACCAAAA 61.460 55.000 0.00 0.00 0.00 2.44
196 197 0.603065 GCAGCGAAAGGGACCAAAAT 59.397 50.000 0.00 0.00 0.00 1.82
197 198 1.816224 GCAGCGAAAGGGACCAAAATA 59.184 47.619 0.00 0.00 0.00 1.40
198 199 2.159379 GCAGCGAAAGGGACCAAAATAG 60.159 50.000 0.00 0.00 0.00 1.73
199 200 3.081804 CAGCGAAAGGGACCAAAATAGT 58.918 45.455 0.00 0.00 0.00 2.12
200 201 4.258543 CAGCGAAAGGGACCAAAATAGTA 58.741 43.478 0.00 0.00 0.00 1.82
201 202 4.698304 CAGCGAAAGGGACCAAAATAGTAA 59.302 41.667 0.00 0.00 0.00 2.24
202 203 4.941873 AGCGAAAGGGACCAAAATAGTAAG 59.058 41.667 0.00 0.00 0.00 2.34
203 204 4.438336 GCGAAAGGGACCAAAATAGTAAGC 60.438 45.833 0.00 0.00 0.00 3.09
204 205 4.941873 CGAAAGGGACCAAAATAGTAAGCT 59.058 41.667 0.00 0.00 0.00 3.74
205 206 6.110707 CGAAAGGGACCAAAATAGTAAGCTA 58.889 40.000 0.00 0.00 0.00 3.32
206 207 6.258068 CGAAAGGGACCAAAATAGTAAGCTAG 59.742 42.308 0.00 0.00 0.00 3.42
207 208 6.886178 AAGGGACCAAAATAGTAAGCTAGA 57.114 37.500 0.00 0.00 0.00 2.43
208 209 7.453141 AAGGGACCAAAATAGTAAGCTAGAT 57.547 36.000 0.00 0.00 0.00 1.98
209 210 7.068686 AGGGACCAAAATAGTAAGCTAGATC 57.931 40.000 0.00 0.00 0.00 2.75
210 211 6.847036 AGGGACCAAAATAGTAAGCTAGATCT 59.153 38.462 0.00 0.00 0.00 2.75
211 212 7.348537 AGGGACCAAAATAGTAAGCTAGATCTT 59.651 37.037 0.00 0.00 0.00 2.40
212 213 7.658167 GGGACCAAAATAGTAAGCTAGATCTTC 59.342 40.741 0.00 0.00 0.00 2.87
213 214 8.204836 GGACCAAAATAGTAAGCTAGATCTTCA 58.795 37.037 0.00 0.00 0.00 3.02
214 215 8.950208 ACCAAAATAGTAAGCTAGATCTTCAC 57.050 34.615 0.00 0.00 0.00 3.18
215 216 8.540388 ACCAAAATAGTAAGCTAGATCTTCACA 58.460 33.333 0.00 0.00 0.00 3.58
216 217 9.383519 CCAAAATAGTAAGCTAGATCTTCACAA 57.616 33.333 0.00 0.00 0.00 3.33
226 227 8.934507 AGCTAGATCTTCACAAGTATTACAAC 57.065 34.615 0.00 0.00 0.00 3.32
227 228 8.531982 AGCTAGATCTTCACAAGTATTACAACA 58.468 33.333 0.00 0.00 0.00 3.33
228 229 9.151471 GCTAGATCTTCACAAGTATTACAACAA 57.849 33.333 0.00 0.00 0.00 2.83
231 232 9.337396 AGATCTTCACAAGTATTACAACAAACA 57.663 29.630 0.00 0.00 0.00 2.83
232 233 9.382244 GATCTTCACAAGTATTACAACAAACAC 57.618 33.333 0.00 0.00 0.00 3.32
233 234 7.699566 TCTTCACAAGTATTACAACAAACACC 58.300 34.615 0.00 0.00 0.00 4.16
234 235 7.554835 TCTTCACAAGTATTACAACAAACACCT 59.445 33.333 0.00 0.00 0.00 4.00
235 236 7.633193 TCACAAGTATTACAACAAACACCTT 57.367 32.000 0.00 0.00 0.00 3.50
236 237 7.476667 TCACAAGTATTACAACAAACACCTTG 58.523 34.615 0.00 0.00 41.19 3.61
247 248 4.776349 ACAAACACCTTGTGTCATGTAGA 58.224 39.130 13.68 0.00 46.79 2.59
248 249 5.189928 ACAAACACCTTGTGTCATGTAGAA 58.810 37.500 13.68 0.00 46.79 2.10
249 250 5.650266 ACAAACACCTTGTGTCATGTAGAAA 59.350 36.000 13.68 0.00 46.79 2.52
250 251 6.151985 ACAAACACCTTGTGTCATGTAGAAAA 59.848 34.615 13.68 0.00 46.79 2.29
251 252 6.959639 AACACCTTGTGTCATGTAGAAAAT 57.040 33.333 0.00 0.00 46.79 1.82
252 253 6.560253 ACACCTTGTGTCATGTAGAAAATC 57.440 37.500 0.00 0.00 43.92 2.17
253 254 6.299141 ACACCTTGTGTCATGTAGAAAATCT 58.701 36.000 0.00 0.00 43.92 2.40
254 255 6.205464 ACACCTTGTGTCATGTAGAAAATCTG 59.795 38.462 0.00 0.00 43.92 2.90
255 256 6.427853 CACCTTGTGTCATGTAGAAAATCTGA 59.572 38.462 0.00 0.00 0.00 3.27
256 257 6.998074 ACCTTGTGTCATGTAGAAAATCTGAA 59.002 34.615 0.00 0.00 0.00 3.02
257 258 7.041098 ACCTTGTGTCATGTAGAAAATCTGAAC 60.041 37.037 0.00 0.00 0.00 3.18
258 259 6.801539 TGTGTCATGTAGAAAATCTGAACC 57.198 37.500 0.00 0.00 0.00 3.62
259 260 6.295249 TGTGTCATGTAGAAAATCTGAACCA 58.705 36.000 0.00 0.00 0.00 3.67
260 261 6.942005 TGTGTCATGTAGAAAATCTGAACCAT 59.058 34.615 0.00 0.00 0.00 3.55
261 262 8.100164 TGTGTCATGTAGAAAATCTGAACCATA 58.900 33.333 0.00 0.00 0.00 2.74
262 263 9.113838 GTGTCATGTAGAAAATCTGAACCATAT 57.886 33.333 0.00 0.00 0.00 1.78
263 264 9.330063 TGTCATGTAGAAAATCTGAACCATATC 57.670 33.333 0.00 0.00 0.00 1.63
264 265 9.330063 GTCATGTAGAAAATCTGAACCATATCA 57.670 33.333 0.00 0.00 0.00 2.15
268 269 9.904198 TGTAGAAAATCTGAACCATATCATGAA 57.096 29.630 0.00 0.00 0.00 2.57
272 273 9.688592 GAAAATCTGAACCATATCATGAAATCC 57.311 33.333 0.00 0.00 0.00 3.01
273 274 8.771521 AAATCTGAACCATATCATGAAATCCA 57.228 30.769 0.00 0.00 0.00 3.41
274 275 7.756395 ATCTGAACCATATCATGAAATCCAC 57.244 36.000 0.00 0.00 0.00 4.02
275 276 6.661777 TCTGAACCATATCATGAAATCCACA 58.338 36.000 0.00 0.00 0.00 4.17
276 277 7.118060 TCTGAACCATATCATGAAATCCACAA 58.882 34.615 0.00 0.00 0.00 3.33
277 278 7.283807 TCTGAACCATATCATGAAATCCACAAG 59.716 37.037 0.00 0.00 0.00 3.16
278 279 6.891361 TGAACCATATCATGAAATCCACAAGT 59.109 34.615 0.00 0.00 0.00 3.16
279 280 8.052141 TGAACCATATCATGAAATCCACAAGTA 58.948 33.333 0.00 0.00 0.00 2.24
280 281 9.071276 GAACCATATCATGAAATCCACAAGTAT 57.929 33.333 0.00 0.00 0.00 2.12
281 282 8.627208 ACCATATCATGAAATCCACAAGTATC 57.373 34.615 0.00 0.00 0.00 2.24
282 283 8.219868 ACCATATCATGAAATCCACAAGTATCA 58.780 33.333 0.00 0.00 0.00 2.15
283 284 9.070179 CCATATCATGAAATCCACAAGTATCAA 57.930 33.333 0.00 0.00 0.00 2.57
291 292 9.473007 TGAAATCCACAAGTATCAAATTATCCA 57.527 29.630 0.00 0.00 0.00 3.41
301 302 9.812347 AAGTATCAAATTATCCAATATCTGCCA 57.188 29.630 0.00 0.00 0.00 4.92
302 303 9.236006 AGTATCAAATTATCCAATATCTGCCAC 57.764 33.333 0.00 0.00 0.00 5.01
303 304 9.013229 GTATCAAATTATCCAATATCTGCCACA 57.987 33.333 0.00 0.00 0.00 4.17
304 305 7.514784 TCAAATTATCCAATATCTGCCACAG 57.485 36.000 0.00 0.00 0.00 3.66
305 306 5.972107 AATTATCCAATATCTGCCACAGC 57.028 39.130 0.00 0.00 40.48 4.40
326 327 5.747951 GCAATATACTTGCAAGAGAAGCT 57.252 39.130 32.50 11.72 44.34 3.74
327 328 5.746539 GCAATATACTTGCAAGAGAAGCTC 58.253 41.667 32.50 12.31 44.34 4.09
328 329 5.557893 GCAATATACTTGCAAGAGAAGCTCG 60.558 44.000 32.50 13.78 44.34 5.03
329 330 1.714794 TACTTGCAAGAGAAGCTCGC 58.285 50.000 32.50 0.00 35.36 5.03
330 331 0.034616 ACTTGCAAGAGAAGCTCGCT 59.965 50.000 32.50 3.08 35.36 4.93
331 332 1.273606 ACTTGCAAGAGAAGCTCGCTA 59.726 47.619 32.50 0.00 35.36 4.26
332 333 1.658095 CTTGCAAGAGAAGCTCGCTAC 59.342 52.381 22.31 0.00 35.36 3.58
333 334 0.603065 TGCAAGAGAAGCTCGCTACA 59.397 50.000 0.00 0.00 35.36 2.74
334 335 1.000843 TGCAAGAGAAGCTCGCTACAA 59.999 47.619 0.00 0.00 35.36 2.41
335 336 2.275318 GCAAGAGAAGCTCGCTACAAT 58.725 47.619 0.00 0.00 35.36 2.71
336 337 3.119137 TGCAAGAGAAGCTCGCTACAATA 60.119 43.478 0.00 0.00 35.36 1.90
337 338 4.054671 GCAAGAGAAGCTCGCTACAATAT 58.945 43.478 0.00 0.00 35.36 1.28
338 339 4.509600 GCAAGAGAAGCTCGCTACAATATT 59.490 41.667 0.00 0.00 35.36 1.28
339 340 5.692204 GCAAGAGAAGCTCGCTACAATATTA 59.308 40.000 0.00 0.00 35.36 0.98
340 341 6.201044 GCAAGAGAAGCTCGCTACAATATTAA 59.799 38.462 0.00 0.00 35.36 1.40
341 342 7.095439 GCAAGAGAAGCTCGCTACAATATTAAT 60.095 37.037 0.00 0.00 35.36 1.40
342 343 9.411801 CAAGAGAAGCTCGCTACAATATTAATA 57.588 33.333 0.00 0.00 35.36 0.98
343 344 8.973835 AGAGAAGCTCGCTACAATATTAATAC 57.026 34.615 0.00 0.00 35.36 1.89
344 345 8.030106 AGAGAAGCTCGCTACAATATTAATACC 58.970 37.037 0.00 0.00 35.36 2.73
345 346 7.097834 AGAAGCTCGCTACAATATTAATACCC 58.902 38.462 0.00 0.00 0.00 3.69
346 347 5.731591 AGCTCGCTACAATATTAATACCCC 58.268 41.667 0.00 0.00 0.00 4.95
347 348 5.247564 AGCTCGCTACAATATTAATACCCCA 59.752 40.000 0.00 0.00 0.00 4.96
348 349 5.935789 GCTCGCTACAATATTAATACCCCAA 59.064 40.000 0.00 0.00 0.00 4.12
349 350 6.128363 GCTCGCTACAATATTAATACCCCAAC 60.128 42.308 0.00 0.00 0.00 3.77
350 351 6.828788 TCGCTACAATATTAATACCCCAACA 58.171 36.000 0.00 0.00 0.00 3.33
351 352 7.455058 TCGCTACAATATTAATACCCCAACAT 58.545 34.615 0.00 0.00 0.00 2.71
352 353 8.595421 TCGCTACAATATTAATACCCCAACATA 58.405 33.333 0.00 0.00 0.00 2.29
353 354 9.221933 CGCTACAATATTAATACCCCAACATAA 57.778 33.333 0.00 0.00 0.00 1.90
362 363 9.653516 ATTAATACCCCAACATAATCATCAACA 57.346 29.630 0.00 0.00 0.00 3.33
363 364 9.653516 TTAATACCCCAACATAATCATCAACAT 57.346 29.630 0.00 0.00 0.00 2.71
364 365 7.765695 ATACCCCAACATAATCATCAACATC 57.234 36.000 0.00 0.00 0.00 3.06
365 366 5.769835 ACCCCAACATAATCATCAACATCT 58.230 37.500 0.00 0.00 0.00 2.90
366 367 5.595542 ACCCCAACATAATCATCAACATCTG 59.404 40.000 0.00 0.00 0.00 2.90
367 368 5.829391 CCCCAACATAATCATCAACATCTGA 59.171 40.000 0.00 0.00 38.81 3.27
368 369 6.321945 CCCCAACATAATCATCAACATCTGAA 59.678 38.462 0.00 0.00 37.67 3.02
369 370 7.423199 CCCAACATAATCATCAACATCTGAAG 58.577 38.462 0.00 0.00 37.67 3.02
370 371 7.423199 CCAACATAATCATCAACATCTGAAGG 58.577 38.462 0.00 0.00 37.67 3.46
371 372 7.283807 CCAACATAATCATCAACATCTGAAGGA 59.716 37.037 0.00 0.00 37.67 3.36
372 373 8.680001 CAACATAATCATCAACATCTGAAGGAA 58.320 33.333 0.00 0.00 37.67 3.36
373 374 8.218338 ACATAATCATCAACATCTGAAGGAAC 57.782 34.615 0.00 0.00 37.67 3.62
375 376 6.998968 AATCATCAACATCTGAAGGAACTC 57.001 37.500 0.00 0.00 38.49 3.01
376 377 5.488262 TCATCAACATCTGAAGGAACTCA 57.512 39.130 0.00 0.00 38.49 3.41
377 378 6.058553 TCATCAACATCTGAAGGAACTCAT 57.941 37.500 0.00 0.00 38.49 2.90
378 379 5.878669 TCATCAACATCTGAAGGAACTCATG 59.121 40.000 0.00 0.00 38.49 3.07
379 380 5.233083 TCAACATCTGAAGGAACTCATGT 57.767 39.130 0.00 0.00 38.49 3.21
380 381 6.358974 TCAACATCTGAAGGAACTCATGTA 57.641 37.500 0.00 0.00 38.49 2.29
381 382 6.950842 TCAACATCTGAAGGAACTCATGTAT 58.049 36.000 0.00 0.00 38.49 2.29
382 383 6.820152 TCAACATCTGAAGGAACTCATGTATG 59.180 38.462 0.00 0.00 38.49 2.39
383 384 5.678583 ACATCTGAAGGAACTCATGTATGG 58.321 41.667 0.00 0.00 38.49 2.74
384 385 4.142609 TCTGAAGGAACTCATGTATGGC 57.857 45.455 0.00 0.00 38.49 4.40
385 386 3.519107 TCTGAAGGAACTCATGTATGGCA 59.481 43.478 0.00 0.00 38.49 4.92
386 387 4.164796 TCTGAAGGAACTCATGTATGGCAT 59.835 41.667 4.88 4.88 38.49 4.40
395 396 2.688902 ATGTATGGCATGCCTCCAAT 57.311 45.000 35.53 23.16 37.13 3.16
396 397 1.694844 TGTATGGCATGCCTCCAATG 58.305 50.000 35.53 0.00 37.13 2.82
397 398 1.063792 TGTATGGCATGCCTCCAATGT 60.064 47.619 35.53 15.45 37.13 2.71
398 399 1.610522 GTATGGCATGCCTCCAATGTC 59.389 52.381 35.53 14.95 37.13 3.06
399 400 0.032912 ATGGCATGCCTCCAATGTCA 60.033 50.000 35.53 14.13 37.13 3.58
400 401 0.251698 TGGCATGCCTCCAATGTCAA 60.252 50.000 35.53 10.21 36.94 3.18
401 402 0.174162 GGCATGCCTCCAATGTCAAC 59.826 55.000 29.98 0.00 0.00 3.18
402 403 0.889994 GCATGCCTCCAATGTCAACA 59.110 50.000 6.36 0.00 0.00 3.33
403 404 1.403249 GCATGCCTCCAATGTCAACAC 60.403 52.381 6.36 0.00 0.00 3.32
404 405 1.887854 CATGCCTCCAATGTCAACACA 59.112 47.619 0.00 0.00 36.78 3.72
405 406 2.064434 TGCCTCCAATGTCAACACAA 57.936 45.000 0.00 0.00 35.64 3.33
406 407 2.382882 TGCCTCCAATGTCAACACAAA 58.617 42.857 0.00 0.00 35.64 2.83
407 408 2.361757 TGCCTCCAATGTCAACACAAAG 59.638 45.455 0.00 0.00 35.64 2.77
408 409 2.622942 GCCTCCAATGTCAACACAAAGA 59.377 45.455 0.00 0.00 35.64 2.52
409 410 3.068024 GCCTCCAATGTCAACACAAAGAA 59.932 43.478 0.00 0.00 35.64 2.52
410 411 4.441356 GCCTCCAATGTCAACACAAAGAAA 60.441 41.667 0.00 0.00 35.64 2.52
411 412 5.043248 CCTCCAATGTCAACACAAAGAAAC 58.957 41.667 0.00 0.00 35.64 2.78
412 413 5.004922 TCCAATGTCAACACAAAGAAACC 57.995 39.130 0.00 0.00 35.64 3.27
413 414 4.464244 TCCAATGTCAACACAAAGAAACCA 59.536 37.500 0.00 0.00 35.64 3.67
414 415 5.128499 TCCAATGTCAACACAAAGAAACCAT 59.872 36.000 0.00 0.00 35.64 3.55
415 416 5.234757 CCAATGTCAACACAAAGAAACCATG 59.765 40.000 0.00 0.00 35.64 3.66
416 417 3.779759 TGTCAACACAAAGAAACCATGC 58.220 40.909 0.00 0.00 0.00 4.06
417 418 3.123050 GTCAACACAAAGAAACCATGCC 58.877 45.455 0.00 0.00 0.00 4.40
418 419 2.762887 TCAACACAAAGAAACCATGCCA 59.237 40.909 0.00 0.00 0.00 4.92
419 420 3.196469 TCAACACAAAGAAACCATGCCAA 59.804 39.130 0.00 0.00 0.00 4.52
420 421 3.902881 ACACAAAGAAACCATGCCAAA 57.097 38.095 0.00 0.00 0.00 3.28
421 422 3.530535 ACACAAAGAAACCATGCCAAAC 58.469 40.909 0.00 0.00 0.00 2.93
422 423 3.197549 ACACAAAGAAACCATGCCAAACT 59.802 39.130 0.00 0.00 0.00 2.66
423 424 4.190772 CACAAAGAAACCATGCCAAACTT 58.809 39.130 0.00 0.00 0.00 2.66
424 425 4.034279 CACAAAGAAACCATGCCAAACTTG 59.966 41.667 0.00 0.00 0.00 3.16
425 426 4.081198 ACAAAGAAACCATGCCAAACTTGA 60.081 37.500 0.00 0.00 0.00 3.02
426 427 3.733443 AGAAACCATGCCAAACTTGAC 57.267 42.857 0.00 0.00 0.00 3.18
427 428 2.365293 AGAAACCATGCCAAACTTGACC 59.635 45.455 0.00 0.00 0.00 4.02
428 429 1.786937 AACCATGCCAAACTTGACCA 58.213 45.000 0.00 0.00 0.00 4.02
429 430 1.786937 ACCATGCCAAACTTGACCAA 58.213 45.000 0.00 0.00 0.00 3.67
430 431 2.328319 ACCATGCCAAACTTGACCAAT 58.672 42.857 0.00 0.00 0.00 3.16
431 432 3.505386 ACCATGCCAAACTTGACCAATA 58.495 40.909 0.00 0.00 0.00 1.90
432 433 3.900601 ACCATGCCAAACTTGACCAATAA 59.099 39.130 0.00 0.00 0.00 1.40
433 434 4.021192 ACCATGCCAAACTTGACCAATAAG 60.021 41.667 0.00 0.00 0.00 1.73
434 435 3.658757 TGCCAAACTTGACCAATAAGC 57.341 42.857 0.00 0.00 0.00 3.09
435 436 2.961741 TGCCAAACTTGACCAATAAGCA 59.038 40.909 0.00 0.00 0.00 3.91
436 437 3.243704 TGCCAAACTTGACCAATAAGCAC 60.244 43.478 0.00 0.00 0.00 4.40
437 438 3.860754 GCCAAACTTGACCAATAAGCACC 60.861 47.826 0.00 0.00 0.00 5.01
438 439 3.320541 CCAAACTTGACCAATAAGCACCA 59.679 43.478 0.00 0.00 0.00 4.17
439 440 4.202202 CCAAACTTGACCAATAAGCACCAA 60.202 41.667 0.00 0.00 0.00 3.67
440 441 5.511202 CCAAACTTGACCAATAAGCACCAAT 60.511 40.000 0.00 0.00 0.00 3.16
441 442 6.295011 CCAAACTTGACCAATAAGCACCAATA 60.295 38.462 0.00 0.00 0.00 1.90
442 443 6.909550 AACTTGACCAATAAGCACCAATAA 57.090 33.333 0.00 0.00 0.00 1.40
443 444 6.267496 ACTTGACCAATAAGCACCAATAAC 57.733 37.500 0.00 0.00 0.00 1.89
444 445 5.772672 ACTTGACCAATAAGCACCAATAACA 59.227 36.000 0.00 0.00 0.00 2.41
445 446 6.266558 ACTTGACCAATAAGCACCAATAACAA 59.733 34.615 0.00 0.00 0.00 2.83
446 447 6.266168 TGACCAATAAGCACCAATAACAAG 57.734 37.500 0.00 0.00 0.00 3.16
447 448 5.072040 ACCAATAAGCACCAATAACAAGC 57.928 39.130 0.00 0.00 0.00 4.01
448 449 4.526262 ACCAATAAGCACCAATAACAAGCA 59.474 37.500 0.00 0.00 0.00 3.91
449 450 5.011533 ACCAATAAGCACCAATAACAAGCAA 59.988 36.000 0.00 0.00 0.00 3.91
450 451 5.577945 CCAATAAGCACCAATAACAAGCAAG 59.422 40.000 0.00 0.00 0.00 4.01
451 452 2.730550 AGCACCAATAACAAGCAAGC 57.269 45.000 0.00 0.00 0.00 4.01
452 453 1.962807 AGCACCAATAACAAGCAAGCA 59.037 42.857 0.00 0.00 0.00 3.91
453 454 2.061028 GCACCAATAACAAGCAAGCAC 58.939 47.619 0.00 0.00 0.00 4.40
454 455 2.676076 CACCAATAACAAGCAAGCACC 58.324 47.619 0.00 0.00 0.00 5.01
455 456 2.297033 CACCAATAACAAGCAAGCACCT 59.703 45.455 0.00 0.00 0.00 4.00
456 457 2.297033 ACCAATAACAAGCAAGCACCTG 59.703 45.455 0.00 0.00 0.00 4.00
457 458 2.557924 CCAATAACAAGCAAGCACCTGA 59.442 45.455 0.00 0.00 0.00 3.86
458 459 3.366679 CCAATAACAAGCAAGCACCTGAG 60.367 47.826 0.00 0.00 0.00 3.35
459 460 1.238439 TAACAAGCAAGCACCTGAGC 58.762 50.000 0.00 0.00 0.00 4.26
460 461 0.752743 AACAAGCAAGCACCTGAGCA 60.753 50.000 0.00 0.00 36.85 4.26
461 462 1.170919 ACAAGCAAGCACCTGAGCAG 61.171 55.000 0.00 0.00 36.85 4.24
462 463 2.266627 AAGCAAGCACCTGAGCAGC 61.267 57.895 0.00 0.00 37.85 5.25
463 464 2.971095 AAGCAAGCACCTGAGCAGCA 62.971 55.000 0.00 0.00 39.34 4.41
464 465 2.558286 GCAAGCACCTGAGCAGCAA 61.558 57.895 0.00 0.00 37.62 3.91
465 466 1.285023 CAAGCACCTGAGCAGCAAC 59.715 57.895 0.00 0.00 36.85 4.17
466 467 1.900498 AAGCACCTGAGCAGCAACC 60.900 57.895 0.00 0.00 36.85 3.77
467 468 2.595463 GCACCTGAGCAGCAACCA 60.595 61.111 0.00 0.00 0.00 3.67
468 469 2.195567 GCACCTGAGCAGCAACCAA 61.196 57.895 0.00 0.00 0.00 3.67
469 470 1.530013 GCACCTGAGCAGCAACCAAT 61.530 55.000 0.00 0.00 0.00 3.16
470 471 1.825090 CACCTGAGCAGCAACCAATA 58.175 50.000 0.00 0.00 0.00 1.90
471 472 2.372264 CACCTGAGCAGCAACCAATAT 58.628 47.619 0.00 0.00 0.00 1.28
472 473 2.098607 CACCTGAGCAGCAACCAATATG 59.901 50.000 0.00 0.00 0.00 1.78
473 474 2.025981 ACCTGAGCAGCAACCAATATGA 60.026 45.455 0.00 0.00 0.00 2.15
474 475 2.357009 CCTGAGCAGCAACCAATATGAC 59.643 50.000 0.00 0.00 0.00 3.06
475 476 3.011818 CTGAGCAGCAACCAATATGACA 58.988 45.455 0.00 0.00 0.00 3.58
476 477 3.419943 TGAGCAGCAACCAATATGACAA 58.580 40.909 0.00 0.00 0.00 3.18
477 478 3.441222 TGAGCAGCAACCAATATGACAAG 59.559 43.478 0.00 0.00 0.00 3.16
478 479 3.689347 AGCAGCAACCAATATGACAAGA 58.311 40.909 0.00 0.00 0.00 3.02
479 480 3.693085 AGCAGCAACCAATATGACAAGAG 59.307 43.478 0.00 0.00 0.00 2.85
480 481 3.691118 GCAGCAACCAATATGACAAGAGA 59.309 43.478 0.00 0.00 0.00 3.10
481 482 4.156556 GCAGCAACCAATATGACAAGAGAA 59.843 41.667 0.00 0.00 0.00 2.87
482 483 5.335897 GCAGCAACCAATATGACAAGAGAAA 60.336 40.000 0.00 0.00 0.00 2.52
483 484 6.088824 CAGCAACCAATATGACAAGAGAAAC 58.911 40.000 0.00 0.00 0.00 2.78
484 485 5.769662 AGCAACCAATATGACAAGAGAAACA 59.230 36.000 0.00 0.00 0.00 2.83
485 486 5.858581 GCAACCAATATGACAAGAGAAACAC 59.141 40.000 0.00 0.00 0.00 3.32
486 487 6.381801 CAACCAATATGACAAGAGAAACACC 58.618 40.000 0.00 0.00 0.00 4.16
487 488 5.630121 ACCAATATGACAAGAGAAACACCA 58.370 37.500 0.00 0.00 0.00 4.17
488 489 6.068010 ACCAATATGACAAGAGAAACACCAA 58.932 36.000 0.00 0.00 0.00 3.67
489 490 6.549364 ACCAATATGACAAGAGAAACACCAAA 59.451 34.615 0.00 0.00 0.00 3.28
490 491 7.233348 ACCAATATGACAAGAGAAACACCAAAT 59.767 33.333 0.00 0.00 0.00 2.32
491 492 7.756722 CCAATATGACAAGAGAAACACCAAATC 59.243 37.037 0.00 0.00 0.00 2.17
492 493 8.517878 CAATATGACAAGAGAAACACCAAATCT 58.482 33.333 0.00 0.00 0.00 2.40
493 494 9.739276 AATATGACAAGAGAAACACCAAATCTA 57.261 29.630 0.00 0.00 0.00 1.98
494 495 9.911788 ATATGACAAGAGAAACACCAAATCTAT 57.088 29.630 0.00 0.00 0.00 1.98
495 496 8.641498 ATGACAAGAGAAACACCAAATCTATT 57.359 30.769 0.00 0.00 0.00 1.73
496 497 7.874940 TGACAAGAGAAACACCAAATCTATTG 58.125 34.615 7.58 7.58 44.09 1.90
497 498 7.040478 TGACAAGAGAAACACCAAATCTATTGG 60.040 37.037 12.31 5.69 43.28 3.16
498 499 7.004086 ACAAGAGAAACACCAAATCTATTGGA 58.996 34.615 13.81 0.00 43.28 3.53
499 500 7.175641 ACAAGAGAAACACCAAATCTATTGGAG 59.824 37.037 13.81 8.47 43.28 3.86
500 501 7.020827 AGAGAAACACCAAATCTATTGGAGA 57.979 36.000 13.81 0.00 42.06 3.71
502 503 8.772250 AGAGAAACACCAAATCTATTGGAGATA 58.228 33.333 13.81 0.00 44.68 1.98
503 504 8.738645 AGAAACACCAAATCTATTGGAGATAC 57.261 34.615 13.81 3.21 44.68 2.24
504 505 8.328758 AGAAACACCAAATCTATTGGAGATACA 58.671 33.333 13.81 0.00 44.68 2.29
505 506 8.877864 AAACACCAAATCTATTGGAGATACAA 57.122 30.769 13.81 0.00 44.68 2.41
506 507 8.877864 AACACCAAATCTATTGGAGATACAAA 57.122 30.769 13.81 0.00 44.68 2.83
507 508 8.511604 ACACCAAATCTATTGGAGATACAAAG 57.488 34.615 13.81 0.00 44.68 2.77
508 509 8.328758 ACACCAAATCTATTGGAGATACAAAGA 58.671 33.333 13.81 0.00 44.68 2.52
509 510 9.347240 CACCAAATCTATTGGAGATACAAAGAT 57.653 33.333 13.81 0.00 44.68 2.40
510 511 9.927081 ACCAAATCTATTGGAGATACAAAGATT 57.073 29.630 13.81 8.31 44.68 2.40
516 517 9.529325 TCTATTGGAGATACAAAGATTTACGTG 57.471 33.333 0.00 0.00 33.48 4.49
517 518 6.978343 TTGGAGATACAAAGATTTACGTGG 57.022 37.500 0.00 0.00 0.00 4.94
518 519 6.288941 TGGAGATACAAAGATTTACGTGGA 57.711 37.500 0.00 0.00 0.00 4.02
519 520 6.703319 TGGAGATACAAAGATTTACGTGGAA 58.297 36.000 0.00 0.00 0.00 3.53
520 521 7.162761 TGGAGATACAAAGATTTACGTGGAAA 58.837 34.615 0.00 0.00 0.00 3.13
521 522 7.827236 TGGAGATACAAAGATTTACGTGGAAAT 59.173 33.333 0.00 0.00 0.00 2.17
522 523 8.336080 GGAGATACAAAGATTTACGTGGAAATC 58.664 37.037 13.57 13.57 43.35 2.17
523 524 8.209917 AGATACAAAGATTTACGTGGAAATCC 57.790 34.615 16.54 0.00 43.84 3.01
524 525 5.638596 ACAAAGATTTACGTGGAAATCCC 57.361 39.130 16.54 0.00 43.84 3.85
525 526 5.321927 ACAAAGATTTACGTGGAAATCCCT 58.678 37.500 16.54 5.55 43.84 4.20
526 527 5.773176 ACAAAGATTTACGTGGAAATCCCTT 59.227 36.000 16.54 10.00 43.84 3.95
527 528 5.897377 AAGATTTACGTGGAAATCCCTTG 57.103 39.130 16.54 0.00 43.84 3.61
528 529 3.694566 AGATTTACGTGGAAATCCCTTGC 59.305 43.478 16.54 0.00 43.84 4.01
529 530 1.444836 TTACGTGGAAATCCCTTGCG 58.555 50.000 0.00 0.00 35.38 4.85
530 531 0.391927 TACGTGGAAATCCCTTGCGG 60.392 55.000 0.00 0.00 35.38 5.69
540 541 3.681473 CCTTGCGGGGAAGAAACC 58.319 61.111 1.16 0.00 0.00 3.27
541 542 1.228429 CCTTGCGGGGAAGAAACCA 60.228 57.895 1.16 0.00 0.00 3.67
542 543 0.611896 CCTTGCGGGGAAGAAACCAT 60.612 55.000 1.16 0.00 0.00 3.55
543 544 0.527565 CTTGCGGGGAAGAAACCATG 59.472 55.000 0.00 0.00 0.00 3.66
544 545 0.897863 TTGCGGGGAAGAAACCATGG 60.898 55.000 11.19 11.19 0.00 3.66
545 546 2.052104 GCGGGGAAGAAACCATGGG 61.052 63.158 18.09 0.00 0.00 4.00
546 547 2.052104 CGGGGAAGAAACCATGGGC 61.052 63.158 18.09 4.98 0.00 5.36
547 548 2.052104 GGGGAAGAAACCATGGGCG 61.052 63.158 18.09 0.00 0.00 6.13
548 549 1.001393 GGGAAGAAACCATGGGCGA 60.001 57.895 18.09 0.00 0.00 5.54
549 550 1.313091 GGGAAGAAACCATGGGCGAC 61.313 60.000 18.09 4.57 0.00 5.19
550 551 0.608035 GGAAGAAACCATGGGCGACA 60.608 55.000 18.09 0.00 0.00 4.35
551 552 0.804989 GAAGAAACCATGGGCGACAG 59.195 55.000 18.09 0.00 0.00 3.51
552 553 1.244019 AAGAAACCATGGGCGACAGC 61.244 55.000 18.09 0.00 44.18 4.40
553 554 3.039202 GAAACCATGGGCGACAGCG 62.039 63.158 18.09 0.00 46.35 5.18
554 555 3.545124 AAACCATGGGCGACAGCGA 62.545 57.895 18.09 0.00 46.35 4.93
555 556 3.958147 AACCATGGGCGACAGCGAG 62.958 63.158 18.09 0.00 46.35 5.03
558 559 4.393155 ATGGGCGACAGCGAGCAA 62.393 61.111 0.00 0.00 46.35 3.91
559 560 3.687321 ATGGGCGACAGCGAGCAAT 62.687 57.895 0.00 0.00 46.35 3.56
560 561 3.567797 GGGCGACAGCGAGCAATC 61.568 66.667 0.00 0.00 46.35 2.67
561 562 2.510238 GGCGACAGCGAGCAATCT 60.510 61.111 0.00 0.00 46.35 2.40
562 563 2.103042 GGCGACAGCGAGCAATCTT 61.103 57.895 0.00 0.00 46.35 2.40
563 564 1.346538 GCGACAGCGAGCAATCTTC 59.653 57.895 0.00 0.00 40.82 2.87
