Multiple sequence alignment - TraesCS1A01G009500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G009500 chr1A 100.000 5285 0 0 1 5285 5870427 5875711 0.000000e+00 9760
1 TraesCS1A01G009500 chr1A 93.590 156 9 1 5130 5285 5888279 5888433 1.140000e-56 231
2 TraesCS1A01G009500 chr7D 79.339 3417 629 52 1040 4414 25040631 25037250 0.000000e+00 2327
3 TraesCS1A01G009500 chr7A 79.078 3427 633 61 1025 4405 25926062 25922674 0.000000e+00 2279
4 TraesCS1A01G009500 chr7A 89.912 456 45 1 4595 5049 539831095 539831550 2.120000e-163 586
5 TraesCS1A01G009500 chr7A 86.755 151 20 0 4990 5140 539831535 539831685 9.100000e-38 169
6 TraesCS1A01G009500 chr4A 78.983 3440 641 58 1019 4414 708566685 708570086 0.000000e+00 2272
7 TraesCS1A01G009500 chr4A 88.559 236 22 2 4596 4826 67872163 67872398 1.120000e-71 281
8 TraesCS1A01G009500 chr6A 85.923 547 68 5 4595 5140 546925884 546925346 4.590000e-160 575
9 TraesCS1A01G009500 chr6A 91.558 154 10 3 5130 5281 184372215 184372063 5.360000e-50 209
10 TraesCS1A01G009500 chr6A 90.968 155 13 1 5127 5281 465603449 465603602 1.930000e-49 207
11 TraesCS1A01G009500 chrUn 84.095 547 73 7 4595 5140 81662012 81661479 2.820000e-142 516
12 TraesCS1A01G009500 chrUn 91.329 173 14 1 8 179 1923006 1923178 8.850000e-58 235
13 TraesCS1A01G009500 chr5A 83.729 547 79 5 4595 5140 649316240 649315703 4.720000e-140 508
14 TraesCS1A01G009500 chr5A 93.023 172 11 1 8 178 680715774 680715945 3.160000e-62 250
15 TraesCS1A01G009500 chr5A 76.371 474 97 13 4596 5058 573954623 573954154 1.900000e-59 241
16 TraesCS1A01G009500 chr5A 91.720 157 13 0 22 178 102610363 102610207 8.910000e-53 219
17 TraesCS1A01G009500 chr2B 83.547 547 46 23 4595 5140 473307836 473308339 6.200000e-129 472
18 TraesCS1A01G009500 chr2B 89.071 183 20 0 4594 4776 453031969 453032151 1.480000e-55 228
19 TraesCS1A01G009500 chr4B 81.633 392 46 17 4595 4977 473552417 473552791 8.600000e-78 302
20 TraesCS1A01G009500 chr3D 91.379 174 12 2 8 178 80217953 80217780 8.850000e-58 235
21 TraesCS1A01G009500 chr3D 90.058 171 16 1 8 178 595778949 595779118 2.480000e-53 220
22 TraesCS1A01G009500 chr3D 92.105 152 11 1 5130 5281 585363476 585363326 4.150000e-51 213
23 TraesCS1A01G009500 chr6D 91.463 164 14 0 13 176 417885403 417885566 5.330000e-55 226
24 TraesCS1A01G009500 chr6D 90.854 164 15 0 13 176 90927462 90927625 2.480000e-53 220
25 TraesCS1A01G009500 chr5D 92.453 159 11 1 22 179 84379809 84379651 5.330000e-55 226
26 TraesCS1A01G009500 chr5D 92.715 151 10 1 5131 5281 52271491 52271342 3.210000e-52 217
27 TraesCS1A01G009500 chr7B 91.463 164 13 1 13 176 3022310 3022148 1.920000e-54 224
28 TraesCS1A01G009500 chr3B 92.810 153 9 2 5130 5281 30379377 30379226 2.480000e-53 220
29 TraesCS1A01G009500 chr2A 92.763 152 10 1 5130 5281 256807735 256807885 8.910000e-53 219
30 TraesCS1A01G009500 chr1D 92.258 155 10 2 5127 5281 432781525 432781677 8.910000e-53 219
31 TraesCS1A01G009500 chr4D 92.105 152 11 1 5130 5281 109918569 109918719 4.150000e-51 213


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G009500 chr1A 5870427 5875711 5284 False 9760.0 9760 100.0000 1 5285 1 chr1A.!!$F1 5284
1 TraesCS1A01G009500 chr7D 25037250 25040631 3381 True 2327.0 2327 79.3390 1040 4414 1 chr7D.!!$R1 3374
2 TraesCS1A01G009500 chr7A 25922674 25926062 3388 True 2279.0 2279 79.0780 1025 4405 1 chr7A.!!$R1 3380
3 TraesCS1A01G009500 chr7A 539831095 539831685 590 False 377.5 586 88.3335 4595 5140 2 chr7A.!!$F1 545
4 TraesCS1A01G009500 chr4A 708566685 708570086 3401 False 2272.0 2272 78.9830 1019 4414 1 chr4A.!!$F2 3395
5 TraesCS1A01G009500 chr6A 546925346 546925884 538 True 575.0 575 85.9230 4595 5140 1 chr6A.!!$R2 545
6 TraesCS1A01G009500 chrUn 81661479 81662012 533 True 516.0 516 84.0950 4595 5140 1 chrUn.!!$R1 545
7 TraesCS1A01G009500 chr5A 649315703 649316240 537 True 508.0 508 83.7290 4595 5140 1 chr5A.!!$R3 545
8 TraesCS1A01G009500 chr2B 473307836 473308339 503 False 472.0 472 83.5470 4595 5140 1 chr2B.!!$F2 545


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
403 404 0.028110 GAATCCAATTCGTCCGCAGC 59.972 55.0 0.0 0.0 0.00 5.25 F
410 411 0.037326 ATTCGTCCGCAGCTTTCAGA 60.037 50.0 0.0 0.0 0.00 3.27 F
725 726 0.105964 CGGTGTCCTGAAAGTCCACA 59.894 55.0 0.0 0.0 35.19 4.17 F
1647 1648 0.106419 TGGGGAGCAACGGTTTTCTT 60.106 50.0 0.0 0.0 0.00 2.52 F
2790 2794 0.037139 CGGGGAACATACCGTCACAA 60.037 55.0 0.0 0.0 44.85 3.33 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1814 1818 0.271927 AGGAATGCCCCCTGATAGGA 59.728 55.0 0.00 0.0 33.47 2.94 R
1818 1822 0.628668 AGGAAGGAATGCCCCCTGAT 60.629 55.0 0.43 0.0 36.65 2.90 R
2537 2541 0.741915 TCCGGACAGTTTGTTTTGGC 59.258 50.0 0.00 0.0 0.00 4.52 R
3507 3511 0.101219 GGCGAATGTTCCTCAATGCC 59.899 55.0 0.00 0.0 35.61 4.40 R
4513 4541 0.038310 GTAGCAAGCCCCCAACTTCT 59.962 55.0 0.00 0.0 0.00 2.85 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
17 18 3.330853 GCATAAGCCGGCGAGTCG 61.331 66.667 23.20 8.54 33.58 4.18
18 19 2.104331 CATAAGCCGGCGAGTCGT 59.896 61.111 23.20 0.00 0.00 4.34
19 20 2.104331 ATAAGCCGGCGAGTCGTG 59.896 61.111 23.20 7.16 0.00 4.35
20 21 3.426117 ATAAGCCGGCGAGTCGTGG 62.426 63.158 23.20 16.88 0.00 4.94
29 30 2.742372 GAGTCGTGGGCGTTGCAT 60.742 61.111 0.00 0.00 39.49 3.96
30 31 2.281484 AGTCGTGGGCGTTGCATT 60.281 55.556 0.00 0.00 39.49 3.56
31 32 1.852067 GAGTCGTGGGCGTTGCATTT 61.852 55.000 0.00 0.00 39.49 2.32
32 33 1.007849 GTCGTGGGCGTTGCATTTT 60.008 52.632 0.00 0.00 39.49 1.82
33 34 0.596341 GTCGTGGGCGTTGCATTTTT 60.596 50.000 0.00 0.00 39.49 1.94
34 35 0.596083 TCGTGGGCGTTGCATTTTTG 60.596 50.000 0.00 0.00 39.49 2.44
35 36 1.569003 GTGGGCGTTGCATTTTTGC 59.431 52.632 0.00 0.00 0.00 3.68
36 37 1.953138 TGGGCGTTGCATTTTTGCG 60.953 52.632 0.00 0.00 37.69 4.85
37 38 2.170747 GGCGTTGCATTTTTGCGC 59.829 55.556 0.00 0.00 46.24 6.09
38 39 2.201910 GCGTTGCATTTTTGCGCG 60.202 55.556 0.00 0.00 38.75 6.86
39 40 2.201910 CGTTGCATTTTTGCGCGC 60.202 55.556 27.26 27.26 37.69 6.86
40 41 2.647381 CGTTGCATTTTTGCGCGCT 61.647 52.632 33.29 8.62 37.69 5.92
41 42 1.154800 GTTGCATTTTTGCGCGCTG 60.155 52.632 33.29 22.29 37.69 5.18
42 43 2.941081 TTGCATTTTTGCGCGCTGC 61.941 52.632 33.29 30.70 46.70 5.25
43 44 3.107661 GCATTTTTGCGCGCTGCT 61.108 55.556 33.29 9.52 46.63 4.24
44 45 1.801113 GCATTTTTGCGCGCTGCTA 60.801 52.632 33.29 15.52 46.63 3.49
45 46 1.736249 GCATTTTTGCGCGCTGCTAG 61.736 55.000 33.29 17.94 46.63 3.42
46 47 0.179192 CATTTTTGCGCGCTGCTAGA 60.179 50.000 33.29 13.45 46.63 2.43
47 48 0.097674 ATTTTTGCGCGCTGCTAGAG 59.902 50.000 33.29 0.00 46.63 2.43
48 49 2.513065 TTTTTGCGCGCTGCTAGAGC 62.513 55.000 33.29 9.63 46.63 4.09
68 69 2.202285 CACGCGCGCTGCATTTTA 60.202 55.556 32.58 0.00 46.97 1.52
69 70 2.098298 ACGCGCGCTGCATTTTAG 59.902 55.556 32.58 12.54 46.97 1.85
70 71 3.307262 CGCGCGCTGCATTTTAGC 61.307 61.111 30.48 6.56 46.97 3.09
76 77 2.793946 CTGCATTTTAGCGCGGCT 59.206 55.556 8.83 8.38 43.41 5.52
77 78 1.584483 CTGCATTTTAGCGCGGCTG 60.584 57.895 8.83 0.53 40.10 4.85
78 79 2.951227 GCATTTTAGCGCGGCTGC 60.951 61.111 8.83 7.70 40.10 5.25
80 81 1.584483 CATTTTAGCGCGGCTGCTG 60.584 57.895 22.96 10.42 46.70 4.41
81 82 2.764314 ATTTTAGCGCGGCTGCTGG 61.764 57.895 22.96 1.40 46.70 4.85
82 83 3.892740 TTTTAGCGCGGCTGCTGGA 62.893 57.895 22.96 12.50 46.70 3.86
83 84 4.819761 TTAGCGCGGCTGCTGGAG 62.820 66.667 22.96 0.14 46.70 3.86
130 131 4.776647 GATGGGCGCACGGCAAAC 62.777 66.667 18.56 1.90 46.16 2.93
132 133 3.910914 ATGGGCGCACGGCAAACTA 62.911 57.895 18.56 0.00 46.16 2.24
133 134 3.799755 GGGCGCACGGCAAACTAG 61.800 66.667 18.56 0.00 46.16 2.57
134 135 3.047877 GGCGCACGGCAAACTAGT 61.048 61.111 10.83 0.00 46.16 2.57
135 136 2.474712 GCGCACGGCAAACTAGTC 59.525 61.111 0.30 0.00 42.87 2.59
136 137 2.027625 GCGCACGGCAAACTAGTCT 61.028 57.895 0.30 0.00 42.87 3.24
137 138 1.566018 GCGCACGGCAAACTAGTCTT 61.566 55.000 0.30 0.00 42.87 3.01
138 139 0.865769 CGCACGGCAAACTAGTCTTT 59.134 50.000 0.00 0.00 0.00 2.52
139 140 1.263217 CGCACGGCAAACTAGTCTTTT 59.737 47.619 0.00 0.00 0.00 2.27
140 141 2.650608 GCACGGCAAACTAGTCTTTTG 58.349 47.619 0.00 0.00 37.07 2.44
144 145 1.318251 GCAAACTAGTCTTTTGCGCG 58.682 50.000 13.46 0.00 46.77 6.86
145 146 1.318251 CAAACTAGTCTTTTGCGCGC 58.682 50.000 27.26 27.26 0.00 6.86
146 147 0.110823 AAACTAGTCTTTTGCGCGCG 60.111 50.000 28.44 28.44 0.00 6.86
147 148 1.897398 AACTAGTCTTTTGCGCGCGG 61.897 55.000 33.06 14.75 0.00 6.46
148 149 3.702334 CTAGTCTTTTGCGCGCGGC 62.702 63.158 33.06 23.43 43.96 6.53
168 169 3.423154 GTTCGGCGGCTGTTGGAG 61.423 66.667 7.21 0.00 0.00 3.86
169 170 3.621805 TTCGGCGGCTGTTGGAGA 61.622 61.111 7.21 0.00 0.00 3.71
170 171 2.954684 TTCGGCGGCTGTTGGAGAT 61.955 57.895 7.21 0.00 0.00 2.75
171 172 3.197790 CGGCGGCTGTTGGAGATG 61.198 66.667 7.61 0.00 0.00 2.90
172 173 3.512516 GGCGGCTGTTGGAGATGC 61.513 66.667 0.00 0.00 0.00 3.91
173 174 2.437359 GCGGCTGTTGGAGATGCT 60.437 61.111 0.00 0.00 0.00 3.79
174 175 2.467826 GCGGCTGTTGGAGATGCTC 61.468 63.158 0.00 0.00 0.00 4.26
175 176 1.220206 CGGCTGTTGGAGATGCTCT 59.780 57.895 0.00 0.00 0.00 4.09
176 177 0.392193 CGGCTGTTGGAGATGCTCTT 60.392 55.000 0.00 0.00 0.00 2.85
177 178 1.134699 CGGCTGTTGGAGATGCTCTTA 60.135 52.381 0.00 0.00 0.00 2.10
178 179 2.284190 GGCTGTTGGAGATGCTCTTAC 58.716 52.381 0.00 0.00 0.00 2.34
179 180 1.929836 GCTGTTGGAGATGCTCTTACG 59.070 52.381 0.00 0.00 0.00 3.18
180 181 2.675317 GCTGTTGGAGATGCTCTTACGT 60.675 50.000 0.00 0.00 0.00 3.57
181 182 3.428999 GCTGTTGGAGATGCTCTTACGTA 60.429 47.826 0.00 0.00 0.00 3.57
182 183 4.355437 CTGTTGGAGATGCTCTTACGTAG 58.645 47.826 0.00 0.00 0.00 3.51
183 184 3.117046 GTTGGAGATGCTCTTACGTAGC 58.883 50.000 1.75 1.75 40.50 3.58
184 185 2.656002 TGGAGATGCTCTTACGTAGCT 58.344 47.619 10.01 0.00 40.73 3.32
185 186 3.024547 TGGAGATGCTCTTACGTAGCTT 58.975 45.455 10.01 3.84 40.73 3.74
186 187 4.204799 TGGAGATGCTCTTACGTAGCTTA 58.795 43.478 10.01 0.00 40.73 3.09
187 188 4.036498 TGGAGATGCTCTTACGTAGCTTAC 59.964 45.833 10.01 2.41 40.73 2.34
188 189 4.036498 GGAGATGCTCTTACGTAGCTTACA 59.964 45.833 10.01 0.87 40.73 2.41
189 190 5.450137 GGAGATGCTCTTACGTAGCTTACAA 60.450 44.000 10.01 0.00 40.73 2.41
190 191 5.962433 AGATGCTCTTACGTAGCTTACAAA 58.038 37.500 10.01 0.00 40.73 2.83
191 192 5.805994 AGATGCTCTTACGTAGCTTACAAAC 59.194 40.000 10.01 0.00 40.73 2.93
192 193 5.130292 TGCTCTTACGTAGCTTACAAACT 57.870 39.130 10.01 0.00 40.73 2.66
193 194 6.258230 TGCTCTTACGTAGCTTACAAACTA 57.742 37.500 10.01 0.00 40.73 2.24
194 195 6.680810 TGCTCTTACGTAGCTTACAAACTAA 58.319 36.000 10.01 0.00 40.73 2.24
195 196 7.147312 TGCTCTTACGTAGCTTACAAACTAAA 58.853 34.615 10.01 0.00 40.73 1.85
196 197 7.327761 TGCTCTTACGTAGCTTACAAACTAAAG 59.672 37.037 10.01 0.00 40.73 1.85
197 198 7.328005 GCTCTTACGTAGCTTACAAACTAAAGT 59.672 37.037 1.49 0.00 37.01 2.66
198 199 9.189723 CTCTTACGTAGCTTACAAACTAAAGTT 57.810 33.333 0.00 0.00 40.50 2.66
203 204 9.097257 ACGTAGCTTACAAACTAAAGTTTAACA 57.903 29.630 7.73 0.00 45.54 2.41
204 205 9.919348 CGTAGCTTACAAACTAAAGTTTAACAA 57.081 29.630 7.73 2.73 45.54 2.83
230 231 9.453572 AATAAAATTCTTAGAGATGCAGACACA 57.546 29.630 0.00 0.00 0.00 3.72
231 232 7.934855 AAAATTCTTAGAGATGCAGACACAT 57.065 32.000 0.00 0.00 0.00 3.21
232 233 7.551035 AAATTCTTAGAGATGCAGACACATC 57.449 36.000 0.00 0.00 45.62 3.06
233 234 4.662468 TCTTAGAGATGCAGACACATCC 57.338 45.455 0.00 0.00 46.29 3.51
234 235 4.285020 TCTTAGAGATGCAGACACATCCT 58.715 43.478 0.00 1.96 46.29 3.24
235 236 4.713814 TCTTAGAGATGCAGACACATCCTT 59.286 41.667 0.00 0.00 46.29 3.36
236 237 3.263489 AGAGATGCAGACACATCCTTG 57.737 47.619 0.00 0.00 46.29 3.61
237 238 2.570752 AGAGATGCAGACACATCCTTGT 59.429 45.455 0.00 0.00 46.29 3.16
238 239 3.771479 AGAGATGCAGACACATCCTTGTA 59.229 43.478 0.00 0.00 46.29 2.41
239 240 3.866651 AGATGCAGACACATCCTTGTAC 58.133 45.455 0.00 0.00 46.29 2.90
240 241 3.261643 AGATGCAGACACATCCTTGTACA 59.738 43.478 0.00 0.00 46.29 2.90
241 242 3.701205 TGCAGACACATCCTTGTACAT 57.299 42.857 0.00 0.00 33.76 2.29
242 243 3.337358 TGCAGACACATCCTTGTACATG 58.663 45.455 0.00 0.00 33.76 3.21
243 244 3.244526 TGCAGACACATCCTTGTACATGT 60.245 43.478 2.69 2.69 33.76 3.21
249 250 4.623932 ACATCCTTGTACATGTGAGTGT 57.376 40.909 9.11 2.92 33.16 3.55
250 251 4.318332 ACATCCTTGTACATGTGAGTGTG 58.682 43.478 9.11 7.17 33.16 3.82
251 252 4.202357 ACATCCTTGTACATGTGAGTGTGT 60.202 41.667 9.11 7.71 33.16 3.72
252 253 4.415881 TCCTTGTACATGTGAGTGTGTT 57.584 40.909 9.11 0.00 33.62 3.32
253 254 4.776349 TCCTTGTACATGTGAGTGTGTTT 58.224 39.130 9.11 0.00 33.62 2.83
254 255 4.574421 TCCTTGTACATGTGAGTGTGTTTG 59.426 41.667 9.11 0.00 33.62 2.93
255 256 4.261155 CCTTGTACATGTGAGTGTGTTTGG 60.261 45.833 9.11 0.00 33.62 3.28
256 257 3.210227 TGTACATGTGAGTGTGTTTGGG 58.790 45.455 9.11 0.00 33.62 4.12
257 258 1.691196 ACATGTGAGTGTGTTTGGGG 58.309 50.000 0.00 0.00 0.00 4.96
258 259 1.064017 ACATGTGAGTGTGTTTGGGGT 60.064 47.619 0.00 0.00 0.00 4.95
259 260 1.608590 CATGTGAGTGTGTTTGGGGTC 59.391 52.381 0.00 0.00 0.00 4.46
260 261 0.462937 TGTGAGTGTGTTTGGGGTCG 60.463 55.000 0.00 0.00 0.00 4.79
261 262 1.525077 TGAGTGTGTTTGGGGTCGC 60.525 57.895 0.00 0.00 0.00 5.19
262 263 2.590575 AGTGTGTTTGGGGTCGCG 60.591 61.111 0.00 0.00 0.00 5.87
263 264 3.656045 GTGTGTTTGGGGTCGCGG 61.656 66.667 6.13 0.00 0.00 6.46
264 265 4.178169 TGTGTTTGGGGTCGCGGT 62.178 61.111 6.13 0.00 0.00 5.68
265 266 3.656045 GTGTTTGGGGTCGCGGTG 61.656 66.667 6.13 0.00 0.00 4.94
266 267 4.178169 TGTTTGGGGTCGCGGTGT 62.178 61.111 6.13 0.00 0.00 4.16
267 268 3.656045 GTTTGGGGTCGCGGTGTG 61.656 66.667 6.13 0.00 0.00 3.82
268 269 4.178169 TTTGGGGTCGCGGTGTGT 62.178 61.111 6.13 0.00 0.00 3.72
269 270 4.920112 TTGGGGTCGCGGTGTGTG 62.920 66.667 6.13 0.00 0.00 3.82
277 278 4.000557 GCGGTGTGTGTGCGTCTG 62.001 66.667 0.00 0.00 0.00 3.51
278 279 4.000557 CGGTGTGTGTGCGTCTGC 62.001 66.667 0.00 0.00 43.20 4.26
299 300 3.469008 ACATCTGTGTGTTCCGAGAAA 57.531 42.857 0.00 0.00 37.14 2.52
300 301 3.804036 ACATCTGTGTGTTCCGAGAAAA 58.196 40.909 0.00 0.00 37.14 2.29
301 302 4.196193 ACATCTGTGTGTTCCGAGAAAAA 58.804 39.130 0.00 0.00 37.14 1.94
323 324 5.520376 AAAATGGTTGAACACTTGAGAGG 57.480 39.130 0.00 0.00 0.00 3.69
324 325 2.638480 TGGTTGAACACTTGAGAGGG 57.362 50.000 0.00 0.00 0.00 4.30
325 326 2.123589 TGGTTGAACACTTGAGAGGGA 58.876 47.619 0.00 0.00 0.00 4.20
326 327 2.711009 TGGTTGAACACTTGAGAGGGAT 59.289 45.455 0.00 0.00 0.00 3.85
327 328 3.907474 TGGTTGAACACTTGAGAGGGATA 59.093 43.478 0.00 0.00 0.00 2.59
328 329 4.349636 TGGTTGAACACTTGAGAGGGATAA 59.650 41.667 0.00 0.00 0.00 1.75
329 330 4.695928 GGTTGAACACTTGAGAGGGATAAC 59.304 45.833 0.00 0.00 0.00 1.89
330 331 5.305585 GTTGAACACTTGAGAGGGATAACA 58.694 41.667 0.00 0.00 0.00 2.41
331 332 5.152623 TGAACACTTGAGAGGGATAACAG 57.847 43.478 0.00 0.00 0.00 3.16
332 333 4.838423 TGAACACTTGAGAGGGATAACAGA 59.162 41.667 0.00 0.00 0.00 3.41
333 334 4.810191 ACACTTGAGAGGGATAACAGAC 57.190 45.455 0.00 0.00 0.00 3.51
334 335 3.515901 ACACTTGAGAGGGATAACAGACC 59.484 47.826 0.00 0.00 0.00 3.85
335 336 2.761208 ACTTGAGAGGGATAACAGACCG 59.239 50.000 0.00 0.00 0.00 4.79