564 565 2.002127 CGACAGCGAGCAATCTTCC 58.998 57.895 0.00 0.00 40.82 3.46
565 566 0.737367 CGACAGCGAGCAATCTTCCA 60.737 55.000 0.00 0.00 40.82 3.53
566 567 0.723981 GACAGCGAGCAATCTTCCAC 59.276 55.000 0.00 0.00 0.00 4.02
567 568 0.322975 ACAGCGAGCAATCTTCCACT 59.677 50.000 0.00 0.00 0.00 4.00
568 569 1.550524 ACAGCGAGCAATCTTCCACTA 59.449 47.619 0.00 0.00 0.00 2.74
569 570 2.169352 ACAGCGAGCAATCTTCCACTAT 59.831 45.455 0.00 0.00 0.00 2.12
570 571 3.384789 ACAGCGAGCAATCTTCCACTATA 59.615 43.478 0.00 0.00 0.00 1.31
571 572 4.141937 ACAGCGAGCAATCTTCCACTATAA 60.142 41.667 0.00 0.00 0.00 0.98
572 573 4.811024 CAGCGAGCAATCTTCCACTATAAA 59.189 41.667 0.00 0.00 0.00 1.40
573 574 5.294306 CAGCGAGCAATCTTCCACTATAAAA 59.706 40.000 0.00 0.00 0.00 1.52
574 575 5.880332 AGCGAGCAATCTTCCACTATAAAAA 59.120 36.000 0.00 0.00 0.00 1.94
575 576 6.543831 AGCGAGCAATCTTCCACTATAAAAAT 59.456 34.615 0.00 0.00 0.00 1.82
576 577 6.634436 GCGAGCAATCTTCCACTATAAAAATG 59.366 38.462 0.00 0.00 0.00 2.32
577 578 7.467267 GCGAGCAATCTTCCACTATAAAAATGA 60.467 37.037 0.00 0.00 0.00 2.57
578 579 8.397906 CGAGCAATCTTCCACTATAAAAATGAA 58.602 33.333 0.00 0.00 0.00 2.57
581 582 9.468532 GCAATCTTCCACTATAAAAATGAATCC 57.531 33.333 0.00 0.00 0.00 3.01
582 583 9.669353 CAATCTTCCACTATAAAAATGAATCCG 57.331 33.333 0.00 0.00 0.00 4.18
583 584 7.801716 TCTTCCACTATAAAAATGAATCCGG 57.198 36.000 0.00 0.00 0.00 5.14
584 585 7.343357 TCTTCCACTATAAAAATGAATCCGGT 58.657 34.615 0.00 0.00 0.00 5.28
585 586 8.487848 TCTTCCACTATAAAAATGAATCCGGTA 58.512 33.333 0.00 0.00 0.00 4.02
586 587 8.441312 TTCCACTATAAAAATGAATCCGGTAC 57.559 34.615 0.00 0.00 0.00 3.34
587 588 7.566569 TCCACTATAAAAATGAATCCGGTACA 58.433 34.615 0.00 0.40 0.00 2.90
588 589 8.047911 TCCACTATAAAAATGAATCCGGTACAA 58.952 33.333 0.00 0.00 0.00 2.41
589 590 8.342634 CCACTATAAAAATGAATCCGGTACAAG 58.657 37.037 0.00 0.00 0.00 3.16
590 591 8.342634 CACTATAAAAATGAATCCGGTACAAGG 58.657 37.037 0.00 0.00 0.00 3.61
591 592 8.050930 ACTATAAAAATGAATCCGGTACAAGGT 58.949 33.333 0.00 0.00 0.00 3.50
592 593 5.385509 AAAAATGAATCCGGTACAAGGTG 57.614 39.130 0.00 0.00 0.00 4.00
593 594 2.710096 ATGAATCCGGTACAAGGTGG 57.290 50.000 0.00 0.00 0.00 4.61
594 595 1.646912 TGAATCCGGTACAAGGTGGA 58.353 50.000 0.00 0.46 34.45 4.02
595 596 1.979308 TGAATCCGGTACAAGGTGGAA 59.021 47.619 0.00 0.00 33.48 3.53
596 597 2.027561 TGAATCCGGTACAAGGTGGAAG 60.028 50.000 0.00 0.00 33.48 3.46
597 598 0.252197 ATCCGGTACAAGGTGGAAGC 59.748 55.000 0.00 0.00 33.48 3.86
598 599 1.376812 CCGGTACAAGGTGGAAGCC 60.377 63.158 0.00 0.00 32.25 4.35
599 600 1.373435 CGGTACAAGGTGGAAGCCA 59.627 57.895 0.00 0.00 32.25 4.75
600 601 0.250553 CGGTACAAGGTGGAAGCCAA 60.251 55.000 0.00 0.00 34.18 4.52
601 602 1.244816 GGTACAAGGTGGAAGCCAAC 58.755 55.000 0.00 0.00 42.50 3.77
608 609 2.115343 GGTGGAAGCCAACTAGAAGG 57.885 55.000 0.00 0.00 38.38 3.46
609 610 1.340114 GGTGGAAGCCAACTAGAAGGG 60.340 57.143 0.00 0.00 38.38 3.95
610 611 0.991920 TGGAAGCCAACTAGAAGGGG 59.008 55.000 0.00 0.00 0.00 4.79
611 612 1.286248 GGAAGCCAACTAGAAGGGGA 58.714 55.000 0.00 0.00 0.00 4.81
612 613 1.210722 GGAAGCCAACTAGAAGGGGAG 59.789 57.143 0.00 0.00 0.00 4.30
613 614 1.210722 GAAGCCAACTAGAAGGGGAGG 59.789 57.143 0.00 0.00 0.00 4.30
614 615 1.224870 GCCAACTAGAAGGGGAGGC 59.775 63.158 0.00 0.00 0.00 4.70
615 616 1.275421 GCCAACTAGAAGGGGAGGCT 61.275 60.000 0.00 0.00 37.67 4.58
616 617 0.833949 CCAACTAGAAGGGGAGGCTC 59.166 60.000 5.78 5.78 0.00 4.70
617 618 0.833949 CAACTAGAAGGGGAGGCTCC 59.166 60.000 25.80 25.80 35.23 4.70
618 619 0.417841 AACTAGAAGGGGAGGCTCCA 59.582 55.000 33.27 12.19 38.64 3.86
619 620 0.417841 ACTAGAAGGGGAGGCTCCAA 59.582 55.000 33.27 11.10 38.64 3.53
620 621 1.203440 ACTAGAAGGGGAGGCTCCAAA 60.203 52.381 33.27 11.44 38.64 3.28
621 622 2.131023 CTAGAAGGGGAGGCTCCAAAT 58.869 52.381 33.27 18.73 38.64 2.32
622 623 0.922626 AGAAGGGGAGGCTCCAAATC 59.077 55.000 33.27 25.00 38.64 2.17
623 624 0.106469 GAAGGGGAGGCTCCAAATCC 60.106 60.000 33.27 24.37 38.64 3.01
625 626 2.603580 GGGAGGCTCCAAATCCCC 59.396 66.667 33.27 12.68 46.03 4.81
626 627 2.316586 GGGAGGCTCCAAATCCCCA 61.317 63.158 33.27 0.00 46.03 4.96
627 628 1.697297 GGAGGCTCCAAATCCCCAA 59.303 57.895 28.55 0.00 36.28 4.12
628 629 0.262876 GGAGGCTCCAAATCCCCAAT 59.737 55.000 28.55 0.00 36.28 3.16
629 630 1.343377 GGAGGCTCCAAATCCCCAATT 60.343 52.381 28.55 0.00 36.28 2.32
630 631 2.470990 GAGGCTCCAAATCCCCAATTT 58.529 47.619 2.15 0.00 38.11 1.82
631 632 2.840038 GAGGCTCCAAATCCCCAATTTT 59.160 45.455 2.15 0.00 35.32 1.82
632 633 4.030216 GAGGCTCCAAATCCCCAATTTTA 58.970 43.478 2.15 0.00 35.32 1.52
633 634 4.033009 AGGCTCCAAATCCCCAATTTTAG 58.967 43.478 0.00 0.00 35.32 1.85
634 635 3.432186 GGCTCCAAATCCCCAATTTTAGC 60.432 47.826 0.00 0.00 40.19 3.09
635 636 3.197549 GCTCCAAATCCCCAATTTTAGCA 59.802 43.478 8.59 0.00 40.41 3.49
636 637 4.758688 CTCCAAATCCCCAATTTTAGCAC 58.241 43.478 0.00 0.00 35.32 4.40
637 638 4.424842 TCCAAATCCCCAATTTTAGCACT 58.575 39.130 0.00 0.00 35.32 4.40
638 639 4.466015 TCCAAATCCCCAATTTTAGCACTC 59.534 41.667 0.00 0.00 35.32 3.51
639 640 4.222588 CCAAATCCCCAATTTTAGCACTCA 59.777 41.667 0.00 0.00 35.32 3.41
640 641 5.413499 CAAATCCCCAATTTTAGCACTCAG 58.587 41.667 0.00 0.00 35.32 3.35
641 642 4.591321 ATCCCCAATTTTAGCACTCAGA 57.409 40.909 0.00 0.00 0.00 3.27
642 643 4.591321 TCCCCAATTTTAGCACTCAGAT 57.409 40.909 0.00 0.00 0.00 2.90
643 644 4.934356 TCCCCAATTTTAGCACTCAGATT 58.066 39.130 0.00 0.00 0.00 2.40
644 645 5.332743 TCCCCAATTTTAGCACTCAGATTT 58.667 37.500 0.00 0.00 0.00 2.17
645 646 5.779771 TCCCCAATTTTAGCACTCAGATTTT 59.220 36.000 0.00 0.00 0.00 1.82
646 647 5.870978 CCCCAATTTTAGCACTCAGATTTTG 59.129 40.000 0.00 0.00 0.00 2.44
647 648 5.349543 CCCAATTTTAGCACTCAGATTTTGC 59.650 40.000 0.00 0.00 36.45 3.68
648 649 5.061311 CCAATTTTAGCACTCAGATTTTGCG 59.939 40.000 0.00 0.00 41.33 4.85
649 650 4.829064 TTTTAGCACTCAGATTTTGCGT 57.171 36.364 0.00 0.00 41.33 5.24
650 651 3.811722 TTAGCACTCAGATTTTGCGTG 57.188 42.857 0.00 0.00 43.69 5.34
651 652 0.877071 AGCACTCAGATTTTGCGTGG 59.123 50.000 0.27 0.00 41.67 4.94
652 653 0.874390 GCACTCAGATTTTGCGTGGA 59.126 50.000 0.27 0.00 41.67 4.02
653 654 1.470098 GCACTCAGATTTTGCGTGGAT 59.530 47.619 0.27 0.00 41.67 3.41
654 655 2.095059 GCACTCAGATTTTGCGTGGATT 60.095 45.455 0.27 0.00 41.67 3.01
655 656 3.612479 GCACTCAGATTTTGCGTGGATTT 60.612 43.478 0.27 0.00 41.67 2.17
656 657 3.916172 CACTCAGATTTTGCGTGGATTTG 59.084 43.478 0.00 0.00 38.54 2.32
657 658 3.569701 ACTCAGATTTTGCGTGGATTTGT 59.430 39.130 0.00 0.00 0.00 2.83
658 659 4.759693 ACTCAGATTTTGCGTGGATTTGTA 59.240 37.500 0.00 0.00 0.00 2.41
659 660 5.106555 ACTCAGATTTTGCGTGGATTTGTAG 60.107 40.000 0.00 0.00 0.00 2.74
660 661 5.000591 TCAGATTTTGCGTGGATTTGTAGA 58.999 37.500 0.00 0.00 0.00 2.59
661 662 5.647658 TCAGATTTTGCGTGGATTTGTAGAT 59.352 36.000 0.00 0.00 0.00 1.98
662 663 5.967674 CAGATTTTGCGTGGATTTGTAGATC 59.032 40.000 0.00 0.00 0.00 2.75
663 664 5.647658 AGATTTTGCGTGGATTTGTAGATCA 59.352 36.000 0.00 0.00 0.00 2.92
664 665 5.697473 TTTTGCGTGGATTTGTAGATCAA 57.303 34.783 0.00 0.00 0.00 2.57
675 676 4.574674 TTGTAGATCAAATGGGCTCACT 57.425 40.909 0.00 0.00 32.64 3.41
676 677 4.574674 TGTAGATCAAATGGGCTCACTT 57.425 40.909 0.00 0.00 0.00 3.16
677 678 4.517285 TGTAGATCAAATGGGCTCACTTC 58.483 43.478 0.00 0.00 0.00 3.01
678 679 4.225942 TGTAGATCAAATGGGCTCACTTCT 59.774 41.667 0.00 0.00 0.00 2.85
679 680 3.883669 AGATCAAATGGGCTCACTTCTC 58.116 45.455 0.00 0.00 0.00 2.87
680 681 3.522750 AGATCAAATGGGCTCACTTCTCT 59.477 43.478 0.00 0.00 0.00 3.10
681 682 3.340814 TCAAATGGGCTCACTTCTCTC 57.659 47.619 0.00 0.00 0.00 3.20
682 683 2.026822 TCAAATGGGCTCACTTCTCTCC 60.027 50.000 0.00 0.00 0.00 3.71
683 684 1.963985 AATGGGCTCACTTCTCTCCT 58.036 50.000 0.00 0.00 0.00 3.69
684 685 2.856760 ATGGGCTCACTTCTCTCCTA 57.143 50.000 0.00 0.00 0.00 2.94
685 686 2.623418 TGGGCTCACTTCTCTCCTAA 57.377 50.000 0.00 0.00 0.00 2.69
686 687 2.180276 TGGGCTCACTTCTCTCCTAAC 58.820 52.381 0.00 0.00 0.00 2.34
687 688 1.483004 GGGCTCACTTCTCTCCTAACC 59.517 57.143 0.00 0.00 0.00 2.85
688 689 1.483004 GGCTCACTTCTCTCCTAACCC 59.517 57.143 0.00 0.00 0.00 4.11
689 690 2.462723 GCTCACTTCTCTCCTAACCCT 58.537 52.381 0.00 0.00 0.00 4.34
690 691 3.627747 GGCTCACTTCTCTCCTAACCCTA 60.628 52.174 0.00 0.00 0.00 3.53
691 692 3.634910 GCTCACTTCTCTCCTAACCCTAG 59.365 52.174 0.00 0.00 0.00 3.02
692 693 4.629204 GCTCACTTCTCTCCTAACCCTAGA 60.629 50.000 0.00 0.00 0.00 2.43
693 694 5.118729 TCACTTCTCTCCTAACCCTAGAG 57.881 47.826 0.00 0.00 38.48 2.43
694 695 3.634910 CACTTCTCTCCTAACCCTAGAGC 59.365 52.174 0.00 0.00 37.31 4.09
695 696 3.530149 ACTTCTCTCCTAACCCTAGAGCT 59.470 47.826 0.00 0.00 37.31 4.09
696 697 3.868619 TCTCTCCTAACCCTAGAGCTC 57.131 52.381 5.27 5.27 37.31 4.09
697 698 2.444010 TCTCTCCTAACCCTAGAGCTCC 59.556 54.545 10.93 0.00 37.31 4.70
698 699 1.499870 TCTCCTAACCCTAGAGCTCCC 59.500 57.143 10.93 0.00 0.00 4.30
699 700 1.218196 CTCCTAACCCTAGAGCTCCCA 59.782 57.143 10.93 0.00 0.00 4.37
700 701 1.063114 TCCTAACCCTAGAGCTCCCAC 60.063 57.143 10.93 0.00 0.00 4.61
701 702 1.062810 CCTAACCCTAGAGCTCCCACT 60.063 57.143 10.93 0.00 0.00 4.00
702 703 2.177233 CCTAACCCTAGAGCTCCCACTA 59.823 54.545 10.93 0.00 0.00 2.74
703 704 2.463047 AACCCTAGAGCTCCCACTAG 57.537 55.000 10.93 5.42 36.73 2.57
704 705 1.609626 ACCCTAGAGCTCCCACTAGA 58.390 55.000 10.93 0.00 38.53 2.43
705 706 1.930914 ACCCTAGAGCTCCCACTAGAA 59.069 52.381 10.93 0.00 38.53 2.10
706 707 2.312390 CCCTAGAGCTCCCACTAGAAC 58.688 57.143 10.93 0.00 38.53 3.01
707 708 2.358300 CCCTAGAGCTCCCACTAGAACA 60.358 54.545 10.93 0.00 38.53 3.18
708 709 2.955660 CCTAGAGCTCCCACTAGAACAG 59.044 54.545 10.93 0.00 38.53 3.16
709 710 2.909504 AGAGCTCCCACTAGAACAGA 57.090 50.000 10.93 0.00 0.00 3.41
710 711 3.176924 AGAGCTCCCACTAGAACAGAA 57.823 47.619 10.93 0.00 0.00 3.02
711 712 3.511477 AGAGCTCCCACTAGAACAGAAA 58.489 45.455 10.93 0.00 0.00 2.52
712 713 3.904339 AGAGCTCCCACTAGAACAGAAAA 59.096 43.478 10.93 0.00 0.00 2.29
713 714 4.348168 AGAGCTCCCACTAGAACAGAAAAA 59.652 41.667 10.93 0.00 0.00 1.94
714 715 5.013599 AGAGCTCCCACTAGAACAGAAAAAT 59.986 40.000 10.93 0.00 0.00 1.82
715 716 5.635120 AGCTCCCACTAGAACAGAAAAATT 58.365 37.500 0.00 0.00 0.00 1.82
716 717 5.707764 AGCTCCCACTAGAACAGAAAAATTC 59.292 40.000 0.00 0.00 0.00 2.17
717 718 5.473504 GCTCCCACTAGAACAGAAAAATTCA 59.526 40.000 0.00 0.00 0.00 2.57
718 719 6.016276 GCTCCCACTAGAACAGAAAAATTCAA 60.016 38.462 0.00 0.00 0.00 2.69
719 720 7.272037 TCCCACTAGAACAGAAAAATTCAAC 57.728 36.000 0.00 0.00 0.00 3.18
720 721 7.060421 TCCCACTAGAACAGAAAAATTCAACT 58.940 34.615 0.00 0.00 0.00 3.16
721 722 7.228706 TCCCACTAGAACAGAAAAATTCAACTC 59.771 37.037 0.00 0.00 0.00 3.01
722 723 7.363431 CCACTAGAACAGAAAAATTCAACTCC 58.637 38.462 0.00 0.00 0.00 3.85
723 724 7.363431 CACTAGAACAGAAAAATTCAACTCCC 58.637 38.462 0.00 0.00 0.00 4.30
724 725 7.229506 CACTAGAACAGAAAAATTCAACTCCCT 59.770 37.037 0.00 0.00 0.00 4.20
725 726 8.437575 ACTAGAACAGAAAAATTCAACTCCCTA 58.562 33.333 0.00 0.00 0.00 3.53
726 727 9.454859 CTAGAACAGAAAAATTCAACTCCCTAT 57.545 33.333 0.00 0.00 0.00 2.57
727 728 8.341892 AGAACAGAAAAATTCAACTCCCTATC 57.658 34.615 0.00 0.00 0.00 2.08
728 729 8.166726 AGAACAGAAAAATTCAACTCCCTATCT 58.833 33.333 0.00 0.00 0.00 1.98
729 730 9.449719 GAACAGAAAAATTCAACTCCCTATCTA 57.550 33.333 0.00 0.00 0.00 1.98
730 731 9.981460 AACAGAAAAATTCAACTCCCTATCTAT 57.019 29.630 0.00 0.00 0.00 1.98
731 732 9.981460 ACAGAAAAATTCAACTCCCTATCTATT 57.019 29.630 0.00 0.00 0.00 1.73
733 734 9.634021 AGAAAAATTCAACTCCCTATCTATTCC 57.366 33.333 0.00 0.00 0.00 3.01
734 735 8.768501 AAAAATTCAACTCCCTATCTATTCCC 57.231 34.615 0.00 0.00 0.00 3.97
735 736 5.746990 ATTCAACTCCCTATCTATTCCCG 57.253 43.478 0.00 0.00 0.00 5.14
736 737 4.464652 TCAACTCCCTATCTATTCCCGA 57.535 45.455 0.00 0.00 0.00 5.14
737 738 4.408276 TCAACTCCCTATCTATTCCCGAG 58.592 47.826 0.00 0.00 0.00 4.63
738 739 2.810164 ACTCCCTATCTATTCCCGAGC 58.190 52.381 0.00 0.00 0.00 5.03
739 740 2.380590 ACTCCCTATCTATTCCCGAGCT 59.619 50.000 0.00 0.00 0.00 4.09
740 741 3.592427 ACTCCCTATCTATTCCCGAGCTA 59.408 47.826 0.00 0.00 0.00 3.32
741 742 4.204012 CTCCCTATCTATTCCCGAGCTAG 58.796 52.174 0.00 0.00 0.00 3.42
742 743 2.691011 CCCTATCTATTCCCGAGCTAGC 59.309 54.545 6.62 6.62 0.00 3.42
743 744 3.626222 CCCTATCTATTCCCGAGCTAGCT 60.626 52.174 19.45 19.45 0.00 3.32
744 745 3.380004 CCTATCTATTCCCGAGCTAGCTG 59.620 52.174 24.99 14.20 0.00 4.24
745 746 2.658807 TCTATTCCCGAGCTAGCTGA 57.341 50.000 24.99 10.87 0.00 4.26
746 747 2.945456 TCTATTCCCGAGCTAGCTGAA 58.055 47.619 24.99 19.49 0.00 3.02
747 748 2.887783 TCTATTCCCGAGCTAGCTGAAG 59.112 50.000 24.99 13.01 0.00 3.02
748 749 1.781786 ATTCCCGAGCTAGCTGAAGA 58.218 50.000 24.99 12.46 0.00 2.87
749 750 1.557099 TTCCCGAGCTAGCTGAAGAA 58.443 50.000 24.99 17.70 0.00 2.52
750 751 1.107114 TCCCGAGCTAGCTGAAGAAG 58.893 55.000 24.99 8.27 0.00 2.85
765 766 6.670077 CTGAAGAAGCCTAAATAGTGAACC 57.330 41.667 0.00 0.00 0.00 3.62
766 767 6.374417 TGAAGAAGCCTAAATAGTGAACCT 57.626 37.500 0.00 0.00 0.00 3.50
767 768 6.779860 TGAAGAAGCCTAAATAGTGAACCTT 58.220 36.000 0.00 0.00 0.00 3.50
768 769 6.879458 TGAAGAAGCCTAAATAGTGAACCTTC 59.121 38.462 0.00 0.00 0.00 3.46
769 770 5.746284 AGAAGCCTAAATAGTGAACCTTCC 58.254 41.667 0.00 0.00 0.00 3.46
770 771 5.250774 AGAAGCCTAAATAGTGAACCTTCCA 59.749 40.000 0.00 0.00 0.00 3.53
771 772 5.514500 AGCCTAAATAGTGAACCTTCCAA 57.486 39.130 0.00 0.00 0.00 3.53
772 773 5.887754 AGCCTAAATAGTGAACCTTCCAAA 58.112 37.500 0.00 0.00 0.00 3.28
773 774 5.946377 AGCCTAAATAGTGAACCTTCCAAAG 59.054 40.000 0.00 0.00 0.00 2.77
774 775 5.944007 GCCTAAATAGTGAACCTTCCAAAGA 59.056 40.000 0.00 0.00 0.00 2.52
775 776 6.094186 GCCTAAATAGTGAACCTTCCAAAGAG 59.906 42.308 0.00 0.00 0.00 2.85
776 777 5.966742 AAATAGTGAACCTTCCAAAGAGC 57.033 39.130 0.00 0.00 0.00 4.09
777 778 2.278332 AGTGAACCTTCCAAAGAGCC 57.722 50.000 0.00 0.00 0.00 4.70
778 779 1.777272 AGTGAACCTTCCAAAGAGCCT 59.223 47.619 0.00 0.00 0.00 4.58
779 780 2.155279 GTGAACCTTCCAAAGAGCCTC 58.845 52.381 0.00 0.00 0.00 4.70
780 781 1.073923 TGAACCTTCCAAAGAGCCTCC 59.926 52.381 0.00 0.00 0.00 4.30
781 782 1.352687 GAACCTTCCAAAGAGCCTCCT 59.647 52.381 0.00 0.00 0.00 3.69
782 783 0.988063 ACCTTCCAAAGAGCCTCCTC 59.012 55.000 0.00 0.00 38.42 3.71
783 784 0.987294 CCTTCCAAAGAGCCTCCTCA 59.013 55.000 0.00 0.00 40.68 3.86
784 785 1.065564 CCTTCCAAAGAGCCTCCTCAG 60.066 57.143 0.00 0.00 40.68 3.35
785 786 0.326264 TTCCAAAGAGCCTCCTCAGC 59.674 55.000 0.00 0.00 40.68 4.26
786 787 0.546267 TCCAAAGAGCCTCCTCAGCT 60.546 55.000 0.00 0.00 45.23 4.24
787 788 0.327591 CCAAAGAGCCTCCTCAGCTT 59.672 55.000 0.00 0.00 41.75 3.74
788 789 1.451067 CAAAGAGCCTCCTCAGCTTG 58.549 55.000 0.00 0.00 41.75 4.01
789 790 0.327591 AAAGAGCCTCCTCAGCTTGG 59.672 55.000 0.00 0.00 41.75 3.61
790 791 0.839853 AAGAGCCTCCTCAGCTTGGT 60.840 55.000 2.79 0.00 41.75 3.67
791 792 0.041833 AGAGCCTCCTCAGCTTGGTA 59.958 55.000 2.79 0.00 41.75 3.25
792 793 0.905357 GAGCCTCCTCAGCTTGGTAA 59.095 55.000 2.79 0.00 41.75 2.85
793 794 0.615850 AGCCTCCTCAGCTTGGTAAC 59.384 55.000 2.79 0.00 37.24 2.50
794 795 3.997768 GAGCCTCCTCAGCTTGGTAACA 61.998 54.545 2.79 0.00 43.48 2.41
795 796 5.443892 GAGCCTCCTCAGCTTGGTAACAA 62.444 52.174 0.00 0.00 45.64 2.83
796 797 6.680522 GAGCCTCCTCAGCTTGGTAACAAT 62.681 50.000 0.00 0.00 46.16 2.71
810 811 5.461032 GGTAACAATGTCAAACAATCCCA 57.539 39.130 0.00 0.00 0.00 4.37
811 812 6.036577 GGTAACAATGTCAAACAATCCCAT 57.963 37.500 0.00 0.00 0.00 4.00
812 813 6.099341 GGTAACAATGTCAAACAATCCCATC 58.901 40.000 0.00 0.00 0.00 3.51
813 814 4.439305 ACAATGTCAAACAATCCCATCG 57.561 40.909 0.00 0.00 0.00 3.84
814 815 3.826157 ACAATGTCAAACAATCCCATCGT 59.174 39.130 0.00 0.00 0.00 3.73
815 816 4.168014 CAATGTCAAACAATCCCATCGTG 58.832 43.478 0.00 0.00 0.00 4.35
816 817 2.158559 TGTCAAACAATCCCATCGTGG 58.841 47.619 0.00 0.00 37.25 4.94
826 827 3.778619 CCATCGTGGGCTGTTATGA 57.221 52.632 0.00 0.00 32.67 2.15
827 828 2.036958 CCATCGTGGGCTGTTATGAA 57.963 50.000 0.00 0.00 32.67 2.57
828 829 2.364632 CCATCGTGGGCTGTTATGAAA 58.635 47.619 0.00 0.00 32.67 2.69
829 830 2.355756 CCATCGTGGGCTGTTATGAAAG 59.644 50.000 0.00 0.00 32.67 2.62
830 831 2.851263 TCGTGGGCTGTTATGAAAGT 57.149 45.000 0.00 0.00 0.00 2.66
831 832 3.134574 TCGTGGGCTGTTATGAAAGTT 57.865 42.857 0.00 0.00 0.00 2.66
832 833 3.482436 TCGTGGGCTGTTATGAAAGTTT 58.518 40.909 0.00 0.00 0.00 2.66
833 834 3.500680 TCGTGGGCTGTTATGAAAGTTTC 59.499 43.478 8.75 8.75 0.00 2.78
834 835 3.252215 CGTGGGCTGTTATGAAAGTTTCA 59.748 43.478 20.14 20.14 45.01 2.69
835 836 4.261405 CGTGGGCTGTTATGAAAGTTTCAA 60.261 41.667 21.57 8.99 43.95 2.69
836 837 5.564651 CGTGGGCTGTTATGAAAGTTTCAAT 60.565 40.000 21.57 12.60 43.95 2.57
837 838 5.634859 GTGGGCTGTTATGAAAGTTTCAATG 59.365 40.000 21.57 11.06 43.95 2.82
838 839 5.170748 GGGCTGTTATGAAAGTTTCAATGG 58.829 41.667 21.57 11.33 43.95 3.16
839 840 4.627035 GGCTGTTATGAAAGTTTCAATGGC 59.373 41.667 21.57 18.50 43.95 4.40
840 841 4.627035 GCTGTTATGAAAGTTTCAATGGCC 59.373 41.667 21.57 0.00 43.95 5.36
841 842 5.782047 CTGTTATGAAAGTTTCAATGGCCA 58.218 37.500 21.57 8.56 43.95 5.36
842 843 6.166984 TGTTATGAAAGTTTCAATGGCCAA 57.833 33.333 21.57 7.08 43.95 4.52
843 844 6.586344 TGTTATGAAAGTTTCAATGGCCAAA 58.414 32.000 21.57 0.00 43.95 3.28
844 845 7.050377 TGTTATGAAAGTTTCAATGGCCAAAA 58.950 30.769 21.57 2.49 43.95 2.44
845 846 7.554118 TGTTATGAAAGTTTCAATGGCCAAAAA 59.446 29.630 21.57 8.46 43.95 1.94
863 864 4.365514 AAAAAGCCCCCAAATGGTTAAG 57.634 40.909 0.00 0.00 0.00 1.85
864 865 2.713828 AAGCCCCCAAATGGTTAAGT 57.286 45.000 0.00 0.00 0.00 2.24
865 866 3.837399 AAGCCCCCAAATGGTTAAGTA 57.163 42.857 0.00 0.00 0.00 2.24
866 867 3.837399 AGCCCCCAAATGGTTAAGTAA 57.163 42.857 0.00 0.00 0.00 2.24
867 868 3.708451 AGCCCCCAAATGGTTAAGTAAG 58.292 45.455 0.00 0.00 0.00 2.34
868 869 3.335484 AGCCCCCAAATGGTTAAGTAAGA 59.665 43.478 0.00 0.00 0.00 2.10
869 870 3.699538 GCCCCCAAATGGTTAAGTAAGAG 59.300 47.826 0.00 0.00 0.00 2.85
870 871 3.699538 CCCCCAAATGGTTAAGTAAGAGC 59.300 47.826 0.00 0.00 0.00 4.09
871 872 4.569865 CCCCCAAATGGTTAAGTAAGAGCT 60.570 45.833 0.00 0.00 0.00 4.09
872 873 4.399303 CCCCAAATGGTTAAGTAAGAGCTG 59.601 45.833 0.00 0.00 0.00 4.24
873 874 4.142381 CCCAAATGGTTAAGTAAGAGCTGC 60.142 45.833 0.00 0.00 0.00 5.25
874 875 4.458989 CCAAATGGTTAAGTAAGAGCTGCA 59.541 41.667 1.02 0.00 0.00 4.41
875 876 5.393962 CAAATGGTTAAGTAAGAGCTGCAC 58.606 41.667 1.02 0.00 0.00 4.57
876 877 3.762407 TGGTTAAGTAAGAGCTGCACA 57.238 42.857 1.02 0.00 0.00 4.57
877 878 4.286297 TGGTTAAGTAAGAGCTGCACAT 57.714 40.909 1.02 0.00 0.00 3.21
878 879 4.651778 TGGTTAAGTAAGAGCTGCACATT 58.348 39.130 1.02 0.00 0.00 2.71
879 880 5.800296 TGGTTAAGTAAGAGCTGCACATTA 58.200 37.500 1.02 0.00 0.00 1.90
880 881 5.642063 TGGTTAAGTAAGAGCTGCACATTAC 59.358 40.000 1.02 7.86 0.00 1.89
881 882 5.064834 GGTTAAGTAAGAGCTGCACATTACC 59.935 44.000 1.02 0.00 0.00 2.85
882 883 3.981071 AGTAAGAGCTGCACATTACCA 57.019 42.857 1.02 0.00 0.00 3.25
883 884 3.600388 AGTAAGAGCTGCACATTACCAC 58.400 45.455 1.02 0.00 0.00 4.16
884 885 2.566833 AAGAGCTGCACATTACCACA 57.433 45.000 1.02 0.00 0.00 4.17
885 886 2.795231 AGAGCTGCACATTACCACAT 57.205 45.000 1.02 0.00 0.00 3.21
886 887 3.912496 AGAGCTGCACATTACCACATA 57.088 42.857 1.02 0.00 0.00 2.29
890 891 2.099098 GCTGCACATTACCACATAACCC 59.901 50.000 0.00 0.00 0.00 4.11
903 904 0.545787 ATAACCCCACCGTGGACTCA 60.546 55.000 19.81 1.90 40.96 3.41
906 907 1.990060 CCCCACCGTGGACTCAGAT 60.990 63.158 19.81 0.00 40.96 2.90
907 908 0.686441 CCCCACCGTGGACTCAGATA 60.686 60.000 19.81 0.00 40.96 1.98
919 921 0.669932 CTCAGATATGGAGCAGCGGC 60.670 60.000 0.00 0.00 41.61 6.53
920 922 1.070275 CAGATATGGAGCAGCGGCA 59.930 57.895 12.44 0.00 44.61 5.69
923 925 0.036577 GATATGGAGCAGCGGCATCT 60.037 55.000 12.44 0.00 44.61 2.90
924 926 0.036577 ATATGGAGCAGCGGCATCTC 60.037 55.000 12.44 7.83 44.61 2.75
925 927 1.117749 TATGGAGCAGCGGCATCTCT 61.118 55.000 12.44 3.02 44.61 3.10
926 928 1.980784 ATGGAGCAGCGGCATCTCTT 61.981 55.000 12.44 6.58 44.61 2.85
929 931 0.875474 GAGCAGCGGCATCTCTTCTC 60.875 60.000 12.44 0.00 44.61 2.87
945 947 1.523258 CTCCCATCTCTTGCCGCAG 60.523 63.158 0.00 0.00 0.00 5.18
956 958 4.802051 GCCGCAGCAGGATCCCAA 62.802 66.667 8.55 0.00 39.53 4.12
967 969 4.413520 AGCAGGATCCCAAATTAAGAGCTA 59.586 41.667 8.55 0.00 0.00 3.32
972 974 6.013812 AGGATCCCAAATTAAGAGCTAGCTAG 60.014 42.308 19.38 16.84 0.00 3.42
993 995 8.508883 GCTAGCTAGCTAATTATAGTACTCCA 57.491 38.462 33.71 0.00 45.62 3.86
999 1003 7.361457 AGCTAATTATAGTACTCCACAAGCA 57.639 36.000 0.00 0.00 0.00 3.91
1021 1025 4.303257 GCTTTTGCCGCCTAGAGT 57.697 55.556 0.00 0.00 40.15 3.24
1024 1028 0.036388 CTTTTGCCGCCTAGAGTCCA 60.036 55.000 0.00 0.00 0.00 4.02
1028 1032 2.840102 CCGCCTAGAGTCCAGGGG 60.840 72.222 13.76 13.76 43.82 4.79
1036 1040 2.943265 AGTCCAGGGGCAATGGCT 60.943 61.111 6.78 1.39 40.87 4.75
1041 1045 1.610554 CCAGGGGCAATGGCTTCTTG 61.611 60.000 6.78 0.00 40.87 3.02
1050 1054 0.036010 ATGGCTTCTTGGTCCTCACG 60.036 55.000 0.00 0.00 0.00 4.35
1051 1055 1.118965 TGGCTTCTTGGTCCTCACGA 61.119 55.000 0.00 0.00 0.00 4.35
1086 1090 0.603569 AGCACAACTACCTGACCGAG 59.396 55.000 0.00 0.00 0.00 4.63