336 337 1.112113 TGAGAGGGATAACAGACCGC 58.888 55.000 0.00 0.00 0.00 5.68
337 338 0.389757 GAGAGGGATAACAGACCGCC 59.610 60.000 0.00 0.00 0.00 6.13
338 339 1.049289 AGAGGGATAACAGACCGCCC 61.049 60.000 0.00 0.00 39.12 6.13
339 340 2.041206 GAGGGATAACAGACCGCCCC 62.041 65.000 0.00 0.00 39.68 5.80
340 341 2.108362 GGATAACAGACCGCCCCG 59.892 66.667 0.00 0.00 0.00 5.73
341 342 2.728435 GGATAACAGACCGCCCCGT 61.728 63.158 0.00 0.00 0.00 5.28
342 343 1.520787 GATAACAGACCGCCCCGTG 60.521 63.158 0.00 0.00 0.00 4.94
343 344 2.234913 GATAACAGACCGCCCCGTGT 62.235 60.000 0.00 0.00 0.00 4.49
344 345 2.234913 ATAACAGACCGCCCCGTGTC 62.235 60.000 0.00 0.00 0.00 3.67
346 347 4.308458 CAGACCGCCCCGTGTCAA 62.308 66.667 8.25 0.00 32.50 3.18
347 348 3.552384 AGACCGCCCCGTGTCAAA 61.552 61.111 8.25 0.00 32.50 2.69
348 349 2.359478 GACCGCCCCGTGTCAAAT 60.359 61.111 0.00 0.00 31.22 2.32
349 350 1.078988 GACCGCCCCGTGTCAAATA 60.079 57.895 0.00 0.00 31.22 1.40
350 351 0.674269 GACCGCCCCGTGTCAAATAA 60.674 55.000 0.00 0.00 31.22 1.40
351 352 0.250814 ACCGCCCCGTGTCAAATAAA 60.251 50.000 0.00 0.00 0.00 1.40
352 353 0.882474 CCGCCCCGTGTCAAATAAAA 59.118 50.000 0.00 0.00 0.00 1.52
353 354 1.474879 CCGCCCCGTGTCAAATAAAAT 59.525 47.619 0.00 0.00 0.00 1.82
354 355 2.478879 CCGCCCCGTGTCAAATAAAATC 60.479 50.000 0.00 0.00 0.00 2.17
355 356 2.162608 CGCCCCGTGTCAAATAAAATCA 59.837 45.455 0.00 0.00 0.00 2.57
356 357 3.730662 CGCCCCGTGTCAAATAAAATCAG 60.731 47.826 0.00 0.00 0.00 2.90
357 358 3.192633 GCCCCGTGTCAAATAAAATCAGT 59.807 43.478 0.00 0.00 0.00 3.41
358 359 4.321675 GCCCCGTGTCAAATAAAATCAGTT 60.322 41.667 0.00 0.00 0.00 3.16
359 360 5.778862 CCCCGTGTCAAATAAAATCAGTTT 58.221 37.500 0.00 0.00 0.00 2.66
360 361 6.570764 GCCCCGTGTCAAATAAAATCAGTTTA 60.571 38.462 0.00 0.00 36.14 2.01
361 362 7.543756 CCCCGTGTCAAATAAAATCAGTTTAT 58.456 34.615 0.00 0.00 43.02 1.40
375 376 9.934190 AAAATCAGTTTATTTGTGTGAATTTGC 57.066 25.926 0.00 0.00 0.00 3.68
376 377 7.656707 ATCAGTTTATTTGTGTGAATTTGCC 57.343 32.000 0.00 0.00 0.00 4.52
377 378 6.815089 TCAGTTTATTTGTGTGAATTTGCCT 58.185 32.000 0.00 0.00 0.00 4.75
378 379 7.271511 TCAGTTTATTTGTGTGAATTTGCCTT 58.728 30.769 0.00 0.00 0.00 4.35
379 380 7.224362 TCAGTTTATTTGTGTGAATTTGCCTTG 59.776 33.333 0.00 0.00 0.00 3.61
380 381 7.224362 CAGTTTATTTGTGTGAATTTGCCTTGA 59.776 33.333 0.00 0.00 0.00 3.02
381 382 7.768120 AGTTTATTTGTGTGAATTTGCCTTGAA 59.232 29.630 0.00 0.00 0.00 2.69
382 383 8.558700 GTTTATTTGTGTGAATTTGCCTTGAAT 58.441 29.630 0.00 0.00 0.00 2.57
383 384 9.770097 TTTATTTGTGTGAATTTGCCTTGAATA 57.230 25.926 0.00 0.00 0.00 1.75
384 385 7.894376 ATTTGTGTGAATTTGCCTTGAATAG 57.106 32.000 0.00 0.00 0.00 1.73
385 386 6.647334 TTGTGTGAATTTGCCTTGAATAGA 57.353 33.333 0.00 0.00 0.00 1.98
386 387 6.647334 TGTGTGAATTTGCCTTGAATAGAA 57.353 33.333 0.00 0.00 0.00 2.10
387 388 7.230849 TGTGTGAATTTGCCTTGAATAGAAT 57.769 32.000 0.00 0.00 0.00 2.40
388 389 7.315142 TGTGTGAATTTGCCTTGAATAGAATC 58.685 34.615 0.00 0.00 0.00 2.52
389 390 6.753744 GTGTGAATTTGCCTTGAATAGAATCC 59.246 38.462 0.00 0.00 0.00 3.01
390 391 6.436847 TGTGAATTTGCCTTGAATAGAATCCA 59.563 34.615 0.00 0.00 0.00 3.41
391 392 7.039152 TGTGAATTTGCCTTGAATAGAATCCAA 60.039 33.333 0.00 0.00 0.00 3.53
392 393 7.983484 GTGAATTTGCCTTGAATAGAATCCAAT 59.017 33.333 0.00 0.00 0.00 3.16
393 394 8.542080 TGAATTTGCCTTGAATAGAATCCAATT 58.458 29.630 0.00 0.00 0.00 2.32
394 395 8.953368 AATTTGCCTTGAATAGAATCCAATTC 57.047 30.769 0.50 0.50 39.56 2.17
395 396 5.756195 TGCCTTGAATAGAATCCAATTCG 57.244 39.130 2.74 0.00 43.92 3.34
396 397 5.192927 TGCCTTGAATAGAATCCAATTCGT 58.807 37.500 2.74 0.00 43.92 3.85
397 398 5.296780 TGCCTTGAATAGAATCCAATTCGTC 59.703 40.000 2.74 0.00 43.92 4.20
398 399 5.278022 GCCTTGAATAGAATCCAATTCGTCC 60.278 44.000 2.74 0.00 43.92 4.79
399 400 5.050091 CCTTGAATAGAATCCAATTCGTCCG 60.050 44.000 2.74 0.00 43.92 4.79
400 401 3.807622 TGAATAGAATCCAATTCGTCCGC 59.192 43.478 2.74 0.00 43.92 5.54
401 402 2.971660 TAGAATCCAATTCGTCCGCA 57.028 45.000 0.00 0.00 43.92 5.69
402 403 1.656652 AGAATCCAATTCGTCCGCAG 58.343 50.000 0.00 0.00 43.92 5.18
403 404 0.028110 GAATCCAATTCGTCCGCAGC 59.972 55.000 0.00 0.00 0.00 5.25
404 405 0.392998 AATCCAATTCGTCCGCAGCT 60.393 50.000 0.00 0.00 0.00 4.24
405 406 0.392998 ATCCAATTCGTCCGCAGCTT 60.393 50.000 0.00 0.00 0.00 3.74
406 407 0.605319 TCCAATTCGTCCGCAGCTTT 60.605 50.000 0.00 0.00 0.00 3.51
407 408 0.179189 CCAATTCGTCCGCAGCTTTC 60.179 55.000 0.00 0.00 0.00 2.62
408 409 0.516877 CAATTCGTCCGCAGCTTTCA 59.483 50.000 0.00 0.00 0.00 2.69
409 410 0.798776 AATTCGTCCGCAGCTTTCAG 59.201 50.000 0.00 0.00 0.00 3.02
410 411 0.037326 ATTCGTCCGCAGCTTTCAGA 60.037 50.000 0.00 0.00 0.00 3.27
411 412 0.667487 TTCGTCCGCAGCTTTCAGAG 60.667 55.000 0.00 0.00 0.00 3.35
412 413 1.080501 CGTCCGCAGCTTTCAGAGA 60.081 57.895 0.00 0.00 0.00 3.10
413 414 0.667487 CGTCCGCAGCTTTCAGAGAA 60.667 55.000 0.00 0.00 0.00 2.87
414 415 1.731720 GTCCGCAGCTTTCAGAGAAT 58.268 50.000 0.00 0.00 0.00 2.40
415 416 1.663135 GTCCGCAGCTTTCAGAGAATC 59.337 52.381 0.00 0.00 0.00 2.52
430 431 4.491554 GAGAATCTGTCGTCGAAATGTG 57.508 45.455 0.00 0.00 0.00 3.21
431 432 3.914312 AGAATCTGTCGTCGAAATGTGT 58.086 40.909 0.00 0.00 0.00 3.72
432 433 3.675225 AGAATCTGTCGTCGAAATGTGTG 59.325 43.478 0.00 0.00 0.00 3.82
433 434 2.785713 TCTGTCGTCGAAATGTGTGA 57.214 45.000 0.00 0.00 0.00 3.58
434 435 2.390938 TCTGTCGTCGAAATGTGTGAC 58.609 47.619 0.00 0.00 0.00 3.67
435 436 2.124122 CTGTCGTCGAAATGTGTGACA 58.876 47.619 0.00 0.00 35.31 3.58
436 437 2.731451 CTGTCGTCGAAATGTGTGACAT 59.269 45.455 0.00 0.00 41.31 3.06
437 438 3.903360 TGTCGTCGAAATGTGTGACATA 58.097 40.909 0.00 0.00 37.97 2.29
438 439 4.299978 TGTCGTCGAAATGTGTGACATAA 58.700 39.130 0.00 0.00 37.97 1.90
439 440 4.745620 TGTCGTCGAAATGTGTGACATAAA 59.254 37.500 0.00 0.00 37.97 1.40
440 441 5.234543 TGTCGTCGAAATGTGTGACATAAAA 59.765 36.000 0.00 0.00 37.97 1.52
441 442 6.073494 TGTCGTCGAAATGTGTGACATAAAAT 60.073 34.615 0.00 0.00 37.97 1.82
442 443 6.795114 GTCGTCGAAATGTGTGACATAAAATT 59.205 34.615 0.00 0.00 37.97 1.82
443 444 6.794636 TCGTCGAAATGTGTGACATAAAATTG 59.205 34.615 0.00 0.00 37.97 2.32
444 445 6.577055 CGTCGAAATGTGTGACATAAAATTGT 59.423 34.615 0.00 0.00 37.97 2.71
445 446 7.112844 CGTCGAAATGTGTGACATAAAATTGTT 59.887 33.333 0.00 0.00 37.97 2.83
446 447 9.388346 GTCGAAATGTGTGACATAAAATTGTTA 57.612 29.630 0.00 0.00 37.97 2.41
451 452 7.865875 TGTGTGACATAAAATTGTTATGTGC 57.134 32.000 15.44 9.41 43.39 4.57
452 453 6.580416 TGTGTGACATAAAATTGTTATGTGCG 59.420 34.615 15.44 0.00 43.39 5.34
453 454 6.580791 GTGTGACATAAAATTGTTATGTGCGT 59.419 34.615 15.44 0.00 43.39 5.24
454 455 6.580416 TGTGACATAAAATTGTTATGTGCGTG 59.420 34.615 15.44 0.00 43.39 5.34
455 456 6.033407 GTGACATAAAATTGTTATGTGCGTGG 59.967 38.462 15.44 0.00 43.39 4.94
456 457 4.862018 ACATAAAATTGTTATGTGCGTGGC 59.138 37.500 10.77 0.00 42.21 5.01
457 458 3.377346 AAAATTGTTATGTGCGTGGCA 57.623 38.095 0.00 0.00 35.60 4.92
458 459 2.634982 AATTGTTATGTGCGTGGCAG 57.365 45.000 0.00 0.00 40.08 4.85
459 460 1.819928 ATTGTTATGTGCGTGGCAGA 58.180 45.000 0.00 0.00 40.08 4.26
460 461 1.155889 TTGTTATGTGCGTGGCAGAG 58.844 50.000 0.00 0.00 40.08 3.35
461 462 0.320050 TGTTATGTGCGTGGCAGAGA 59.680 50.000 0.00 0.00 40.08 3.10
462 463 1.066215 TGTTATGTGCGTGGCAGAGAT 60.066 47.619 0.00 0.00 40.08 2.75
463 464 2.009774 GTTATGTGCGTGGCAGAGATT 58.990 47.619 0.00 0.00 40.08 2.40
464 465 2.401583 TATGTGCGTGGCAGAGATTT 57.598 45.000 0.00 0.00 40.08 2.17
465 466 0.806868 ATGTGCGTGGCAGAGATTTG 59.193 50.000 0.00 0.00 40.08 2.32
466 467 0.534877 TGTGCGTGGCAGAGATTTGT 60.535 50.000 0.00 0.00 40.08 2.83
467 468 1.270571 TGTGCGTGGCAGAGATTTGTA 60.271 47.619 0.00 0.00 40.08 2.41
468 469 1.128692 GTGCGTGGCAGAGATTTGTAC 59.871 52.381 0.00 0.00 40.08 2.90
469 470 1.270571 TGCGTGGCAGAGATTTGTACA 60.271 47.619 0.00 0.00 33.32 2.90
470 471 1.128692 GCGTGGCAGAGATTTGTACAC 59.871 52.381 0.00 0.00 0.00 2.90
471 472 1.390123 CGTGGCAGAGATTTGTACACG 59.610 52.381 0.00 0.00 41.35 4.49
472 473 2.683968 GTGGCAGAGATTTGTACACGA 58.316 47.619 0.00 0.00 0.00 4.35
473 474 2.412089 GTGGCAGAGATTTGTACACGAC 59.588 50.000 0.00 0.00 0.00 4.34
474 475 2.299013 TGGCAGAGATTTGTACACGACT 59.701 45.455 0.00 0.00 0.00 4.18
475 476 3.244078 TGGCAGAGATTTGTACACGACTT 60.244 43.478 0.00 0.00 0.00 3.01
476 477 3.123621 GGCAGAGATTTGTACACGACTTG 59.876 47.826 0.00 0.00 0.00 3.16
477 478 3.741344 GCAGAGATTTGTACACGACTTGT 59.259 43.478 0.00 0.00 42.84 3.16
478 479 4.143305 GCAGAGATTTGTACACGACTTGTC 60.143 45.833 0.00 0.00 39.91 3.18
479 480 4.386049 CAGAGATTTGTACACGACTTGTCC 59.614 45.833 0.00 0.00 39.91 4.02
480 481 4.038763 AGAGATTTGTACACGACTTGTCCA 59.961 41.667 0.00 0.00 39.91 4.02
481 482 4.699637 AGATTTGTACACGACTTGTCCAA 58.300 39.130 0.00 0.00 39.91 3.53
482 483 5.120399 AGATTTGTACACGACTTGTCCAAA 58.880 37.500 5.49 5.49 45.12 3.28
483 484 4.603231 TTTGTACACGACTTGTCCAAAC 57.397 40.909 0.00 0.00 38.67 2.93
484 485 2.195096 TGTACACGACTTGTCCAAACG 58.805 47.619 0.00 0.00 39.91 3.60
485 486 2.159268 TGTACACGACTTGTCCAAACGA 60.159 45.455 11.29 0.00 39.91 3.85
486 487 1.283736 ACACGACTTGTCCAAACGAC 58.716 50.000 11.29 0.00 42.33 4.34
487 488 1.134907 ACACGACTTGTCCAAACGACT 60.135 47.619 11.29 0.00 42.49 4.18
488 489 2.099592 ACACGACTTGTCCAAACGACTA 59.900 45.455 11.29 0.00 42.49 2.59
489 490 2.724690 CACGACTTGTCCAAACGACTAG 59.275 50.000 11.29 3.13 46.21 2.57
493 494 3.662247 CTTGTCCAAACGACTAGTCCT 57.338 47.619 17.23 2.73 42.49 3.85
494 495 3.576648 CTTGTCCAAACGACTAGTCCTC 58.423 50.000 17.23 0.00 42.49 3.71
495 496 1.538512 TGTCCAAACGACTAGTCCTCG 59.461 52.381 17.23 9.02 42.49 4.63
496 497 1.808945 GTCCAAACGACTAGTCCTCGA 59.191 52.381 17.23 3.36 38.57 4.04
497 498 2.422832 GTCCAAACGACTAGTCCTCGAT 59.577 50.000 17.23 0.00 38.57 3.59
498 499 2.422479 TCCAAACGACTAGTCCTCGATG 59.578 50.000 17.23 10.52 35.08 3.84
499 500 2.186076 CAAACGACTAGTCCTCGATGC 58.814 52.381 17.23 0.00 35.08 3.91
500 501 0.739561 AACGACTAGTCCTCGATGCC 59.260 55.000 17.23 0.00 35.08 4.40
501 502 0.107116 ACGACTAGTCCTCGATGCCT 60.107 55.000 17.23 0.00 35.08 4.75
502 503 1.025812 CGACTAGTCCTCGATGCCTT 58.974 55.000 17.23 0.00 32.65 4.35
503 504 2.219458 CGACTAGTCCTCGATGCCTTA 58.781 52.381 17.23 0.00 32.65 2.69
504 505 2.617308 CGACTAGTCCTCGATGCCTTAA 59.383 50.000 17.23 0.00 32.65 1.85
505 506 3.304123 CGACTAGTCCTCGATGCCTTAAG 60.304 52.174 17.23 0.00 32.65 1.85
506 507 2.362717 ACTAGTCCTCGATGCCTTAAGC 59.637 50.000 0.00 0.00 44.14 3.09
507 508 0.466124 AGTCCTCGATGCCTTAAGCC 59.534 55.000 0.00 0.00 42.71 4.35
508 509 0.178068 GTCCTCGATGCCTTAAGCCA 59.822 55.000 0.00 0.00 42.71 4.75
509 510 0.465705 TCCTCGATGCCTTAAGCCAG 59.534 55.000 0.00 0.00 42.71 4.85
510 511 0.179000 CCTCGATGCCTTAAGCCAGT 59.821 55.000 0.00 0.00 42.71 4.00
511 512 1.293924 CTCGATGCCTTAAGCCAGTG 58.706 55.000 0.00 0.00 42.71 3.66
512 513 0.107703 TCGATGCCTTAAGCCAGTGG 60.108 55.000 4.20 4.20 42.71 4.00
513 514 0.392998 CGATGCCTTAAGCCAGTGGT 60.393 55.000 11.74 0.00 42.71 4.16
514 515 1.383523 GATGCCTTAAGCCAGTGGTC 58.616 55.000 11.74 3.09 42.71 4.02
515 516 0.698238 ATGCCTTAAGCCAGTGGTCA 59.302 50.000 11.74 0.00 42.71 4.02
516 517 0.250727 TGCCTTAAGCCAGTGGTCAC 60.251 55.000 11.74 0.00 42.71 3.67
517 518 0.250727 GCCTTAAGCCAGTGGTCACA 60.251 55.000 11.74 0.00 34.35 3.58
518 519 1.614317 GCCTTAAGCCAGTGGTCACAT 60.614 52.381 11.74 0.00 34.35 3.21
519 520 2.355716 GCCTTAAGCCAGTGGTCACATA 60.356 50.000 11.74 0.00 34.35 2.29
520 521 3.872240 GCCTTAAGCCAGTGGTCACATAA 60.872 47.826 11.74 3.06 34.35 1.90
521 522 4.331968 CCTTAAGCCAGTGGTCACATAAA 58.668 43.478 11.74 0.00 0.00 1.40
522 523 4.764823 CCTTAAGCCAGTGGTCACATAAAA 59.235 41.667 11.74 0.00 0.00 1.52
523 524 5.418840 CCTTAAGCCAGTGGTCACATAAAAT 59.581 40.000 11.74 0.00 0.00 1.82
524 525 6.404734 CCTTAAGCCAGTGGTCACATAAAATC 60.405 42.308 11.74 0.00 0.00 2.17
525 526 4.307032 AGCCAGTGGTCACATAAAATCT 57.693 40.909 11.74 0.00 0.00 2.40
526 527 4.012374 AGCCAGTGGTCACATAAAATCTG 58.988 43.478 11.74 0.00 0.00 2.90
527 528 3.758554 GCCAGTGGTCACATAAAATCTGT 59.241 43.478 11.74 0.00 0.00 3.41
528 529 4.218417 GCCAGTGGTCACATAAAATCTGTT 59.782 41.667 11.74 0.00 0.00 3.16
529 530 5.702865 CCAGTGGTCACATAAAATCTGTTG 58.297 41.667 0.00 0.00 0.00 3.33
530 531 5.241506 CCAGTGGTCACATAAAATCTGTTGT 59.758 40.000 0.00 0.00 0.00 3.32
531 532 6.373779 CAGTGGTCACATAAAATCTGTTGTC 58.626 40.000 3.82 0.00 0.00 3.18
532 533 6.205464 CAGTGGTCACATAAAATCTGTTGTCT 59.795 38.462 3.82 0.00 0.00 3.41
533 534 6.205464 AGTGGTCACATAAAATCTGTTGTCTG 59.795 38.462 3.82 0.00 0.00 3.51
534 535 6.017109 GTGGTCACATAAAATCTGTTGTCTGT 60.017 38.462 0.00 0.00 0.00 3.41
535 536 6.204688 TGGTCACATAAAATCTGTTGTCTGTC 59.795 38.462 0.00 0.00 0.00 3.51
536 537 6.348540 GGTCACATAAAATCTGTTGTCTGTCC 60.349 42.308 0.00 0.00 0.00 4.02
537 538 6.204688 GTCACATAAAATCTGTTGTCTGTCCA 59.795 38.462 0.00 0.00 0.00 4.02
538 539 6.770303 TCACATAAAATCTGTTGTCTGTCCAA 59.230 34.615 0.00 0.00 0.00 3.53
539 540 7.284261 TCACATAAAATCTGTTGTCTGTCCAAA 59.716 33.333 0.00 0.00 0.00 3.28
540 541 7.592533 CACATAAAATCTGTTGTCTGTCCAAAG 59.407 37.037 0.00 0.00 0.00 2.77
541 542 7.502226 ACATAAAATCTGTTGTCTGTCCAAAGA 59.498 33.333 0.00 0.00 0.00 2.52
542 543 6.966534 AAAATCTGTTGTCTGTCCAAAGAT 57.033 33.333 0.00 0.00 30.50 2.40
543 544 6.966534 AAATCTGTTGTCTGTCCAAAGATT 57.033 33.333 0.00 0.00 35.77 2.40
544 545 8.463930 AAAATCTGTTGTCTGTCCAAAGATTA 57.536 30.769 0.00 0.00 34.64 1.75
545 546 8.641498 AAATCTGTTGTCTGTCCAAAGATTAT 57.359 30.769 0.00 0.00 34.64 1.28
546 547 8.641498 AATCTGTTGTCTGTCCAAAGATTATT 57.359 30.769 0.00 0.00 34.35 1.40
547 548 7.439157 TCTGTTGTCTGTCCAAAGATTATTG 57.561 36.000 0.00 0.00 0.00 1.90
548 549 6.012658 TGTTGTCTGTCCAAAGATTATTGC 57.987 37.500 0.00 0.00 0.00 3.56
549 550 5.534278 TGTTGTCTGTCCAAAGATTATTGCA 59.466 36.000 0.00 0.00 0.00 4.08
550 551 6.040278 TGTTGTCTGTCCAAAGATTATTGCAA 59.960 34.615 0.00 0.00 0.00 4.08
551 552 6.258230 TGTCTGTCCAAAGATTATTGCAAG 57.742 37.500 4.94 0.00 0.00 4.01
552 553 5.098211 GTCTGTCCAAAGATTATTGCAAGC 58.902 41.667 4.94 0.00 0.00 4.01
553 554 5.012239 TCTGTCCAAAGATTATTGCAAGCT 58.988 37.500 4.94 0.00 0.00 3.74
554 555 5.477984 TCTGTCCAAAGATTATTGCAAGCTT 59.522 36.000 4.94 0.00 0.00 3.74
555 556 5.713025 TGTCCAAAGATTATTGCAAGCTTC 58.287 37.500 4.94 1.17 0.00 3.86
556 557 5.243507 TGTCCAAAGATTATTGCAAGCTTCA 59.756 36.000 4.94 0.00 0.00 3.02
557 558 5.803967 GTCCAAAGATTATTGCAAGCTTCAG 59.196 40.000 4.94 3.24 0.00 3.02
558 559 5.477984 TCCAAAGATTATTGCAAGCTTCAGT 59.522 36.000 4.94 0.00 0.00 3.41
559 560 6.015180 TCCAAAGATTATTGCAAGCTTCAGTT 60.015 34.615 4.94 0.00 0.00 3.16
560 561 6.647895 CCAAAGATTATTGCAAGCTTCAGTTT 59.352 34.615 4.94 0.00 0.00 2.66
561 562 7.359765 CCAAAGATTATTGCAAGCTTCAGTTTG 60.360 37.037 4.94 8.52 38.94 2.93
562 563 6.336842 AGATTATTGCAAGCTTCAGTTTGT 57.663 33.333 4.94 0.00 38.32 2.83
563 564 7.452880 AGATTATTGCAAGCTTCAGTTTGTA 57.547 32.000 4.94 0.00 38.32 2.41
564 565 7.533426 AGATTATTGCAAGCTTCAGTTTGTAG 58.467 34.615 4.94 0.00 38.32 2.74