1101 1105 1.218047 CGAGGAAGCCATCACGGAA 59.782 57.895 0.00 0.00 36.56 4.30
1104 1108 0.250513 AGGAAGCCATCACGGAACTC 59.749 55.000 0.00 0.00 36.56 3.01
1117 1121 1.579932 GAACTCGTCGAGGTGCTCA 59.420 57.895 25.25 0.00 33.35 4.26
1126 1130 1.063806 CGAGGTGCTCAAGAAAGTCG 58.936 55.000 0.00 0.00 0.00 4.18
1133 1137 2.218603 GCTCAAGAAAGTCGGGAACAA 58.781 47.619 0.00 0.00 0.00 2.83
1135 1139 2.206750 TCAAGAAAGTCGGGAACAACG 58.793 47.619 0.00 0.00 0.00 4.10
1158 1162 3.056328 GCGAAAGGCCTGGTGACC 61.056 66.667 5.69 0.00 34.80 4.02
1227 1231 3.844090 GAGTCGGAGGAGCAGGCC 61.844 72.222 0.00 0.00 0.00 5.19
1272 1276 2.894387 GTGATCCGCCTGCTGCTC 60.894 66.667 0.00 0.00 38.05 4.26
1371 1375 0.249398 ACTGCTTCGTATGGGACCAC 59.751 55.000 0.00 0.00 0.00 4.16
1374 1378 1.515954 CTTCGTATGGGACCACGCT 59.484 57.895 0.00 0.00 36.04 5.07
1378 1382 2.106683 GTATGGGACCACGCTGTGC 61.107 63.158 0.00 0.00 31.34 4.57
1380 1384 2.238847 TATGGGACCACGCTGTGCTC 62.239 60.000 0.00 0.54 31.34 4.26
1426 1430 2.125512 GGCTGCCAGACTACGTGG 60.126 66.667 15.17 0.00 38.21 4.94
1452 1456 2.320587 CCTGCGTGACAAGCTGTCC 61.321 63.158 14.49 5.00 46.40 4.02
1453 1457 1.301244 CTGCGTGACAAGCTGTCCT 60.301 57.895 14.49 0.00 46.40 3.85
1454 1458 0.882042 CTGCGTGACAAGCTGTCCTT 60.882 55.000 14.49 0.00 46.40 3.36
1484 1488 1.429927 CGGAAGCTGCTGATGCTCAG 61.430 60.000 1.35 8.34 46.90 3.35
1485 1489 1.096386 GGAAGCTGCTGATGCTCAGG 61.096 60.000 1.35 1.89 44.43 3.86
1587 1591 2.357517 AAAGCCGTCGACCTGCTG 60.358 61.111 23.28 4.40 35.08 4.41
1588 1592 3.165160 AAAGCCGTCGACCTGCTGT 62.165 57.895 23.28 17.25 35.08 4.40
1594 1598 0.861866 CGTCGACCTGCTGTACGATG 60.862 60.000 10.58 11.42 37.14 3.84
1605 1609 1.317431 TGTACGATGTCCAGGTCGGG 61.317 60.000 3.21 0.00 41.87 5.14
1646 1650 3.200593 GAGGCAGATGCTGTGCGG 61.201 66.667 4.59 0.00 42.19 5.69
1675 1679 4.720902 CCGCTGTGGGCATCACCA 62.721 66.667 0.00 0.00 45.48 4.17
1676 1680 2.438975 CGCTGTGGGCATCACCAT 60.439 61.111 6.92 0.00 45.48 3.55
1677 1681 2.475466 CGCTGTGGGCATCACCATC 61.475 63.158 6.92 0.00 45.48 3.51
1678 1682 1.378911 GCTGTGGGCATCACCATCA 60.379 57.895 6.92 0.00 45.48 3.07
1679 1683 1.660560 GCTGTGGGCATCACCATCAC 61.661 60.000 6.92 0.00 45.48 3.06
1680 1684 1.001020 TGTGGGCATCACCATCACC 60.001 57.895 6.92 0.00 45.48 4.02
1681 1685 1.001020 GTGGGCATCACCATCACCA 60.001 57.895 0.00 0.00 43.59 4.17
1682 1686 0.396139 GTGGGCATCACCATCACCAT 60.396 55.000 0.00 0.00 43.59 3.55
1683 1687 0.396001 TGGGCATCACCATCACCATG 60.396 55.000 0.00 0.00 42.05 3.66
1693 1697 2.118313 CATCACCATGGAGAAGCACA 57.882 50.000 21.47 0.00 0.00 4.57
1694 1698 2.439409 CATCACCATGGAGAAGCACAA 58.561 47.619 21.47 0.00 0.00 3.33
1695 1699 2.655090 TCACCATGGAGAAGCACAAA 57.345 45.000 21.47 0.00 0.00 2.83
1696 1700 2.229792 TCACCATGGAGAAGCACAAAC 58.770 47.619 21.47 0.00 0.00 2.93
1697 1701 1.270550 CACCATGGAGAAGCACAAACC 59.729 52.381 21.47 0.00 0.00 3.27
1698 1702 0.523072 CCATGGAGAAGCACAAACCG 59.477 55.000 5.56 0.00 0.00 4.44
1699 1703 0.109597 CATGGAGAAGCACAAACCGC 60.110 55.000 0.00 0.00 0.00 5.68
1700 1704 0.537143 ATGGAGAAGCACAAACCGCA 60.537 50.000 0.00 0.00 0.00 5.69
1701 1705 1.165907 TGGAGAAGCACAAACCGCAG 61.166 55.000 0.00 0.00 0.00 5.18
1702 1706 1.081840 GAGAAGCACAAACCGCAGC 60.082 57.895 0.00 0.00 0.00 5.25
1703 1707 2.050077 GAAGCACAAACCGCAGCC 60.050 61.111 0.00 0.00 0.00 4.85
1704 1708 3.879351 GAAGCACAAACCGCAGCCG 62.879 63.158 0.00 0.00 0.00 5.52
1705 1709 4.927782 AGCACAAACCGCAGCCGA 62.928 61.111 0.00 0.00 36.29 5.54
1706 1710 4.683334 GCACAAACCGCAGCCGAC 62.683 66.667 0.00 0.00 36.29 4.79
1707 1711 2.972505 CACAAACCGCAGCCGACT 60.973 61.111 0.00 0.00 36.29 4.18
1708 1712 2.665185 ACAAACCGCAGCCGACTC 60.665 61.111 0.00 0.00 36.29 3.36
1709 1713 3.423154 CAAACCGCAGCCGACTCC 61.423 66.667 0.00 0.00 36.29 3.85
1710 1714 3.626924 AAACCGCAGCCGACTCCT 61.627 61.111 0.00 0.00 36.29 3.69
1711 1715 3.883744 AAACCGCAGCCGACTCCTG 62.884 63.158 0.00 0.00 36.29 3.86
1726 1730 2.589494 CCTGCAGAGCTAGACAGGT 58.411 57.895 17.39 0.00 43.86 4.00
1727 1731 0.901124 CCTGCAGAGCTAGACAGGTT 59.099 55.000 17.39 0.00 43.86 3.50
1728 1732 1.134848 CCTGCAGAGCTAGACAGGTTC 60.135 57.143 17.39 0.00 43.86 3.62
1729 1733 0.528017 TGCAGAGCTAGACAGGTTCG 59.472 55.000 0.00 0.00 30.99 3.95
1730 1734 0.528470 GCAGAGCTAGACAGGTTCGT 59.472 55.000 0.00 0.00 30.99 3.85
1731 1735 1.743958 GCAGAGCTAGACAGGTTCGTA 59.256 52.381 0.00 0.00 30.99 3.43
1732 1736 2.478200 GCAGAGCTAGACAGGTTCGTAC 60.478 54.545 0.00 0.00 30.99 3.67
1733 1737 2.008329 AGAGCTAGACAGGTTCGTACG 58.992 52.381 9.53 9.53 30.99 3.67
1734 1738 1.736681 GAGCTAGACAGGTTCGTACGT 59.263 52.381 16.05 0.00 30.99 3.57
1735 1739 2.157738 AGCTAGACAGGTTCGTACGTT 58.842 47.619 16.05 0.00 0.00 3.99
1736 1740 2.161211 AGCTAGACAGGTTCGTACGTTC 59.839 50.000 16.05 9.31 0.00 3.95
1737 1741 2.161211 GCTAGACAGGTTCGTACGTTCT 59.839 50.000 16.05 8.40 0.00 3.01
1738 1742 3.365767 GCTAGACAGGTTCGTACGTTCTT 60.366 47.826 16.05 3.33 0.00 2.52
1739 1743 3.279853 AGACAGGTTCGTACGTTCTTC 57.720 47.619 16.05 5.80 0.00 2.87
1740 1744 2.883386 AGACAGGTTCGTACGTTCTTCT 59.117 45.455 16.05 7.92 0.00 2.85
1741 1745 2.978489 GACAGGTTCGTACGTTCTTCTG 59.022 50.000 16.05 17.09 0.00 3.02
1742 1746 2.620115 ACAGGTTCGTACGTTCTTCTGA 59.380 45.455 16.05 0.00 0.00 3.27
1743 1747 3.255149 ACAGGTTCGTACGTTCTTCTGAT 59.745 43.478 16.05 5.89 0.00 2.90
1744 1748 4.456911 ACAGGTTCGTACGTTCTTCTGATA 59.543 41.667 16.05 0.00 0.00 2.15
1745 1749 4.792189 CAGGTTCGTACGTTCTTCTGATAC 59.208 45.833 16.05 0.00 0.00 2.24
1746 1750 4.456911 AGGTTCGTACGTTCTTCTGATACA 59.543 41.667 16.05 0.00 0.00 2.29
1747 1751 5.125097 AGGTTCGTACGTTCTTCTGATACAT 59.875 40.000 16.05 0.00 0.00 2.29
1748 1752 6.317140 AGGTTCGTACGTTCTTCTGATACATA 59.683 38.462 16.05 0.00 0.00 2.29
1749 1753 6.413235 GGTTCGTACGTTCTTCTGATACATAC 59.587 42.308 16.05 0.00 0.00 2.39
1750 1754 6.052840 TCGTACGTTCTTCTGATACATACC 57.947 41.667 16.05 0.00 0.00 2.73
1751 1755 5.585844 TCGTACGTTCTTCTGATACATACCA 59.414 40.000 16.05 0.00 0.00 3.25
1752 1756 5.680229 CGTACGTTCTTCTGATACATACCAC 59.320 44.000 7.22 0.00 0.00 4.16
1753 1757 5.654603 ACGTTCTTCTGATACATACCACA 57.345 39.130 0.00 0.00 0.00 4.17
1754 1758 5.408356 ACGTTCTTCTGATACATACCACAC 58.592 41.667 0.00 0.00 0.00 3.82
1755 1759 4.499399 CGTTCTTCTGATACATACCACACG 59.501 45.833 0.00 0.00 0.00 4.49
1756 1760 4.041740 TCTTCTGATACATACCACACGC 57.958 45.455 0.00 0.00 0.00 5.34
1757 1761 3.699538 TCTTCTGATACATACCACACGCT 59.300 43.478 0.00 0.00 0.00 5.07
1758 1762 4.159693 TCTTCTGATACATACCACACGCTT 59.840 41.667 0.00 0.00 0.00 4.68
1759 1763 5.358725 TCTTCTGATACATACCACACGCTTA 59.641 40.000 0.00 0.00 0.00 3.09
1760 1764 5.183014 TCTGATACATACCACACGCTTAG 57.817 43.478 0.00 0.00 0.00 2.18
1761 1765 3.713288 TGATACATACCACACGCTTAGC 58.287 45.455 0.00 0.00 0.00 3.09
1762 1766 2.589798 TACATACCACACGCTTAGCC 57.410 50.000 0.00 0.00 0.00 3.93
1763 1767 0.611200 ACATACCACACGCTTAGCCA 59.389 50.000 0.00 0.00 0.00 4.75
1764 1768 1.209504 ACATACCACACGCTTAGCCAT 59.790 47.619 0.00 0.00 0.00 4.40
1765 1769 1.599071 CATACCACACGCTTAGCCATG 59.401 52.381 0.00 0.00 0.00 3.66
1766 1770 0.742990 TACCACACGCTTAGCCATGC 60.743 55.000 0.00 0.00 0.00 4.06
1767 1771 1.746615 CCACACGCTTAGCCATGCT 60.747 57.895 0.00 0.00 43.41 3.79
1768 1772 1.709147 CCACACGCTTAGCCATGCTC 61.709 60.000 0.00 0.00 40.44 4.26
1769 1773 1.020861 CACACGCTTAGCCATGCTCA 61.021 55.000 0.00 0.00 40.44 4.26
1770 1774 0.321564 ACACGCTTAGCCATGCTCAA 60.322 50.000 0.00 0.00 40.44 3.02
1771 1775 0.804364 CACGCTTAGCCATGCTCAAA 59.196 50.000 0.00 0.00 40.44 2.69
1772 1776 0.804989 ACGCTTAGCCATGCTCAAAC 59.195 50.000 0.00 0.00 40.44 2.93
1773 1777 0.804364 CGCTTAGCCATGCTCAAACA 59.196 50.000 0.00 0.00 40.44 2.83
1774 1778 1.199789 CGCTTAGCCATGCTCAAACAA 59.800 47.619 0.00 0.00 40.44 2.83
1775 1779 2.730090 CGCTTAGCCATGCTCAAACAAG 60.730 50.000 0.00 0.00 40.44 3.16
1776 1780 2.229784 GCTTAGCCATGCTCAAACAAGT 59.770 45.455 0.00 0.00 40.44 3.16
1777 1781 3.305608 GCTTAGCCATGCTCAAACAAGTT 60.306 43.478 0.00 0.00 40.44 2.66
1778 1782 4.797275 GCTTAGCCATGCTCAAACAAGTTT 60.797 41.667 0.00 0.00 40.44 2.66
1780 1784 1.528161 GCCATGCTCAAACAAGTTTGC 59.472 47.619 18.29 10.10 46.92 3.68
1781 1785 2.137523 CCATGCTCAAACAAGTTTGCC 58.862 47.619 18.29 12.74 46.92 4.52
1782 1786 2.483363 CCATGCTCAAACAAGTTTGCCA 60.483 45.455 18.29 16.84 46.92 4.92
1783 1787 2.582728 TGCTCAAACAAGTTTGCCAG 57.417 45.000 18.29 13.27 46.92 4.85
1784 1788 1.824230 TGCTCAAACAAGTTTGCCAGT 59.176 42.857 18.29 0.00 46.92 4.00
1785 1789 2.233431 TGCTCAAACAAGTTTGCCAGTT 59.767 40.909 18.29 0.00 46.92 3.16
1786 1790 3.445450 TGCTCAAACAAGTTTGCCAGTTA 59.555 39.130 18.29 2.42 46.92 2.24
1787 1791 3.796717 GCTCAAACAAGTTTGCCAGTTAC 59.203 43.478 18.29 2.19 46.92 2.50
1788 1792 4.676723 GCTCAAACAAGTTTGCCAGTTACA 60.677 41.667 18.29 1.18 46.92 2.41
1789 1793 5.392767 TCAAACAAGTTTGCCAGTTACAA 57.607 34.783 18.29 0.00 46.92 2.41
1790 1794 5.971763 TCAAACAAGTTTGCCAGTTACAAT 58.028 33.333 18.29 0.00 46.92 2.71
1791 1795 6.402222 TCAAACAAGTTTGCCAGTTACAATT 58.598 32.000 18.29 0.00 46.92 2.32
1792 1796 7.548097 TCAAACAAGTTTGCCAGTTACAATTA 58.452 30.769 18.29 0.00 46.92 1.40
1793 1797 8.035394 TCAAACAAGTTTGCCAGTTACAATTAA 58.965 29.630 18.29 0.00 46.92 1.40
1794 1798 8.327429 CAAACAAGTTTGCCAGTTACAATTAAG 58.673 33.333 12.18 0.00 42.66 1.85
1795 1799 6.512297 ACAAGTTTGCCAGTTACAATTAAGG 58.488 36.000 0.00 0.00 0.00 2.69
1796 1800 6.097696 ACAAGTTTGCCAGTTACAATTAAGGT 59.902 34.615 0.00 0.00 0.00 3.50
1797 1801 6.724893 AGTTTGCCAGTTACAATTAAGGTT 57.275 33.333 0.00 0.00 0.00 3.50
1798 1802 7.119709 AGTTTGCCAGTTACAATTAAGGTTT 57.880 32.000 0.00 0.00 0.00 3.27
1799 1803 7.561251 AGTTTGCCAGTTACAATTAAGGTTTT 58.439 30.769 0.00 0.00 0.00 2.43
1800 1804 7.709182 AGTTTGCCAGTTACAATTAAGGTTTTC 59.291 33.333 0.00 0.00 0.00 2.29
1801 1805 6.969993 TGCCAGTTACAATTAAGGTTTTCT 57.030 33.333 0.00 0.00 0.00 2.52
1802 1806 8.466617 TTGCCAGTTACAATTAAGGTTTTCTA 57.533 30.769 0.00 0.00 0.00 2.10
1803 1807 8.106247 TGCCAGTTACAATTAAGGTTTTCTAG 57.894 34.615 0.00 0.00 0.00 2.43
1804 1808 7.722285 TGCCAGTTACAATTAAGGTTTTCTAGT 59.278 33.333 0.00 0.00 0.00 2.57
1805 1809 9.223099 GCCAGTTACAATTAAGGTTTTCTAGTA 57.777 33.333 0.00 0.00 0.00 1.82
1816 1820 9.569122 TTAAGGTTTTCTAGTATCTGTTTTGCT 57.431 29.630 0.00 0.00 0.00 3.91
1818 1822 9.569122 AAGGTTTTCTAGTATCTGTTTTGCTAA 57.431 29.630 0.00 0.00 0.00 3.09
1819 1823 9.569122 AGGTTTTCTAGTATCTGTTTTGCTAAA 57.431 29.630 0.00 0.00 0.00 1.85
1820 1824 9.827411 GGTTTTCTAGTATCTGTTTTGCTAAAG 57.173 33.333 0.00 0.00 0.00 1.85
1823 1827 7.596749 TCTAGTATCTGTTTTGCTAAAGTGC 57.403 36.000 0.00 0.00 0.00 4.40
1824 1828 7.158697 TCTAGTATCTGTTTTGCTAAAGTGCA 58.841 34.615 0.00 0.00 41.65 4.57
1825 1829 6.824305 AGTATCTGTTTTGCTAAAGTGCAT 57.176 33.333 0.00 0.00 42.96 3.96
1826 1830 6.846350 AGTATCTGTTTTGCTAAAGTGCATC 58.154 36.000 0.00 0.00 42.96 3.91
1827 1831 5.972107 ATCTGTTTTGCTAAAGTGCATCT 57.028 34.783 0.00 0.00 42.96 2.90
1828 1832 7.824289 AGTATCTGTTTTGCTAAAGTGCATCTA 59.176 33.333 0.00 0.00 42.96 1.98
1829 1833 6.486253 TCTGTTTTGCTAAAGTGCATCTAG 57.514 37.500 0.00 0.00 42.96 2.43
1830 1834 6.230472 TCTGTTTTGCTAAAGTGCATCTAGA 58.770 36.000 0.00 0.00 42.96 2.43
1831 1835 6.881065 TCTGTTTTGCTAAAGTGCATCTAGAT 59.119 34.615 0.00 0.00 42.96 1.98
1832 1836 8.040727 TCTGTTTTGCTAAAGTGCATCTAGATA 58.959 33.333 4.54 0.00 42.96 1.98
1833 1837 8.737168 TGTTTTGCTAAAGTGCATCTAGATAT 57.263 30.769 4.54 0.00 42.96 1.63
1834 1838 8.615211 TGTTTTGCTAAAGTGCATCTAGATATG 58.385 33.333 4.54 0.00 42.96 1.78
1847 1851 6.481644 GCATCTAGATATGCCCTAAGTATTGC 59.518 42.308 4.54 0.00 45.31 3.56
1848 1852 7.559486 CATCTAGATATGCCCTAAGTATTGCA 58.441 38.462 4.54 0.00 38.23 4.08
1849 1853 6.936279 TCTAGATATGCCCTAAGTATTGCAC 58.064 40.000 0.00 0.00 36.41 4.57
1850 1854 5.567037 AGATATGCCCTAAGTATTGCACA 57.433 39.130 0.00 0.00 36.41 4.57
1851 1855 6.131972 AGATATGCCCTAAGTATTGCACAT 57.868 37.500 0.00 0.00 36.41 3.21
1852 1856 6.176183 AGATATGCCCTAAGTATTGCACATC 58.824 40.000 0.00 0.00 37.79 3.06
1853 1857 3.643199 TGCCCTAAGTATTGCACATCA 57.357 42.857 0.00 0.00 0.00 3.07
1854 1858 3.961849 TGCCCTAAGTATTGCACATCAA 58.038 40.909 0.00 0.00 39.32 2.57
1855 1859 4.339748 TGCCCTAAGTATTGCACATCAAA 58.660 39.130 0.00 0.00 38.34 2.69
1856 1860 4.398988 TGCCCTAAGTATTGCACATCAAAG 59.601 41.667 0.00 0.00 38.34 2.77
1857 1861 4.399303 GCCCTAAGTATTGCACATCAAAGT 59.601 41.667 0.00 0.00 38.34 2.66
1858 1862 5.449177 GCCCTAAGTATTGCACATCAAAGTC 60.449 44.000 0.00 0.00 38.34 3.01
1859 1863 5.066505 CCCTAAGTATTGCACATCAAAGTCC 59.933 44.000 0.00 0.00 38.34 3.85
1860 1864 5.882557 CCTAAGTATTGCACATCAAAGTCCT 59.117 40.000 0.00 0.00 38.34 3.85
1861 1865 7.047891 CCTAAGTATTGCACATCAAAGTCCTA 58.952 38.462 0.00 0.00 38.34 2.94
1862 1866 7.716998 CCTAAGTATTGCACATCAAAGTCCTAT 59.283 37.037 0.00 0.00 38.34 2.57
1863 1867 6.932356 AGTATTGCACATCAAAGTCCTATG 57.068 37.500 0.00 0.00 38.34 2.23
1864 1868 6.418101 AGTATTGCACATCAAAGTCCTATGT 58.582 36.000 0.00 0.00 38.34 2.29
1865 1869 5.824904 ATTGCACATCAAAGTCCTATGTC 57.175 39.130 0.00 0.00 38.34 3.06
1866 1870 4.284829 TGCACATCAAAGTCCTATGTCA 57.715 40.909 0.00 0.00 31.60 3.58
1867 1871 4.847198 TGCACATCAAAGTCCTATGTCAT 58.153 39.130 0.00 0.00 31.60 3.06
1868 1872 5.255687 TGCACATCAAAGTCCTATGTCATT 58.744 37.500 0.00 0.00 31.60 2.57
1869 1873 5.124297 TGCACATCAAAGTCCTATGTCATTG 59.876 40.000 0.00 0.00 31.60 2.82
1870 1874 5.124457 GCACATCAAAGTCCTATGTCATTGT 59.876 40.000 0.00 0.00 31.60 2.71
1871 1875 6.349611 GCACATCAAAGTCCTATGTCATTGTT 60.350 38.462 0.00 0.00 31.60 2.83
1872 1876 7.596494 CACATCAAAGTCCTATGTCATTGTTT 58.404 34.615 0.00 0.00 31.60 2.83
1873 1877 8.084073 CACATCAAAGTCCTATGTCATTGTTTT 58.916 33.333 0.00 0.00 31.60 2.43
1874 1878 8.641541 ACATCAAAGTCCTATGTCATTGTTTTT 58.358 29.630 0.00 0.00 0.00 1.94
1878 1882 9.912634 CAAAGTCCTATGTCATTGTTTTTATGT 57.087 29.630 0.00 0.00 0.00 2.29
1879 1883 9.912634 AAAGTCCTATGTCATTGTTTTTATGTG 57.087 29.630 0.00 0.00 0.00 3.21
1880 1884 8.055279 AGTCCTATGTCATTGTTTTTATGTGG 57.945 34.615 0.00 0.00 0.00 4.17
1881 1885 7.888021 AGTCCTATGTCATTGTTTTTATGTGGA 59.112 33.333 0.00 0.00 0.00 4.02
1882 1886 8.519526 GTCCTATGTCATTGTTTTTATGTGGAA 58.480 33.333 0.00 0.00 0.00 3.53
1883 1887 9.083422 TCCTATGTCATTGTTTTTATGTGGAAA 57.917 29.630 0.00 0.00 0.00 3.13
1884 1888 9.874205 CCTATGTCATTGTTTTTATGTGGAAAT 57.126 29.630 0.00 0.00 0.00 2.17
1887 1891 9.775854 ATGTCATTGTTTTTATGTGGAAATTCA 57.224 25.926 0.00 0.00 0.00 2.57
1888 1892 9.775854 TGTCATTGTTTTTATGTGGAAATTCAT 57.224 25.926 0.00 0.00 0.00 2.57
1890 1894 8.719648 TCATTGTTTTTATGTGGAAATTCATGC 58.280 29.630 0.00 0.00 0.00 4.06
1891 1895 8.504815 CATTGTTTTTATGTGGAAATTCATGCA 58.495 29.630 0.00 0.00 0.00 3.96
1892 1896 8.442632 TTGTTTTTATGTGGAAATTCATGCAA 57.557 26.923 0.00 0.00 0.00 4.08
1893 1897 8.442632 TGTTTTTATGTGGAAATTCATGCAAA 57.557 26.923 0.00 0.00 0.00 3.68
1894 1898 8.341173 TGTTTTTATGTGGAAATTCATGCAAAC 58.659 29.630 0.00 0.00 33.23 2.93
1895 1899 8.341173 GTTTTTATGTGGAAATTCATGCAAACA 58.659 29.630 0.00 0.00 33.07 2.83
1896 1900 8.618702 TTTTATGTGGAAATTCATGCAAACAT 57.381 26.923 0.00 0.00 36.79 2.71
1897 1901 8.618702 TTTATGTGGAAATTCATGCAAACATT 57.381 26.923 0.00 0.00 32.87 2.71
1898 1902 8.618702 TTATGTGGAAATTCATGCAAACATTT 57.381 26.923 0.00 0.00 32.87 2.32
1899 1903 6.939132 TGTGGAAATTCATGCAAACATTTT 57.061 29.167 0.00 0.00 32.87 1.82
1900 1904 7.330900 TGTGGAAATTCATGCAAACATTTTT 57.669 28.000 0.00 0.00 32.87 1.94
1948 1952 9.071276 ACTAATTTGATTGAGTCACTTTCATGT 57.929 29.630 0.00 0.00 36.32 3.21
1949 1953 9.338291 CTAATTTGATTGAGTCACTTTCATGTG 57.662 33.333 0.00 0.00 36.32 3.21
1950 1954 4.754372 TGATTGAGTCACTTTCATGTGC 57.246 40.909 0.00 0.00 37.81 4.57
1951 1955 4.136051 TGATTGAGTCACTTTCATGTGCA 58.864 39.130 0.00 0.00 37.81 4.57
1952 1956 4.579753 TGATTGAGTCACTTTCATGTGCAA 59.420 37.500 0.00 0.00 37.81 4.08
1953 1957 5.242171 TGATTGAGTCACTTTCATGTGCAAT 59.758 36.000 0.00 0.00 37.81 3.56
1954 1958 6.430616 TGATTGAGTCACTTTCATGTGCAATA 59.569 34.615 0.00 0.00 37.81 1.90
1955 1959 6.631971 TTGAGTCACTTTCATGTGCAATAA 57.368 33.333 0.00 0.00 37.81 1.40
1956 1960 6.822667 TGAGTCACTTTCATGTGCAATAAT 57.177 33.333 0.00 0.00 37.81 1.28
1957 1961 7.218228 TGAGTCACTTTCATGTGCAATAATT 57.782 32.000 0.00 0.00 37.81 1.40
1958 1962 7.660112 TGAGTCACTTTCATGTGCAATAATTT 58.340 30.769 0.00 0.00 37.81 1.82
1959 1963 7.595875 TGAGTCACTTTCATGTGCAATAATTTG 59.404 33.333 0.00 0.00 37.81 2.32
2008 2012 8.846211 ACAACAAATTATATGTGTATACTGCCC 58.154 33.333 4.17 0.00 0.00 5.36
2009 2013 8.845227 CAACAAATTATATGTGTATACTGCCCA 58.155 33.333 4.17 0.00 0.00 5.36
2010 2014 8.988546 ACAAATTATATGTGTATACTGCCCAA 57.011 30.769 4.17 0.00 0.00 4.12
2011 2015 9.415008 ACAAATTATATGTGTATACTGCCCAAA 57.585 29.630 4.17 0.00 0.00 3.28
2017 2021 6.942532 ATGTGTATACTGCCCAAATTAGTG 57.057 37.500 4.17 0.00 0.00 2.74
2018 2022 4.638421 TGTGTATACTGCCCAAATTAGTGC 59.362 41.667 4.17 0.00 0.00 4.40
2019 2023 4.638421 GTGTATACTGCCCAAATTAGTGCA 59.362 41.667 4.17 0.00 0.00 4.57
2020 2024 4.638421 TGTATACTGCCCAAATTAGTGCAC 59.362 41.667 9.40 9.40 0.00 4.57
2021 2025 1.256812 ACTGCCCAAATTAGTGCACC 58.743 50.000 14.63 0.00 0.00 5.01
2022 2026 1.255882 CTGCCCAAATTAGTGCACCA 58.744 50.000 14.63 0.00 0.00 4.17
2023 2027 1.826720 CTGCCCAAATTAGTGCACCAT 59.173 47.619 14.63 2.86 0.00 3.55
2024 2028 3.023119 CTGCCCAAATTAGTGCACCATA 58.977 45.455 14.63 0.00 0.00 2.74
2025 2029 3.435275 TGCCCAAATTAGTGCACCATAA 58.565 40.909 14.63 7.14 0.00 1.90
2026 2030 4.029520 TGCCCAAATTAGTGCACCATAAT 58.970 39.130 14.63 9.34 0.00 1.28
2027 2031 4.469227 TGCCCAAATTAGTGCACCATAATT 59.531 37.500 14.63 14.83 33.97 1.40
2028 2032 5.046014 TGCCCAAATTAGTGCACCATAATTT 60.046 36.000 21.94 21.94 40.48 1.82
2051 2055 2.452006 GGATACGTTTTGTCATGCCG 57.548 50.000 0.00 0.00 0.00 5.69
2052 2056 2.004017 GGATACGTTTTGTCATGCCGA 58.996 47.619 0.00 0.00 0.00 5.54
2053 2057 2.612212 GGATACGTTTTGTCATGCCGAT 59.388 45.455 0.00 0.00 0.00 4.18
2054 2058 3.805422 GGATACGTTTTGTCATGCCGATA 59.195 43.478 0.00 0.00 0.00 2.92
2055 2059 4.271533 GGATACGTTTTGTCATGCCGATAA 59.728 41.667 0.00 0.00 0.00 1.75
2056 2060 5.049680 GGATACGTTTTGTCATGCCGATAAT 60.050 40.000 0.00 0.00 0.00 1.28
2057 2061 4.273005 ACGTTTTGTCATGCCGATAATC 57.727 40.909 0.00 0.00 0.00 1.75
2058 2062 3.064820 ACGTTTTGTCATGCCGATAATCC 59.935 43.478 0.00 0.00 0.00 3.01
2059 2063 3.064682 CGTTTTGTCATGCCGATAATCCA 59.935 43.478 0.00 0.00 0.00 3.41
2060 2064 4.261155 CGTTTTGTCATGCCGATAATCCAT 60.261 41.667 0.00 0.00 0.00 3.41
2061 2065 5.215160 GTTTTGTCATGCCGATAATCCATC 58.785 41.667 0.00 0.00 0.00 3.51
2062 2066 3.057969 TGTCATGCCGATAATCCATCC 57.942 47.619 0.00 0.00 0.00 3.51
2063 2067 2.290260 TGTCATGCCGATAATCCATCCC 60.290 50.000 0.00 0.00 0.00 3.85
2064 2068 2.026822 GTCATGCCGATAATCCATCCCT 60.027 50.000 0.00 0.00 0.00 4.20
2065 2069 3.197766 GTCATGCCGATAATCCATCCCTA 59.802 47.826 0.00 0.00 0.00 3.53
2066 2070 3.452264 TCATGCCGATAATCCATCCCTAG 59.548 47.826 0.00 0.00 0.00 3.02
2067 2071 3.184382 TGCCGATAATCCATCCCTAGA 57.816 47.619 0.00 0.00 0.00 2.43
2068 2072 3.516586 TGCCGATAATCCATCCCTAGAA 58.483 45.455 0.00 0.00 0.00 2.10
2069 2073 3.907474 TGCCGATAATCCATCCCTAGAAA 59.093 43.478 0.00 0.00 0.00 2.52
2070 2074 4.349636 TGCCGATAATCCATCCCTAGAAAA 59.650 41.667 0.00 0.00 0.00 2.29
2071 2075 5.014123 TGCCGATAATCCATCCCTAGAAAAT 59.986 40.000 0.00 0.00 0.00 1.82
2072 2076 5.355350 GCCGATAATCCATCCCTAGAAAATG 59.645 44.000 0.00 0.00 0.00 2.32
2073 2077 6.476378 CCGATAATCCATCCCTAGAAAATGT 58.524 40.000 0.00 0.00 0.00 2.71
2074 2078 6.595716 CCGATAATCCATCCCTAGAAAATGTC 59.404 42.308 0.00 0.00 0.00 3.06
2075 2079 6.595716 CGATAATCCATCCCTAGAAAATGTCC 59.404 42.308 0.00 0.00 0.00 4.02
2076 2080 7.527868 CGATAATCCATCCCTAGAAAATGTCCT 60.528 40.741 0.00 0.00 0.00 3.85
2077 2081 8.757307 ATAATCCATCCCTAGAAAATGTCCTA 57.243 34.615 0.00 0.00 0.00 2.94
2078 2082 7.465900 AATCCATCCCTAGAAAATGTCCTAA 57.534 36.000 0.00 0.00 0.00 2.69
2079 2083 7.654287 ATCCATCCCTAGAAAATGTCCTAAT 57.346 36.000 0.00 0.00 0.00 1.73
2080 2084 7.465900 TCCATCCCTAGAAAATGTCCTAATT 57.534 36.000 0.00 0.00 0.00 1.40
2081 2085 7.882755 TCCATCCCTAGAAAATGTCCTAATTT 58.117 34.615 0.00 0.00 0.00 1.82
2082 2086 8.343787 TCCATCCCTAGAAAATGTCCTAATTTT 58.656 33.333 0.00 0.00 41.34 1.82
2092 2096 9.710900 GAAAATGTCCTAATTTTCCATCTTGTT 57.289 29.630 10.04 0.00 44.99 2.83
2093 2097 9.710900 AAAATGTCCTAATTTTCCATCTTGTTC 57.289 29.630 0.00 0.00 35.33 3.18
2094 2098 8.421249 AATGTCCTAATTTTCCATCTTGTTCA 57.579 30.769 0.00 0.00 0.00 3.18
2095 2099 8.599624 ATGTCCTAATTTTCCATCTTGTTCAT 57.400 30.769 0.00 0.00 0.00 2.57
2096 2100 7.829725 TGTCCTAATTTTCCATCTTGTTCATG 58.170 34.615 0.00 0.00 0.00 3.07
2097 2101 7.669304 TGTCCTAATTTTCCATCTTGTTCATGA 59.331 33.333 0.00 0.00 0.00 3.07
2098 2102 8.689972 GTCCTAATTTTCCATCTTGTTCATGAT 58.310 33.333 0.00 0.00 0.00 2.45
2099 2103 9.258629 TCCTAATTTTCCATCTTGTTCATGATT 57.741 29.630 0.00 0.00 0.00 2.57
2100 2104 9.309516 CCTAATTTTCCATCTTGTTCATGATTG 57.690 33.333 0.00 0.00 0.00 2.67
2101 2105 7.605410 AATTTTCCATCTTGTTCATGATTGC 57.395 32.000 0.00 0.00 0.00 3.56
2102 2106 5.725325 TTTCCATCTTGTTCATGATTGCA 57.275 34.783 0.00 0.00 0.00 4.08
2103 2107 4.976224 TCCATCTTGTTCATGATTGCAG 57.024 40.909 0.00 0.00 0.00 4.41
2104 2108 4.338012 TCCATCTTGTTCATGATTGCAGT 58.662 39.130 0.00 0.00 0.00 4.40
2105 2109 4.397103 TCCATCTTGTTCATGATTGCAGTC 59.603 41.667 1.56 1.56 0.00 3.51
2106 2110 4.157105 CCATCTTGTTCATGATTGCAGTCA 59.843 41.667 14.80 14.80 0.00 3.41
2107 2111 5.163550 CCATCTTGTTCATGATTGCAGTCAT 60.164 40.000 18.17 18.17 39.34 3.06
2108 2112 6.038936 CCATCTTGTTCATGATTGCAGTCATA 59.961 38.462 22.60 7.42 36.72 2.15
2109 2113 7.415877 CCATCTTGTTCATGATTGCAGTCATAA 60.416 37.037 22.60 13.18 36.72 1.90
2110 2114 7.451501 TCTTGTTCATGATTGCAGTCATAAA 57.548 32.000 22.60 13.57 36.72 1.40
2111 2115 7.532571 TCTTGTTCATGATTGCAGTCATAAAG 58.467 34.615 22.60 20.53 36.72 1.85
2112 2116 5.643664 TGTTCATGATTGCAGTCATAAAGC 58.356 37.500 22.60 15.94 36.72 3.51
2113 2117 5.183522 TGTTCATGATTGCAGTCATAAAGCA 59.816 36.000 22.60 17.92 36.72 3.91
2114 2118 5.494632 TCATGATTGCAGTCATAAAGCAG 57.505 39.130 22.60 10.74 39.72 4.24
2115 2119 3.770263 TGATTGCAGTCATAAAGCAGC 57.230 42.857 7.97 0.00 39.72 5.25
2116 2120 2.096335 TGATTGCAGTCATAAAGCAGCG 59.904 45.455 7.97 0.00 39.72 5.18
2117 2121 0.804364 TTGCAGTCATAAAGCAGCGG 59.196 50.000 0.00 0.00 39.72 5.52
2118 2122 1.026182 TGCAGTCATAAAGCAGCGGG 61.026 55.000 0.00 0.00 33.75 6.13
2119 2123 1.718757 GCAGTCATAAAGCAGCGGGG 61.719 60.000 0.00 0.00 0.00 5.73
2120 2124 1.452108 AGTCATAAAGCAGCGGGGC 60.452 57.895 0.00 0.00 0.00 5.80
2121 2125 2.124320 TCATAAAGCAGCGGGGCC 60.124 61.111 0.00 0.00 0.00 5.80
2122 2126 2.440065 CATAAAGCAGCGGGGCCA 60.440 61.111 4.39 0.00 0.00 5.36
2123 2127 1.829533 CATAAAGCAGCGGGGCCAT 60.830 57.895 4.39 0.00 0.00 4.40
2124 2128 1.529244 ATAAAGCAGCGGGGCCATC 60.529 57.895 4.39 0.00 0.00 3.51
2125 2129 1.999634 ATAAAGCAGCGGGGCCATCT 62.000 55.000 4.39 0.00 0.00 2.90
2126 2130 2.608970 TAAAGCAGCGGGGCCATCTC 62.609 60.000 4.39 0.00 0.00 2.75
2129 2133 3.473647 CAGCGGGGCCATCTCAGA 61.474 66.667 4.39 0.00 0.00 3.27
2130 2134 3.474570 AGCGGGGCCATCTCAGAC 61.475 66.667 4.39 0.00 0.00 3.51
2131 2135 3.785859 GCGGGGCCATCTCAGACA 61.786 66.667 4.39 0.00 0.00 3.41
2132 2136 3.112205 GCGGGGCCATCTCAGACAT 62.112 63.158 4.39 0.00 0.00 3.06
2133 2137 1.070445 CGGGGCCATCTCAGACATC 59.930 63.158 4.39 0.00 0.00 3.06
2134 2138 1.406065 CGGGGCCATCTCAGACATCT 61.406 60.000 4.39 0.00 0.00 2.90
2135 2139 0.108207 GGGGCCATCTCAGACATCTG 59.892 60.000 4.39 2.24 45.08 2.90
2136 2140 0.835941 GGGCCATCTCAGACATCTGT 59.164 55.000 4.39 0.00 44.12 3.41
2137 2141 1.211457 GGGCCATCTCAGACATCTGTT 59.789 52.381 4.39 0.00 44.12 3.16
2138 2142 2.435805 GGGCCATCTCAGACATCTGTTA 59.564 50.000 4.39 0.00 44.12 2.41
2139 2143 3.072184 GGGCCATCTCAGACATCTGTTAT 59.928 47.826 4.39 1.67 44.12 1.89
2140 2144 4.063689 GGCCATCTCAGACATCTGTTATG 58.936 47.826 8.70 12.10 44.12 1.90
2141 2145 4.202295 GGCCATCTCAGACATCTGTTATGA 60.202 45.833 19.14 10.90 44.12 2.15
2142 2146 4.749099 GCCATCTCAGACATCTGTTATGAC 59.251 45.833 19.14 10.20 44.12 3.06
2143 2147 5.683249 GCCATCTCAGACATCTGTTATGACA 60.683 44.000 19.14 0.00 44.12 3.58
2155 2159 4.993705 TGTTATGACAGAAAAGACCCCT 57.006 40.909 0.00 0.00 0.00 4.79
2157 2161 6.442541 TGTTATGACAGAAAAGACCCCTAA 57.557 37.500 0.00 0.00 0.00 2.69
2158 2162 6.843752 TGTTATGACAGAAAAGACCCCTAAA 58.156 36.000 0.00 0.00 0.00 1.85
2159 2163 7.466804 TGTTATGACAGAAAAGACCCCTAAAT 58.533 34.615 0.00 0.00 0.00 1.40
2160 2164 7.393234 TGTTATGACAGAAAAGACCCCTAAATG 59.607 37.037 0.00 0.00 0.00 2.32
2161 2165 4.662278 TGACAGAAAAGACCCCTAAATGG 58.338 43.478 0.00 0.00 0.00 3.16
2162 2166 4.105697 TGACAGAAAAGACCCCTAAATGGT 59.894 41.667 0.00 0.00 39.32 3.55
2163 2167 5.311121 TGACAGAAAAGACCCCTAAATGGTA 59.689 40.000 0.00 0.00 35.85 3.25
2164 2168 6.183361 TGACAGAAAAGACCCCTAAATGGTAA 60.183 38.462 0.00 0.00 35.85 2.85
2165 2169 6.800890 ACAGAAAAGACCCCTAAATGGTAAT 58.199 36.000 0.00 0.00 35.85 1.89
2166 2170 6.663523 ACAGAAAAGACCCCTAAATGGTAATG 59.336 38.462 0.00 0.00 35.85 1.90
2167 2171 6.096846 CAGAAAAGACCCCTAAATGGTAATGG 59.903 42.308 0.00 0.00 35.85 3.16
2168 2172 5.546035 AAAGACCCCTAAATGGTAATGGT 57.454 39.130 0.00 0.00 35.85 3.55
2169 2173 4.519906 AGACCCCTAAATGGTAATGGTG 57.480 45.455 0.00 0.00 35.85 4.17
2170 2174 4.116113 AGACCCCTAAATGGTAATGGTGA 58.884 43.478 0.00 0.00 35.85 4.02
2171 2175 4.542525 AGACCCCTAAATGGTAATGGTGAA 59.457 41.667 0.00 0.00 35.85 3.18
2172 2176 4.606210 ACCCCTAAATGGTAATGGTGAAC 58.394 43.478 0.00 0.00 33.26 3.18
2173 2177 4.044825 ACCCCTAAATGGTAATGGTGAACA 59.955 41.667 0.00 0.00 33.26 3.18
2174 2178 4.401202 CCCCTAAATGGTAATGGTGAACAC 59.599 45.833 0.00 0.00 0.00 3.32
2175 2179 5.013547 CCCTAAATGGTAATGGTGAACACA 58.986 41.667 7.25 0.00 0.00 3.72
2176 2180 5.105917 CCCTAAATGGTAATGGTGAACACAC 60.106 44.000 7.25 0.00 0.00 3.82
2188 2192 4.983671 GTGAACACACCTTTTCCTTCTT 57.016 40.909 0.00 0.00 0.00 2.52
2190 2194 6.635030 GTGAACACACCTTTTCCTTCTTAT 57.365 37.500 0.00 0.00 0.00 1.73
2191 2195 7.739498 GTGAACACACCTTTTCCTTCTTATA 57.261 36.000 0.00 0.00 0.00 0.98
2192 2196 8.161699 GTGAACACACCTTTTCCTTCTTATAA 57.838 34.615 0.00 0.00 0.00 0.98
2193 2197 8.074370 GTGAACACACCTTTTCCTTCTTATAAC 58.926 37.037 0.00 0.00 0.00 1.89
2194 2198 7.229907 TGAACACACCTTTTCCTTCTTATAACC 59.770 37.037 0.00 0.00 0.00 2.85
2195 2199 6.607019 ACACACCTTTTCCTTCTTATAACCA 58.393 36.000 0.00 0.00 0.00 3.67
2196 2200 6.489022 ACACACCTTTTCCTTCTTATAACCAC 59.511 38.462 0.00 0.00 0.00 4.16
2197 2201 5.704053 ACACCTTTTCCTTCTTATAACCACG 59.296 40.000 0.00 0.00 0.00 4.94
2198 2202 5.123344 CACCTTTTCCTTCTTATAACCACGG 59.877 44.000 0.00 0.00 0.00 4.94
2199 2203 5.221986 ACCTTTTCCTTCTTATAACCACGGT 60.222 40.000 0.00 0.00 0.00 4.83
2200 2204 5.123344 CCTTTTCCTTCTTATAACCACGGTG 59.877 44.000 0.00 0.00 0.00 4.94
2201 2205 5.486735 TTTCCTTCTTATAACCACGGTGA 57.513 39.130 10.28 0.00 0.00 4.02
2202 2206 5.687166 TTCCTTCTTATAACCACGGTGAT 57.313 39.130 10.28 0.49 0.00 3.06
2203 2207 5.272283 TCCTTCTTATAACCACGGTGATC 57.728 43.478 10.28 0.00 0.00 2.92
2204 2208 4.712829 TCCTTCTTATAACCACGGTGATCA 59.287 41.667 10.28 0.00 0.00 2.92
2205 2209 5.050490 CCTTCTTATAACCACGGTGATCAG 58.950 45.833 10.28 0.00 0.00 2.90
2206 2210 5.395324 CCTTCTTATAACCACGGTGATCAGT 60.395 44.000 10.28 0.00 0.00 3.41
2207 2211 6.183360 CCTTCTTATAACCACGGTGATCAGTA 60.183 42.308 10.28 0.00 0.00 2.74
2208 2212 6.778834 TCTTATAACCACGGTGATCAGTAA 57.221 37.500 10.28 1.99 0.00 2.24
2209 2213 7.356089 TCTTATAACCACGGTGATCAGTAAT 57.644 36.000 10.28 0.00 0.00 1.89
2210 2214 7.207383 TCTTATAACCACGGTGATCAGTAATG 58.793 38.462 10.28 0.00 0.00 1.90
2211 2215 2.024176 ACCACGGTGATCAGTAATGC 57.976 50.000 10.28 0.00 0.00 3.56
2212 2216 1.277842 ACCACGGTGATCAGTAATGCA 59.722 47.619 10.28 0.00 0.00 3.96
2213 2217 2.092968 ACCACGGTGATCAGTAATGCAT 60.093 45.455 10.28 0.00 0.00 3.96
2214 2218 3.133901 ACCACGGTGATCAGTAATGCATA 59.866 43.478 10.28 0.00 0.00 3.14
2215 2219 3.494626 CCACGGTGATCAGTAATGCATAC 59.505 47.826 10.28 0.00 34.52 2.39
2216 2220 4.371786 CACGGTGATCAGTAATGCATACT 58.628 43.478 0.74 1.12 45.95 2.12
2217 2221 4.445718 CACGGTGATCAGTAATGCATACTC 59.554 45.833 0.74 0.00 43.12 2.59
2218 2222 3.990469 CGGTGATCAGTAATGCATACTCC 59.010 47.826 0.00 1.10 43.12 3.85
2219 2223 4.262207 CGGTGATCAGTAATGCATACTCCT 60.262 45.833 0.00 0.00 43.12 3.69
2220 2224 5.615289 GGTGATCAGTAATGCATACTCCTT 58.385 41.667 0.00 0.00 43.12 3.36
2221 2225 6.058183 GGTGATCAGTAATGCATACTCCTTT 58.942 40.000 0.00 0.00 43.12 3.11
2222 2226 6.543831 GGTGATCAGTAATGCATACTCCTTTT 59.456 38.462 0.00 0.00 43.12 2.27
2223 2227 7.412853 GTGATCAGTAATGCATACTCCTTTTG 58.587 38.462 0.00 0.00 43.12 2.44
2224 2228 7.066284 GTGATCAGTAATGCATACTCCTTTTGT 59.934 37.037 0.00 0.00 43.12 2.83
2225 2229 7.611467 TGATCAGTAATGCATACTCCTTTTGTT 59.389 33.333 0.00 0.00 43.12 2.83
2226 2230 9.109393 GATCAGTAATGCATACTCCTTTTGTTA 57.891 33.333 0.00 0.00 43.12 2.41
2227 2231 8.856153 TCAGTAATGCATACTCCTTTTGTTAA 57.144 30.769 0.00 0.00 43.12 2.01
2228 2232 9.290988 TCAGTAATGCATACTCCTTTTGTTAAA 57.709 29.630 0.00 0.00 43.12 1.52
2229 2233 9.906660 CAGTAATGCATACTCCTTTTGTTAAAA 57.093 29.630 0.00 0.00 43.12 1.52
2262 2266 4.879104 CTCGACTAGGACGTGAATACTT 57.121 45.455 0.00 0.00 0.00 2.24
2263 2267 5.232610 CTCGACTAGGACGTGAATACTTT 57.767 43.478 0.00 0.00 0.00 2.66
2264 2268 5.633830 TCGACTAGGACGTGAATACTTTT 57.366 39.130 0.00 0.00 0.00 2.27
2265 2269 6.741992 TCGACTAGGACGTGAATACTTTTA 57.258 37.500 0.00 0.00 0.00 1.52
2266 2270 7.144722 TCGACTAGGACGTGAATACTTTTAA 57.855 36.000 0.00 0.00 0.00 1.52
2267 2271 7.246311 TCGACTAGGACGTGAATACTTTTAAG 58.754 38.462 0.00 0.00 0.00 1.85
2268 2272 7.119699 TCGACTAGGACGTGAATACTTTTAAGA 59.880 37.037 0.00 0.00 0.00 2.10
2269 2273 7.914346 CGACTAGGACGTGAATACTTTTAAGAT 59.086 37.037 0.00 0.00 0.00 2.40
2274 2278 9.939802 AGGACGTGAATACTTTTAAGATAACTT 57.060 29.630 0.00 0.00 39.81 2.66
2302 2306 6.436843 TTTTTCTCTCCTAATGAAATCGGC 57.563 37.500 0.00 0.00 31.08 5.54
2303 2307 4.753516 TTCTCTCCTAATGAAATCGGCA 57.246 40.909 0.00 0.00 0.00 5.69
2304 2308 4.327982 TCTCTCCTAATGAAATCGGCAG 57.672 45.455 0.00 0.00 0.00 4.85
2305 2309 3.960755 TCTCTCCTAATGAAATCGGCAGA 59.039 43.478 0.00 0.00 0.00 4.26
2306 2310 4.038522 TCTCTCCTAATGAAATCGGCAGAG 59.961 45.833 0.00 0.00 30.99 3.35
2307 2311 2.805099 CTCCTAATGAAATCGGCAGAGC 59.195 50.000 0.00 0.00 0.00 4.09
2308 2312 2.435805 TCCTAATGAAATCGGCAGAGCT 59.564 45.455 0.00 0.00 0.00 4.09
2309 2313 2.805099 CCTAATGAAATCGGCAGAGCTC 59.195 50.000 5.27 5.27 0.00 4.09
2310 2314 1.673168 AATGAAATCGGCAGAGCTCC 58.327 50.000 10.93 0.00 0.00 4.70
2311 2315 0.835941 ATGAAATCGGCAGAGCTCCT 59.164 50.000 10.93 0.00 0.00 3.69
2312 2316 0.107993 TGAAATCGGCAGAGCTCCTG 60.108 55.000 10.93 9.35 45.67 3.86
2319 2323 4.298009 CAGAGCTCCTGCCTTGTG 57.702 61.111 10.93 0.00 40.80 3.33
2320 2324 1.374190 CAGAGCTCCTGCCTTGTGT 59.626 57.895 10.93 0.00 40.80 3.72
2321 2325 0.954449 CAGAGCTCCTGCCTTGTGTG 60.954 60.000 10.93 0.00 40.80 3.82
2322 2326 1.072159 GAGCTCCTGCCTTGTGTGT 59.928 57.895 0.87 0.00 40.80 3.72
2323 2327 0.321671 GAGCTCCTGCCTTGTGTGTA 59.678 55.000 0.87 0.00 40.80 2.90
2324 2328 0.764890 AGCTCCTGCCTTGTGTGTAA 59.235 50.000 0.00 0.00 40.80 2.41
2325 2329 1.142870 AGCTCCTGCCTTGTGTGTAAA 59.857 47.619 0.00 0.00 40.80 2.01
2326 2330 1.953686 GCTCCTGCCTTGTGTGTAAAA 59.046 47.619 0.00 0.00 0.00 1.52
2327 2331 2.360801 GCTCCTGCCTTGTGTGTAAAAA 59.639 45.455 0.00 0.00 0.00 1.94
2354 2358 9.507329 AAAAGAGATTACTTCTTCATAGTTGCA 57.493 29.630 0.00 0.00 33.74 4.08
2355 2359 8.715191 AAGAGATTACTTCTTCATAGTTGCAG 57.285 34.615 0.00 0.00 33.74 4.41
2356 2360 7.271511 AGAGATTACTTCTTCATAGTTGCAGG 58.728 38.462 0.00 0.00 33.74 4.85
2357 2361 7.124901 AGAGATTACTTCTTCATAGTTGCAGGA 59.875 37.037 0.00 0.00 33.74 3.86
2358 2362 7.271511 AGATTACTTCTTCATAGTTGCAGGAG 58.728 38.462 0.00 0.00 28.91 3.69
2359 2363 3.604582 ACTTCTTCATAGTTGCAGGAGC 58.395 45.455 0.00 0.00 42.57 4.70
2360 2364 3.262915 ACTTCTTCATAGTTGCAGGAGCT 59.737 43.478 0.00 0.00 42.74 4.09
2361 2365 4.467795 ACTTCTTCATAGTTGCAGGAGCTA 59.532 41.667 0.00 0.00 42.74 3.32
2362 2366 4.662468 TCTTCATAGTTGCAGGAGCTAG 57.338 45.455 0.00 0.00 42.74 3.42
2363 2367 4.026744 TCTTCATAGTTGCAGGAGCTAGT 58.973 43.478 0.00 0.00 42.74 2.57
2364 2368 5.201243 TCTTCATAGTTGCAGGAGCTAGTA 58.799 41.667 0.00 0.00 42.74 1.82
2365 2369 4.920640 TCATAGTTGCAGGAGCTAGTAC 57.079 45.455 0.00 0.00 42.74 2.73
2366 2370 4.278310 TCATAGTTGCAGGAGCTAGTACA 58.722 43.478 0.00 0.00 42.74 2.90
2367 2371 4.895889 TCATAGTTGCAGGAGCTAGTACAT 59.104 41.667 0.00 0.00 42.74 2.29
2368 2372 3.533606 AGTTGCAGGAGCTAGTACATG 57.466 47.619 0.00 0.00 42.74 3.21
2369 2373 1.936547 GTTGCAGGAGCTAGTACATGC 59.063 52.381 16.48 16.48 42.77 4.06
2370 2374 1.489481 TGCAGGAGCTAGTACATGCT 58.511 50.000 21.06 11.57 42.86 3.79
2371 2375 1.833630 TGCAGGAGCTAGTACATGCTT 59.166 47.619 21.06 0.00 42.86 3.91
2372 2376 2.159043 TGCAGGAGCTAGTACATGCTTC 60.159 50.000 21.06 11.13 42.86 3.86
2373 2377 2.159043 GCAGGAGCTAGTACATGCTTCA 60.159 50.000 17.12 0.00 40.01 3.02
2374 2378 3.715495 CAGGAGCTAGTACATGCTTCAG 58.285 50.000 17.12 8.28 39.91 3.02
2375 2379 3.382865 CAGGAGCTAGTACATGCTTCAGA 59.617 47.826 17.12 0.00 39.91 3.27
2376 2380 4.026744 AGGAGCTAGTACATGCTTCAGAA 58.973 43.478 17.12 0.00 39.91 3.02
2377 2381 4.467795 AGGAGCTAGTACATGCTTCAGAAA 59.532 41.667 17.12 0.00 39.91 2.52
2378 2382 4.808364 GGAGCTAGTACATGCTTCAGAAAG 59.192 45.833 12.71 0.00 39.91 2.62
2379 2383 5.394663 GGAGCTAGTACATGCTTCAGAAAGA 60.395 44.000 12.71 0.00 39.91 2.52
2380 2384 6.042638 AGCTAGTACATGCTTCAGAAAGAA 57.957 37.500 6.78 0.00 35.86 2.52
2381 2385 6.467677 AGCTAGTACATGCTTCAGAAAGAAA 58.532 36.000 6.78 0.00 35.86 2.52
2382 2386 6.936900 AGCTAGTACATGCTTCAGAAAGAAAA 59.063 34.615 6.78 0.00 35.86 2.29
2383 2387 7.118971 AGCTAGTACATGCTTCAGAAAGAAAAG 59.881 37.037 6.78 0.00 35.86 2.27
2384 2388 6.006759 AGTACATGCTTCAGAAAGAAAAGC 57.993 37.500 0.00 0.00 44.41 3.51
2392 2396 5.905733 GCTTCAGAAAGAAAAGCAAAAATGC 59.094 36.000 1.68 0.00 43.77 3.56
2393 2397 5.989551 TCAGAAAGAAAAGCAAAAATGCC 57.010 34.783 0.00 0.00 34.90 4.40
2394 2398 5.673514 TCAGAAAGAAAAGCAAAAATGCCT 58.326 33.333 0.00 0.00 34.90 4.75
2395 2399 6.815089 TCAGAAAGAAAAGCAAAAATGCCTA 58.185 32.000 0.00 0.00 34.90 3.93
2396 2400 7.271511 TCAGAAAGAAAAGCAAAAATGCCTAA 58.728 30.769 0.00 0.00 34.90 2.69
2397 2401 7.224557 TCAGAAAGAAAAGCAAAAATGCCTAAC 59.775 33.333 0.00 0.00 34.90 2.34
2398 2402 7.225341 CAGAAAGAAAAGCAAAAATGCCTAACT 59.775 33.333 0.00 0.00 34.90 2.24
2399 2403 6.849588 AAGAAAAGCAAAAATGCCTAACTG 57.150 33.333 0.00 0.00 34.90 3.16
2400 2404 6.160576 AGAAAAGCAAAAATGCCTAACTGA 57.839 33.333 0.00 0.00 34.90 3.41
2401 2405 5.985530 AGAAAAGCAAAAATGCCTAACTGAC 59.014 36.000 0.00 0.00 34.90 3.51
2402 2406 4.935352 AAGCAAAAATGCCTAACTGACA 57.065 36.364 0.00 0.00 34.90 3.58
2403 2407 4.510038 AGCAAAAATGCCTAACTGACAG 57.490 40.909 0.00 0.00 34.90 3.51
2404 2408 3.891366 AGCAAAAATGCCTAACTGACAGT 59.109 39.130 1.07 1.07 34.90 3.55
2405 2409 4.022849 AGCAAAAATGCCTAACTGACAGTC 60.023 41.667 8.93 0.00 34.90 3.51
2406 2410 4.261572 GCAAAAATGCCTAACTGACAGTCA 60.262 41.667 8.93 2.48 0.00 3.41
2407 2411 8.173410 AGCAAAAATGCCTAACTGACAGTCAG 62.173 42.308 26.42 26.42 42.04 3.51
2420 2424 4.621991 TGACAGTCAGTTCTCAGTTTAGC 58.378 43.478 0.00 0.00 0.00 3.09
2421 2425 3.991121 GACAGTCAGTTCTCAGTTTAGCC 59.009 47.826 0.00 0.00 0.00 3.93
2422 2426 3.388024 ACAGTCAGTTCTCAGTTTAGCCA 59.612 43.478 0.00 0.00 0.00 4.75
2423 2427 3.743396 CAGTCAGTTCTCAGTTTAGCCAC 59.257 47.826 0.00 0.00 0.00 5.01
2424 2428 3.067833 GTCAGTTCTCAGTTTAGCCACC 58.932 50.000 0.00 0.00 0.00 4.61
2425 2429 2.703536 TCAGTTCTCAGTTTAGCCACCA 59.296 45.455 0.00 0.00 0.00 4.17
2426 2430 3.327757 TCAGTTCTCAGTTTAGCCACCAT 59.672 43.478 0.00 0.00 0.00 3.55
2427 2431 4.530553 TCAGTTCTCAGTTTAGCCACCATA 59.469 41.667 0.00 0.00 0.00 2.74
2428 2432 4.631813 CAGTTCTCAGTTTAGCCACCATAC 59.368 45.833 0.00 0.00 0.00 2.39
2429 2433 4.532521 AGTTCTCAGTTTAGCCACCATACT 59.467 41.667 0.00 0.00 0.00 2.12
2430 2434 5.013183 AGTTCTCAGTTTAGCCACCATACTT 59.987 40.000 0.00 0.00 0.00 2.24
2431 2435 5.086104 TCTCAGTTTAGCCACCATACTTC 57.914 43.478 0.00 0.00 0.00 3.01
2432 2436 4.777896 TCTCAGTTTAGCCACCATACTTCT 59.222 41.667 0.00 0.00 0.00 2.85
2433 2437 5.955959 TCTCAGTTTAGCCACCATACTTCTA 59.044 40.000 0.00 0.00 0.00 2.10
2434 2438 5.974108 TCAGTTTAGCCACCATACTTCTAC 58.026 41.667 0.00 0.00 0.00 2.59
2435 2439 5.482526 TCAGTTTAGCCACCATACTTCTACA 59.517 40.000 0.00 0.00 0.00 2.74
2436 2440 6.156256 TCAGTTTAGCCACCATACTTCTACAT 59.844 38.462 0.00 0.00 0.00 2.29
2437 2441 7.343574 TCAGTTTAGCCACCATACTTCTACATA 59.656 37.037 0.00 0.00 0.00 2.29
2438 2442 7.653713 CAGTTTAGCCACCATACTTCTACATAG 59.346 40.741 0.00 0.00 0.00 2.23
2439 2443 7.344871 AGTTTAGCCACCATACTTCTACATAGT 59.655 37.037 0.00 0.00 0.00 2.12
2440 2444 7.670605 TTAGCCACCATACTTCTACATAGTT 57.329 36.000 0.00 0.00 0.00 2.24
2441 2445 6.561519 AGCCACCATACTTCTACATAGTTT 57.438 37.500 0.00 0.00 0.00 2.66
2442 2446 6.958767 AGCCACCATACTTCTACATAGTTTT 58.041 36.000 0.00 0.00 0.00 2.43
2443 2447 7.402862 AGCCACCATACTTCTACATAGTTTTT 58.597 34.615 0.00 0.00 0.00 1.94
2444 2448 7.553044 AGCCACCATACTTCTACATAGTTTTTC 59.447 37.037 0.00 0.00 0.00 2.29
2445 2449 7.465513 GCCACCATACTTCTACATAGTTTTTCG 60.466 40.741 0.00 0.00 0.00 3.46
2446 2450 7.762615 CCACCATACTTCTACATAGTTTTTCGA 59.237 37.037 0.00 0.00 0.00 3.71
2447 2451 9.146984 CACCATACTTCTACATAGTTTTTCGAA 57.853 33.333 0.00 0.00 0.00 3.71
2448 2452 9.886132 ACCATACTTCTACATAGTTTTTCGAAT 57.114 29.630 0.00 0.00 0.00 3.34
2456 2460 9.031360 TCTACATAGTTTTTCGAATCTATGTGC 57.969 33.333 32.45 11.84 46.57 4.57
2457 2461 6.705782 ACATAGTTTTTCGAATCTATGTGCG 58.294 36.000 29.03 16.35 45.91 5.34
2458 2462 4.600012 AGTTTTTCGAATCTATGTGCGG 57.400 40.909 0.00 0.00 0.00 5.69
2459 2463 3.098636 GTTTTTCGAATCTATGTGCGGC 58.901 45.455 0.00 0.00 0.00 6.53
2460 2464 1.295792 TTTCGAATCTATGTGCGGCC 58.704 50.000 0.00 0.00 0.00 6.13
2461 2465 0.176910 TTCGAATCTATGTGCGGCCA 59.823 50.000 2.24 0.00 0.00 5.36
2462 2466 0.529773 TCGAATCTATGTGCGGCCAC 60.530 55.000 2.24 0.00 42.40 5.01
2463 2467 0.530650 CGAATCTATGTGCGGCCACT 60.531 55.000 2.24 0.00 42.54 4.00
2464 2468 1.668419 GAATCTATGTGCGGCCACTT 58.332 50.000 2.24 0.00 42.54 3.16
2465 2469 1.599542 GAATCTATGTGCGGCCACTTC 59.400 52.381 2.24 0.00 42.54 3.01
2466 2470 0.833287 ATCTATGTGCGGCCACTTCT 59.167 50.000 2.24 0.00 42.54 2.85
2467 2471 0.108186 TCTATGTGCGGCCACTTCTG 60.108 55.000 2.24 0.00 42.54 3.02
2468 2472 0.391661 CTATGTGCGGCCACTTCTGT 60.392 55.000 2.24 0.00 42.54 3.41
2469 2473 0.036164 TATGTGCGGCCACTTCTGTT 59.964 50.000 2.24 0.00 42.54 3.16
2470 2474 0.036164 ATGTGCGGCCACTTCTGTTA 59.964 50.000 2.24 0.00 42.54 2.41
2471 2475 0.036164 TGTGCGGCCACTTCTGTTAT 59.964 50.000 2.24 0.00 42.54 1.89
2472 2476 1.165270 GTGCGGCCACTTCTGTTATT 58.835 50.000 2.24 0.00 38.93 1.40
2473 2477 1.539827 GTGCGGCCACTTCTGTTATTT 59.460 47.619 2.24 0.00 38.93 1.40
2474 2478 1.810151 TGCGGCCACTTCTGTTATTTC 59.190 47.619 2.24 0.00 0.00 2.17
2475 2479 1.810151 GCGGCCACTTCTGTTATTTCA 59.190 47.619 2.24 0.00 0.00 2.69
2476 2480 2.423538 GCGGCCACTTCTGTTATTTCAT 59.576 45.455 2.24 0.00 0.00 2.57
2477 2481 3.487544 GCGGCCACTTCTGTTATTTCATC 60.488 47.826 2.24 0.00 0.00 2.92
2478 2482 3.689161 CGGCCACTTCTGTTATTTCATCA 59.311 43.478 2.24 0.00 0.00 3.07
2479 2483 4.336433 CGGCCACTTCTGTTATTTCATCAT 59.664 41.667 2.24 0.00 0.00 2.45
2480 2484 5.504665 CGGCCACTTCTGTTATTTCATCATC 60.505 44.000 2.24 0.00 0.00 2.92
2481 2485 5.357878 GGCCACTTCTGTTATTTCATCATCA 59.642 40.000 0.00 0.00 0.00 3.07
2482 2486 6.261118 GCCACTTCTGTTATTTCATCATCAC 58.739 40.000 0.00 0.00 0.00 3.06
2483 2487 6.094603 GCCACTTCTGTTATTTCATCATCACT 59.905 38.462 0.00 0.00 0.00 3.41
2484 2488 7.362401 GCCACTTCTGTTATTTCATCATCACTT 60.362 37.037 0.00 0.00 0.00 3.16
2485 2489 8.517878 CCACTTCTGTTATTTCATCATCACTTT 58.482 33.333 0.00 0.00 0.00 2.66
2486 2490 9.903682 CACTTCTGTTATTTCATCATCACTTTT 57.096 29.630 0.00 0.00 0.00 2.27
2487 2491 9.903682 ACTTCTGTTATTTCATCATCACTTTTG 57.096 29.630 0.00 0.00 0.00 2.44
2490 2494 9.288576 TCTGTTATTTCATCATCACTTTTGAGT 57.711 29.630 0.00 0.00 34.35 3.41
2491 2495 9.338291 CTGTTATTTCATCATCACTTTTGAGTG 57.662 33.333 0.20 0.20 40.90 3.51
2492 2496 8.298854 TGTTATTTCATCATCACTTTTGAGTGG 58.701 33.333 6.70 0.00 40.03 4.00
2493 2497 6.906157 ATTTCATCATCACTTTTGAGTGGT 57.094 33.333 6.70 0.00 40.03 4.16
2494 2498 6.713762 TTTCATCATCACTTTTGAGTGGTT 57.286 33.333 6.70 0.00 40.03 3.67
2495 2499 6.713762 TTCATCATCACTTTTGAGTGGTTT 57.286 33.333 6.70 0.00 40.03 3.27
2496 2500 6.713762 TCATCATCACTTTTGAGTGGTTTT 57.286 33.333 6.70 0.00 40.03 2.43
2497 2501 6.738114 TCATCATCACTTTTGAGTGGTTTTC 58.262 36.000 6.70 0.00 40.03 2.29
2498 2502 6.320926 TCATCATCACTTTTGAGTGGTTTTCA 59.679 34.615 6.70 0.00 40.03 2.69
2499 2503 6.522625 TCATCACTTTTGAGTGGTTTTCAA 57.477 33.333 6.70 0.00 40.03 2.69
2500 2504 6.929625 TCATCACTTTTGAGTGGTTTTCAAA 58.070 32.000 6.70 0.00 41.40 2.69
2501 2505 7.555087 TCATCACTTTTGAGTGGTTTTCAAAT 58.445 30.769 6.70 0.00 42.31 2.32
2502 2506 8.690884 TCATCACTTTTGAGTGGTTTTCAAATA 58.309 29.630 6.70 0.00 42.31 1.40
2503 2507 8.755018 CATCACTTTTGAGTGGTTTTCAAATAC 58.245 33.333 6.70 0.00 42.31 1.89
2504 2508 8.062065 TCACTTTTGAGTGGTTTTCAAATACT 57.938 30.769 6.70 0.00 42.31 2.12
2505 2509 8.188139 TCACTTTTGAGTGGTTTTCAAATACTC 58.812 33.333 6.70 10.45 42.31 2.59
2506 2510 7.435192 CACTTTTGAGTGGTTTTCAAATACTCC 59.565 37.037 13.03 0.00 42.31 3.85
2507 2511 7.342026 ACTTTTGAGTGGTTTTCAAATACTCCT 59.658 33.333 13.03 0.00 42.31 3.69
2508 2512 8.754991 TTTTGAGTGGTTTTCAAATACTCCTA 57.245 30.769 13.03 4.02 42.31 2.94
2509 2513 8.934023 TTTGAGTGGTTTTCAAATACTCCTAT 57.066 30.769 13.03 0.00 39.05 2.57
2525 2529 6.287589 ACTCCTATATAACATAGCACCTGC 57.712 41.667 0.00 0.00 42.49 4.85
2535 2539 2.331451 GCACCTGCGCGAAAGTTT 59.669 55.556 12.10 0.00 0.00 2.66
2536 2540 1.725973 GCACCTGCGCGAAAGTTTC 60.726 57.895 12.10 5.47 0.00 2.78
2537 2541 1.941812 CACCTGCGCGAAAGTTTCT 59.058 52.632 12.10 0.00 0.00 2.52
2538 2542 0.307760 CACCTGCGCGAAAGTTTCTT 59.692 50.000 12.10 0.00 0.00 2.52
2539 2543 1.529438 CACCTGCGCGAAAGTTTCTTA 59.471 47.619 12.10 0.00 0.00 2.10