565 566 3.988379 TTGCAAGCTTCAGTTTGTAGG 57.012 42.857 0.00 0.00 38.32 3.18
566 567 3.207265 TGCAAGCTTCAGTTTGTAGGA 57.793 42.857 0.00 0.00 38.32 2.94
567 568 3.754965 TGCAAGCTTCAGTTTGTAGGAT 58.245 40.909 0.00 0.00 38.32 3.24
568 569 3.503363 TGCAAGCTTCAGTTTGTAGGATG 59.497 43.478 0.00 0.00 38.32 3.51
569 570 3.503748 GCAAGCTTCAGTTTGTAGGATGT 59.496 43.478 0.00 0.00 38.32 3.06
570 571 4.022849 GCAAGCTTCAGTTTGTAGGATGTT 60.023 41.667 0.00 0.00 38.32 2.71
571 572 5.507985 GCAAGCTTCAGTTTGTAGGATGTTT 60.508 40.000 0.00 0.00 38.32 2.83
572 573 5.695851 AGCTTCAGTTTGTAGGATGTTTG 57.304 39.130 0.00 0.00 0.00 2.93
573 574 5.376625 AGCTTCAGTTTGTAGGATGTTTGA 58.623 37.500 0.00 0.00 0.00 2.69
574 575 5.239525 AGCTTCAGTTTGTAGGATGTTTGAC 59.760 40.000 0.00 0.00 0.00 3.18
575 576 5.239525 GCTTCAGTTTGTAGGATGTTTGACT 59.760 40.000 0.00 0.00 0.00 3.41
576 577 6.238759 GCTTCAGTTTGTAGGATGTTTGACTT 60.239 38.462 0.00 0.00 0.00 3.01
577 578 6.618287 TCAGTTTGTAGGATGTTTGACTTG 57.382 37.500 0.00 0.00 0.00 3.16
578 579 6.353323 TCAGTTTGTAGGATGTTTGACTTGA 58.647 36.000 0.00 0.00 0.00 3.02
579 580 6.826231 TCAGTTTGTAGGATGTTTGACTTGAA 59.174 34.615 0.00 0.00 0.00 2.69
580 581 6.912591 CAGTTTGTAGGATGTTTGACTTGAAC 59.087 38.462 0.00 0.00 0.00 3.18
581 582 5.666969 TTGTAGGATGTTTGACTTGAACG 57.333 39.130 0.00 0.00 0.00 3.95
582 583 4.951254 TGTAGGATGTTTGACTTGAACGA 58.049 39.130 0.00 0.00 0.00 3.85
583 584 5.361427 TGTAGGATGTTTGACTTGAACGAA 58.639 37.500 0.00 0.00 0.00 3.85
584 585 5.465390 TGTAGGATGTTTGACTTGAACGAAG 59.535 40.000 0.00 0.00 37.73 3.79
585 586 3.251004 AGGATGTTTGACTTGAACGAAGC 59.749 43.478 0.00 0.00 34.68 3.86
586 587 3.555518 GATGTTTGACTTGAACGAAGCC 58.444 45.455 0.00 0.00 34.68 4.35
587 588 1.329292 TGTTTGACTTGAACGAAGCCG 59.671 47.619 0.00 0.00 42.50 5.52
588 589 1.595794 GTTTGACTTGAACGAAGCCGA 59.404 47.619 0.00 0.00 39.50 5.54
589 590 1.497991 TTGACTTGAACGAAGCCGAG 58.502 50.000 0.00 0.00 39.50 4.63
590 591 0.387929 TGACTTGAACGAAGCCGAGT 59.612 50.000 0.00 0.00 39.50 4.18
591 592 1.061485 GACTTGAACGAAGCCGAGTC 58.939 55.000 0.00 0.00 37.60 3.36
592 593 0.387929 ACTTGAACGAAGCCGAGTCA 59.612 50.000 0.00 0.00 39.50 3.41
593 594 1.000955 ACTTGAACGAAGCCGAGTCAT 59.999 47.619 0.00 0.00 39.50 3.06
594 595 1.391485 CTTGAACGAAGCCGAGTCATG 59.609 52.381 0.00 0.00 39.50 3.07
595 596 0.389817 TGAACGAAGCCGAGTCATGG 60.390 55.000 0.00 0.00 39.50 3.66
596 597 1.079127 AACGAAGCCGAGTCATGGG 60.079 57.895 0.00 0.00 39.50 4.00
597 598 1.827399 AACGAAGCCGAGTCATGGGT 61.827 55.000 0.00 0.00 39.32 4.51
598 599 0.968901 ACGAAGCCGAGTCATGGGTA 60.969 55.000 0.00 0.00 35.85 3.69
599 600 0.527817 CGAAGCCGAGTCATGGGTAC 60.528 60.000 0.00 0.00 35.85 3.34
600 601 0.824759 GAAGCCGAGTCATGGGTACT 59.175 55.000 0.00 0.00 35.85 2.73
601 602 0.537188 AAGCCGAGTCATGGGTACTG 59.463 55.000 0.00 0.00 35.85 2.74
602 603 0.614979 AGCCGAGTCATGGGTACTGT 60.615 55.000 0.00 0.00 34.93 3.55
603 604 0.249398 GCCGAGTCATGGGTACTGTT 59.751 55.000 0.00 0.00 0.00 3.16
604 605 1.338769 GCCGAGTCATGGGTACTGTTT 60.339 52.381 0.00 0.00 0.00 2.83
605 606 2.618053 CCGAGTCATGGGTACTGTTTC 58.382 52.381 0.00 0.00 0.00 2.78
606 607 2.618053 CGAGTCATGGGTACTGTTTCC 58.382 52.381 0.00 0.00 0.00 3.13
607 608 2.233922 CGAGTCATGGGTACTGTTTCCT 59.766 50.000 0.00 0.00 0.00 3.36
608 609 3.600388 GAGTCATGGGTACTGTTTCCTG 58.400 50.000 0.00 0.00 0.00 3.86
609 610 3.248024 AGTCATGGGTACTGTTTCCTGA 58.752 45.455 0.00 0.00 0.00 3.86
610 611 3.650942 AGTCATGGGTACTGTTTCCTGAA 59.349 43.478 0.00 0.00 0.00 3.02
611 612 4.104102 AGTCATGGGTACTGTTTCCTGAAA 59.896 41.667 0.00 0.00 0.00 2.69
612 613 4.455877 GTCATGGGTACTGTTTCCTGAAAG 59.544 45.833 0.00 0.00 0.00 2.62
613 614 4.104102 TCATGGGTACTGTTTCCTGAAAGT 59.896 41.667 0.00 0.00 0.00 2.66
614 615 5.308497 TCATGGGTACTGTTTCCTGAAAGTA 59.692 40.000 0.00 0.00 0.00 2.24
615 616 5.223449 TGGGTACTGTTTCCTGAAAGTAG 57.777 43.478 0.00 0.00 0.00 2.57
616 617 4.001652 GGGTACTGTTTCCTGAAAGTAGC 58.998 47.826 10.39 10.39 32.96 3.58
617 618 4.262938 GGGTACTGTTTCCTGAAAGTAGCT 60.263 45.833 15.23 0.00 33.62 3.32
618 619 4.691216 GGTACTGTTTCCTGAAAGTAGCTG 59.309 45.833 0.00 1.01 31.98 4.24
619 620 4.423625 ACTGTTTCCTGAAAGTAGCTGT 57.576 40.909 0.00 0.00 0.00 4.40
620 621 4.781934 ACTGTTTCCTGAAAGTAGCTGTT 58.218 39.130 0.00 0.00 0.00 3.16
621 622 4.576463 ACTGTTTCCTGAAAGTAGCTGTTG 59.424 41.667 0.00 0.00 0.00 3.33
622 623 4.776349 TGTTTCCTGAAAGTAGCTGTTGA 58.224 39.130 0.00 0.00 0.00 3.18
623 624 4.574828 TGTTTCCTGAAAGTAGCTGTTGAC 59.425 41.667 0.00 0.00 0.00 3.18
624 625 4.415881 TTCCTGAAAGTAGCTGTTGACA 57.584 40.909 0.00 0.00 0.00 3.58
625 626 3.995199 TCCTGAAAGTAGCTGTTGACAG 58.005 45.455 6.77 6.77 46.40 3.51
626 627 3.070018 CCTGAAAGTAGCTGTTGACAGG 58.930 50.000 12.65 13.60 43.94 4.00
627 628 3.244215 CCTGAAAGTAGCTGTTGACAGGA 60.244 47.826 19.24 0.00 44.08 3.86
628 629 4.564406 CCTGAAAGTAGCTGTTGACAGGAT 60.564 45.833 19.24 0.00 44.08 3.24
629 630 5.337571 CCTGAAAGTAGCTGTTGACAGGATA 60.338 44.000 19.24 0.00 44.08 2.59
630 631 6.299805 TGAAAGTAGCTGTTGACAGGATAT 57.700 37.500 12.65 0.00 43.94 1.63
631 632 6.711277 TGAAAGTAGCTGTTGACAGGATATT 58.289 36.000 12.65 0.00 43.94 1.28
632 633 7.168219 TGAAAGTAGCTGTTGACAGGATATTT 58.832 34.615 12.65 0.00 43.94 1.40
633 634 7.665559 TGAAAGTAGCTGTTGACAGGATATTTT 59.334 33.333 12.65 6.28 43.94 1.82
634 635 8.409358 AAAGTAGCTGTTGACAGGATATTTTT 57.591 30.769 12.65 1.63 43.94 1.94
635 636 7.383102 AGTAGCTGTTGACAGGATATTTTTG 57.617 36.000 12.65 0.00 43.94 2.44
636 637 7.168219 AGTAGCTGTTGACAGGATATTTTTGA 58.832 34.615 12.65 0.00 43.94 2.69
637 638 6.259550 AGCTGTTGACAGGATATTTTTGAC 57.740 37.500 12.65 0.00 43.94 3.18
638 639 6.006449 AGCTGTTGACAGGATATTTTTGACT 58.994 36.000 12.65 0.00 43.94 3.41
639 640 6.491403 AGCTGTTGACAGGATATTTTTGACTT 59.509 34.615 12.65 0.00 43.94 3.01
640 641 6.803807 GCTGTTGACAGGATATTTTTGACTTC 59.196 38.462 12.65 0.00 43.94 3.01
641 642 7.522073 GCTGTTGACAGGATATTTTTGACTTCA 60.522 37.037 12.65 0.00 43.94 3.02
642 643 7.648142 TGTTGACAGGATATTTTTGACTTCAC 58.352 34.615 0.00 0.00 0.00 3.18
643 644 7.284261 TGTTGACAGGATATTTTTGACTTCACA 59.716 33.333 0.00 0.00 0.00 3.58
644 645 7.202016 TGACAGGATATTTTTGACTTCACAC 57.798 36.000 0.00 0.00 0.00 3.82
645 646 6.998074 TGACAGGATATTTTTGACTTCACACT 59.002 34.615 0.00 0.00 0.00 3.55
646 647 7.041167 TGACAGGATATTTTTGACTTCACACTG 60.041 37.037 0.00 0.00 0.00 3.66
647 648 6.207417 ACAGGATATTTTTGACTTCACACTGG 59.793 38.462 0.00 0.00 0.00 4.00
648 649 5.183904 AGGATATTTTTGACTTCACACTGGC 59.816 40.000 0.00 0.00 0.00 4.85
649 650 3.733443 ATTTTTGACTTCACACTGGCC 57.267 42.857 0.00 0.00 0.00 5.36
650 651 1.021202 TTTTGACTTCACACTGGCCG 58.979 50.000 0.00 0.00 0.00 6.13
651 652 0.107410 TTTGACTTCACACTGGCCGT 60.107 50.000 0.00 0.00 0.00 5.68
659 660 3.030652 CACTGGCCGTGTGTTTCC 58.969 61.111 17.46 0.00 38.84 3.13
660 661 1.821759 CACTGGCCGTGTGTTTCCA 60.822 57.895 17.46 0.00 38.84 3.53
661 662 1.150536 ACTGGCCGTGTGTTTCCAT 59.849 52.632 0.00 0.00 0.00 3.41
662 663 1.172180 ACTGGCCGTGTGTTTCCATG 61.172 55.000 0.00 0.00 0.00 3.66
663 664 1.152860 TGGCCGTGTGTTTCCATGT 60.153 52.632 0.00 0.00 0.00 3.21
664 665 1.285641 GGCCGTGTGTTTCCATGTG 59.714 57.895 0.00 0.00 0.00 3.21
665 666 1.452145 GGCCGTGTGTTTCCATGTGT 61.452 55.000 0.00 0.00 0.00 3.72
666 667 0.317770 GCCGTGTGTTTCCATGTGTG 60.318 55.000 0.00 0.00 0.00 3.82
667 668 1.304254 CCGTGTGTTTCCATGTGTGA 58.696 50.000 0.00 0.00 0.00 3.58
668 669 1.002900 CCGTGTGTTTCCATGTGTGAC 60.003 52.381 0.00 0.00 0.00 3.67
669 670 1.939934 CGTGTGTTTCCATGTGTGACT 59.060 47.619 0.00 0.00 0.00 3.41
670 671 2.286359 CGTGTGTTTCCATGTGTGACTG 60.286 50.000 0.00 0.00 0.00 3.51
671 672 2.682856 GTGTGTTTCCATGTGTGACTGT 59.317 45.455 0.00 0.00 0.00 3.55
672 673 2.942376 TGTGTTTCCATGTGTGACTGTC 59.058 45.455 0.00 0.00 0.00 3.51
673 674 2.032894 GTGTTTCCATGTGTGACTGTCG 60.033 50.000 2.98 0.00 0.00 4.35
674 675 2.210116 GTTTCCATGTGTGACTGTCGT 58.790 47.619 2.98 0.00 0.00 4.34
675 676 2.612212 GTTTCCATGTGTGACTGTCGTT 59.388 45.455 2.98 0.00 0.00 3.85
676 677 1.864565 TCCATGTGTGACTGTCGTTG 58.135 50.000 2.98 0.00 0.00 4.10
677 678 1.410882 TCCATGTGTGACTGTCGTTGA 59.589 47.619 2.98 0.00 0.00 3.18
678 679 2.037121 TCCATGTGTGACTGTCGTTGAT 59.963 45.455 2.98 0.00 0.00 2.57
679 680 3.257127 TCCATGTGTGACTGTCGTTGATA 59.743 43.478 2.98 0.00 0.00 2.15
680 681 3.367932 CCATGTGTGACTGTCGTTGATAC 59.632 47.826 2.98 0.00 0.00 2.24
681 682 3.719173 TGTGTGACTGTCGTTGATACA 57.281 42.857 2.98 0.00 0.00 2.29
682 683 3.377439 TGTGTGACTGTCGTTGATACAC 58.623 45.455 15.75 15.75 37.89 2.90
683 684 3.181485 TGTGTGACTGTCGTTGATACACA 60.181 43.478 19.37 19.37 42.98 3.72
684 685 3.799963 GTGTGACTGTCGTTGATACACAA 59.200 43.478 17.02 0.00 38.24 3.33
693 694 2.552599 TTGATACACAACCGGCTGAA 57.447 45.000 12.82 0.00 33.18 3.02
694 695 2.552599 TGATACACAACCGGCTGAAA 57.447 45.000 12.82 0.00 0.00 2.69
695 696 3.066291 TGATACACAACCGGCTGAAAT 57.934 42.857 12.82 1.48 0.00 2.17
696 697 2.746904 TGATACACAACCGGCTGAAATG 59.253 45.455 12.82 1.85 0.00 2.32
697 698 2.552599 TACACAACCGGCTGAAATGA 57.447 45.000 12.82 0.00 0.00 2.57
698 699 0.951558 ACACAACCGGCTGAAATGAC 59.048 50.000 12.82 0.00 0.00 3.06
699 700 1.238439 CACAACCGGCTGAAATGACT 58.762 50.000 12.82 0.00 0.00 3.41
700 701 2.224426 ACACAACCGGCTGAAATGACTA 60.224 45.455 12.82 0.00 0.00 2.59
701 702 2.416547 CACAACCGGCTGAAATGACTAG 59.583 50.000 12.82 0.00 0.00 2.57
702 703 2.038557 ACAACCGGCTGAAATGACTAGT 59.961 45.455 12.82 0.00 0.00 2.57
703 704 2.673368 CAACCGGCTGAAATGACTAGTC 59.327 50.000 16.32 16.32 0.00 2.59
704 705 1.899814 ACCGGCTGAAATGACTAGTCA 59.100 47.619 27.07 27.07 44.59 3.41
705 706 2.271800 CCGGCTGAAATGACTAGTCAC 58.728 52.381 27.41 15.46 43.11 3.67
706 707 2.271800 CGGCTGAAATGACTAGTCACC 58.728 52.381 27.41 20.25 43.11 4.02
707 708 2.271800 GGCTGAAATGACTAGTCACCG 58.728 52.381 27.41 12.49 43.11 4.94
708 709 2.271800 GCTGAAATGACTAGTCACCGG 58.728 52.381 27.41 22.17 43.11 5.28
709 710 2.353803 GCTGAAATGACTAGTCACCGGT 60.354 50.000 27.41 12.75 43.11 5.28
710 711 3.254060 CTGAAATGACTAGTCACCGGTG 58.746 50.000 29.26 29.26 43.11 4.94
711 712 2.631062 TGAAATGACTAGTCACCGGTGT 59.369 45.455 32.74 18.32 43.11 4.16
712 713 3.251571 GAAATGACTAGTCACCGGTGTC 58.748 50.000 32.74 27.41 43.11 3.67
713 714 1.183549 ATGACTAGTCACCGGTGTCC 58.816 55.000 32.74 23.62 43.11 4.02
714 715 0.111832 TGACTAGTCACCGGTGTCCT 59.888 55.000 32.74 28.40 34.14 3.85
715 716 0.526662 GACTAGTCACCGGTGTCCTG 59.473 60.000 32.74 23.03 0.00 3.86
716 717 0.111832 ACTAGTCACCGGTGTCCTGA 59.888 55.000 32.74 11.90 0.00 3.86
717 718 1.254026 CTAGTCACCGGTGTCCTGAA 58.746 55.000 32.74 11.09 0.00 3.02
718 719 1.616865 CTAGTCACCGGTGTCCTGAAA 59.383 52.381 32.74 10.28 0.00 2.69
719 720 0.393077 AGTCACCGGTGTCCTGAAAG 59.607 55.000 32.74 5.39 0.00 2.62
720 721 0.106149 GTCACCGGTGTCCTGAAAGT 59.894 55.000 32.74 0.00 0.00 2.66
721 722 0.391597 TCACCGGTGTCCTGAAAGTC 59.608 55.000 32.74 0.00 0.00 3.01
722 723 0.602905 CACCGGTGTCCTGAAAGTCC 60.603 60.000 26.95 0.00 0.00 3.85
723 724 1.052124 ACCGGTGTCCTGAAAGTCCA 61.052 55.000 6.12 0.00 0.00 4.02
724 725 0.602905 CCGGTGTCCTGAAAGTCCAC 60.603 60.000 0.00 0.00 33.42 4.02
725 726 0.105964 CGGTGTCCTGAAAGTCCACA 59.894 55.000 0.00 0.00 35.19 4.17
726 727 1.270839 CGGTGTCCTGAAAGTCCACAT 60.271 52.381 0.00 0.00 35.19 3.21
727 728 2.028476 CGGTGTCCTGAAAGTCCACATA 60.028 50.000 0.00 0.00 35.19 2.29
728 729 3.600388 GGTGTCCTGAAAGTCCACATAG 58.400 50.000 0.00 0.00 35.19 2.23
729 730 3.260884 GGTGTCCTGAAAGTCCACATAGA 59.739 47.826 0.00 0.00 35.19 1.98
730 731 4.499183 GTGTCCTGAAAGTCCACATAGAG 58.501 47.826 0.00 0.00 34.10 2.43
731 732 3.055819 TGTCCTGAAAGTCCACATAGAGC 60.056 47.826 0.00 0.00 0.00 4.09
732 733 2.501723 TCCTGAAAGTCCACATAGAGCC 59.498 50.000 0.00 0.00 0.00 4.70
733 734 2.503356 CCTGAAAGTCCACATAGAGCCT 59.497 50.000 0.00 0.00 0.00 4.58
734 735 3.054802 CCTGAAAGTCCACATAGAGCCTT 60.055 47.826 0.00 0.00 0.00 4.35
735 736 3.937706 CTGAAAGTCCACATAGAGCCTTG 59.062 47.826 0.00 0.00 0.00 3.61
736 737 3.582647 TGAAAGTCCACATAGAGCCTTGA 59.417 43.478 0.00 0.00 0.00 3.02
737 738 4.041567 TGAAAGTCCACATAGAGCCTTGAA 59.958 41.667 0.00 0.00 0.00 2.69
738 739 4.851639 AAGTCCACATAGAGCCTTGAAT 57.148 40.909 0.00 0.00 0.00 2.57
739 740 4.414337 AGTCCACATAGAGCCTTGAATC 57.586 45.455 0.00 0.00 0.00 2.52
740 741 3.135530 AGTCCACATAGAGCCTTGAATCC 59.864 47.826 0.00 0.00 0.00 3.01
741 742 3.114606 TCCACATAGAGCCTTGAATCCA 58.885 45.455 0.00 0.00 0.00 3.41
742 743 3.718434 TCCACATAGAGCCTTGAATCCAT 59.282 43.478 0.00 0.00 0.00 3.41
743 744 4.070716 CCACATAGAGCCTTGAATCCATC 58.929 47.826 0.00 0.00 0.00 3.51
744 745 4.445305 CCACATAGAGCCTTGAATCCATCA 60.445 45.833 0.00 0.00 35.85 3.07
745 746 4.755629 CACATAGAGCCTTGAATCCATCAG 59.244 45.833 0.00 0.00 39.77 2.90
746 747 2.345124 AGAGCCTTGAATCCATCAGC 57.655 50.000 0.00 0.00 39.77 4.26
747 748 1.562942 AGAGCCTTGAATCCATCAGCA 59.437 47.619 0.00 0.00 39.77 4.41
748 749 2.025605 AGAGCCTTGAATCCATCAGCAA 60.026 45.455 0.00 0.00 39.77 3.91
749 750 2.756760 GAGCCTTGAATCCATCAGCAAA 59.243 45.455 0.00 0.00 39.77 3.68
750 751 3.167485 AGCCTTGAATCCATCAGCAAAA 58.833 40.909 0.00 0.00 39.77 2.44
751 752 3.579586 AGCCTTGAATCCATCAGCAAAAA 59.420 39.130 0.00 0.00 39.77 1.94
770 771 5.809719 AAAAATTGTTCAAACATTGCGGT 57.190 30.435 0.00 0.00 38.95 5.68
771 772 5.402464 AAAATTGTTCAAACATTGCGGTC 57.598 34.783 0.00 0.00 38.95 4.79
772 773 4.320608 AATTGTTCAAACATTGCGGTCT 57.679 36.364 0.00 0.00 38.95 3.85
773 774 3.791973 TTGTTCAAACATTGCGGTCTT 57.208 38.095 0.00 0.00 38.95 3.01
774 775 3.347958 TGTTCAAACATTGCGGTCTTC 57.652 42.857 0.00 0.00 33.17 2.87
775 776 2.685388 TGTTCAAACATTGCGGTCTTCA 59.315 40.909 0.00 0.00 33.17 3.02
776 777 3.243035 TGTTCAAACATTGCGGTCTTCAG 60.243 43.478 0.00 0.00 33.17 3.02
777 778 2.844946 TCAAACATTGCGGTCTTCAGA 58.155 42.857 0.00 0.00 0.00 3.27
778 779 3.210227 TCAAACATTGCGGTCTTCAGAA 58.790 40.909 0.00 0.00 0.00 3.02
779 780 3.003275 TCAAACATTGCGGTCTTCAGAAC 59.997 43.478 0.00 0.00 0.00 3.01
780 781 2.550830 ACATTGCGGTCTTCAGAACT 57.449 45.000 0.00 0.00 0.00 3.01
781 782 2.146342 ACATTGCGGTCTTCAGAACTG 58.854 47.619 0.00 0.00 0.00 3.16
782 783 1.135859 CATTGCGGTCTTCAGAACTGC 60.136 52.381 0.00 0.00 33.91 4.40
783 784 0.884704 TTGCGGTCTTCAGAACTGCC 60.885 55.000 3.96 0.00 32.91 4.85
784 785 1.301716 GCGGTCTTCAGAACTGCCA 60.302 57.895 0.00 0.00 0.00 4.92
785 786 0.884704 GCGGTCTTCAGAACTGCCAA 60.885 55.000 0.00 0.00 0.00 4.52
786 787 1.593196 CGGTCTTCAGAACTGCCAAA 58.407 50.000 0.00 0.00 0.00 3.28
787 788 1.946768 CGGTCTTCAGAACTGCCAAAA 59.053 47.619 0.00 0.00 0.00 2.44
788 789 2.554032 CGGTCTTCAGAACTGCCAAAAT 59.446 45.455 0.00 0.00 0.00 1.82
789 790 3.610114 CGGTCTTCAGAACTGCCAAAATG 60.610 47.826 0.00 0.00 0.00 2.32
790 791 3.311966 GTCTTCAGAACTGCCAAAATGC 58.688 45.455 0.00 0.00 0.00 3.56
791 792 2.957680 TCTTCAGAACTGCCAAAATGCA 59.042 40.909 0.00 0.00 39.37 3.96
792 793 2.798976 TCAGAACTGCCAAAATGCAC 57.201 45.000 0.00 0.00 36.04 4.57
793 794 2.309613 TCAGAACTGCCAAAATGCACT 58.690 42.857 0.00 0.00 36.04 4.40