2540 2544 2.159627 CACCTGCGCGAAAGTTTCTTAT 59.840 45.455 12.10 0.00 0.00 1.73
2541 2545 2.415512 ACCTGCGCGAAAGTTTCTTATC 59.584 45.455 12.10 1.51 0.00 1.75
2542 2546 2.673368 CCTGCGCGAAAGTTTCTTATCT 59.327 45.455 12.10 0.00 0.00 1.98
2543 2547 3.125316 CCTGCGCGAAAGTTTCTTATCTT 59.875 43.478 12.10 0.00 0.00 2.40
2544 2548 4.378459 CCTGCGCGAAAGTTTCTTATCTTT 60.378 41.667 12.10 0.00 36.72 2.52
2545 2549 5.103290 TGCGCGAAAGTTTCTTATCTTTT 57.897 34.783 12.10 0.00 34.60 2.27
2546 2550 5.516090 TGCGCGAAAGTTTCTTATCTTTTT 58.484 33.333 12.10 0.00 34.60 1.94
2547 2551 5.398122 TGCGCGAAAGTTTCTTATCTTTTTG 59.602 36.000 12.10 0.00 34.60 2.44
2548 2552 5.398416 GCGCGAAAGTTTCTTATCTTTTTGT 59.602 36.000 12.10 0.00 34.60 2.83
2549 2553 6.397584 GCGCGAAAGTTTCTTATCTTTTTGTC 60.398 38.462 12.10 0.00 34.60 3.18
2550 2554 6.086371 CGCGAAAGTTTCTTATCTTTTTGTCC 59.914 38.462 13.56 0.00 34.60 4.02
2551 2555 6.362551 GCGAAAGTTTCTTATCTTTTTGTCCC 59.637 38.462 13.56 0.00 34.60 4.46
2552 2556 6.861572 CGAAAGTTTCTTATCTTTTTGTCCCC 59.138 38.462 13.56 0.00 34.60 4.81
2553 2557 6.665992 AAGTTTCTTATCTTTTTGTCCCCC 57.334 37.500 0.00 0.00 0.00 5.40
2554 2558 5.965486 AGTTTCTTATCTTTTTGTCCCCCT 58.035 37.500 0.00 0.00 0.00 4.79
2555 2559 6.382087 AGTTTCTTATCTTTTTGTCCCCCTT 58.618 36.000 0.00 0.00 0.00 3.95
2556 2560 6.493802 AGTTTCTTATCTTTTTGTCCCCCTTC 59.506 38.462 0.00 0.00 0.00 3.46
2557 2561 5.860648 TCTTATCTTTTTGTCCCCCTTCT 57.139 39.130 0.00 0.00 0.00 2.85
2558 2562 5.816682 TCTTATCTTTTTGTCCCCCTTCTC 58.183 41.667 0.00 0.00 0.00 2.87
2559 2563 2.971901 TCTTTTTGTCCCCCTTCTCC 57.028 50.000 0.00 0.00 0.00 3.71
2560 2564 2.140224 TCTTTTTGTCCCCCTTCTCCA 58.860 47.619 0.00 0.00 0.00 3.86
2561 2565 2.721906 TCTTTTTGTCCCCCTTCTCCAT 59.278 45.455 0.00 0.00 0.00 3.41
2562 2566 3.920197 TCTTTTTGTCCCCCTTCTCCATA 59.080 43.478 0.00 0.00 0.00 2.74
2563 2567 4.544152 TCTTTTTGTCCCCCTTCTCCATAT 59.456 41.667 0.00 0.00 0.00 1.78
2564 2568 4.965283 TTTTGTCCCCCTTCTCCATATT 57.035 40.909 0.00 0.00 0.00 1.28
2565 2569 4.965283 TTTGTCCCCCTTCTCCATATTT 57.035 40.909 0.00 0.00 0.00 1.40
2566 2570 4.965283 TTGTCCCCCTTCTCCATATTTT 57.035 40.909 0.00 0.00 0.00 1.82
2567 2571 4.965283 TGTCCCCCTTCTCCATATTTTT 57.035 40.909 0.00 0.00 0.00 1.94
2568 2572 4.609301 TGTCCCCCTTCTCCATATTTTTG 58.391 43.478 0.00 0.00 0.00 2.44
2569 2573 3.384789 GTCCCCCTTCTCCATATTTTTGC 59.615 47.826 0.00 0.00 0.00 3.68
2570 2574 2.700371 CCCCCTTCTCCATATTTTTGCC 59.300 50.000 0.00 0.00 0.00 4.52
2571 2575 2.700371 CCCCTTCTCCATATTTTTGCCC 59.300 50.000 0.00 0.00 0.00 5.36
2572 2576 2.362077 CCCTTCTCCATATTTTTGCCCG 59.638 50.000 0.00 0.00 0.00 6.13
2573 2577 2.223805 CCTTCTCCATATTTTTGCCCGC 60.224 50.000 0.00 0.00 0.00 6.13
2574 2578 1.021202 TCTCCATATTTTTGCCCGCG 58.979 50.000 0.00 0.00 0.00 6.46
2575 2579 0.738389 CTCCATATTTTTGCCCGCGT 59.262 50.000 4.92 0.00 0.00 6.01
2576 2580 0.453793 TCCATATTTTTGCCCGCGTG 59.546 50.000 4.92 0.00 0.00 5.34
2577 2581 0.172352 CCATATTTTTGCCCGCGTGT 59.828 50.000 4.92 0.00 0.00 4.49
2578 2582 1.403514 CCATATTTTTGCCCGCGTGTT 60.404 47.619 4.92 0.00 0.00 3.32
2579 2583 2.159366 CCATATTTTTGCCCGCGTGTTA 60.159 45.455 4.92 0.00 0.00 2.41
2580 2584 2.615489 TATTTTTGCCCGCGTGTTAC 57.385 45.000 4.92 0.00 0.00 2.50
2581 2585 0.038983 ATTTTTGCCCGCGTGTTACC 60.039 50.000 4.92 0.00 0.00 2.85
2582 2586 1.102222 TTTTTGCCCGCGTGTTACCT 61.102 50.000 4.92 0.00 0.00 3.08
2583 2587 1.102222 TTTTGCCCGCGTGTTACCTT 61.102 50.000 4.92 0.00 0.00 3.50
2584 2588 0.250209 TTTGCCCGCGTGTTACCTTA 60.250 50.000 4.92 0.00 0.00 2.69
2585 2589 0.036199 TTGCCCGCGTGTTACCTTAT 60.036 50.000 4.92 0.00 0.00 1.73
2586 2590 0.036199 TGCCCGCGTGTTACCTTATT 60.036 50.000 4.92 0.00 0.00 1.40
2587 2591 1.206610 TGCCCGCGTGTTACCTTATTA 59.793 47.619 4.92 0.00 0.00 0.98
2588 2592 1.862827 GCCCGCGTGTTACCTTATTAG 59.137 52.381 4.92 0.00 0.00 1.73
2590 2594 2.101249 CCCGCGTGTTACCTTATTAGGA 59.899 50.000 4.92 0.00 45.05 2.94
2591 2595 3.118542 CCGCGTGTTACCTTATTAGGAC 58.881 50.000 4.92 0.00 45.05 3.85
2592 2596 3.429272 CCGCGTGTTACCTTATTAGGACA 60.429 47.826 4.92 0.00 45.05 4.02
2593 2597 4.365723 CGCGTGTTACCTTATTAGGACAT 58.634 43.478 4.40 0.00 45.05 3.06
2594 2598 4.807304 CGCGTGTTACCTTATTAGGACATT 59.193 41.667 4.40 0.00 45.05 2.71
2595 2599 5.051240 CGCGTGTTACCTTATTAGGACATTC 60.051 44.000 4.40 0.00 45.05 2.67
2596 2600 5.235831 GCGTGTTACCTTATTAGGACATTCC 59.764 44.000 4.40 0.00 45.05 3.01
2598 2602 7.046033 CGTGTTACCTTATTAGGACATTCCTT 58.954 38.462 4.40 0.00 46.91 3.36
2599 2603 7.224167 CGTGTTACCTTATTAGGACATTCCTTC 59.776 40.741 4.40 0.00 46.91 3.46
2600 2604 8.265764 GTGTTACCTTATTAGGACATTCCTTCT 58.734 37.037 4.40 0.00 46.91 2.85
2601 2605 8.832735 TGTTACCTTATTAGGACATTCCTTCTT 58.167 33.333 4.40 0.00 46.91 2.52
2602 2606 9.682465 GTTACCTTATTAGGACATTCCTTCTTT 57.318 33.333 4.40 0.00 46.91 2.52
2605 2609 9.907229 ACCTTATTAGGACATTCCTTCTTTTAG 57.093 33.333 4.40 0.00 46.91 1.85
2610 2614 9.981460 ATTAGGACATTCCTTCTTTTAGACATT 57.019 29.630 0.00 0.00 46.91 2.71
2611 2615 9.807921 TTAGGACATTCCTTCTTTTAGACATTT 57.192 29.630 0.00 0.00 46.91 2.32
2612 2616 8.712228 AGGACATTCCTTCTTTTAGACATTTT 57.288 30.769 0.00 0.00 46.91 1.82
2613 2617 8.579863 AGGACATTCCTTCTTTTAGACATTTTG 58.420 33.333 0.00 0.00 46.91 2.44
2614 2618 8.576442 GGACATTCCTTCTTTTAGACATTTTGA 58.424 33.333 0.00 0.00 32.53 2.69
2616 2620 9.918630 ACATTCCTTCTTTTAGACATTTTGATG 57.081 29.630 0.00 0.00 0.00 3.07
2617 2621 8.866956 CATTCCTTCTTTTAGACATTTTGATGC 58.133 33.333 0.00 0.00 0.00 3.91
2618 2622 7.523293 TCCTTCTTTTAGACATTTTGATGCA 57.477 32.000 0.00 0.00 0.00 3.96
2619 2623 8.125978 TCCTTCTTTTAGACATTTTGATGCAT 57.874 30.769 0.00 0.00 0.00 3.96
2620 2624 8.587608 TCCTTCTTTTAGACATTTTGATGCATT 58.412 29.630 0.00 0.00 0.00 3.56
2621 2625 8.866956 CCTTCTTTTAGACATTTTGATGCATTC 58.133 33.333 0.00 0.00 0.00 2.67
2622 2626 9.414295 CTTCTTTTAGACATTTTGATGCATTCA 57.586 29.630 0.00 0.00 0.00 2.57
2623 2627 9.761504 TTCTTTTAGACATTTTGATGCATTCAA 57.238 25.926 0.00 4.04 42.62 2.69
2624 2628 9.932207 TCTTTTAGACATTTTGATGCATTCAAT 57.068 25.926 0.00 0.00 43.73 2.57
2627 2631 9.708092 TTTAGACATTTTGATGCATTCAATTCA 57.292 25.926 0.00 0.00 43.73 2.57
2628 2632 9.878667 TTAGACATTTTGATGCATTCAATTCAT 57.121 25.926 0.00 0.00 43.73 2.57
2629 2633 8.420374 AGACATTTTGATGCATTCAATTCATC 57.580 30.769 0.00 3.25 43.73 2.92
2630 2634 8.258007 AGACATTTTGATGCATTCAATTCATCT 58.742 29.630 10.81 5.77 43.73 2.90
2631 2635 8.196802 ACATTTTGATGCATTCAATTCATCTG 57.803 30.769 10.81 4.12 43.73 2.90
2632 2636 7.822334 ACATTTTGATGCATTCAATTCATCTGT 59.178 29.630 10.81 4.66 43.73 3.41
2633 2637 9.308318 CATTTTGATGCATTCAATTCATCTGTA 57.692 29.630 10.81 0.00 43.73 2.74
2634 2638 8.692110 TTTTGATGCATTCAATTCATCTGTAC 57.308 30.769 10.81 0.00 43.73 2.90
2635 2639 6.381481 TGATGCATTCAATTCATCTGTACC 57.619 37.500 10.81 0.00 37.91 3.34
2636 2640 6.124340 TGATGCATTCAATTCATCTGTACCT 58.876 36.000 10.81 0.00 37.91 3.08
2637 2641 5.823209 TGCATTCAATTCATCTGTACCTG 57.177 39.130 0.00 0.00 0.00 4.00
2638 2642 5.255687 TGCATTCAATTCATCTGTACCTGT 58.744 37.500 0.00 0.00 0.00 4.00
2639 2643 5.355071 TGCATTCAATTCATCTGTACCTGTC 59.645 40.000 0.00 0.00 0.00 3.51
2640 2644 5.503031 GCATTCAATTCATCTGTACCTGTCG 60.503 44.000 0.00 0.00 0.00 4.35
2641 2645 4.801330 TCAATTCATCTGTACCTGTCGT 57.199 40.909 0.00 0.00 0.00 4.34
2642 2646 4.494484 TCAATTCATCTGTACCTGTCGTG 58.506 43.478 0.00 0.00 0.00 4.35
2643 2647 2.363788 TTCATCTGTACCTGTCGTGC 57.636 50.000 0.00 0.00 0.00 5.34
2644 2648 1.545841 TCATCTGTACCTGTCGTGCT 58.454 50.000 0.00 0.00 0.00 4.40
2645 2649 1.893137 TCATCTGTACCTGTCGTGCTT 59.107 47.619 0.00 0.00 0.00 3.91
2646 2650 2.299013 TCATCTGTACCTGTCGTGCTTT 59.701 45.455 0.00 0.00 0.00 3.51
2647 2651 2.148916 TCTGTACCTGTCGTGCTTTG 57.851 50.000 0.00 0.00 0.00 2.77
2648 2652 1.411246 TCTGTACCTGTCGTGCTTTGT 59.589 47.619 0.00 0.00 0.00 2.83
2649 2653 1.792949 CTGTACCTGTCGTGCTTTGTC 59.207 52.381 0.00 0.00 0.00 3.18
2650 2654 1.137282 TGTACCTGTCGTGCTTTGTCA 59.863 47.619 0.00 0.00 0.00 3.58
2651 2655 1.525619 GTACCTGTCGTGCTTTGTCAC 59.474 52.381 0.00 0.00 0.00 3.67
2652 2656 0.107897 ACCTGTCGTGCTTTGTCACA 60.108 50.000 0.00 0.00 36.80 3.58
2653 2657 0.304705 CCTGTCGTGCTTTGTCACAC 59.695 55.000 0.00 0.00 36.80 3.82
2654 2658 0.304705 CTGTCGTGCTTTGTCACACC 59.695 55.000 0.00 0.00 36.80 4.16
2655 2659 0.107897 TGTCGTGCTTTGTCACACCT 60.108 50.000 0.00 0.00 36.80 4.00
2656 2660 0.304705 GTCGTGCTTTGTCACACCTG 59.695 55.000 0.00 0.00 36.80 4.00
2657 2661 0.176910 TCGTGCTTTGTCACACCTGA 59.823 50.000 0.00 0.00 36.80 3.86
2658 2662 1.013596 CGTGCTTTGTCACACCTGAA 58.986 50.000 0.00 0.00 36.80 3.02
2659 2663 1.400142 CGTGCTTTGTCACACCTGAAA 59.600 47.619 0.00 0.00 36.80 2.69
2660 2664 2.791158 CGTGCTTTGTCACACCTGAAAC 60.791 50.000 0.00 0.00 36.80 2.78
2661 2665 2.163412 GTGCTTTGTCACACCTGAAACA 59.837 45.455 0.00 0.00 36.97 2.83
2662 2666 3.023119 TGCTTTGTCACACCTGAAACAT 58.977 40.909 0.00 0.00 0.00 2.71
2663 2667 3.446873 TGCTTTGTCACACCTGAAACATT 59.553 39.130 0.00 0.00 0.00 2.71
2664 2668 4.081752 TGCTTTGTCACACCTGAAACATTT 60.082 37.500 0.00 0.00 0.00 2.32
2665 2669 4.268405 GCTTTGTCACACCTGAAACATTTG 59.732 41.667 0.00 0.00 0.00 2.32
2666 2670 5.649557 CTTTGTCACACCTGAAACATTTGA 58.350 37.500 0.00 0.00 0.00 2.69
2667 2671 5.651387 TTGTCACACCTGAAACATTTGAA 57.349 34.783 0.00 0.00 0.00 2.69
2668 2672 4.992688 TGTCACACCTGAAACATTTGAAC 58.007 39.130 0.00 0.00 0.00 3.18
2669 2673 4.460731 TGTCACACCTGAAACATTTGAACA 59.539 37.500 0.00 0.00 0.00 3.18
2670 2674 5.047731 TGTCACACCTGAAACATTTGAACAA 60.048 36.000 0.00 0.00 0.00 2.83
2671 2675 5.866633 GTCACACCTGAAACATTTGAACAAA 59.133 36.000 2.48 2.48 34.46 2.83
2672 2676 6.367422 GTCACACCTGAAACATTTGAACAAAA 59.633 34.615 4.12 0.00 33.56 2.44
2673 2677 6.931281 TCACACCTGAAACATTTGAACAAAAA 59.069 30.769 4.12 0.00 33.56 1.94
2674 2678 7.117523 TCACACCTGAAACATTTGAACAAAAAG 59.882 33.333 4.12 3.48 33.56 2.27
2675 2679 6.371271 ACACCTGAAACATTTGAACAAAAAGG 59.629 34.615 4.12 7.25 33.56 3.11
2676 2680 6.593382 CACCTGAAACATTTGAACAAAAAGGA 59.407 34.615 4.12 0.00 33.56 3.36
2677 2681 7.118971 CACCTGAAACATTTGAACAAAAAGGAA 59.881 33.333 4.12 0.00 33.56 3.36
2678 2682 7.334171 ACCTGAAACATTTGAACAAAAAGGAAG 59.666 33.333 4.12 0.07 33.56 3.46
2679 2683 7.201635 CCTGAAACATTTGAACAAAAAGGAAGG 60.202 37.037 4.12 4.62 33.56 3.46
2680 2684 7.390027 TGAAACATTTGAACAAAAAGGAAGGA 58.610 30.769 4.12 0.00 33.56 3.36
2681 2685 7.880195 TGAAACATTTGAACAAAAAGGAAGGAA 59.120 29.630 4.12 0.00 33.56 3.36
2682 2686 8.628630 AAACATTTGAACAAAAAGGAAGGAAA 57.371 26.923 4.12 0.00 33.56 3.13
2683 2687 8.806429 AACATTTGAACAAAAAGGAAGGAAAT 57.194 26.923 4.12 0.00 33.56 2.17
2684 2688 9.898152 AACATTTGAACAAAAAGGAAGGAAATA 57.102 25.926 4.12 0.00 33.56 1.40
2704 2708 8.888579 GAAATATATTTTTCCTCTGTCGGAGA 57.111 34.615 11.92 0.00 44.45 3.71
2705 2709 9.326413 GAAATATATTTTTCCTCTGTCGGAGAA 57.674 33.333 11.92 0.41 44.45 2.87
2706 2710 9.853177 AAATATATTTTTCCTCTGTCGGAGAAT 57.147 29.630 10.48 4.66 44.45 2.40
2707 2711 9.853177 AATATATTTTTCCTCTGTCGGAGAATT 57.147 29.630 10.48 0.00 44.45 2.17
2708 2712 9.853177 ATATATTTTTCCTCTGTCGGAGAATTT 57.147 29.630 10.48 0.72 44.45 1.82
2710 2714 9.853177 ATATTTTTCCTCTGTCGGAGAATTTAT 57.147 29.630 10.48 1.46 44.45 1.40
2711 2715 7.996098 TTTTTCCTCTGTCGGAGAATTTATT 57.004 32.000 10.48 0.00 44.45 1.40
2712 2716 6.985188 TTTCCTCTGTCGGAGAATTTATTG 57.015 37.500 10.48 0.00 44.45 1.90
2713 2717 5.023533 TCCTCTGTCGGAGAATTTATTGG 57.976 43.478 10.48 0.00 44.45 3.16
2714 2718 4.714802 TCCTCTGTCGGAGAATTTATTGGA 59.285 41.667 10.48 0.00 44.45 3.53
2715 2719 4.811557 CCTCTGTCGGAGAATTTATTGGAC 59.188 45.833 10.48 0.00 44.45 4.02
2716 2720 5.395768 CCTCTGTCGGAGAATTTATTGGACT 60.396 44.000 10.48 0.00 44.45 3.85
2717 2721 5.419542 TCTGTCGGAGAATTTATTGGACTG 58.580 41.667 0.00 0.00 39.69 3.51
2718 2722 4.513442 TGTCGGAGAATTTATTGGACTGG 58.487 43.478 0.00 0.00 39.69 4.00
2719 2723 4.019681 TGTCGGAGAATTTATTGGACTGGT 60.020 41.667 0.00 0.00 39.69 4.00
2720 2724 4.941873 GTCGGAGAATTTATTGGACTGGTT 59.058 41.667 0.00 0.00 39.69 3.67
2721 2725 5.414765 GTCGGAGAATTTATTGGACTGGTTT 59.585 40.000 0.00 0.00 39.69 3.27
2722 2726 6.007703 TCGGAGAATTTATTGGACTGGTTTT 58.992 36.000 0.00 0.00 0.00 2.43
2723 2727 6.492087 TCGGAGAATTTATTGGACTGGTTTTT 59.508 34.615 0.00 0.00 0.00 1.94
2724 2728 6.586082 CGGAGAATTTATTGGACTGGTTTTTG 59.414 38.462 0.00 0.00 0.00 2.44
2725 2729 7.523052 CGGAGAATTTATTGGACTGGTTTTTGA 60.523 37.037 0.00 0.00 0.00 2.69
2726 2730 7.814587 GGAGAATTTATTGGACTGGTTTTTGAG 59.185 37.037 0.00 0.00 0.00 3.02
2727 2731 8.477419 AGAATTTATTGGACTGGTTTTTGAGA 57.523 30.769 0.00 0.00 0.00 3.27
2728 2732 9.093458 AGAATTTATTGGACTGGTTTTTGAGAT 57.907 29.630 0.00 0.00 0.00 2.75
2733 2737 9.967451 TTATTGGACTGGTTTTTGAGATATACA 57.033 29.630 0.00 0.00 0.00 2.29
2734 2738 7.681939 TTGGACTGGTTTTTGAGATATACAC 57.318 36.000 0.00 0.00 0.00 2.90
2735 2739 6.774673 TGGACTGGTTTTTGAGATATACACA 58.225 36.000 0.00 0.00 0.00 3.72
2736 2740 7.402054 TGGACTGGTTTTTGAGATATACACAT 58.598 34.615 0.00 0.00 0.00 3.21
2737 2741 7.888021 TGGACTGGTTTTTGAGATATACACATT 59.112 33.333 0.00 0.00 0.00 2.71
2738 2742 8.184192 GGACTGGTTTTTGAGATATACACATTG 58.816 37.037 0.00 0.00 0.00 2.82
2739 2743 8.635765 ACTGGTTTTTGAGATATACACATTGT 57.364 30.769 0.00 0.00 0.00 2.71
2740 2744 9.733556 ACTGGTTTTTGAGATATACACATTGTA 57.266 29.630 0.00 0.00 37.24 2.41
2742 2746 9.733556 TGGTTTTTGAGATATACACATTGTAGT 57.266 29.630 0.00 0.00 36.14 2.73
2751 2755 9.326413 AGATATACACATTGTAGTTACCAAAGC 57.674 33.333 0.00 0.00 36.14 3.51
2752 2756 9.104965 GATATACACATTGTAGTTACCAAAGCA 57.895 33.333 0.00 0.00 36.14 3.91
2753 2757 7.753309 ATACACATTGTAGTTACCAAAGCAA 57.247 32.000 0.00 0.00 36.14 3.91
2754 2758 6.648879 ACACATTGTAGTTACCAAAGCAAT 57.351 33.333 0.00 0.00 0.00 3.56
2755 2759 7.753309 ACACATTGTAGTTACCAAAGCAATA 57.247 32.000 0.00 0.00 0.00 1.90
2756 2760 8.172352 ACACATTGTAGTTACCAAAGCAATAA 57.828 30.769 0.00 0.00 0.00 1.40
2757 2761 8.634444 ACACATTGTAGTTACCAAAGCAATAAA 58.366 29.630 0.00 0.00 0.00 1.40
2758 2762 9.638239 CACATTGTAGTTACCAAAGCAATAAAT 57.362 29.630 0.00 0.00 0.00 1.40
2767 2771 9.476202 GTTACCAAAGCAATAAATATTCCATCC 57.524 33.333 0.00 0.00 0.00 3.51
2768 2772 6.748132 ACCAAAGCAATAAATATTCCATCCG 58.252 36.000 0.00 0.00 0.00 4.18
2769 2773 6.549364 ACCAAAGCAATAAATATTCCATCCGA 59.451 34.615 0.00 0.00 0.00 4.55
2770 2774 7.069331 ACCAAAGCAATAAATATTCCATCCGAA 59.931 33.333 0.00 0.00 34.14 4.30
2771 2775 7.925483 CCAAAGCAATAAATATTCCATCCGAAA 59.075 33.333 0.00 0.00 33.08 3.46
2772 2776 8.971321 CAAAGCAATAAATATTCCATCCGAAAG 58.029 33.333 0.00 0.00 33.08 2.62
2773 2777 8.463930 AAGCAATAAATATTCCATCCGAAAGA 57.536 30.769 0.00 0.00 33.08 2.52
2774 2778 8.641498 AGCAATAAATATTCCATCCGAAAGAT 57.359 30.769 0.00 0.00 33.08 2.40
2803 2807 9.442047 AATCAAATCTCTATCTCTTTTTCGTGT 57.558 29.630 0.00 0.00 0.00 4.49
2804 2808 8.467402 TCAAATCTCTATCTCTTTTTCGTGTC 57.533 34.615 0.00 0.00 0.00 3.67
2805 2809 8.088365 TCAAATCTCTATCTCTTTTTCGTGTCA 58.912 33.333 0.00 0.00 0.00 3.58
2806 2810 8.712363 CAAATCTCTATCTCTTTTTCGTGTCAA 58.288 33.333 0.00 0.00 0.00 3.18
2807 2811 8.472683 AATCTCTATCTCTTTTTCGTGTCAAG 57.527 34.615 0.00 0.00 0.00 3.02
2808 2812 5.864474 TCTCTATCTCTTTTTCGTGTCAAGC 59.136 40.000 0.00 0.00 0.00 4.01
2809 2813 5.538118 TCTATCTCTTTTTCGTGTCAAGCA 58.462 37.500 0.00 0.00 0.00 3.91
2810 2814 4.739046 ATCTCTTTTTCGTGTCAAGCAG 57.261 40.909 0.00 0.00 0.00 4.24
2811 2815 2.872245 TCTCTTTTTCGTGTCAAGCAGG 59.128 45.455 0.00 0.00 0.00 4.85
2812 2816 1.333619 TCTTTTTCGTGTCAAGCAGGC 59.666 47.619 0.00 0.00 33.35 4.85
2813 2817 1.065401 CTTTTTCGTGTCAAGCAGGCA 59.935 47.619 0.00 0.00 33.35 4.75
2819 2823 3.418022 TGTCAAGCAGGCACAATCA 57.582 47.368 0.00 0.00 0.00 2.57
2820 2824 1.913778 TGTCAAGCAGGCACAATCAT 58.086 45.000 0.00 0.00 0.00 2.45
2821 2825 1.542472 TGTCAAGCAGGCACAATCATG 59.458 47.619 0.00 0.00 0.00 3.07
2822 2826 1.814394 GTCAAGCAGGCACAATCATGA 59.186 47.619 0.00 0.00 0.00 3.07
2823 2827 1.814394 TCAAGCAGGCACAATCATGAC 59.186 47.619 0.00 0.00 0.00 3.06
2824 2828 1.135199 CAAGCAGGCACAATCATGACC 60.135 52.381 0.00 0.00 0.00 4.02
2825 2829 0.682209 AGCAGGCACAATCATGACCC 60.682 55.000 0.00 0.00 0.00 4.46
2826 2830 1.996786 GCAGGCACAATCATGACCCG 61.997 60.000 0.00 0.00 0.00 5.28
2827 2831 0.677731 CAGGCACAATCATGACCCGT 60.678 55.000 0.00 0.00 0.00 5.28
2828 2832 0.038166 AGGCACAATCATGACCCGTT 59.962 50.000 0.00 0.00 0.00 4.44
2829 2833 0.451783 GGCACAATCATGACCCGTTC 59.548 55.000 0.00 0.00 0.00 3.95
2830 2834 0.096976 GCACAATCATGACCCGTTCG 59.903 55.000 0.00 0.00 0.00 3.95
2831 2835 1.438651 CACAATCATGACCCGTTCGT 58.561 50.000 0.00 0.00 0.00 3.85
2832 2836 1.128507 CACAATCATGACCCGTTCGTG 59.871 52.381 0.00 0.00 42.03 4.35
2833 2837 0.726827 CAATCATGACCCGTTCGTGG 59.273 55.000 0.00 0.00 41.13 4.94
2834 2838 0.611200 AATCATGACCCGTTCGTGGA 59.389 50.000 0.00 0.00 41.13 4.02
2835 2839 0.830648 ATCATGACCCGTTCGTGGAT 59.169 50.000 0.00 0.00 41.13 3.41
2836 2840 1.476477 TCATGACCCGTTCGTGGATA 58.524 50.000 0.00 0.00 41.13 2.59
2837 2841 2.036387 TCATGACCCGTTCGTGGATAT 58.964 47.619 0.00 0.00 41.13 1.63
2838 2842 2.135139 CATGACCCGTTCGTGGATATG 58.865 52.381 0.00 6.64 37.56 1.78
2839 2843 1.187974 TGACCCGTTCGTGGATATGT 58.812 50.000 6.70 0.00 0.00 2.29
2840 2844 2.377073 TGACCCGTTCGTGGATATGTA 58.623 47.619 6.70 0.00 0.00 2.29
2841 2845 2.099592 TGACCCGTTCGTGGATATGTAC 59.900 50.000 6.70 0.00 0.00 2.90
2842 2846 2.099592 GACCCGTTCGTGGATATGTACA 59.900 50.000 0.00 0.00 0.00 2.90
2843 2847 2.496871 ACCCGTTCGTGGATATGTACAA 59.503 45.455 0.00 0.00 0.00 2.41
2844 2848 3.120792 CCCGTTCGTGGATATGTACAAG 58.879 50.000 0.00 0.00 0.00 3.16
2845 2849 3.120792 CCGTTCGTGGATATGTACAAGG 58.879 50.000 0.00 0.00 0.00 3.61
2846 2850 3.181484 CCGTTCGTGGATATGTACAAGGA 60.181 47.826 0.00 0.00 0.00 3.36
2847 2851 4.500887 CCGTTCGTGGATATGTACAAGGAT 60.501 45.833 0.00 0.00 0.00 3.24
2848 2852 4.444388 CGTTCGTGGATATGTACAAGGATG 59.556 45.833 0.00 0.00 0.00 3.51
2849 2853 4.600692 TCGTGGATATGTACAAGGATGG 57.399 45.455 0.00 0.00 0.00 3.51
2850 2854 4.219919 TCGTGGATATGTACAAGGATGGA 58.780 43.478 0.00 0.00 0.00 3.41
2851 2855 4.838423 TCGTGGATATGTACAAGGATGGAT 59.162 41.667 0.00 0.00 0.00 3.41
2852 2856 5.047306 TCGTGGATATGTACAAGGATGGATC 60.047 44.000 0.00 0.00 0.00 3.36
2853 2857 5.171476 GTGGATATGTACAAGGATGGATCG 58.829 45.833 0.00 0.00 0.00 3.69
2854 2858 4.838423 TGGATATGTACAAGGATGGATCGT 59.162 41.667 0.00 0.00 0.00 3.73
2855 2859 5.171476 GGATATGTACAAGGATGGATCGTG 58.829 45.833 0.00 0.00 0.00 4.35
2856 2860 5.047306 GGATATGTACAAGGATGGATCGTGA 60.047 44.000 0.00 0.00 0.00 4.35
2857 2861 4.753516 ATGTACAAGGATGGATCGTGAA 57.246 40.909 0.00 0.00 0.00 3.18
2858 2862 4.545208 TGTACAAGGATGGATCGTGAAA 57.455 40.909 0.00 0.00 0.00 2.69
2859 2863 5.097742 TGTACAAGGATGGATCGTGAAAT 57.902 39.130 0.00 0.00 0.00 2.17
2860 2864 4.875536 TGTACAAGGATGGATCGTGAAATG 59.124 41.667 0.00 0.00 0.00 2.32
2861 2865 4.220693 ACAAGGATGGATCGTGAAATGA 57.779 40.909 0.00 0.00 35.53 2.57
2862 2866 4.194640 ACAAGGATGGATCGTGAAATGAG 58.805 43.478 0.00 0.00 33.81 2.90
2863 2867 4.194640 CAAGGATGGATCGTGAAATGAGT 58.805 43.478 0.00 0.00 33.81 3.41
2864 2868 5.104941 ACAAGGATGGATCGTGAAATGAGTA 60.105 40.000 0.00 0.00 33.81 2.59
2865 2869 4.950050 AGGATGGATCGTGAAATGAGTAC 58.050 43.478 0.00 0.00 33.81 2.73
2866 2870 4.405680 AGGATGGATCGTGAAATGAGTACA 59.594 41.667 0.00 0.00 33.81 2.90
2867 2871 5.070981 AGGATGGATCGTGAAATGAGTACAT 59.929 40.000 0.00 0.00 33.81 2.29
2868 2872 5.178252 GGATGGATCGTGAAATGAGTACATG 59.822 44.000 0.00 0.00 33.81 3.21
2869 2873 5.337578 TGGATCGTGAAATGAGTACATGA 57.662 39.130 0.00 0.00 33.81 3.07
2870 2874 5.729510 TGGATCGTGAAATGAGTACATGAA 58.270 37.500 0.00 0.00 33.81 2.57
2871 2875 5.580691 TGGATCGTGAAATGAGTACATGAAC 59.419 40.000 0.00 0.00 33.81 3.18
2872 2876 5.580691 GGATCGTGAAATGAGTACATGAACA 59.419 40.000 0.00 0.00 33.81 3.18
2873 2877 6.237942 GGATCGTGAAATGAGTACATGAACAG 60.238 42.308 0.00 0.00 33.81 3.16
2874 2878 4.929211 TCGTGAAATGAGTACATGAACAGG 59.071 41.667 0.00 0.00 36.79 4.00
2875 2879 4.929211 CGTGAAATGAGTACATGAACAGGA 59.071 41.667 0.00 0.00 36.79 3.86
2876 2880 5.408299 CGTGAAATGAGTACATGAACAGGAA 59.592 40.000 0.00 0.00 36.79 3.36
2877 2881 6.073276 CGTGAAATGAGTACATGAACAGGAAA 60.073 38.462 0.00 0.00 36.79 3.13
2878 2882 7.301054 GTGAAATGAGTACATGAACAGGAAAG 58.699 38.462 0.00 0.00 36.79 2.62
2879 2883 7.173218 GTGAAATGAGTACATGAACAGGAAAGA 59.827 37.037 0.00 0.00 36.79 2.52
2880 2884 7.719193 TGAAATGAGTACATGAACAGGAAAGAA 59.281 33.333 0.00 0.00 36.79 2.52
2881 2885 7.678947 AATGAGTACATGAACAGGAAAGAAG 57.321 36.000 0.00 0.00 36.79 2.85
2882 2886 6.174720 TGAGTACATGAACAGGAAAGAAGT 57.825 37.500 0.00 0.00 0.00 3.01
2883 2887 5.991606 TGAGTACATGAACAGGAAAGAAGTG 59.008 40.000 0.00 0.00 0.00 3.16
2884 2888 6.174720 AGTACATGAACAGGAAAGAAGTGA 57.825 37.500 0.00 0.00 0.00 3.41
2885 2889 6.773638 AGTACATGAACAGGAAAGAAGTGAT 58.226 36.000 0.00 0.00 0.00 3.06
2886 2890 5.954296 ACATGAACAGGAAAGAAGTGATG 57.046 39.130 0.00 0.00 0.00 3.07
2887 2891 5.624159 ACATGAACAGGAAAGAAGTGATGA 58.376 37.500 0.00 0.00 0.00 2.92
2888 2892 5.471456 ACATGAACAGGAAAGAAGTGATGAC 59.529 40.000 0.00 0.00 0.00 3.06