794 795 2.694628 TCAGAACTGCCAAAATGCACTT 59.305 40.909 0.00 0.00 36.04 3.16
795 796 3.888323 TCAGAACTGCCAAAATGCACTTA 59.112 39.130 0.00 0.00 36.04 2.24
796 797 4.022935 TCAGAACTGCCAAAATGCACTTAG 60.023 41.667 0.00 0.00 36.04 2.18
797 798 3.891366 AGAACTGCCAAAATGCACTTAGT 59.109 39.130 0.00 0.00 36.04 2.24
798 799 4.342092 AGAACTGCCAAAATGCACTTAGTT 59.658 37.500 0.00 0.00 36.04 2.24
799 800 5.534654 AGAACTGCCAAAATGCACTTAGTTA 59.465 36.000 0.00 0.00 36.04 2.24
800 801 5.121221 ACTGCCAAAATGCACTTAGTTAC 57.879 39.130 0.00 0.00 36.04 2.50
801 802 4.022329 ACTGCCAAAATGCACTTAGTTACC 60.022 41.667 0.00 0.00 36.04 2.85
802 803 3.891977 TGCCAAAATGCACTTAGTTACCA 59.108 39.130 0.00 0.00 36.04 3.25
803 804 4.342378 TGCCAAAATGCACTTAGTTACCAA 59.658 37.500 0.00 0.00 36.04 3.67
804 805 4.923281 GCCAAAATGCACTTAGTTACCAAG 59.077 41.667 0.00 0.00 0.00 3.61
805 806 5.278758 GCCAAAATGCACTTAGTTACCAAGA 60.279 40.000 0.00 0.00 0.00 3.02
806 807 6.149633 CCAAAATGCACTTAGTTACCAAGAC 58.850 40.000 0.00 0.00 0.00 3.01
807 808 5.607119 AAATGCACTTAGTTACCAAGACG 57.393 39.130 0.00 0.00 0.00 4.18
808 809 3.738830 TGCACTTAGTTACCAAGACGT 57.261 42.857 0.00 0.00 0.00 4.34
809 810 4.062677 TGCACTTAGTTACCAAGACGTT 57.937 40.909 0.00 0.00 0.00 3.99
810 811 5.199024 TGCACTTAGTTACCAAGACGTTA 57.801 39.130 0.00 0.00 0.00 3.18
811 812 5.599732 TGCACTTAGTTACCAAGACGTTAA 58.400 37.500 0.00 0.00 0.00 2.01
812 813 5.693104 TGCACTTAGTTACCAAGACGTTAAG 59.307 40.000 0.00 0.00 0.00 1.85
813 814 5.693555 GCACTTAGTTACCAAGACGTTAAGT 59.306 40.000 0.00 0.00 31.96 2.24
823 824 1.210870 GACGTTAAGTCGTTGTGGCA 58.789 50.000 0.00 0.00 44.21 4.92
824 825 1.796459 GACGTTAAGTCGTTGTGGCAT 59.204 47.619 0.00 0.00 44.21 4.40
825 826 2.215196 ACGTTAAGTCGTTGTGGCATT 58.785 42.857 0.00 0.00 41.37 3.56
826 827 3.391965 ACGTTAAGTCGTTGTGGCATTA 58.608 40.909 0.00 0.00 41.37 1.90
827 828 3.808726 ACGTTAAGTCGTTGTGGCATTAA 59.191 39.130 0.00 0.00 41.37 1.40
828 829 4.453136 ACGTTAAGTCGTTGTGGCATTAAT 59.547 37.500 0.00 0.00 41.37 1.40
829 830 4.786068 CGTTAAGTCGTTGTGGCATTAATG 59.214 41.667 11.27 11.27 0.00 1.90
830 831 5.615984 CGTTAAGTCGTTGTGGCATTAATGT 60.616 40.000 16.61 0.00 0.00 2.71
831 832 6.401260 CGTTAAGTCGTTGTGGCATTAATGTA 60.401 38.462 16.61 4.10 0.00 2.29
832 833 4.939509 AGTCGTTGTGGCATTAATGTAC 57.060 40.909 16.61 15.29 0.00 2.90
833 834 4.575885 AGTCGTTGTGGCATTAATGTACT 58.424 39.130 16.61 5.51 0.00 2.73
834 835 5.726397 AGTCGTTGTGGCATTAATGTACTA 58.274 37.500 16.61 10.22 0.00 1.82
835 836 5.579511 AGTCGTTGTGGCATTAATGTACTAC 59.420 40.000 16.61 18.27 0.00 2.73
836 837 5.579511 GTCGTTGTGGCATTAATGTACTACT 59.420 40.000 22.81 0.00 0.00 2.57
837 838 6.753279 GTCGTTGTGGCATTAATGTACTACTA 59.247 38.462 22.81 16.08 0.00 1.82
838 839 6.753279 TCGTTGTGGCATTAATGTACTACTAC 59.247 38.462 22.81 17.42 0.00 2.73
839 840 6.291427 CGTTGTGGCATTAATGTACTACTACG 60.291 42.308 20.86 20.86 0.00 3.51
840 841 6.453926 TGTGGCATTAATGTACTACTACGA 57.546 37.500 16.61 0.00 0.00 3.43
841 842 6.267817 TGTGGCATTAATGTACTACTACGAC 58.732 40.000 16.61 5.68 0.00 4.34
842 843 6.095860 TGTGGCATTAATGTACTACTACGACT 59.904 38.462 16.61 0.00 0.00 4.18
843 844 6.976925 GTGGCATTAATGTACTACTACGACTT 59.023 38.462 16.61 0.00 0.00 3.01
844 845 7.490402 GTGGCATTAATGTACTACTACGACTTT 59.510 37.037 16.61 0.00 0.00 2.66
845 846 7.703621 TGGCATTAATGTACTACTACGACTTTC 59.296 37.037 16.61 0.00 0.00 2.62
846 847 7.096722 GGCATTAATGTACTACTACGACTTTCG 60.097 40.741 16.61 0.00 46.93 3.46
847 848 7.096722 GCATTAATGTACTACTACGACTTTCGG 60.097 40.741 16.61 0.00 45.59 4.30
848 849 3.747099 TGTACTACTACGACTTTCGGC 57.253 47.619 0.03 0.00 45.59 5.54
849 850 3.073678 TGTACTACTACGACTTTCGGCA 58.926 45.455 0.03 0.00 45.59 5.69
850 851 3.691118 TGTACTACTACGACTTTCGGCAT 59.309 43.478 0.03 0.00 45.59 4.40
851 852 3.417690 ACTACTACGACTTTCGGCATC 57.582 47.619 0.03 0.00 45.59 3.91
852 853 2.751259 ACTACTACGACTTTCGGCATCA 59.249 45.455 0.03 0.00 45.59 3.07
853 854 2.961526 ACTACGACTTTCGGCATCAT 57.038 45.000 0.03 0.00 45.59 2.45
854 855 4.577693 ACTACTACGACTTTCGGCATCATA 59.422 41.667 0.03 0.00 45.59 2.15
855 856 4.380841 ACTACGACTTTCGGCATCATAA 57.619 40.909 0.03 0.00 45.59 1.90
856 857 4.751060 ACTACGACTTTCGGCATCATAAA 58.249 39.130 0.03 0.00 45.59 1.40
857 858 5.172934 ACTACGACTTTCGGCATCATAAAA 58.827 37.500 0.03 0.00 45.59 1.52
858 859 5.640357 ACTACGACTTTCGGCATCATAAAAA 59.360 36.000 0.03 0.00 45.59 1.94
859 860 4.719040 ACGACTTTCGGCATCATAAAAAC 58.281 39.130 0.03 0.00 45.59 2.43
860 861 4.095610 CGACTTTCGGCATCATAAAAACC 58.904 43.478 0.00 0.00 36.00 3.27
861 862 4.378978 CGACTTTCGGCATCATAAAAACCA 60.379 41.667 0.00 0.00 36.00 3.67
862 863 5.650543 GACTTTCGGCATCATAAAAACCAT 58.349 37.500 0.00 0.00 0.00 3.55
863 864 5.410067 ACTTTCGGCATCATAAAAACCATG 58.590 37.500 0.00 0.00 0.00 3.66
864 865 5.047377 ACTTTCGGCATCATAAAAACCATGT 60.047 36.000 0.00 0.00 0.00 3.21
865 866 6.151985 ACTTTCGGCATCATAAAAACCATGTA 59.848 34.615 0.00 0.00 0.00 2.29
866 867 6.516739 TTCGGCATCATAAAAACCATGTAA 57.483 33.333 0.00 0.00 0.00 2.41
867 868 5.885881 TCGGCATCATAAAAACCATGTAAC 58.114 37.500 0.00 0.00 0.00 2.50
868 869 5.650266 TCGGCATCATAAAAACCATGTAACT 59.350 36.000 0.00 0.00 0.00 2.24
869 870 6.151985 TCGGCATCATAAAAACCATGTAACTT 59.848 34.615 0.00 0.00 0.00 2.66
870 871 7.337184 TCGGCATCATAAAAACCATGTAACTTA 59.663 33.333 0.00 0.00 0.00 2.24
871 872 8.134895 CGGCATCATAAAAACCATGTAACTTAT 58.865 33.333 0.00 0.00 0.00 1.73
872 873 9.463443 GGCATCATAAAAACCATGTAACTTATC 57.537 33.333 0.00 0.00 0.00 1.75
917 918 7.921041 ATATATATGTGTAGCTAGGCATGGT 57.079 36.000 16.13 9.65 0.00 3.55
918 919 4.982241 ATATGTGTAGCTAGGCATGGTT 57.018 40.909 16.13 3.38 0.00 3.67
919 920 2.691409 TGTGTAGCTAGGCATGGTTC 57.309 50.000 0.00 0.00 0.00 3.62
920 921 1.209504 TGTGTAGCTAGGCATGGTTCC 59.790 52.381 0.00 0.00 0.00 3.62
921 922 0.837272 TGTAGCTAGGCATGGTTCCC 59.163 55.000 0.00 0.00 0.00 3.97
922 923 1.132500 GTAGCTAGGCATGGTTCCCT 58.868 55.000 0.00 0.00 35.22 4.20
923 924 1.490910 GTAGCTAGGCATGGTTCCCTT 59.509 52.381 0.00 0.00 32.65 3.95
924 925 0.548510 AGCTAGGCATGGTTCCCTTC 59.451 55.000 0.00 0.00 32.65 3.46
925 926 0.548510 GCTAGGCATGGTTCCCTTCT 59.451 55.000 0.00 0.00 32.65 2.85
926 927 1.768870 GCTAGGCATGGTTCCCTTCTA 59.231 52.381 0.00 0.00 32.65 2.10
927 928 2.373502 GCTAGGCATGGTTCCCTTCTAT 59.626 50.000 0.00 0.00 32.65 1.98
928 929 3.583086 GCTAGGCATGGTTCCCTTCTATA 59.417 47.826 0.00 0.00 32.65 1.31
929 930 4.226168 GCTAGGCATGGTTCCCTTCTATAT 59.774 45.833 0.00 0.00 32.65 0.86
930 931 5.425539 GCTAGGCATGGTTCCCTTCTATATA 59.574 44.000 0.00 0.00 32.65 0.86
931 932 6.100424 GCTAGGCATGGTTCCCTTCTATATAT 59.900 42.308 0.00 0.00 32.65 0.86
932 933 7.290248 GCTAGGCATGGTTCCCTTCTATATATA 59.710 40.741 0.00 0.00 32.65 0.86
933 934 9.386122 CTAGGCATGGTTCCCTTCTATATATAT 57.614 37.037 0.00 0.00 32.65 0.86
934 935 8.038862 AGGCATGGTTCCCTTCTATATATATG 57.961 38.462 5.44 0.00 0.00 1.78
935 936 7.629315 AGGCATGGTTCCCTTCTATATATATGT 59.371 37.037 5.44 0.00 0.00 2.29
936 937 8.934697 GGCATGGTTCCCTTCTATATATATGTA 58.065 37.037 5.44 0.00 0.00 2.29
937 938 9.765795 GCATGGTTCCCTTCTATATATATGTAC 57.234 37.037 5.44 0.00 0.00 2.90
940 941 9.831682 TGGTTCCCTTCTATATATATGTACACA 57.168 33.333 0.00 0.00 0.00 3.72
955 956 5.922739 TGTACACACACTATGCTTTCTTG 57.077 39.130 0.00 0.00 0.00 3.02
956 957 5.364778 TGTACACACACTATGCTTTCTTGT 58.635 37.500 0.00 0.00 0.00 3.16
957 958 6.517605 TGTACACACACTATGCTTTCTTGTA 58.482 36.000 0.00 0.00 0.00 2.41
958 959 6.645003 TGTACACACACTATGCTTTCTTGTAG 59.355 38.462 0.00 0.00 0.00 2.74