2889 2893 4.389374 TGAACAGGAAAGAAGTGATGACC 58.611 43.478 0.00 0.00 0.00 4.02
2890 2894 4.141505 TGAACAGGAAAGAAGTGATGACCA 60.142 41.667 0.00 0.00 0.00 4.02
2891 2895 4.647564 ACAGGAAAGAAGTGATGACCAT 57.352 40.909 0.00 0.00 0.00 3.55
2892 2896 4.330250 ACAGGAAAGAAGTGATGACCATG 58.670 43.478 0.00 0.00 0.00 3.66
2893 2897 3.128242 CAGGAAAGAAGTGATGACCATGC 59.872 47.826 0.00 0.00 0.00 4.06
2894 2898 3.084039 GGAAAGAAGTGATGACCATGCA 58.916 45.455 0.00 0.00 0.00 3.96
2895 2899 3.698040 GGAAAGAAGTGATGACCATGCAT 59.302 43.478 0.00 0.00 0.00 3.96
2896 2900 4.439700 GGAAAGAAGTGATGACCATGCATG 60.440 45.833 20.19 20.19 0.00 4.06
2897 2901 3.361281 AGAAGTGATGACCATGCATGT 57.639 42.857 24.58 13.09 0.00 3.21
2898 2902 4.492494 AGAAGTGATGACCATGCATGTA 57.508 40.909 24.58 11.45 0.00 2.29
2899 2903 4.847198 AGAAGTGATGACCATGCATGTAA 58.153 39.130 24.58 10.46 0.00 2.41
2900 2904 5.255687 AGAAGTGATGACCATGCATGTAAA 58.744 37.500 24.58 10.10 0.00 2.01
2901 2905 5.889853 AGAAGTGATGACCATGCATGTAAAT 59.110 36.000 24.58 14.26 0.00 1.40
2902 2906 6.379133 AGAAGTGATGACCATGCATGTAAATT 59.621 34.615 24.58 5.42 0.00 1.82
2903 2907 6.534475 AGTGATGACCATGCATGTAAATTT 57.466 33.333 24.58 5.01 0.00 1.82
2904 2908 6.334989 AGTGATGACCATGCATGTAAATTTG 58.665 36.000 24.58 10.29 0.00 2.32
2905 2909 5.005971 GTGATGACCATGCATGTAAATTTGC 59.994 40.000 24.58 0.00 0.00 3.68
2906 2910 4.532314 TGACCATGCATGTAAATTTGCA 57.468 36.364 24.58 11.51 41.73 4.08
2908 2912 5.489249 TGACCATGCATGTAAATTTGCATT 58.511 33.333 24.58 4.06 44.44 3.56
2909 2913 5.581479 TGACCATGCATGTAAATTTGCATTC 59.419 36.000 24.58 14.23 44.44 2.67
2910 2914 5.489249 ACCATGCATGTAAATTTGCATTCA 58.511 33.333 24.58 19.90 44.44 2.57
2911 2915 5.352016 ACCATGCATGTAAATTTGCATTCAC 59.648 36.000 24.58 12.90 44.44 3.18
2912 2916 5.351740 CCATGCATGTAAATTTGCATTCACA 59.648 36.000 24.58 16.99 44.44 3.58
2913 2917 6.037720 CCATGCATGTAAATTTGCATTCACAT 59.962 34.615 24.58 18.12 44.44 3.21
2914 2918 7.224949 CCATGCATGTAAATTTGCATTCACATA 59.775 33.333 24.58 2.34 44.44 2.29
2915 2919 8.769891 CATGCATGTAAATTTGCATTCACATAT 58.230 29.630 19.99 5.58 44.44 1.78
2916 2920 8.719560 TGCATGTAAATTTGCATTCACATATT 57.280 26.923 17.83 0.00 30.88 1.28
2917 2921 8.604890 TGCATGTAAATTTGCATTCACATATTG 58.395 29.630 17.83 7.51 30.88 1.90
2918 2922 8.605746 GCATGTAAATTTGCATTCACATATTGT 58.394 29.630 17.83 0.00 30.88 2.71
2919 2923 9.909043 CATGTAAATTTGCATTCACATATTGTG 57.091 29.630 17.83 1.19 39.28 3.33
2953 2957 6.777526 CTCCCGAGCTTTGATCTATTTAAG 57.222 41.667 0.00 0.00 0.00 1.85
2954 2958 5.057149 TCCCGAGCTTTGATCTATTTAAGC 58.943 41.667 0.00 0.00 42.45 3.09
2955 2959 4.816385 CCCGAGCTTTGATCTATTTAAGCA 59.184 41.667 0.00 0.00 44.08 3.91
2956 2960 5.471456 CCCGAGCTTTGATCTATTTAAGCAT 59.529 40.000 0.00 0.00 44.08 3.79
2957 2961 6.369005 CCGAGCTTTGATCTATTTAAGCATG 58.631 40.000 0.00 0.00 44.08 4.06
2958 2962 5.850128 CGAGCTTTGATCTATTTAAGCATGC 59.150 40.000 10.51 10.51 44.08 4.06
2959 2963 6.512253 CGAGCTTTGATCTATTTAAGCATGCA 60.512 38.462 21.98 0.00 44.08 3.96
2960 2964 7.286215 AGCTTTGATCTATTTAAGCATGCAT 57.714 32.000 21.98 11.22 44.08 3.96
2961 2965 7.145985 AGCTTTGATCTATTTAAGCATGCATG 58.854 34.615 22.70 22.70 44.08 4.06
2962 2966 6.365247 GCTTTGATCTATTTAAGCATGCATGG 59.635 38.462 27.34 6.61 41.89 3.66
2963 2967 7.585579 TTTGATCTATTTAAGCATGCATGGA 57.414 32.000 27.34 12.14 0.00 3.41
2964 2968 6.564709 TGATCTATTTAAGCATGCATGGAC 57.435 37.500 27.34 12.23 0.00 4.02
2965 2969 6.301486 TGATCTATTTAAGCATGCATGGACT 58.699 36.000 27.34 14.37 0.00 3.85
2966 2970 6.206048 TGATCTATTTAAGCATGCATGGACTG 59.794 38.462 27.34 4.17 0.00 3.51
2967 2971 5.439721 TCTATTTAAGCATGCATGGACTGT 58.560 37.500 27.34 10.38 0.00 3.55
2968 2972 6.591001 TCTATTTAAGCATGCATGGACTGTA 58.409 36.000 27.34 9.55 0.00 2.74
2969 2973 7.053498 TCTATTTAAGCATGCATGGACTGTAA 58.947 34.615 27.34 14.01 0.00 2.41
2970 2974 6.720112 ATTTAAGCATGCATGGACTGTAAT 57.280 33.333 27.34 15.35 0.00 1.89
2971 2975 7.822161 ATTTAAGCATGCATGGACTGTAATA 57.178 32.000 27.34 4.42 0.00 0.98
2972 2976 7.637631 TTTAAGCATGCATGGACTGTAATAA 57.362 32.000 27.34 9.69 0.00 1.40
2973 2977 7.822161 TTAAGCATGCATGGACTGTAATAAT 57.178 32.000 27.34 3.68 0.00 1.28
2974 2978 6.720112 AAGCATGCATGGACTGTAATAATT 57.280 33.333 27.34 0.00 0.00 1.40
2975 2979 6.080648 AGCATGCATGGACTGTAATAATTG 57.919 37.500 27.34 0.00 0.00 2.32
2976 2980 5.010314 AGCATGCATGGACTGTAATAATTGG 59.990 40.000 27.34 0.00 0.00 3.16
2977 2981 5.775686 CATGCATGGACTGTAATAATTGGG 58.224 41.667 19.40 0.00 0.00 4.12
2978 2982 5.122707 TGCATGGACTGTAATAATTGGGA 57.877 39.130 0.00 0.00 0.00 4.37
2979 2983 5.514169 TGCATGGACTGTAATAATTGGGAA 58.486 37.500 0.00 0.00 0.00 3.97
2980 2984 5.593909 TGCATGGACTGTAATAATTGGGAAG 59.406 40.000 0.00 0.00 0.00 3.46
2981 2985 5.594317 GCATGGACTGTAATAATTGGGAAGT 59.406 40.000 0.00 0.00 0.00 3.01
2982 2986 6.096846 GCATGGACTGTAATAATTGGGAAGTT 59.903 38.462 0.00 0.00 0.00 2.66
2983 2987 7.363793 GCATGGACTGTAATAATTGGGAAGTTT 60.364 37.037 0.00 0.00 0.00 2.66
2984 2988 8.531146 CATGGACTGTAATAATTGGGAAGTTTT 58.469 33.333 0.00 0.00 0.00 2.43
2985 2989 8.117813 TGGACTGTAATAATTGGGAAGTTTTC 57.882 34.615 0.00 0.00 0.00 2.29
2986 2990 7.947890 TGGACTGTAATAATTGGGAAGTTTTCT 59.052 33.333 0.00 0.00 0.00 2.52
2987 2991 9.457436 GGACTGTAATAATTGGGAAGTTTTCTA 57.543 33.333 0.00 0.00 0.00 2.10
2999 3003 7.703328 TGGGAAGTTTTCTATCAAATTATCGC 58.297 34.615 0.00 0.00 0.00 4.58
3000 3004 7.338196 TGGGAAGTTTTCTATCAAATTATCGCA 59.662 33.333 0.00 0.00 0.00 5.10
3001 3005 7.644157 GGGAAGTTTTCTATCAAATTATCGCAC 59.356 37.037 0.00 0.00 0.00 5.34
3002 3006 8.398665 GGAAGTTTTCTATCAAATTATCGCACT 58.601 33.333 0.00 0.00 0.00 4.40
3003 3007 9.774742 GAAGTTTTCTATCAAATTATCGCACTT 57.225 29.630 0.00 0.00 0.00 3.16
3005 3009 9.774742 AGTTTTCTATCAAATTATCGCACTTTC 57.225 29.630 0.00 0.00 0.00 2.62
3006 3010 9.554724 GTTTTCTATCAAATTATCGCACTTTCA 57.445 29.630 0.00 0.00 0.00 2.69
3014 3018 9.882996 TCAAATTATCGCACTTTCATATGAATC 57.117 29.630 18.61 7.91 33.54 2.52
3015 3019 9.667989 CAAATTATCGCACTTTCATATGAATCA 57.332 29.630 18.61 4.41 33.54 2.57
3016 3020 9.888878 AAATTATCGCACTTTCATATGAATCAG 57.111 29.630 18.61 15.66 33.54 2.90
3017 3021 5.936686 ATCGCACTTTCATATGAATCAGG 57.063 39.130 18.61 11.47 33.54 3.86
3018 3022 5.022282 TCGCACTTTCATATGAATCAGGA 57.978 39.130 18.61 9.99 33.54 3.86
3019 3023 4.811024 TCGCACTTTCATATGAATCAGGAC 59.189 41.667 18.61 9.47 33.54 3.85
3020 3024 4.813161 CGCACTTTCATATGAATCAGGACT 59.187 41.667 18.61 0.00 33.54 3.85
3021 3025 5.295292 CGCACTTTCATATGAATCAGGACTT 59.705 40.000 18.61 0.00 33.54 3.01
3022 3026 6.183360 CGCACTTTCATATGAATCAGGACTTT 60.183 38.462 18.61 0.00 33.54 2.66
3023 3027 6.971184 GCACTTTCATATGAATCAGGACTTTG 59.029 38.462 18.61 8.98 33.54 2.77
3024 3028 6.971184 CACTTTCATATGAATCAGGACTTTGC 59.029 38.462 18.61 0.00 33.54 3.68
3025 3029 6.888632 ACTTTCATATGAATCAGGACTTTGCT 59.111 34.615 18.61 0.00 33.54 3.91
3026 3030 7.395489 ACTTTCATATGAATCAGGACTTTGCTT 59.605 33.333 18.61 0.00 33.54 3.91
3027 3031 7.707624 TTCATATGAATCAGGACTTTGCTTT 57.292 32.000 14.23 0.00 0.00 3.51
3028 3032 8.806429 TTCATATGAATCAGGACTTTGCTTTA 57.194 30.769 14.23 0.00 0.00 1.85
3029 3033 8.806429 TCATATGAATCAGGACTTTGCTTTAA 57.194 30.769 1.98 0.00 0.00 1.52
3030 3034 8.677300 TCATATGAATCAGGACTTTGCTTTAAC 58.323 33.333 1.98 0.00 0.00 2.01
3031 3035 6.899393 ATGAATCAGGACTTTGCTTTAACA 57.101 33.333 0.00 0.00 0.00 2.41
3032 3036 6.899393 TGAATCAGGACTTTGCTTTAACAT 57.101 33.333 0.00 0.00 0.00 2.71
3033 3037 6.913170 TGAATCAGGACTTTGCTTTAACATC 58.087 36.000 0.00 0.00 0.00 3.06
3034 3038 5.904362 ATCAGGACTTTGCTTTAACATCC 57.096 39.130 0.00 0.00 0.00 3.51
3035 3039 4.724399 TCAGGACTTTGCTTTAACATCCA 58.276 39.130 0.00 0.00 0.00 3.41
3036 3040 5.324409 TCAGGACTTTGCTTTAACATCCAT 58.676 37.500 0.00 0.00 0.00 3.41
3037 3041 5.774690 TCAGGACTTTGCTTTAACATCCATT 59.225 36.000 0.00 0.00 0.00 3.16
3038 3042 6.945435 TCAGGACTTTGCTTTAACATCCATTA 59.055 34.615 0.00 0.00 0.00 1.90
3039 3043 7.121168 TCAGGACTTTGCTTTAACATCCATTAG 59.879 37.037 0.00 0.00 0.00 1.73
3040 3044 7.121168 CAGGACTTTGCTTTAACATCCATTAGA 59.879 37.037 0.00 0.00 0.00 2.10
3041 3045 7.836183 AGGACTTTGCTTTAACATCCATTAGAT 59.164 33.333 0.00 0.00 34.66 1.98
3042 3046 9.120538 GGACTTTGCTTTAACATCCATTAGATA 57.879 33.333 0.00 0.00 32.37 1.98
3048 3052 9.625747 TGCTTTAACATCCATTAGATATTGTGA 57.374 29.630 0.00 0.00 32.37 3.58
3080 3084 7.701539 TGGAACATTACATATCTGCAAAGTT 57.298 32.000 0.00 0.00 0.00 2.66
3081 3085 8.121305 TGGAACATTACATATCTGCAAAGTTT 57.879 30.769 0.00 0.00 0.00 2.66
3082 3086 8.584157 TGGAACATTACATATCTGCAAAGTTTT 58.416 29.630 0.00 0.00 0.00 2.43
3083 3087 9.076596 GGAACATTACATATCTGCAAAGTTTTC 57.923 33.333 0.00 0.00 0.00 2.29
3084 3088 9.846248 GAACATTACATATCTGCAAAGTTTTCT 57.154 29.630 0.00 0.00 0.00 2.52
3090 3094 8.798859 ACATATCTGCAAAGTTTTCTATCACT 57.201 30.769 0.00 0.00 0.00 3.41
3091 3095 9.890629 ACATATCTGCAAAGTTTTCTATCACTA 57.109 29.630 0.00 0.00 0.00 2.74
3095 3099 8.758633 TCTGCAAAGTTTTCTATCACTACTAC 57.241 34.615 0.00 0.00 0.00 2.73
3096 3100 8.364894 TCTGCAAAGTTTTCTATCACTACTACA 58.635 33.333 0.00 0.00 0.00 2.74
3097 3101 9.155975 CTGCAAAGTTTTCTATCACTACTACAT 57.844 33.333 0.00 0.00 0.00 2.29
3104 3108 9.490379 GTTTTCTATCACTACTACATAATGGGG 57.510 37.037 0.00 0.00 0.00 4.96
3105 3109 6.852420 TCTATCACTACTACATAATGGGGC 57.148 41.667 0.00 0.00 0.00 5.80
3106 3110 6.562228 TCTATCACTACTACATAATGGGGCT 58.438 40.000 0.00 0.00 0.00 5.19
3107 3111 7.705700 TCTATCACTACTACATAATGGGGCTA 58.294 38.462 0.00 0.00 0.00 3.93
3108 3112 8.174757 TCTATCACTACTACATAATGGGGCTAA 58.825 37.037 0.00 0.00 0.00 3.09
3109 3113 6.665992 TCACTACTACATAATGGGGCTAAG 57.334 41.667 0.00 0.00 0.00 2.18
3110 3114 6.378745 TCACTACTACATAATGGGGCTAAGA 58.621 40.000 0.00 0.00 0.00 2.10
3111 3115 6.842280 TCACTACTACATAATGGGGCTAAGAA 59.158 38.462 0.00 0.00 0.00 2.52
3112 3116 7.015292 TCACTACTACATAATGGGGCTAAGAAG 59.985 40.741 0.00 0.00 0.00 2.85
3113 3117 7.015292 CACTACTACATAATGGGGCTAAGAAGA 59.985 40.741 0.00 0.00 0.00 2.87
3114 3118 6.176014 ACTACATAATGGGGCTAAGAAGAC 57.824 41.667 0.00 0.00 0.00 3.01
3115 3119 5.665812 ACTACATAATGGGGCTAAGAAGACA 59.334 40.000 0.00 0.00 29.10 3.41
3116 3120 4.781934 ACATAATGGGGCTAAGAAGACAC 58.218 43.478 0.00 0.00 33.11 3.67
3120 3124 2.551270 TGGGGCTAAGAAGACACATCT 58.449 47.619 0.00 0.00 40.15 2.90
3121 3125 3.719871 TGGGGCTAAGAAGACACATCTA 58.280 45.455 0.00 0.00 40.15 1.98
3122 3126 3.451178 TGGGGCTAAGAAGACACATCTAC 59.549 47.826 0.00 0.00 40.15 2.59
3123 3127 3.181464 GGGGCTAAGAAGACACATCTACC 60.181 52.174 0.00 0.00 32.54 3.18
3124 3128 3.491104 GGGCTAAGAAGACACATCTACCG 60.491 52.174 0.00 0.00 33.57 4.02
3125 3129 3.130693 GGCTAAGAAGACACATCTACCGT 59.869 47.826 0.00 0.00 33.57 4.83
3126 3130 4.337555 GGCTAAGAAGACACATCTACCGTA 59.662 45.833 0.00 0.00 33.57 4.02
3127 3131 5.272397 GCTAAGAAGACACATCTACCGTAC 58.728 45.833 0.00 0.00 33.57 3.67
3128 3132 4.352600 AAGAAGACACATCTACCGTACG 57.647 45.455 8.69 8.69 33.57 3.67
3129 3133 2.097142 AGAAGACACATCTACCGTACGC 59.903 50.000 10.49 0.00 33.57 4.42
3130 3134 0.737219 AGACACATCTACCGTACGCC 59.263 55.000 10.49 0.00 31.46 5.68
3131 3135 0.248784 GACACATCTACCGTACGCCC 60.249 60.000 10.49 0.00 0.00 6.13
3132 3136 0.682209 ACACATCTACCGTACGCCCT 60.682 55.000 10.49 0.00 0.00 5.19
3133 3137 0.248907 CACATCTACCGTACGCCCTG 60.249 60.000 10.49 4.99 0.00 4.45
3134 3138 1.362717 CATCTACCGTACGCCCTGG 59.637 63.158 10.49 0.00 0.00 4.45
3135 3139 1.105167 CATCTACCGTACGCCCTGGA 61.105 60.000 10.49 2.08 0.00 3.86
3136 3140 1.105759 ATCTACCGTACGCCCTGGAC 61.106 60.000 10.49 0.00 0.00 4.02
3137 3141 2.755469 TACCGTACGCCCTGGACC 60.755 66.667 10.49 0.00 0.00 4.46
3140 3144 3.751246 CGTACGCCCTGGACCGAA 61.751 66.667 0.52 0.00 0.00 4.30
3141 3145 2.125793 GTACGCCCTGGACCGAAC 60.126 66.667 12.49 0.00 0.00 3.95
3142 3146 2.283388 TACGCCCTGGACCGAACT 60.283 61.111 12.49 0.00 0.00 3.01
3143 3147 1.001020 TACGCCCTGGACCGAACTA 60.001 57.895 12.49 0.00 0.00 2.24
3144 3148 0.396139 TACGCCCTGGACCGAACTAT 60.396 55.000 12.49 0.00 0.00 2.12
3145 3149 1.227263 CGCCCTGGACCGAACTATG 60.227 63.158 0.00 0.00 0.00 2.23
3146 3150 1.905512 GCCCTGGACCGAACTATGT 59.094 57.895 0.00 0.00 0.00 2.29
3147 3151 0.462047 GCCCTGGACCGAACTATGTG 60.462 60.000 0.00 0.00 0.00 3.21
3148 3152 0.902531 CCCTGGACCGAACTATGTGT 59.097 55.000 0.00 0.00 0.00 3.72
3149 3153 1.405526 CCCTGGACCGAACTATGTGTG 60.406 57.143 0.00 0.00 0.00 3.82
3150 3154 1.548719 CCTGGACCGAACTATGTGTGA 59.451 52.381 0.00 0.00 0.00 3.58
3151 3155 2.168521 CCTGGACCGAACTATGTGTGAT 59.831 50.000 0.00 0.00 0.00 3.06
3152 3156 3.383505 CCTGGACCGAACTATGTGTGATA 59.616 47.826 0.00 0.00 0.00 2.15
3153 3157 4.360563 CTGGACCGAACTATGTGTGATAC 58.639 47.826 0.00 0.00 0.00 2.24
3154 3158 3.764972 TGGACCGAACTATGTGTGATACA 59.235 43.478 0.00 0.00 44.87 2.29
3166 3170 3.483808 TGTGATACACAGGCAGTTCAA 57.516 42.857 0.25 0.00 39.62 2.69
3167 3171 3.402110 TGTGATACACAGGCAGTTCAAG 58.598 45.455 0.25 0.00 39.62 3.02
3168 3172 2.744202 GTGATACACAGGCAGTTCAAGG 59.256 50.000 0.00 0.00 34.08 3.61
3169 3173 2.637382 TGATACACAGGCAGTTCAAGGA 59.363 45.455 0.00 0.00 0.00 3.36
3170 3174 3.072330 TGATACACAGGCAGTTCAAGGAA 59.928 43.478 0.00 0.00 0.00 3.36
3171 3175 2.435372 ACACAGGCAGTTCAAGGAAA 57.565 45.000 0.00 0.00 0.00 3.13
3172 3176 2.733956 ACACAGGCAGTTCAAGGAAAA 58.266 42.857 0.00 0.00 0.00 2.29
3173 3177 3.096092 ACACAGGCAGTTCAAGGAAAAA 58.904 40.909 0.00 0.00 0.00 1.94
3205 3209 8.614469 TGATGTTGTAATATCACACAGTTCAA 57.386 30.769 0.63 0.00 32.56 2.69
3206 3210 9.061435 TGATGTTGTAATATCACACAGTTCAAA 57.939 29.630 0.63 0.00 32.56 2.69
3207 3211 9.891828 GATGTTGTAATATCACACAGTTCAAAA 57.108 29.630 0.00 0.00 0.00 2.44
3211 3215 8.741101 TGTAATATCACACAGTTCAAAAATGC 57.259 30.769 0.00 0.00 0.00 3.56
3212 3216 8.355913 TGTAATATCACACAGTTCAAAAATGCA 58.644 29.630 0.00 0.00 0.00 3.96
3213 3217 9.190858 GTAATATCACACAGTTCAAAAATGCAA 57.809 29.630 0.00 0.00 0.00 4.08
3214 3218 8.836268 AATATCACACAGTTCAAAAATGCAAT 57.164 26.923 0.00 0.00 0.00 3.56
3215 3219 6.774354 ATCACACAGTTCAAAAATGCAATC 57.226 33.333 0.00 0.00 0.00 2.67
3216 3220 4.739228 TCACACAGTTCAAAAATGCAATCG 59.261 37.500 0.00 0.00 0.00 3.34
3217 3221 4.503734 CACACAGTTCAAAAATGCAATCGT 59.496 37.500 0.00 0.00 0.00 3.73
3218 3222 4.503734 ACACAGTTCAAAAATGCAATCGTG 59.496 37.500 0.00 0.00 0.00 4.35
3219 3223 4.503734 CACAGTTCAAAAATGCAATCGTGT 59.496 37.500 0.00 0.00 0.00 4.49
3220 3224 4.503734 ACAGTTCAAAAATGCAATCGTGTG 59.496 37.500 0.00 0.00 0.00 3.82
3221 3225 3.490526 AGTTCAAAAATGCAATCGTGTGC 59.509 39.130 0.00 6.19 45.15 4.57
3231 3235 2.935191 TCGTGTGCGATGTTGTGC 59.065 55.556 0.00 0.00 42.81 4.57
3232 3236 1.884926 TCGTGTGCGATGTTGTGCA 60.885 52.632 0.00 0.00 42.81 4.57
3233 3237 1.010238 CGTGTGCGATGTTGTGCAA 60.010 52.632 0.00 0.00 43.75 4.08
3234 3238 0.590984 CGTGTGCGATGTTGTGCAAA 60.591 50.000 0.00 0.00 43.75 3.68
3235 3239 1.769733 GTGTGCGATGTTGTGCAAAT 58.230 45.000 0.00 0.00 43.75 2.32
3236 3240 2.664151 CGTGTGCGATGTTGTGCAAATA 60.664 45.455 0.00 0.00 43.75 1.40
3237 3241 3.500982 GTGTGCGATGTTGTGCAAATAT 58.499 40.909 0.00 0.00 43.75 1.28
3238 3242 3.919804 GTGTGCGATGTTGTGCAAATATT 59.080 39.130 0.00 0.00 43.75 1.28
3239 3243 4.385447 GTGTGCGATGTTGTGCAAATATTT 59.615 37.500 0.00 0.00 43.75 1.40
3240 3244 4.987285 TGTGCGATGTTGTGCAAATATTTT 59.013 33.333 0.00 0.00 43.75 1.82
3241 3245 5.464722 TGTGCGATGTTGTGCAAATATTTTT 59.535 32.000 0.00 0.00 43.75 1.94
3242 3246 5.784625 GTGCGATGTTGTGCAAATATTTTTG 59.215 36.000 0.00 4.44 43.75 2.44
3243 3247 5.693555 TGCGATGTTGTGCAAATATTTTTGA 59.306 32.000 12.18 0.00 44.11 2.69
3244 3248 6.128876 TGCGATGTTGTGCAAATATTTTTGAG 60.129 34.615 12.18 0.00 44.11 3.02
3245 3249 6.089283 GCGATGTTGTGCAAATATTTTTGAGA 59.911 34.615 12.18 0.00 44.11 3.27
3246 3250 7.359097 GCGATGTTGTGCAAATATTTTTGAGAA 60.359 33.333 12.18 1.22 44.11 2.87
3247 3251 8.486383 CGATGTTGTGCAAATATTTTTGAGAAA 58.514 29.630 12.18 0.88 44.11 2.52
3248 3252 9.584839 GATGTTGTGCAAATATTTTTGAGAAAC 57.415 29.630 12.18 11.31 44.11 2.78
3249 3253 8.484641 TGTTGTGCAAATATTTTTGAGAAACA 57.515 26.923 12.18 13.20 44.11 2.83
3250 3254 9.107177 TGTTGTGCAAATATTTTTGAGAAACAT 57.893 25.926 12.18 0.00 44.11 2.71
3251 3255 9.372541 GTTGTGCAAATATTTTTGAGAAACATG 57.627 29.630 12.18 0.00 44.11 3.21
3252 3256 8.659925 TGTGCAAATATTTTTGAGAAACATGT 57.340 26.923 12.18 0.00 44.11 3.21
3253 3257 9.107177 TGTGCAAATATTTTTGAGAAACATGTT 57.893 25.926 4.92 4.92 44.11 2.71
3254 3258 9.934190 GTGCAAATATTTTTGAGAAACATGTTT 57.066 25.926 23.49 23.49 44.11 2.83
3255 3259 9.932699 TGCAAATATTTTTGAGAAACATGTTTG 57.067 25.926 27.85 10.26 44.11 2.93
3256 3260 9.934190 GCAAATATTTTTGAGAAACATGTTTGT 57.066 25.926 27.85 23.83 44.11 2.83
3258 3262 9.934190 AAATATTTTTGAGAAACATGTTTGTGC 57.066 25.926 27.85 16.90 35.83 4.57
3259 3263 5.447478 TTTTTGAGAAACATGTTTGTGCG 57.553 34.783 27.85 0.00 35.83 5.34
3260 3264 4.362932 TTTGAGAAACATGTTTGTGCGA 57.637 36.364 27.85 14.15 35.83 5.10
3261 3265 4.566545 TTGAGAAACATGTTTGTGCGAT 57.433 36.364 27.85 2.09 35.83 4.58
3262 3266 3.887741 TGAGAAACATGTTTGTGCGATG 58.112 40.909 27.85 0.00 35.83 3.84
3263 3267 3.314913 TGAGAAACATGTTTGTGCGATGT 59.685 39.130 27.85 0.71 35.83 3.06
3264 3268 4.513318 TGAGAAACATGTTTGTGCGATGTA 59.487 37.500 27.85 2.21 35.83 2.29
3265 3269 5.034554 AGAAACATGTTTGTGCGATGTAG 57.965 39.130 27.85 0.00 35.83 2.74
3266 3270 2.900122 ACATGTTTGTGCGATGTAGC 57.100 45.000 0.00 0.00 33.85 3.58
3267 3271 2.426522 ACATGTTTGTGCGATGTAGCT 58.573 42.857 0.00 0.00 38.13 3.32
3268 3272 2.813754 ACATGTTTGTGCGATGTAGCTT 59.186 40.909 0.00 0.00 38.13 3.74
3269 3273 4.000325 ACATGTTTGTGCGATGTAGCTTA 59.000 39.130 0.00 0.00 38.13 3.09
3270 3274 4.635765 ACATGTTTGTGCGATGTAGCTTAT 59.364 37.500 0.00 0.00 38.13 1.73
3271 3275 4.857871 TGTTTGTGCGATGTAGCTTATC 57.142 40.909 0.00 0.00 38.13 1.75
3272 3276 4.249661 TGTTTGTGCGATGTAGCTTATCA 58.750 39.130 0.00 0.00 38.13 2.15
3273 3277 4.875536 TGTTTGTGCGATGTAGCTTATCAT 59.124 37.500 0.00 0.00 38.13 2.45
3274 3278 5.353956 TGTTTGTGCGATGTAGCTTATCATT 59.646 36.000 0.00 0.00 38.13 2.57
3275 3279 5.408204 TTGTGCGATGTAGCTTATCATTG 57.592 39.130 0.00 0.25 38.13 2.82
3276 3280 3.248363 TGTGCGATGTAGCTTATCATTGC 59.752 43.478 21.27 21.27 46.01 3.56
3278 3282 3.803555 GCGATGTAGCTTATCATTGCAC 58.196 45.455 22.28 2.97 45.47 4.57
3279 3283 3.248363 GCGATGTAGCTTATCATTGCACA 59.752 43.478 22.28 7.77 45.47 4.57
3280 3284 4.083643 GCGATGTAGCTTATCATTGCACAT 60.084 41.667 22.28 11.41 45.47 3.21
3281 3285 5.379827 CGATGTAGCTTATCATTGCACATG 58.620 41.667 0.00 0.00 34.09 3.21
3282 3286 5.178067 CGATGTAGCTTATCATTGCACATGA 59.822 40.000 0.00 12.06 34.09 3.07
3283 3287 6.128363 CGATGTAGCTTATCATTGCACATGAT 60.128 38.462 20.59 20.59 41.25 2.45
3284 3288 6.947644 TGTAGCTTATCATTGCACATGATT 57.052 33.333 21.44 11.48 39.30 2.57
3285 3289 6.962686 TGTAGCTTATCATTGCACATGATTC 58.037 36.000 21.44 14.30 39.30 2.52
3286 3290 6.769341 TGTAGCTTATCATTGCACATGATTCT 59.231 34.615 21.44 18.16 39.30 2.40
3287 3291 7.933033 TGTAGCTTATCATTGCACATGATTCTA 59.067 33.333 21.44 17.54 39.30 2.10
3288 3292 7.812690 AGCTTATCATTGCACATGATTCTAA 57.187 32.000 21.44 13.21 39.30 2.10
3289 3293 8.229253 AGCTTATCATTGCACATGATTCTAAA 57.771 30.769 21.44 12.98 39.30 1.85
3290 3294 8.689061 AGCTTATCATTGCACATGATTCTAAAA 58.311 29.630 21.44 12.73 39.30 1.52
3291 3295 9.304731 GCTTATCATTGCACATGATTCTAAAAA 57.695 29.630 21.44 12.27 39.30 1.94
3319 3323 2.855963 GCATATGTGATGCTTTGCACAC 59.144 45.455 4.29 13.89 46.52 3.82
3320 3324 2.898181 TATGTGATGCTTTGCACACG 57.102 45.000 14.96 0.00 46.52 4.49
3321 3325 0.241749 ATGTGATGCTTTGCACACGG 59.758 50.000 14.96 0.00 46.52 4.94
3322 3326 1.100463 TGTGATGCTTTGCACACGGT 61.100 50.000 14.96 0.00 43.04 4.83
3323 3327 0.030638 GTGATGCTTTGCACACGGTT 59.969 50.000 0.00 0.00 43.04 4.44
3324 3328 1.265635 GTGATGCTTTGCACACGGTTA 59.734 47.619 0.00 0.00 43.04 2.85
3325 3329 2.095263 GTGATGCTTTGCACACGGTTAT 60.095 45.455 0.00 0.00 43.04 1.89
3326 3330 2.095314 TGATGCTTTGCACACGGTTATG 60.095 45.455 0.00 0.00 43.04 1.90
3327 3331 1.598882 TGCTTTGCACACGGTTATGA 58.401 45.000 0.00 0.00 31.71 2.15
3328 3332 1.265635 TGCTTTGCACACGGTTATGAC 59.734 47.619 0.00 0.00 31.71 3.06
3329 3333 1.265635 GCTTTGCACACGGTTATGACA 59.734 47.619 0.00 0.00 0.00 3.58
3330 3334 2.287308 GCTTTGCACACGGTTATGACAA 60.287 45.455 0.00 0.00 0.00 3.18
3331 3335 3.793801 GCTTTGCACACGGTTATGACAAA 60.794 43.478 0.00 0.00 32.36 2.83
3332 3336 4.355437 CTTTGCACACGGTTATGACAAAA 58.645 39.130 0.00 0.00 32.68 2.44
3333 3337 4.371855 TTGCACACGGTTATGACAAAAA 57.628 36.364 0.00 0.00 0.00 1.94
3361 3365 7.015226 TGTGTGCAATGTAGATTATTACTGC 57.985 36.000 0.00 0.00 0.00 4.40
3362 3366 6.597280 TGTGTGCAATGTAGATTATTACTGCA 59.403 34.615 0.00 0.00 34.39 4.41
3363 3367 6.907212 GTGTGCAATGTAGATTATTACTGCAC 59.093 38.462 14.79 14.79 45.87 4.57
3364 3368 7.015226 GTGCAATGTAGATTATTACTGCACA 57.985 36.000 16.11 0.00 45.46 4.57
3365 3369 6.907212 GTGCAATGTAGATTATTACTGCACAC 59.093 38.462 16.11 0.00 45.46 3.82
3366 3370 6.823182 TGCAATGTAGATTATTACTGCACACT 59.177 34.615 0.00 0.00 32.86 3.55
3367 3371 7.011389 TGCAATGTAGATTATTACTGCACACTC 59.989 37.037 0.00 0.00 32.86 3.51
3368 3372 7.225538 GCAATGTAGATTATTACTGCACACTCT 59.774 37.037 0.00 0.00 33.42 3.24
3369 3373 9.102757 CAATGTAGATTATTACTGCACACTCTT 57.897 33.333 0.00 0.00 33.42 2.85
3370 3374 9.672673 AATGTAGATTATTACTGCACACTCTTT 57.327 29.630 0.00 0.00 33.42 2.52
3371 3375 8.703604 TGTAGATTATTACTGCACACTCTTTC 57.296 34.615 0.00 0.00 0.00 2.62
3372 3376 8.311109 TGTAGATTATTACTGCACACTCTTTCA 58.689 33.333 0.00 0.00 0.00 2.69
3373 3377 9.151471 GTAGATTATTACTGCACACTCTTTCAA 57.849 33.333 0.00 0.00 0.00 2.69
3374 3378 8.621532 AGATTATTACTGCACACTCTTTCAAA 57.378 30.769 0.00 0.00 0.00 2.69
3375 3379 9.066892 AGATTATTACTGCACACTCTTTCAAAA 57.933 29.630 0.00 0.00 0.00 2.44
3376 3380 9.677567 GATTATTACTGCACACTCTTTCAAAAA 57.322 29.630 0.00 0.00 0.00 1.94
3378 3382 7.935338 ATTACTGCACACTCTTTCAAAAATG 57.065 32.000 0.00 0.00 0.00 2.32
3379 3383 4.114794 ACTGCACACTCTTTCAAAAATGC 58.885 39.130 0.00 0.00 0.00 3.56
3380 3384 4.114073 CTGCACACTCTTTCAAAAATGCA 58.886 39.130 0.00 0.00 39.38 3.96
3381 3385 4.502016 TGCACACTCTTTCAAAAATGCAA 58.498 34.783 0.00 0.00 38.78 4.08
3382 3386 4.329528 TGCACACTCTTTCAAAAATGCAAC 59.670 37.500 0.00 0.00 38.78 4.17
3383 3387 4.260334 GCACACTCTTTCAAAAATGCAACC 60.260 41.667 0.00 0.00 0.00 3.77
3384 3388 4.026640 CACACTCTTTCAAAAATGCAACCG 60.027 41.667 0.00 0.00 0.00 4.44
3385 3389 4.111916 CACTCTTTCAAAAATGCAACCGT 58.888 39.130 0.00 0.00 0.00 4.83
3386 3390 5.163602 ACACTCTTTCAAAAATGCAACCGTA 60.164 36.000 0.00 0.00 0.00 4.02
3387 3391 5.173131 CACTCTTTCAAAAATGCAACCGTAC 59.827 40.000 0.00 0.00 0.00 3.67
3388 3392 5.067283 ACTCTTTCAAAAATGCAACCGTACT 59.933 36.000 0.00 0.00 0.00 2.73
3389 3393 5.897050 TCTTTCAAAAATGCAACCGTACTT 58.103 33.333 0.00 0.00 0.00 2.24
3390 3394 5.974751 TCTTTCAAAAATGCAACCGTACTTC 59.025 36.000 0.00 0.00 0.00 3.01
3391 3395 4.902443 TCAAAAATGCAACCGTACTTCA 57.098 36.364 0.00 0.00 0.00 3.02
3392 3396 5.446143 TCAAAAATGCAACCGTACTTCAT 57.554 34.783 0.00 0.00 0.00 2.57
3393 3397 5.218885 TCAAAAATGCAACCGTACTTCATG 58.781 37.500 0.00 0.00 0.00 3.07
3394 3398 4.846779 AAAATGCAACCGTACTTCATGT 57.153 36.364 0.00 0.00 0.00 3.21
3395 3399 4.419522 AAATGCAACCGTACTTCATGTC 57.580 40.909 0.00 0.00 0.00 3.06
3396 3400 2.831685 TGCAACCGTACTTCATGTCT 57.168 45.000 0.00 0.00 0.00 3.41
3397 3401 3.120321 TGCAACCGTACTTCATGTCTT 57.880 42.857 0.00 0.00 0.00 3.01
3398 3402 2.805671 TGCAACCGTACTTCATGTCTTG 59.194 45.455 0.00 0.00 0.00 3.02
3399 3403 2.412847 GCAACCGTACTTCATGTCTTGC 60.413 50.000 0.00 0.00 0.00 4.01
3400 3404 3.067106 CAACCGTACTTCATGTCTTGCT 58.933 45.455 0.00 0.00 0.00 3.91
3401 3405 2.960819 ACCGTACTTCATGTCTTGCTC 58.039 47.619 0.00 0.00 0.00 4.26
3402 3406 2.299013 ACCGTACTTCATGTCTTGCTCA 59.701 45.455 0.00 0.00 0.00 4.26
3403 3407 3.055819 ACCGTACTTCATGTCTTGCTCAT 60.056 43.478 0.00 0.00 0.00 2.90
3404 3408 3.308053 CCGTACTTCATGTCTTGCTCATG 59.692 47.826 0.00 0.00 42.53 3.07
3405 3409 3.242220 CGTACTTCATGTCTTGCTCATGC 60.242 47.826 0.00 0.00 41.40 4.06
3406 3410 3.069079 ACTTCATGTCTTGCTCATGCT 57.931 42.857 0.00 0.00 41.40 3.79
3407 3411 3.418995 ACTTCATGTCTTGCTCATGCTT 58.581 40.909 0.00 0.00 41.40 3.91
3408 3412 3.825014 ACTTCATGTCTTGCTCATGCTTT 59.175 39.130 0.00 0.00 41.40 3.51
3409 3413 4.280174 ACTTCATGTCTTGCTCATGCTTTT 59.720 37.500 0.00 0.00 41.40 2.27
3410 3414 4.859304 TCATGTCTTGCTCATGCTTTTT 57.141 36.364 0.00 0.00 41.40 1.94
3411 3415 5.963176 TCATGTCTTGCTCATGCTTTTTA 57.037 34.783 0.00 0.00 41.40 1.52
3412 3416 6.519679 TCATGTCTTGCTCATGCTTTTTAT 57.480 33.333 0.00 0.00 41.40 1.40
3413 3417 6.927416 TCATGTCTTGCTCATGCTTTTTATT 58.073 32.000 0.00 0.00 41.40 1.40
3414 3418 8.054152 TCATGTCTTGCTCATGCTTTTTATTA 57.946 30.769 0.00 0.00 41.40 0.98
3415 3419 8.522003 TCATGTCTTGCTCATGCTTTTTATTAA 58.478 29.630 0.00 0.00 41.40 1.40
3416 3420 9.142515 CATGTCTTGCTCATGCTTTTTATTAAA 57.857 29.630 0.00 0.00 40.48 1.52
3417 3421 9.709495 ATGTCTTGCTCATGCTTTTTATTAAAA 57.291 25.926 0.00 0.00 40.48 1.52
3418 3422 9.539825 TGTCTTGCTCATGCTTTTTATTAAAAA 57.460 25.926 12.48 12.48 40.48 1.94
3439 3443 5.982465 AAAAACATGTGTGCAATGTAACC 57.018 34.783 0.00 0.00 0.00 2.85
3440 3444 4.935352 AAACATGTGTGCAATGTAACCT 57.065 36.364 0.00 0.00 0.00 3.50
3441 3445 6.398234 AAAACATGTGTGCAATGTAACCTA 57.602 33.333 0.00 0.00 0.00 3.08
3442 3446 6.588719 AAACATGTGTGCAATGTAACCTAT 57.411 33.333 0.00 0.00 0.00 2.57
3443 3447 5.818136 ACATGTGTGCAATGTAACCTATC 57.182 39.130 0.00 0.00 0.00 2.08
3444 3448 5.252547 ACATGTGTGCAATGTAACCTATCA 58.747 37.500 0.00 0.00 0.00 2.15
3445 3449 5.887598 ACATGTGTGCAATGTAACCTATCAT 59.112 36.000 0.00 0.00 0.00 2.45
3446 3450 6.377996 ACATGTGTGCAATGTAACCTATCATT 59.622 34.615 0.00 0.00 35.08 2.57
3453 3457 6.193514 CAATGTAACCTATCATTGCACACA 57.806 37.500 5.23 0.00 42.37 3.72
3454 3458 6.260377 CAATGTAACCTATCATTGCACACAG 58.740 40.000 5.23 0.00 42.37 3.66
3455 3459 4.905429 TGTAACCTATCATTGCACACAGT 58.095 39.130 0.00 0.00 0.00 3.55
3456 3460 5.312895 TGTAACCTATCATTGCACACAGTT 58.687 37.500 0.00 0.00 0.00 3.16
3457 3461 5.767665 TGTAACCTATCATTGCACACAGTTT 59.232 36.000 0.00 0.00 0.00 2.66
3458 3462 6.937465 TGTAACCTATCATTGCACACAGTTTA 59.063 34.615 0.00 0.00 0.00 2.01
3459 3463 7.609918 TGTAACCTATCATTGCACACAGTTTAT 59.390 33.333 0.00 0.00 0.00 1.40
3460 3464 9.104965 GTAACCTATCATTGCACACAGTTTATA 57.895 33.333 0.00 0.00 0.00 0.98
3461 3465 7.553881 ACCTATCATTGCACACAGTTTATAC 57.446 36.000 0.00 0.00 0.00 1.47
3462 3466 6.257849 ACCTATCATTGCACACAGTTTATACG 59.742 38.462 0.00 0.00 0.00 3.06
3463 3467 6.478673 CCTATCATTGCACACAGTTTATACGA 59.521 38.462 0.00 0.00 0.00 3.43
3464 3468 6.925610 ATCATTGCACACAGTTTATACGAT 57.074 33.333 0.00 0.00 0.00 3.73
3465 3469 6.105657 TCATTGCACACAGTTTATACGATG 57.894 37.500 0.00 0.00 0.00 3.84
3466 3470 5.872070 TCATTGCACACAGTTTATACGATGA 59.128 36.000 0.00 0.00 0.00 2.92
3467 3471 6.370166 TCATTGCACACAGTTTATACGATGAA 59.630 34.615 0.00 0.00 0.00 2.57
3468 3472 6.546972 TTGCACACAGTTTATACGATGAAA 57.453 33.333 0.00 0.00 0.00 2.69
3469 3473 5.922546 TGCACACAGTTTATACGATGAAAC 58.077 37.500 0.00 0.00 36.08 2.78
3470 3474 5.106869 TGCACACAGTTTATACGATGAAACC 60.107 40.000 0.00 0.00 36.41 3.27
3471 3475 5.547341 CACACAGTTTATACGATGAAACCG 58.453 41.667 0.00 0.00 36.41 4.44
3472 3476 5.119588 CACACAGTTTATACGATGAAACCGT 59.880 40.000 0.00 0.00 43.26 4.83
3473 3477 5.119588 ACACAGTTTATACGATGAAACCGTG 59.880 40.000 17.46 17.46 44.20 4.94
3474 3478 5.119588 CACAGTTTATACGATGAAACCGTGT 59.880 40.000 13.83 0.00 38.37 4.49
3475 3479 5.119588 ACAGTTTATACGATGAAACCGTGTG 59.880 40.000 0.00 0.00 40.76 3.82
3476 3480 5.119588 CAGTTTATACGATGAAACCGTGTGT 59.880 40.000 0.00 0.00 40.76 3.72
3477 3481 5.119588 AGTTTATACGATGAAACCGTGTGTG 59.880 40.000 0.00 0.00 40.76 3.82
3478 3482 2.797074 TACGATGAAACCGTGTGTGA 57.203 45.000 0.00 0.00 40.76 3.58
3479 3483 2.163818 ACGATGAAACCGTGTGTGAT 57.836 45.000 0.00 0.00 38.97 3.06
3480 3484 1.798223 ACGATGAAACCGTGTGTGATG 59.202 47.619 0.00 0.00 38.97 3.07
3481 3485 2.065512 CGATGAAACCGTGTGTGATGA 58.934 47.619 0.00 0.00 0.00 2.92
3482 3486 2.159841 CGATGAAACCGTGTGTGATGAC 60.160 50.000 0.00 0.00 0.00 3.06
3483 3487 2.613026 TGAAACCGTGTGTGATGACT 57.387 45.000 0.00 0.00 0.00 3.41
3484 3488 2.912771 TGAAACCGTGTGTGATGACTT 58.087 42.857 0.00 0.00 0.00 3.01
3485 3489 2.611751 TGAAACCGTGTGTGATGACTTG 59.388 45.455 0.00 0.00 0.00 3.16
3486 3490 0.944386 AACCGTGTGTGATGACTTGC 59.056 50.000 0.00 0.00 0.00 4.01
3487 3491 0.179059 ACCGTGTGTGATGACTTGCA 60.179 50.000 0.00 0.00 0.00 4.08
3488 3492 0.235665 CCGTGTGTGATGACTTGCAC 59.764 55.000 0.00 0.00 35.63 4.57
3489 3493 0.936600 CGTGTGTGATGACTTGCACA 59.063 50.000 0.00 0.00 42.25 4.57
3490 3494 1.070376 CGTGTGTGATGACTTGCACAG 60.070 52.381 0.00 0.00 44.78 3.66
3491 3495 1.942657 GTGTGTGATGACTTGCACAGT 59.057 47.619 0.00 0.00 44.78 3.55
3492 3496 2.355756 GTGTGTGATGACTTGCACAGTT 59.644 45.455 0.00 0.00 44.78 3.16
3493 3497 3.016031 TGTGTGATGACTTGCACAGTTT 58.984 40.909 0.00 0.00 44.78 2.66
3494 3498 3.443329 TGTGTGATGACTTGCACAGTTTT 59.557 39.130 0.00 0.00 44.78 2.43
3495 3499 4.082300 TGTGTGATGACTTGCACAGTTTTT 60.082 37.500 0.00 0.00 44.78 1.94
3519 3523 7.534085 TTTTTAAGTGTGTCGATATAGCCTG 57.466 36.000 0.00 0.00 0.00 4.85
3520 3524 2.802787 AGTGTGTCGATATAGCCTGC 57.197 50.000 0.00 0.00 0.00 4.85
3521 3525 1.341531 AGTGTGTCGATATAGCCTGCC 59.658 52.381 0.00 0.00 0.00 4.85
3522 3526 1.068588 GTGTGTCGATATAGCCTGCCA 59.931 52.381 0.00 0.00 0.00 4.92
3523 3527 1.068588 TGTGTCGATATAGCCTGCCAC 59.931 52.381 0.00 0.00 0.00 5.01
3524 3528 0.679505 TGTCGATATAGCCTGCCACC 59.320 55.000 0.00 0.00 0.00 4.61
3525 3529 0.388649 GTCGATATAGCCTGCCACCG 60.389 60.000 0.00 0.00 0.00 4.94
3526 3530 1.738099 CGATATAGCCTGCCACCGC 60.738 63.158 0.00 0.00 0.00 5.68
3527 3531 1.371183 GATATAGCCTGCCACCGCA 59.629 57.895 0.00 0.00 44.78 5.69
3528 3532 0.951040 GATATAGCCTGCCACCGCAC 60.951 60.000 0.00 0.00 41.12 5.34
3529 3533 1.695114 ATATAGCCTGCCACCGCACA 61.695 55.000 0.00 0.00 41.12 4.57
3530 3534 2.587322 TATAGCCTGCCACCGCACAC 62.587 60.000 0.00 0.00 41.12 3.82
3533 3537 2.985282 CCTGCCACCGCACACATT 60.985 61.111 0.00 0.00 41.12 2.71
3534 3538 2.563798 CCTGCCACCGCACACATTT 61.564 57.895 0.00 0.00 41.12 2.32
3535 3539 1.363443 CTGCCACCGCACACATTTT 59.637 52.632 0.00 0.00 41.12 1.82
3536 3540 0.249405 CTGCCACCGCACACATTTTT 60.249 50.000 0.00 0.00 41.12 1.94
3537 3541 1.000827 CTGCCACCGCACACATTTTTA 60.001 47.619 0.00 0.00 41.12 1.52
3538 3542 1.409064 TGCCACCGCACACATTTTTAA 59.591 42.857 0.00 0.00 41.12 1.52
3539 3543 2.159099 TGCCACCGCACACATTTTTAAA 60.159 40.909 0.00 0.00 41.12 1.52
3540 3544 2.866762 GCCACCGCACACATTTTTAAAA 59.133 40.909 0.00 0.00 34.03 1.52
3541 3545 3.309954 GCCACCGCACACATTTTTAAAAA 59.690 39.130 15.38 15.38 34.03 1.94
3542 3546 4.783764 GCCACCGCACACATTTTTAAAAAC 60.784 41.667 15.35 1.60 34.03 2.43
3543 3547 4.500735 CACCGCACACATTTTTAAAAACG 58.499 39.130 15.35 10.25 0.00 3.60
3544 3548 3.000423 ACCGCACACATTTTTAAAAACGC 60.000 39.130 15.35 11.61 0.00 4.84
3545 3549 3.000322 CCGCACACATTTTTAAAAACGCA 60.000 39.130 15.35 0.00 0.00 5.24
3546 3550 4.492570 CCGCACACATTTTTAAAAACGCAA 60.493 37.500 15.35 0.00 0.00 4.85
3547 3551 4.428538 CGCACACATTTTTAAAAACGCAAC 59.571 37.500 15.35 3.98 0.00 4.17
3548 3552 4.726229 GCACACATTTTTAAAAACGCAACC 59.274 37.500 15.35 0.92 0.00 3.77
3549 3553 5.671329 GCACACATTTTTAAAAACGCAACCA 60.671 36.000 15.35 0.00 0.00 3.67
3550 3554 6.481984 CACACATTTTTAAAAACGCAACCAT 58.518 32.000 15.35 0.00 0.00 3.55
3551 3555 6.410337 CACACATTTTTAAAAACGCAACCATG 59.590 34.615 15.35 9.69 0.00 3.66
3552 3556 6.092807 ACACATTTTTAAAAACGCAACCATGT 59.907 30.769 15.35 10.27 0.00 3.21
3553 3557 6.410337 CACATTTTTAAAAACGCAACCATGTG 59.590 34.615 15.35 17.05 42.84 3.21
3559 3563 2.127270 CGCAACCATGTGTGACGC 60.127 61.111 0.00 0.00 32.29 5.19
3560 3564 2.255252 GCAACCATGTGTGACGCC 59.745 61.111 0.00 0.00 0.00 5.68
3561 3565 2.260869 GCAACCATGTGTGACGCCT 61.261 57.895 0.00 0.00 0.00 5.52
3562 3566 1.795170 GCAACCATGTGTGACGCCTT 61.795 55.000 0.00 0.00 0.00 4.35
3563 3567 1.518325 CAACCATGTGTGACGCCTTA 58.482 50.000 0.00 0.00 0.00 2.69
3564 3568 1.196808 CAACCATGTGTGACGCCTTAC 59.803 52.381 0.00 0.00 0.00 2.34
3565 3569 0.394938 ACCATGTGTGACGCCTTACA 59.605 50.000 0.00 0.00 0.00 2.41
3566 3570 1.003118 ACCATGTGTGACGCCTTACAT 59.997 47.619 0.00 0.00 34.31 2.29
3567 3571 2.235155 ACCATGTGTGACGCCTTACATA 59.765 45.455 0.00 0.00 32.86 2.29
3568 3572 3.266636 CCATGTGTGACGCCTTACATAA 58.733 45.455 0.00 0.00 32.86 1.90
3569 3573 3.063452 CCATGTGTGACGCCTTACATAAC 59.937 47.826 0.00 0.00 32.86 1.89
3570 3574 3.388345 TGTGTGACGCCTTACATAACA 57.612 42.857 0.00 0.00 0.00 2.41
3571 3575 3.061322 TGTGTGACGCCTTACATAACAC 58.939 45.455 0.00 0.00 37.53 3.32
3572 3576 3.243941 TGTGTGACGCCTTACATAACACT 60.244 43.478 0.00 0.00 37.81 3.55
3573 3577 3.744426 GTGTGACGCCTTACATAACACTT 59.256 43.478 0.00 0.00 34.91 3.16
3574 3578 4.212636 GTGTGACGCCTTACATAACACTTT 59.787 41.667 0.00 0.00 34.91 2.66
3575 3579 4.817464 TGTGACGCCTTACATAACACTTTT 59.183 37.500 0.00 0.00 0.00 2.27
3576 3580 5.297278 TGTGACGCCTTACATAACACTTTTT 59.703 36.000 0.00 0.00 0.00 1.94
3577 3581 5.849604 GTGACGCCTTACATAACACTTTTTC 59.150 40.000 0.00 0.00 0.00 2.29
3578 3582 5.049267 TGACGCCTTACATAACACTTTTTCC 60.049 40.000 0.00 0.00 0.00 3.13
3579 3583 4.822896 ACGCCTTACATAACACTTTTTCCA 59.177 37.500 0.00 0.00 0.00 3.53
3580 3584 5.299782 ACGCCTTACATAACACTTTTTCCAA 59.700 36.000 0.00 0.00 0.00 3.53
3581 3585 5.856455 CGCCTTACATAACACTTTTTCCAAG 59.144 40.000 0.00 0.00 0.00 3.61
3582 3586 6.293735 CGCCTTACATAACACTTTTTCCAAGA 60.294 38.462 0.00 0.00 0.00 3.02
3583 3587 7.430441 GCCTTACATAACACTTTTTCCAAGAA 58.570 34.615 0.00 0.00 0.00 2.52
3584 3588 7.923878 GCCTTACATAACACTTTTTCCAAGAAA 59.076 33.333 0.00 0.00 0.00 2.52
3585 3589 9.981114 CCTTACATAACACTTTTTCCAAGAAAT 57.019 29.630 0.00 0.00 0.00 2.17
3596 3600 9.190858 ACTTTTTCCAAGAAATTTTGTTTTTGC 57.809 25.926 0.00 0.00 0.00 3.68
3597 3601 7.787823 TTTTCCAAGAAATTTTGTTTTTGCG 57.212 28.000 0.00 0.00 0.00 4.85
3598 3602 6.727824 TTCCAAGAAATTTTGTTTTTGCGA 57.272 29.167 0.00 0.00 0.00 5.10
3599 3603 6.917217 TCCAAGAAATTTTGTTTTTGCGAT 57.083 29.167 0.00 0.00 0.00 4.58
3600 3604 8.425577 TTCCAAGAAATTTTGTTTTTGCGATA 57.574 26.923 0.00 0.00 0.00 2.92
3601 3605 8.425577 TCCAAGAAATTTTGTTTTTGCGATAA 57.574 26.923 0.00 0.00 0.00 1.75
3602 3606 8.547069 TCCAAGAAATTTTGTTTTTGCGATAAG 58.453 29.630 0.00 0.00 0.00 1.73
3603 3607 8.334632 CCAAGAAATTTTGTTTTTGCGATAAGT 58.665 29.630 0.00 0.00 0.00 2.24
3604 3608 9.701355 CAAGAAATTTTGTTTTTGCGATAAGTT 57.299 25.926 0.00 0.00 0.00 2.66
3606 3610 9.701355 AGAAATTTTGTTTTTGCGATAAGTTTG 57.299 25.926 0.00 0.00 0.00 2.93
3607 3611 9.695884 GAAATTTTGTTTTTGCGATAAGTTTGA 57.304 25.926 0.00 0.00 0.00 2.69
3610 3614 9.862585 ATTTTGTTTTTGCGATAAGTTTGAATC 57.137 25.926 0.00 0.00 0.00 2.52
3611 3615 8.641499 TTTGTTTTTGCGATAAGTTTGAATCT 57.359 26.923 0.00 0.00 0.00 2.40
3612 3616 9.737427 TTTGTTTTTGCGATAAGTTTGAATCTA 57.263 25.926 0.00 0.00 0.00 1.98
3613 3617 8.722342 TGTTTTTGCGATAAGTTTGAATCTAC 57.278 30.769 0.00 0.00 0.00 2.59
3614 3618 8.346300 TGTTTTTGCGATAAGTTTGAATCTACA 58.654 29.630 0.00 0.00 0.00 2.74
3615 3619 8.840867 GTTTTTGCGATAAGTTTGAATCTACAG 58.159 33.333 0.00 0.00 0.00 2.74
3616 3620 5.718649 TGCGATAAGTTTGAATCTACAGC 57.281 39.130 0.00 0.00 0.00 4.40
3617 3621 4.267690 TGCGATAAGTTTGAATCTACAGCG 59.732 41.667 0.00 0.00 0.00 5.18
3618 3622 4.503007 GCGATAAGTTTGAATCTACAGCGA 59.497 41.667 0.00 0.00 0.00 4.93
3619 3623 5.331905 GCGATAAGTTTGAATCTACAGCGAG 60.332 44.000 0.00 0.00 0.00 5.03
3620 3624 5.174035 CGATAAGTTTGAATCTACAGCGAGG 59.826 44.000 0.00 0.00 0.00 4.63
3621 3625 2.622436 AGTTTGAATCTACAGCGAGGC 58.378 47.619 0.00 0.00 0.00 4.70
3622 3626 1.324736 GTTTGAATCTACAGCGAGGCG 59.675 52.381 0.00 0.00 0.00 5.52
3623 3627 0.815095 TTGAATCTACAGCGAGGCGA 59.185 50.000 0.00 0.00 0.00 5.54
3624 3628 0.815095 TGAATCTACAGCGAGGCGAA 59.185 50.000 0.00 0.00 0.00 4.70
3625 3629 1.201343 GAATCTACAGCGAGGCGAAC 58.799 55.000 0.00 0.00 0.00 3.95
3626 3630 0.530744 AATCTACAGCGAGGCGAACA 59.469 50.000 0.00 0.00 0.00 3.18
3627 3631 0.530744 ATCTACAGCGAGGCGAACAA 59.469 50.000 0.00 0.00 0.00 2.83
3628 3632 0.109272 TCTACAGCGAGGCGAACAAG 60.109 55.000 0.00 0.00 0.00 3.16
3629 3633 1.078759 CTACAGCGAGGCGAACAAGG 61.079 60.000 0.00 0.00 0.00 3.61
3630 3634 2.501223 TACAGCGAGGCGAACAAGGG 62.501 60.000 0.00 0.00 0.00 3.95
3631 3635 3.626924 AGCGAGGCGAACAAGGGT 61.627 61.111 0.00 0.00 0.00 4.34
3632 3636 3.423154 GCGAGGCGAACAAGGGTG 61.423 66.667 0.00 0.00 0.00 4.61
3633 3637 3.423154 CGAGGCGAACAAGGGTGC 61.423 66.667 0.00 0.00 0.00 5.01
3636 3640 2.909965 GGCGAACAAGGGTGCCAA 60.910 61.111 0.00 0.00 46.76 4.52
3637 3641 2.275380 GGCGAACAAGGGTGCCAAT 61.275 57.895 0.00 0.00 46.76 3.16
3638 3642 1.080569 GCGAACAAGGGTGCCAATG 60.081 57.895 0.00 0.00 0.00 2.82
3639 3643 1.080569 CGAACAAGGGTGCCAATGC 60.081 57.895 0.00 0.00 38.26 3.56
3658 3662 3.457484 TGGCAAGCCACCAACATG 58.543 55.556 10.24 0.00 41.89 3.21
3659 3663 1.152589 TGGCAAGCCACCAACATGA 60.153 52.632 10.24 0.00 41.89 3.07
3660 3664 0.758310 TGGCAAGCCACCAACATGAA 60.758 50.000 10.24 0.00 41.89 2.57
3661 3665 0.037975 GGCAAGCCACCAACATGAAG 60.038 55.000 6.14 0.00 35.81 3.02
3662 3666 0.037975 GCAAGCCACCAACATGAAGG 60.038 55.000 0.00 2.82 0.00 3.46
3663 3667 0.604578 CAAGCCACCAACATGAAGGG 59.395 55.000 0.00 0.00 0.00 3.95
3664 3668 0.188342 AAGCCACCAACATGAAGGGT 59.812 50.000 0.00 0.20 34.59 4.34
3667 3671 1.966762 CACCAACATGAAGGGTGGC 59.033 57.895 20.20 0.00 46.51 5.01
3668 3672 1.603455 ACCAACATGAAGGGTGGCG 60.603 57.895 0.00 0.00 32.60 5.69
3669 3673 2.568090 CAACATGAAGGGTGGCGC 59.432 61.111 0.00 0.00 0.00 6.53
3670 3674 2.115052 AACATGAAGGGTGGCGCA 59.885 55.556 10.83 0.00 0.00 6.09
3671 3675 2.268076 AACATGAAGGGTGGCGCAC 61.268 57.895 10.83 5.50 0.00 5.34
3672 3676 2.672651 CATGAAGGGTGGCGCACA 60.673 61.111 10.83 1.22 35.86 4.57
3673 3677 2.048023 CATGAAGGGTGGCGCACAT 61.048 57.895 10.83 0.00 35.86 3.21
3674 3678 1.750399 ATGAAGGGTGGCGCACATC 60.750 57.895 10.83 5.01 35.86 3.06
3679 3683 4.101448 GGTGGCGCACATCCTCCT 62.101 66.667 10.83 0.00 35.86 3.69
3680 3684 2.821366 GTGGCGCACATCCTCCTG 60.821 66.667 10.83 0.00 34.08 3.86
3681 3685 3.002583 TGGCGCACATCCTCCTGA 61.003 61.111 10.83 0.00 0.00 3.86
3682 3686 2.512515 GGCGCACATCCTCCTGAC 60.513 66.667 10.83 0.00 0.00 3.51
3683 3687 2.265739 GCGCACATCCTCCTGACA 59.734 61.111 0.30 0.00 0.00 3.58
3684 3688 1.375908 GCGCACATCCTCCTGACAA 60.376 57.895 0.30 0.00 0.00 3.18
3685 3689 1.364626 GCGCACATCCTCCTGACAAG 61.365 60.000 0.30 0.00 0.00 3.16
3686 3690 0.742281 CGCACATCCTCCTGACAAGG 60.742 60.000 0.00 0.00 46.06 3.61
3720 3724 4.875713 GCCGGGCCCATAGTGGTG 62.876 72.222 24.92 1.64 35.17 4.17
3721 3725 4.875713 CCGGGCCCATAGTGGTGC 62.876 72.222 24.92 0.00 35.17 5.01
3722 3726 4.108299 CGGGCCCATAGTGGTGCA 62.108 66.667 24.92 0.00 36.04 4.57
3723 3727 2.358619 GGGCCCATAGTGGTGCAA 59.641 61.111 19.95 0.00 36.04 4.08
3724 3728 1.304879 GGGCCCATAGTGGTGCAAA 60.305 57.895 19.95 0.00 36.04 3.68
3725 3729 0.902516 GGGCCCATAGTGGTGCAAAA 60.903 55.000 19.95 0.00 36.04 2.44
3726 3730 0.972883 GGCCCATAGTGGTGCAAAAA 59.027 50.000 0.00 0.00 36.04 1.94
3727 3731 1.066929 GGCCCATAGTGGTGCAAAAAG 60.067 52.381 0.00 0.00 36.04 2.27
3728 3732 1.618343 GCCCATAGTGGTGCAAAAAGT 59.382 47.619 0.00 0.00 35.17 2.66
3729 3733 2.610232 GCCCATAGTGGTGCAAAAAGTG 60.610 50.000 0.00 0.00 35.17 3.16
3730 3734 2.610232 CCCATAGTGGTGCAAAAAGTGC 60.610 50.000 0.00 0.00 43.82 4.40
3731 3735 5.993405 CCCATAGTGGTGCAAAAAGTGCG 62.993 52.174 0.00 0.00 45.39 5.34
3754 3758 4.404098 CAGGAAACGGGGTCGGGG 62.404 72.222 0.00 0.00 41.39 5.73
3755 3759 4.644288 AGGAAACGGGGTCGGGGA 62.644 66.667 0.00 0.00 41.39 4.81
3756 3760 3.405318 GGAAACGGGGTCGGGGAT 61.405 66.667 0.00 0.00 41.39 3.85
3757 3761 2.188731 GAAACGGGGTCGGGGATC 59.811 66.667 0.00 0.00 41.39 3.36
3758 3762 3.728279 GAAACGGGGTCGGGGATCG 62.728 68.421 0.00 0.00 41.39 3.69
3762 3766 4.855072 GGGGTCGGGGATCGGTCT 62.855 72.222 0.00 0.00 39.77 3.85
3763 3767 3.225061 GGGTCGGGGATCGGTCTC 61.225 72.222 0.00 0.00 39.77 3.36
3764 3768 3.225061 GGTCGGGGATCGGTCTCC 61.225 72.222 3.78 3.78 42.02 3.71
3765 3769 2.123812 GTCGGGGATCGGTCTCCT 60.124 66.667 14.03 0.00 43.39 3.69
3766 3770 2.194889 GTCGGGGATCGGTCTCCTC 61.195 68.421 14.03 1.64 43.39 3.71
3767 3771 2.913060 CGGGGATCGGTCTCCTCC 60.913 72.222 14.03 0.00 43.39 4.30
3768 3772 2.609920 GGGGATCGGTCTCCTCCT 59.390 66.667 7.57 0.00 42.19 3.69
3769 3773 1.532078 GGGGATCGGTCTCCTCCTC 60.532 68.421 7.57 0.00 42.19 3.71
3770 3774 1.532078 GGGATCGGTCTCCTCCTCC 60.532 68.421 0.00 0.00 35.50 4.30
3771 3775 1.539665 GGATCGGTCTCCTCCTCCT 59.460 63.158 0.00 0.00 32.18 3.69
3772 3776 0.538746 GGATCGGTCTCCTCCTCCTC 60.539 65.000 0.00 0.00 32.18 3.71
3773 3777 0.476771 GATCGGTCTCCTCCTCCTCT 59.523 60.000 0.00 0.00 0.00 3.69
3774 3778 0.930726 ATCGGTCTCCTCCTCCTCTT 59.069 55.000 0.00 0.00 0.00 2.85
3775 3779 0.256464 TCGGTCTCCTCCTCCTCTTC 59.744 60.000 0.00 0.00 0.00 2.87
3776 3780 0.753848 CGGTCTCCTCCTCCTCTTCC 60.754 65.000 0.00 0.00 0.00 3.46
3777 3781 0.336737 GGTCTCCTCCTCCTCTTCCA 59.663 60.000 0.00 0.00 0.00 3.53
3778 3782 1.687996 GGTCTCCTCCTCCTCTTCCAG 60.688 61.905 0.00 0.00 0.00 3.86
3779 3783 1.006639 GTCTCCTCCTCCTCTTCCAGT 59.993 57.143 0.00 0.00 0.00 4.00
3780 3784 1.286553 TCTCCTCCTCCTCTTCCAGTC 59.713 57.143 0.00 0.00 0.00 3.51
3781 3785 0.336737 TCCTCCTCCTCTTCCAGTCC 59.663 60.000 0.00 0.00 0.00 3.85
3782 3786 0.338120 CCTCCTCCTCTTCCAGTCCT 59.662 60.000 0.00 0.00 0.00 3.85
3783 3787 1.687996 CCTCCTCCTCTTCCAGTCCTC 60.688 61.905 0.00 0.00 0.00 3.71
3784 3788 0.336737 TCCTCCTCTTCCAGTCCTCC 59.663 60.000 0.00 0.00 0.00 4.30
3785 3789 0.338120 CCTCCTCTTCCAGTCCTCCT 59.662 60.000 0.00 0.00 0.00 3.69
3786 3790 1.571457 CCTCCTCTTCCAGTCCTCCTA 59.429 57.143 0.00 0.00 0.00 2.94
3787 3791 2.661718 CTCCTCTTCCAGTCCTCCTAC 58.338 57.143 0.00 0.00 0.00 3.18
3788 3792 2.243736 CTCCTCTTCCAGTCCTCCTACT 59.756 54.545 0.00 0.00 0.00 2.57
3789 3793 2.242708 TCCTCTTCCAGTCCTCCTACTC 59.757 54.545 0.00 0.00 0.00 2.59
3790 3794 2.294074 CTCTTCCAGTCCTCCTACTCG 58.706 57.143 0.00 0.00 0.00 4.18
3791 3795 1.634459 TCTTCCAGTCCTCCTACTCGT 59.366 52.381 0.00 0.00 0.00 4.18
3792 3796 2.018515 CTTCCAGTCCTCCTACTCGTC 58.981 57.143 0.00 0.00 0.00 4.20
3793 3797 1.287217 TCCAGTCCTCCTACTCGTCT 58.713 55.000 0.00 0.00 0.00 4.18
3794 3798 1.209990 TCCAGTCCTCCTACTCGTCTC 59.790 57.143 0.00 0.00 0.00 3.36
3795 3799 1.292061 CAGTCCTCCTACTCGTCTCG 58.708 60.000 0.00 0.00 0.00 4.04
3796 3800 1.134759 CAGTCCTCCTACTCGTCTCGA 60.135 57.143 0.00 0.00 0.00 4.04
3797 3801 1.764134 AGTCCTCCTACTCGTCTCGAT 59.236 52.381 0.00 0.00 34.61 3.59
3798 3802 2.137523 GTCCTCCTACTCGTCTCGATC 58.862 57.143 0.00 0.00 34.61 3.69
3799 3803 1.141645 CCTCCTACTCGTCTCGATCG 58.858 60.000 9.36 9.36 34.61 3.69
3800 3804 0.509499 CTCCTACTCGTCTCGATCGC 59.491 60.000 11.09 0.00 34.61 4.58
3801 3805 0.104487 TCCTACTCGTCTCGATCGCT 59.896 55.000 11.09 0.00 34.61 4.93
3802 3806 1.339291 TCCTACTCGTCTCGATCGCTA 59.661 52.381 11.09 0.00 34.61 4.26
3803 3807 2.029200 TCCTACTCGTCTCGATCGCTAT 60.029 50.000 11.09 0.00 34.61 2.97
3804 3808 3.192212 TCCTACTCGTCTCGATCGCTATA 59.808 47.826 11.09 0.00 34.61 1.31
3805 3809 3.548668 CCTACTCGTCTCGATCGCTATAG 59.451 52.174 11.09 2.33 34.61 1.31
3806 3810 1.727880 ACTCGTCTCGATCGCTATAGC 59.272 52.381 15.09 15.09 34.61 2.97
3807 3811 1.061421 CTCGTCTCGATCGCTATAGCC 59.939 57.143 19.00 4.33 34.48 3.93
3808 3812 1.080298 CGTCTCGATCGCTATAGCCT 58.920 55.000 19.00 6.66 37.91 4.58
3809 3813 1.201976 CGTCTCGATCGCTATAGCCTG 60.202 57.143 19.00 6.22 37.91 4.85
3810 3814 0.805614 TCTCGATCGCTATAGCCTGC 59.194 55.000 19.00 7.16 37.91 4.85
3811 3815 0.523519 CTCGATCGCTATAGCCTGCA 59.476 55.000 19.00 1.13 37.91 4.41
3812 3816 0.523519 TCGATCGCTATAGCCTGCAG 59.476 55.000 19.00 6.78 37.91 4.41
3813 3817 0.457509 CGATCGCTATAGCCTGCAGG 60.458 60.000 29.34 29.34 37.91 4.85
3814 3818 0.891373 GATCGCTATAGCCTGCAGGA 59.109 55.000 37.21 17.52 37.91 3.86
3815 3819 1.273606 GATCGCTATAGCCTGCAGGAA 59.726 52.381 37.21 23.11 37.91 3.36
3816 3820 1.119684 TCGCTATAGCCTGCAGGAAA 58.880 50.000 37.21 22.73 37.91 3.13
3817 3821 1.069204 TCGCTATAGCCTGCAGGAAAG 59.931 52.381 37.21 24.54 37.91 2.62
3818 3822 1.875576 CGCTATAGCCTGCAGGAAAGG 60.876 57.143 37.21 20.45 37.91 3.11
3819 3823 1.417890 GCTATAGCCTGCAGGAAAGGA 59.582 52.381 37.21 15.39 36.91 3.36
3820 3824 2.808567 GCTATAGCCTGCAGGAAAGGAC 60.809 54.545 37.21 17.23 36.91 3.85
3821 3825 0.548510 ATAGCCTGCAGGAAAGGACC 59.451 55.000 37.21 16.45 36.91 4.46
3822 3826 0.547712 TAGCCTGCAGGAAAGGACCT 60.548 55.000 37.21 22.63 41.43 3.85
3823 3827 1.075659 GCCTGCAGGAAAGGACCTT 59.924 57.895 37.21 0.00 38.32 3.50
3824 3828 0.540597 GCCTGCAGGAAAGGACCTTT 60.541 55.000 37.21 19.66 38.32 3.11
3825 3829 1.251251 CCTGCAGGAAAGGACCTTTG 58.749 55.000 29.88 11.86 38.32 2.77
3826 3830 1.202927 CCTGCAGGAAAGGACCTTTGA 60.203 52.381 29.88 2.20 38.32 2.69
3827 3831 2.556114 CCTGCAGGAAAGGACCTTTGAT 60.556 50.000 29.88 9.29 38.32 2.57
3828 3832 2.751806 CTGCAGGAAAGGACCTTTGATC 59.248 50.000 24.31 9.92 38.32 2.92
3829 3833 2.095461 GCAGGAAAGGACCTTTGATCC 58.905 52.381 24.31 18.39 38.32 3.36
3830 3834 2.555227 GCAGGAAAGGACCTTTGATCCA 60.555 50.000 24.31 0.00 38.86 3.41
3831 3835 3.766545 CAGGAAAGGACCTTTGATCCAA 58.233 45.455 24.31 0.00 38.86 3.53
3832 3836 3.760684 CAGGAAAGGACCTTTGATCCAAG 59.239 47.826 24.31 11.75 38.86 3.61
3833 3837 3.092301 GGAAAGGACCTTTGATCCAAGG 58.908 50.000 24.31 21.19 38.86 3.61
3834 3838 3.500471 GGAAAGGACCTTTGATCCAAGGT 60.500 47.826 26.87 26.87 38.86 3.50
3835 3839 2.887151 AGGACCTTTGATCCAAGGTG 57.113 50.000 30.45 8.32 38.86 4.00
3836 3840 2.065799 AGGACCTTTGATCCAAGGTGT 58.934 47.619 30.45 17.19 38.86 4.16
3837 3841 2.447047 AGGACCTTTGATCCAAGGTGTT 59.553 45.455 30.45 17.48 38.86 3.32
3838 3842 2.820197 GGACCTTTGATCCAAGGTGTTC 59.180 50.000 30.45 18.18 36.15 3.18
3839 3843 3.486383 GACCTTTGATCCAAGGTGTTCA 58.514 45.455 30.45 0.00 34.38 3.18
3840 3844 3.222603 ACCTTTGATCCAAGGTGTTCAC 58.777 45.455 26.17 0.00 32.77 3.18
3841 3845 3.117512 ACCTTTGATCCAAGGTGTTCACT 60.118 43.478 26.17 3.94 32.77 3.41
3842 3846 3.891366 CCTTTGATCCAAGGTGTTCACTT 59.109 43.478 15.92 0.00 0.00 3.16
3843 3847 4.022849 CCTTTGATCCAAGGTGTTCACTTC 60.023 45.833 15.92 0.00 0.00 3.01
3844 3848 2.766313 TGATCCAAGGTGTTCACTTCG 58.234 47.619 2.98 0.00 0.00 3.79
3845 3849 1.464997 GATCCAAGGTGTTCACTTCGC 59.535 52.381 2.98 0.00 0.00 4.70
3846 3850 0.534203 TCCAAGGTGTTCACTTCGCC 60.534 55.000 2.98 0.00 35.90 5.54
3847 3851 0.535102 CCAAGGTGTTCACTTCGCCT 60.535 55.000 2.98 0.00 46.12 5.52
3848 3852 0.588252 CAAGGTGTTCACTTCGCCTG 59.412 55.000 2.98 0.00 43.82 4.85
3849 3853 0.180406 AAGGTGTTCACTTCGCCTGT 59.820 50.000 2.98 0.00 43.82 4.00
3850 3854 0.532862 AGGTGTTCACTTCGCCTGTG 60.533 55.000 2.98 0.00 43.11 3.66
3851 3855 0.814010 GGTGTTCACTTCGCCTGTGT 60.814 55.000 2.98 0.00 36.83 3.72
3852 3856 1.014352 GTGTTCACTTCGCCTGTGTT 58.986 50.000 0.00 0.00 36.83 3.32
3853 3857 1.013596 TGTTCACTTCGCCTGTGTTG 58.986 50.000 0.00 0.00 36.83 3.33
3854 3858 0.307760 GTTCACTTCGCCTGTGTTGG 59.692 55.000 0.00 0.00 36.83 3.77
3855 3859 0.179234 TTCACTTCGCCTGTGTTGGA 59.821 50.000 0.00 0.00 36.83 3.53
3856 3860 0.249868 TCACTTCGCCTGTGTTGGAG 60.250 55.000 0.00 0.00 36.83 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 6.683715 TGTAACAATGACGTGACTCAGAATA 58.316 36.000 0.00 0.00 0.00 1.75
1 2 5.538118 TGTAACAATGACGTGACTCAGAAT 58.462 37.500 0.00 0.00 0.00 2.40
2 3 4.939271 TGTAACAATGACGTGACTCAGAA 58.061 39.130 0.00 0.00 0.00 3.02
3 4 4.577834 TGTAACAATGACGTGACTCAGA 57.422 40.909 0.00 0.00 0.00 3.27
4 5 5.405269 TGAATGTAACAATGACGTGACTCAG 59.595 40.000 0.00 0.00 0.00 3.35
5 6 5.293560 TGAATGTAACAATGACGTGACTCA 58.706 37.500 0.00 0.00 0.00 3.41
6 7 5.839262 TGAATGTAACAATGACGTGACTC 57.161 39.130 0.00 0.00 0.00 3.36
7 8 6.166279 AGATGAATGTAACAATGACGTGACT 58.834 36.000 0.00 0.00 0.00 3.41
8 9 6.408858 AGATGAATGTAACAATGACGTGAC 57.591 37.500 0.00 0.00 0.00 3.67
9 10 6.092122 GGAAGATGAATGTAACAATGACGTGA 59.908 38.462 0.00 0.00 0.00 4.35
10 11 6.092670 AGGAAGATGAATGTAACAATGACGTG 59.907 38.462 0.00 0.00 0.00 4.49
11 12 6.173339 AGGAAGATGAATGTAACAATGACGT 58.827 36.000 0.00 0.00 0.00 4.34
12 13 6.536582 AGAGGAAGATGAATGTAACAATGACG 59.463 38.462 0.00 0.00 0.00 4.35
13 14 7.856145 AGAGGAAGATGAATGTAACAATGAC 57.144 36.000 0.00 0.00 0.00 3.06
14 15 8.868522 AAAGAGGAAGATGAATGTAACAATGA 57.131 30.769 0.00 0.00 0.00 2.57
15 16 9.918630 AAAAAGAGGAAGATGAATGTAACAATG 57.081 29.630 0.00 0.00 0.00 2.82
16 17 9.918630 CAAAAAGAGGAAGATGAATGTAACAAT 57.081 29.630 0.00 0.00 0.00 2.71
17 18 8.912988 ACAAAAAGAGGAAGATGAATGTAACAA 58.087 29.630 0.00 0.00 0.00 2.83
18 19 8.463930 ACAAAAAGAGGAAGATGAATGTAACA 57.536 30.769 0.00 0.00 0.00 2.41
60 61 9.461312 TGGCTAGACAAATTACATACAGATTTT 57.539 29.630 0.00 0.00 0.00 1.82
61 62 9.632638 ATGGCTAGACAAATTACATACAGATTT 57.367 29.630 0.13 0.00 0.00 2.17
122 123 9.431887 TCAAACAGCTTTTTAGACGAATACTAT 57.568 29.630 0.00 0.00 0.00 2.12
123 124 8.821147 TCAAACAGCTTTTTAGACGAATACTA 57.179 30.769 0.00 0.00 0.00 1.82
124 125 7.724305 TCAAACAGCTTTTTAGACGAATACT 57.276 32.000 0.00 0.00 0.00 2.12
125 126 9.474249 GTATCAAACAGCTTTTTAGACGAATAC 57.526 33.333 0.00 0.00 0.00 1.89
126 127 9.431887 AGTATCAAACAGCTTTTTAGACGAATA 57.568 29.630 0.00 0.00 0.00 1.75
127 128 8.324163 AGTATCAAACAGCTTTTTAGACGAAT 57.676 30.769 0.00 0.00 0.00 3.34
128 129 7.724305 AGTATCAAACAGCTTTTTAGACGAA 57.276 32.000 0.00 0.00 0.00 3.85
129 130 7.724305 AAGTATCAAACAGCTTTTTAGACGA 57.276 32.000 0.00 0.00 0.00 4.20
144 145 9.826574 ACGCTCAAAGGTTATATAAGTATCAAA 57.173 29.630 0.00 0.00 0.00 2.69
145 146 9.256477 CACGCTCAAAGGTTATATAAGTATCAA 57.744 33.333 0.00 0.00 0.00 2.57
146 147 7.870954 CCACGCTCAAAGGTTATATAAGTATCA 59.129 37.037 0.00 0.00 0.00 2.15
147 148 8.086522 TCCACGCTCAAAGGTTATATAAGTATC 58.913 37.037 0.00 0.00 0.00 2.24
148 149 7.959175 TCCACGCTCAAAGGTTATATAAGTAT 58.041 34.615 0.00 0.00 0.00 2.12
149 150 7.350744 TCCACGCTCAAAGGTTATATAAGTA 57.649 36.000 0.00 0.00 0.00 2.24
150 151 6.229936 TCCACGCTCAAAGGTTATATAAGT 57.770 37.500 0.00 0.00 0.00 2.24
151 152 5.696724 CCTCCACGCTCAAAGGTTATATAAG 59.303 44.000 0.00 0.00 0.00 1.73
152 153 5.454187 CCCTCCACGCTCAAAGGTTATATAA 60.454 44.000 0.00 0.00 0.00 0.98
153 154 4.039973 CCCTCCACGCTCAAAGGTTATATA 59.960 45.833 0.00 0.00 0.00 0.86
154 155 3.181454 CCCTCCACGCTCAAAGGTTATAT 60.181 47.826 0.00 0.00 0.00 0.86
155 156 2.169769 CCCTCCACGCTCAAAGGTTATA 59.830 50.000 0.00 0.00 0.00 0.98
156 157 1.065418 CCCTCCACGCTCAAAGGTTAT 60.065 52.381 0.00 0.00 0.00 1.89
157 158 0.323629 CCCTCCACGCTCAAAGGTTA 59.676 55.000 0.00 0.00 0.00 2.85
158 159 1.073199 CCCTCCACGCTCAAAGGTT 59.927 57.895 0.00 0.00 0.00 3.50
159 160 2.750350 CCCTCCACGCTCAAAGGT 59.250 61.111 0.00 0.00 0.00 3.50
160 161 2.045926 CCCCTCCACGCTCAAAGG 60.046 66.667 0.00 0.00 0.00 3.11
161 162 2.747855 GCCCCTCCACGCTCAAAG 60.748 66.667 0.00 0.00 0.00 2.77
162 163 3.551496 CTGCCCCTCCACGCTCAAA 62.551 63.158 0.00 0.00 0.00 2.69
163 164 4.020617 CTGCCCCTCCACGCTCAA 62.021 66.667 0.00 0.00 0.00 3.02
168 169 4.697756 TTTCGCTGCCCCTCCACG 62.698 66.667 0.00 0.00 0.00 4.94
169 170 2.747855 CTTTCGCTGCCCCTCCAC 60.748 66.667 0.00 0.00 0.00 4.02
170 171 4.033776 CCTTTCGCTGCCCCTCCA 62.034 66.667 0.00 0.00 0.00 3.86
171 172 4.803908 CCCTTTCGCTGCCCCTCC 62.804 72.222 0.00 0.00 0.00 4.30
172 173 3.717294 TCCCTTTCGCTGCCCCTC 61.717 66.667 0.00 0.00 0.00 4.30
173 174 4.035102 GTCCCTTTCGCTGCCCCT 62.035 66.667 0.00 0.00 0.00 4.79
175 176 3.860930 TTGGTCCCTTTCGCTGCCC 62.861 63.158 0.00 0.00 0.00 5.36
176 177 1.460273 TTTTGGTCCCTTTCGCTGCC 61.460 55.000 0.00 0.00 0.00 4.85
177 178 0.603065 ATTTTGGTCCCTTTCGCTGC 59.397 50.000 0.00 0.00 0.00 5.25
178 179 3.081804 ACTATTTTGGTCCCTTTCGCTG 58.918 45.455 0.00 0.00 0.00 5.18
179 180 3.434940 ACTATTTTGGTCCCTTTCGCT 57.565 42.857 0.00 0.00 0.00 4.93
180 181 4.438336 GCTTACTATTTTGGTCCCTTTCGC 60.438 45.833 0.00 0.00 0.00 4.70
181 182 4.941873 AGCTTACTATTTTGGTCCCTTTCG 59.058 41.667 0.00 0.00 0.00 3.46
182 183 7.336396 TCTAGCTTACTATTTTGGTCCCTTTC 58.664 38.462 0.00 0.00 0.00 2.62
183 184 7.266905 TCTAGCTTACTATTTTGGTCCCTTT 57.733 36.000 0.00 0.00 0.00 3.11
184 185 6.886178 TCTAGCTTACTATTTTGGTCCCTT 57.114 37.500 0.00 0.00 0.00 3.95
185 186 6.847036 AGATCTAGCTTACTATTTTGGTCCCT 59.153 38.462 0.00 0.00 0.00 4.20
186 187 7.068686 AGATCTAGCTTACTATTTTGGTCCC 57.931 40.000 0.00 0.00 0.00 4.46
187 188 8.204836 TGAAGATCTAGCTTACTATTTTGGTCC 58.795 37.037 0.00 0.00 0.00 4.46
188 189 9.036671 GTGAAGATCTAGCTTACTATTTTGGTC 57.963 37.037 0.00 0.00 0.00 4.02
189 190 8.540388 TGTGAAGATCTAGCTTACTATTTTGGT 58.460 33.333 0.00 0.00 0.00 3.67
190 191 8.948631 TGTGAAGATCTAGCTTACTATTTTGG 57.051 34.615 0.00 0.00 0.00 3.28
200 201 9.372369 GTTGTAATACTTGTGAAGATCTAGCTT 57.628 33.333 0.00 0.00 0.00 3.74
201 202 8.531982 TGTTGTAATACTTGTGAAGATCTAGCT 58.468 33.333 0.00 0.00 0.00 3.32
202 203 8.703604 TGTTGTAATACTTGTGAAGATCTAGC 57.296 34.615 0.00 0.00 0.00 3.42
205 206 9.337396 TGTTTGTTGTAATACTTGTGAAGATCT 57.663 29.630 0.00 0.00 0.00 2.75
206 207 9.382244 GTGTTTGTTGTAATACTTGTGAAGATC 57.618 33.333 0.00 0.00 0.00 2.75
207 208 8.349983 GGTGTTTGTTGTAATACTTGTGAAGAT 58.650 33.333 0.00 0.00 0.00 2.40
208 209 7.554835 AGGTGTTTGTTGTAATACTTGTGAAGA 59.445 33.333 0.00 0.00 0.00 2.87
209 210 7.703328 AGGTGTTTGTTGTAATACTTGTGAAG 58.297 34.615 0.00 0.00 0.00 3.02
210 211 7.633193 AGGTGTTTGTTGTAATACTTGTGAA 57.367 32.000 0.00 0.00 0.00 3.18
211 212 7.476667 CAAGGTGTTTGTTGTAATACTTGTGA 58.523 34.615 0.00 0.00 31.92 3.58
212 213 7.678194 CAAGGTGTTTGTTGTAATACTTGTG 57.322 36.000 0.00 0.00 31.92 3.33
230 231 6.427853 TCAGATTTTCTACATGACACAAGGTG 59.572 38.462 0.00 0.00 39.75 4.00
231 232 6.533730 TCAGATTTTCTACATGACACAAGGT 58.466 36.000 0.00 0.00 0.00 3.50
232 233 7.301054 GTTCAGATTTTCTACATGACACAAGG 58.699 38.462 0.00 0.00 0.00 3.61
233 234 7.041167 TGGTTCAGATTTTCTACATGACACAAG 60.041 37.037 0.00 0.00 0.00 3.16
234 235 6.770303 TGGTTCAGATTTTCTACATGACACAA 59.230 34.615 0.00 0.00 0.00 3.33
235 236 6.295249 TGGTTCAGATTTTCTACATGACACA 58.705 36.000 0.00 0.00 0.00 3.72
236 237 6.801539 TGGTTCAGATTTTCTACATGACAC 57.198 37.500 0.00 0.00 0.00 3.67
237 238 9.330063 GATATGGTTCAGATTTTCTACATGACA 57.670 33.333 0.00 0.00 0.00 3.58
238 239 9.330063 TGATATGGTTCAGATTTTCTACATGAC 57.670 33.333 0.00 0.00 0.00 3.06
242 243 9.904198 TTCATGATATGGTTCAGATTTTCTACA 57.096 29.630 0.00 0.00 0.00 2.74
246 247 9.688592 GGATTTCATGATATGGTTCAGATTTTC 57.311 33.333 3.15 0.00 0.00 2.29
247 248 9.204337 TGGATTTCATGATATGGTTCAGATTTT 57.796 29.630 3.15 0.00 0.00 1.82
248 249 8.636213 GTGGATTTCATGATATGGTTCAGATTT 58.364 33.333 3.15 0.00 0.00 2.17
249 250 7.781219 TGTGGATTTCATGATATGGTTCAGATT 59.219 33.333 3.15 0.00 0.00 2.40
250 251 7.292319 TGTGGATTTCATGATATGGTTCAGAT 58.708 34.615 3.15 0.00 0.00 2.90
251 252 6.661777 TGTGGATTTCATGATATGGTTCAGA 58.338 36.000 3.15 0.00 0.00 3.27
252 253 6.947644 TGTGGATTTCATGATATGGTTCAG 57.052 37.500 3.15 0.00 0.00 3.02
253 254 6.891361 ACTTGTGGATTTCATGATATGGTTCA 59.109 34.615 3.15 0.00 0.00 3.18
254 255 7.338800 ACTTGTGGATTTCATGATATGGTTC 57.661 36.000 3.15 0.00 0.00 3.62
255 256 9.071276 GATACTTGTGGATTTCATGATATGGTT 57.929 33.333 3.15 0.00 0.00 3.67
256 257 8.219868 TGATACTTGTGGATTTCATGATATGGT 58.780 33.333 3.15 0.00 0.00 3.55
257 258 8.625786 TGATACTTGTGGATTTCATGATATGG 57.374 34.615 3.15 0.00 0.00 2.74
265 266 9.473007 TGGATAATTTGATACTTGTGGATTTCA 57.527 29.630 0.00 0.00 0.00 2.69
275 276 9.812347 TGGCAGATATTGGATAATTTGATACTT 57.188 29.630 0.00 0.00 0.00 2.24
276 277 9.236006 GTGGCAGATATTGGATAATTTGATACT 57.764 33.333 0.00 0.00 0.00 2.12
277 278 9.013229 TGTGGCAGATATTGGATAATTTGATAC 57.987 33.333 0.00 0.00 0.00 2.24
278 279 9.234827 CTGTGGCAGATATTGGATAATTTGATA 57.765 33.333 0.00 0.00 32.44 2.15
279 280 7.309621 GCTGTGGCAGATATTGGATAATTTGAT 60.310 37.037 0.00 0.00 38.54 2.57
280 281 6.016024 GCTGTGGCAGATATTGGATAATTTGA 60.016 38.462 0.00 0.00 38.54 2.69
281 282 6.154445 GCTGTGGCAGATATTGGATAATTTG 58.846 40.000 0.00 0.00 38.54 2.32
282 283 5.834742 TGCTGTGGCAGATATTGGATAATTT 59.165 36.000 0.00 0.00 44.28 1.82
283 284 5.387788 TGCTGTGGCAGATATTGGATAATT 58.612 37.500 0.00 0.00 44.28 1.40
284 285 4.989277 TGCTGTGGCAGATATTGGATAAT 58.011 39.130 0.00 0.00 44.28 1.28
285 286 4.436113 TGCTGTGGCAGATATTGGATAA 57.564 40.909 0.00 0.00 44.28 1.75
298 299 3.378112 TCTTGCAAGTATATTGCTGTGGC 59.622 43.478 25.19 0.00 45.13 5.01
299 300 4.877823 TCTCTTGCAAGTATATTGCTGTGG 59.122 41.667 25.19 0.00 45.13 4.17
300 301 6.426980 TTCTCTTGCAAGTATATTGCTGTG 57.573 37.500 25.19 7.64 45.13 3.66
301 302 5.065731 GCTTCTCTTGCAAGTATATTGCTGT 59.934 40.000 25.19 0.00 45.13 4.40
302 303 5.296283 AGCTTCTCTTGCAAGTATATTGCTG 59.704 40.000 25.19 8.80 45.13 4.41
303 304 5.435291 AGCTTCTCTTGCAAGTATATTGCT 58.565 37.500 25.19 21.86 45.13 3.91
304 305 5.557893 CGAGCTTCTCTTGCAAGTATATTGC 60.558 44.000 25.19 20.30 45.11 3.56
305 306 5.972018 CGAGCTTCTCTTGCAAGTATATTG 58.028 41.667 25.19 12.84 0.00 1.90
316 317 7.700322 TTAATATTGTAGCGAGCTTCTCTTG 57.300 36.000 1.86 0.00 0.00 3.02
317 318 9.413048 GTATTAATATTGTAGCGAGCTTCTCTT 57.587 33.333 1.86 0.00 0.00 2.85
318 319 8.030106 GGTATTAATATTGTAGCGAGCTTCTCT 58.970 37.037 1.86 0.00 0.00 3.10
319 320 7.275999 GGGTATTAATATTGTAGCGAGCTTCTC 59.724 40.741 1.86 0.00 0.00 2.87
320 321 7.097834 GGGTATTAATATTGTAGCGAGCTTCT 58.902 38.462 1.86 0.00 0.00 2.85
321 322 6.313164 GGGGTATTAATATTGTAGCGAGCTTC 59.687 42.308 1.86 0.00 0.00 3.86
322 323 6.171213 GGGGTATTAATATTGTAGCGAGCTT 58.829 40.000 1.86 0.00 0.00 3.74
323 324 5.247564 TGGGGTATTAATATTGTAGCGAGCT 59.752 40.000 2.25 2.25 0.00 4.09
324 325 5.484715 TGGGGTATTAATATTGTAGCGAGC 58.515 41.667 0.00 0.00 0.00 5.03
325 326 6.932400 TGTTGGGGTATTAATATTGTAGCGAG 59.068 38.462 0.00 0.00 0.00 5.03
326 327 6.828788 TGTTGGGGTATTAATATTGTAGCGA 58.171 36.000 0.00 0.00 0.00 4.93
327 328 7.681939 ATGTTGGGGTATTAATATTGTAGCG 57.318 36.000 0.00 0.00 0.00 4.26
336 337 9.653516 TGTTGATGATTATGTTGGGGTATTAAT 57.346 29.630 0.00 0.00 0.00 1.40
337 338 9.653516 ATGTTGATGATTATGTTGGGGTATTAA 57.346 29.630 0.00 0.00 0.00 1.40
338 339 9.295825 GATGTTGATGATTATGTTGGGGTATTA 57.704 33.333 0.00 0.00 0.00 0.98
339 340 8.006564 AGATGTTGATGATTATGTTGGGGTATT 58.993 33.333 0.00 0.00 0.00 1.89
340 341 7.449395 CAGATGTTGATGATTATGTTGGGGTAT 59.551 37.037 0.00 0.00 0.00 2.73
341 342 6.772233 CAGATGTTGATGATTATGTTGGGGTA 59.228 38.462 0.00 0.00 0.00 3.69
342 343 5.595542 CAGATGTTGATGATTATGTTGGGGT 59.404 40.000 0.00 0.00 0.00 4.95
343 344 5.829391 TCAGATGTTGATGATTATGTTGGGG 59.171 40.000 0.00 0.00 0.00 4.96
344 345 6.947644 TCAGATGTTGATGATTATGTTGGG 57.052 37.500 0.00 0.00 0.00 4.12
345 346 7.283807 TCCTTCAGATGTTGATGATTATGTTGG 59.716 37.037 0.00 0.00 35.27 3.77
346 347 8.217131 TCCTTCAGATGTTGATGATTATGTTG 57.783 34.615 0.00 0.00 35.27 3.33
347 348 8.680903 GTTCCTTCAGATGTTGATGATTATGTT 58.319 33.333 0.00 0.00 35.27 2.71
348 349 8.051535 AGTTCCTTCAGATGTTGATGATTATGT 58.948 33.333 0.00 0.00 35.27 2.29
349 350 8.447924 AGTTCCTTCAGATGTTGATGATTATG 57.552 34.615 0.00 0.00 35.27 1.90
350 351 8.270030 TGAGTTCCTTCAGATGTTGATGATTAT 58.730 33.333 0.00 0.00 35.27 1.28
351 352 7.623630 TGAGTTCCTTCAGATGTTGATGATTA 58.376 34.615 0.00 0.00 35.27 1.75
352 353 6.479006 TGAGTTCCTTCAGATGTTGATGATT 58.521 36.000 0.00 0.00 35.27 2.57
353 354 6.058553 TGAGTTCCTTCAGATGTTGATGAT 57.941 37.500 0.00 0.00 35.27 2.45
354 355 5.488262 TGAGTTCCTTCAGATGTTGATGA 57.512 39.130 0.00 0.00 35.27 2.92
355 356 5.646793 ACATGAGTTCCTTCAGATGTTGATG 59.353 40.000 0.00 0.00 35.27 3.07
356 357 5.813383 ACATGAGTTCCTTCAGATGTTGAT 58.187 37.500 0.00 0.00 35.27 2.57
357 358 5.233083 ACATGAGTTCCTTCAGATGTTGA 57.767 39.130 0.00 0.00 0.00 3.18
358 359 6.037940 CCATACATGAGTTCCTTCAGATGTTG 59.962 42.308 0.00 0.00 0.00 3.33
359 360 6.118170 CCATACATGAGTTCCTTCAGATGTT 58.882 40.000 0.00 0.00 0.00 2.71
360 361 5.678583 CCATACATGAGTTCCTTCAGATGT 58.321 41.667 0.00 0.00 0.00 3.06
361 362 4.514441 GCCATACATGAGTTCCTTCAGATG 59.486 45.833 0.00 0.00 0.00 2.90
362 363 4.164796 TGCCATACATGAGTTCCTTCAGAT 59.835 41.667 0.00 0.00 0.00 2.90
363 364 3.519107 TGCCATACATGAGTTCCTTCAGA 59.481 43.478 0.00 0.00 0.00 3.27
364 365 3.877559 TGCCATACATGAGTTCCTTCAG 58.122 45.455 0.00 0.00 0.00 3.02
365 366 3.998913 TGCCATACATGAGTTCCTTCA 57.001 42.857 0.00 0.00 0.00 3.02
376 377 2.244695 CATTGGAGGCATGCCATACAT 58.755 47.619 37.18 20.59 40.66 2.29
377 378 1.063792 ACATTGGAGGCATGCCATACA 60.064 47.619 37.18 27.73 38.92 2.29
378 379 1.610522 GACATTGGAGGCATGCCATAC 59.389 52.381 37.18 25.58 38.92 2.39
379 380 1.214923 TGACATTGGAGGCATGCCATA 59.785 47.619 37.18 20.32 38.92 2.74
380 381 0.032912 TGACATTGGAGGCATGCCAT 60.033 50.000 37.18 22.55 38.92 4.40
381 382 0.251698 TTGACATTGGAGGCATGCCA 60.252 50.000 37.18 18.41 38.92 4.92
382 383 0.174162 GTTGACATTGGAGGCATGCC 59.826 55.000 30.12 30.12 0.00 4.40
383 384 0.889994 TGTTGACATTGGAGGCATGC 59.110 50.000 9.90 9.90 0.00 4.06
384 385 1.887854 TGTGTTGACATTGGAGGCATG 59.112 47.619 0.00 0.00 0.00 4.06
385 386 2.291209 TGTGTTGACATTGGAGGCAT 57.709 45.000 0.00 0.00 0.00 4.40
386 387 2.064434 TTGTGTTGACATTGGAGGCA 57.936 45.000 0.00 0.00 30.13 4.75
387 388 2.622942 TCTTTGTGTTGACATTGGAGGC 59.377 45.455 0.00 0.00 30.13 4.70
388 389 4.916983 TTCTTTGTGTTGACATTGGAGG 57.083 40.909 0.00 0.00 30.13 4.30
389 390 5.043248 GGTTTCTTTGTGTTGACATTGGAG 58.957 41.667 0.00 0.00 30.13 3.86
390 391 4.464244 TGGTTTCTTTGTGTTGACATTGGA 59.536 37.500 0.00 0.00 30.13 3.53
391 392 4.753233 TGGTTTCTTTGTGTTGACATTGG 58.247 39.130 0.00 0.00 30.13 3.16
392 393 5.276963 GCATGGTTTCTTTGTGTTGACATTG 60.277 40.000 0.00 0.00 30.13 2.82
393 394 4.810491 GCATGGTTTCTTTGTGTTGACATT 59.190 37.500 0.00 0.00 30.13 2.71
394 395 4.370917 GCATGGTTTCTTTGTGTTGACAT 58.629 39.130 0.00 0.00 30.13 3.06
395 396 3.430098 GGCATGGTTTCTTTGTGTTGACA 60.430 43.478 0.00 0.00 0.00 3.58
396 397 3.123050 GGCATGGTTTCTTTGTGTTGAC 58.877 45.455 0.00 0.00 0.00 3.18
397 398 2.762887 TGGCATGGTTTCTTTGTGTTGA 59.237 40.909 0.00 0.00 0.00 3.18
398 399 3.176552 TGGCATGGTTTCTTTGTGTTG 57.823 42.857 0.00 0.00 0.00 3.33
399 400 3.902881 TTGGCATGGTTTCTTTGTGTT 57.097 38.095 0.00 0.00 0.00 3.32
400 401 3.197549 AGTTTGGCATGGTTTCTTTGTGT 59.802 39.130 0.00 0.00 0.00 3.72
401 402 3.795877 AGTTTGGCATGGTTTCTTTGTG 58.204 40.909 0.00 0.00 0.00 3.33
402 403 4.081198 TCAAGTTTGGCATGGTTTCTTTGT 60.081 37.500 0.00 0.00 0.00 2.83
403 404 4.270808 GTCAAGTTTGGCATGGTTTCTTTG 59.729 41.667 0.00 0.00 31.86 2.77
404 405 4.441792 GTCAAGTTTGGCATGGTTTCTTT 58.558 39.130 0.00 0.00 31.86 2.52
405 406 3.181466 GGTCAAGTTTGGCATGGTTTCTT 60.181 43.478 0.00 0.00 33.59 2.52
406 407 2.365293 GGTCAAGTTTGGCATGGTTTCT 59.635 45.455 0.00 0.00 33.59 2.52
407 408 2.102252 TGGTCAAGTTTGGCATGGTTTC 59.898 45.455 0.00 0.00 33.59 2.78
408 409 2.114616 TGGTCAAGTTTGGCATGGTTT 58.885 42.857 0.00 0.00 33.59 3.27
409 410 1.786937 TGGTCAAGTTTGGCATGGTT 58.213 45.000 0.00 0.00 33.59 3.67
410 411 1.786937 TTGGTCAAGTTTGGCATGGT 58.213 45.000 0.00 0.00 33.59 3.55
411 412 4.497300 CTTATTGGTCAAGTTTGGCATGG 58.503 43.478 0.00 0.00 33.59 3.66
412 413 3.928375 GCTTATTGGTCAAGTTTGGCATG 59.072 43.478 0.00 0.00 33.59 4.06
413 414 3.577848 TGCTTATTGGTCAAGTTTGGCAT 59.422 39.130 0.00 0.00 33.59 4.40
414 415 2.961741 TGCTTATTGGTCAAGTTTGGCA 59.038 40.909 0.00 0.00 33.59 4.92
415 416 3.317150 GTGCTTATTGGTCAAGTTTGGC 58.683 45.455 0.00 0.00 0.00 4.52