959 960 5.611374 ACACACACTATGCTTTCTTGTAGT 58.389 37.500 0.00 0.00 0.00 2.73
960 961 5.466728 ACACACACTATGCTTTCTTGTAGTG 59.533 40.000 9.20 9.20 45.84 2.74
961 962 4.452455 ACACACTATGCTTTCTTGTAGTGC 59.548 41.667 10.36 0.00 44.83 4.40
962 963 4.452114 CACACTATGCTTTCTTGTAGTGCA 59.548 41.667 10.36 0.00 44.83 4.57
963 964 5.049474 CACACTATGCTTTCTTGTAGTGCAA 60.049 40.000 10.36 0.00 44.83 4.08
964 965 5.530915 ACACTATGCTTTCTTGTAGTGCAAA 59.469 36.000 10.36 0.00 44.83 3.68
965 966 6.207417 ACACTATGCTTTCTTGTAGTGCAAAT 59.793 34.615 10.36 0.00 44.83 2.32
966 967 6.525628 CACTATGCTTTCTTGTAGTGCAAATG 59.474 38.462 0.00 0.00 38.06 2.32
967 968 5.710513 ATGCTTTCTTGTAGTGCAAATGA 57.289 34.783 0.00 0.00 36.53 2.57
968 969 5.710513 TGCTTTCTTGTAGTGCAAATGAT 57.289 34.783 0.00 0.00 36.53 2.45
969 970 5.702865 TGCTTTCTTGTAGTGCAAATGATC 58.297 37.500 0.00 0.00 36.53 2.92
970 971 5.241285 TGCTTTCTTGTAGTGCAAATGATCA 59.759 36.000 0.00 0.00 36.53 2.92
971 972 5.570589 GCTTTCTTGTAGTGCAAATGATCAC 59.429 40.000 0.00 0.00 36.53 3.06
972 973 6.631971 TTTCTTGTAGTGCAAATGATCACA 57.368 33.333 0.00 0.00 36.53 3.58
973 974 5.611796 TCTTGTAGTGCAAATGATCACAC 57.388 39.130 0.00 1.29 36.53 3.82
974 975 5.062528 TCTTGTAGTGCAAATGATCACACA 58.937 37.500 14.50 1.67 36.53 3.72
975 976 5.706833 TCTTGTAGTGCAAATGATCACACAT 59.293 36.000 14.50 4.86 36.53 3.21
976 977 6.878389 TCTTGTAGTGCAAATGATCACACATA 59.122 34.615 14.50 4.12 36.53 2.29
977 978 6.667007 TGTAGTGCAAATGATCACACATAG 57.333 37.500 14.50 0.00 35.47 2.23
978 979 4.627611 AGTGCAAATGATCACACATAGC 57.372 40.909 14.50 7.07 35.47 2.97
979 980 3.379372 AGTGCAAATGATCACACATAGCC 59.621 43.478 14.50 2.56 35.47 3.93
980 981 2.689471 TGCAAATGATCACACATAGCCC 59.311 45.455 0.00 0.00 33.56 5.19
981 982 2.689471 GCAAATGATCACACATAGCCCA 59.311 45.455 0.00 0.00 0.00 5.36
982 983 3.130869 GCAAATGATCACACATAGCCCAA 59.869 43.478 0.00 0.00 0.00 4.12
983 984 4.735578 GCAAATGATCACACATAGCCCAAG 60.736 45.833 0.00 0.00 0.00 3.61
984 985 4.508551 AATGATCACACATAGCCCAAGA 57.491 40.909 0.00 0.00 0.00 3.02
985 986 3.266510 TGATCACACATAGCCCAAGAC 57.733 47.619 0.00 0.00 0.00 3.01
986 987 2.092968 TGATCACACATAGCCCAAGACC 60.093 50.000 0.00 0.00 0.00 3.85
987 988 1.357137 TCACACATAGCCCAAGACCA 58.643 50.000 0.00 0.00 0.00 4.02
988 989 1.915489 TCACACATAGCCCAAGACCAT 59.085 47.619 0.00 0.00 0.00 3.55
989 990 3.111484 TCACACATAGCCCAAGACCATA 58.889 45.455 0.00 0.00 0.00 2.74
990 991 3.716353 TCACACATAGCCCAAGACCATAT 59.284 43.478 0.00 0.00 0.00 1.78
991 992 4.904853 TCACACATAGCCCAAGACCATATA 59.095 41.667 0.00 0.00 0.00 0.86
992 993 5.012046 TCACACATAGCCCAAGACCATATAG 59.988 44.000 0.00 0.00 0.00 1.31
993 994 5.012046 CACACATAGCCCAAGACCATATAGA 59.988 44.000 0.00 0.00 0.00 1.98
994 995 5.606749 ACACATAGCCCAAGACCATATAGAA 59.393 40.000 0.00 0.00 0.00 2.10
995 996 6.169094 CACATAGCCCAAGACCATATAGAAG 58.831 44.000 0.00 0.00 0.00 2.85
996 997 3.778954 AGCCCAAGACCATATAGAAGC 57.221 47.619 0.00 0.00 0.00 3.86
997 998 3.048600 AGCCCAAGACCATATAGAAGCA 58.951 45.455 0.00 0.00 0.00 3.91
998 999 3.072184 AGCCCAAGACCATATAGAAGCAG 59.928 47.826 0.00 0.00 0.00 4.24
999 1000 3.071602 GCCCAAGACCATATAGAAGCAGA 59.928 47.826 0.00 0.00 0.00 4.26
1000 1001 4.444876 GCCCAAGACCATATAGAAGCAGAA 60.445 45.833 0.00 0.00 0.00 3.02
1001 1002 5.747248 GCCCAAGACCATATAGAAGCAGAAT 60.747 44.000 0.00 0.00 0.00 2.40
1002 1003 5.704515 CCCAAGACCATATAGAAGCAGAATG 59.295 44.000 0.00 0.00 40.87 2.67
1014 1015 3.280920 CAGAATGCCTCGTCTAGCC 57.719 57.895 0.00 0.00 0.00 3.93
1015 1016 0.461548 CAGAATGCCTCGTCTAGCCA 59.538 55.000 0.00 0.00 0.00 4.75
1016 1017 0.461961 AGAATGCCTCGTCTAGCCAC 59.538 55.000 0.00 0.00 0.00 5.01
1017 1018 0.175760 GAATGCCTCGTCTAGCCACA 59.824 55.000 0.00 0.00 0.00 4.17
1018 1019 0.108138 AATGCCTCGTCTAGCCACAC 60.108 55.000 0.00 0.00 0.00 3.82
1019 1020 0.972983 ATGCCTCGTCTAGCCACACT 60.973 55.000 0.00 0.00 0.00 3.55
1020 1021 1.153745 GCCTCGTCTAGCCACACTG 60.154 63.158 0.00 0.00 0.00 3.66
1021 1022 1.153745 CCTCGTCTAGCCACACTGC 60.154 63.158 0.00 0.00 0.00 4.40
1022 1023 1.599606 CCTCGTCTAGCCACACTGCT 61.600 60.000 0.00 0.00 45.38 4.24
1023 1024 0.244994 CTCGTCTAGCCACACTGCTT 59.755 55.000 0.00 0.00 42.75 3.91
1035 1036 3.129287 CCACACTGCTTCTTGTTTTCACT 59.871 43.478 0.00 0.00 0.00 3.41
1036 1037 4.100529 CACACTGCTTCTTGTTTTCACTG 58.899 43.478 0.00 0.00 0.00 3.66
1037 1038 3.111098 CACTGCTTCTTGTTTTCACTGC 58.889 45.455 0.00 0.00 0.00 4.40
1043 1044 4.789481 GCTTCTTGTTTTCACTGCGATTCA 60.789 41.667 0.00 0.00 0.00 2.57
1050 1051 4.685169 TTTCACTGCGATTCATTTCCTC 57.315 40.909 0.00 0.00 0.00 3.71
1052 1053 3.264947 TCACTGCGATTCATTTCCTCAG 58.735 45.455 0.00 0.00 0.00 3.35
1057 1058 2.424956 GCGATTCATTTCCTCAGCCTTT 59.575 45.455 0.00 0.00 0.00 3.11
1062 1063 2.819608 TCATTTCCTCAGCCTTTTTCCG 59.180 45.455 0.00 0.00 0.00 4.30
1064 1065 1.892209 TTCCTCAGCCTTTTTCCGTC 58.108 50.000 0.00 0.00 0.00 4.79
1071 1072 0.109132 GCCTTTTTCCGTCCATGCAG 60.109 55.000 0.00 0.00 0.00 4.41
1074 1075 1.200020 CTTTTTCCGTCCATGCAGTCC 59.800 52.381 0.00 0.00 0.00 3.85
1075 1076 0.109532 TTTTCCGTCCATGCAGTCCA 59.890 50.000 0.00 0.00 0.00 4.02
1076 1077 0.109532 TTTCCGTCCATGCAGTCCAA 59.890 50.000 0.00 0.00 0.00 3.53
1107 1108 2.430465 GATGCACTTCTCTGCCTCAAA 58.570 47.619 0.00 0.00 36.21 2.69
1110 1111 2.224597 TGCACTTCTCTGCCTCAAATCA 60.225 45.455 0.00 0.00 36.21 2.57
1113 1114 3.817084 CACTTCTCTGCCTCAAATCACAA 59.183 43.478 0.00 0.00 0.00 3.33
1116 1117 4.890158 TCTCTGCCTCAAATCACAACTA 57.110 40.909 0.00 0.00 0.00 2.24
1122 1123 5.748402 TGCCTCAAATCACAACTATCTGAT 58.252 37.500 0.00 0.00 0.00 2.90
1127 1128 6.962182 TCAAATCACAACTATCTGATCCCTT 58.038 36.000 0.00 0.00 0.00 3.95
1129 1130 8.206867 TCAAATCACAACTATCTGATCCCTTAG 58.793 37.037 0.00 0.00 0.00 2.18
1149 1150 4.917906 AGGAACTTTAGCTTCATGGAGT 57.082 40.909 2.16 0.00 27.25 3.85
1153 1154 7.406104 AGGAACTTTAGCTTCATGGAGTAATT 58.594 34.615 2.16 0.00 27.25 1.40
1155 1156 7.201741 GGAACTTTAGCTTCATGGAGTAATTCC 60.202 40.741 2.16 7.59 46.98 3.01
1158 1159 4.065321 AGCTTCATGGAGTAATTCCTCG 57.935 45.455 2.16 0.00 46.92 4.63
1165 1166 1.134560 GGAGTAATTCCTCGCTCACGT 59.865 52.381 0.00 0.00 43.16 4.49
1166 1167 2.416972 GGAGTAATTCCTCGCTCACGTT 60.417 50.000 0.00 0.00 43.16 3.99
1187 1188 3.044059 GCGCTTGGCATGGAGTGAC 62.044 63.158 0.00 0.00 42.87 3.67
1196 1197 0.733150 CATGGAGTGACATGCAGCAG 59.267 55.000 0.00 0.00 41.43 4.24
1197 1198 0.616891 ATGGAGTGACATGCAGCAGA 59.383 50.000 0.00 0.00 0.00 4.26
1199 1200 1.357258 GGAGTGACATGCAGCAGACG 61.357 60.000 0.00 0.00 0.00 4.18
1200 1201 0.389037 GAGTGACATGCAGCAGACGA 60.389 55.000 0.00 0.00 0.00 4.20
1201 1202 0.668706 AGTGACATGCAGCAGACGAC 60.669 55.000 0.00 0.00 0.00 4.34
1206 1207 3.864160 ATGCAGCAGACGACACGCA 62.864 57.895 0.00 0.00 0.00 5.24
1230 1231 5.250982 TCTCGTGTGAGTTCATTAGACCTA 58.749 41.667 0.00 0.00 43.09 3.08
1232 1233 5.250982 TCGTGTGAGTTCATTAGACCTAGA 58.749 41.667 0.00 0.00 0.00 2.43
1233 1234 5.708697 TCGTGTGAGTTCATTAGACCTAGAA 59.291 40.000 0.00 0.00 0.00 2.10
1237 1238 8.200792 GTGTGAGTTCATTAGACCTAGAATCAT 58.799 37.037 0.00 0.00 0.00 2.45
1238 1239 8.417106 TGTGAGTTCATTAGACCTAGAATCATC 58.583 37.037 0.00 0.00 0.00 2.92
1248 1249 5.723887 AGACCTAGAATCATCAAACCTCACT 59.276 40.000 0.00 0.00 0.00 3.41
1260 1261 4.462483 TCAAACCTCACTGGCCAAATATTC 59.538 41.667 7.01 0.00 40.22 1.75
1263 1264 2.091665 CCTCACTGGCCAAATATTCCCT 60.092 50.000 7.01 0.00 0.00 4.20
1267 1268 2.109774 CTGGCCAAATATTCCCTTGCA 58.890 47.619 7.01 0.00 0.00 4.08
1270 1271 4.293494 TGGCCAAATATTCCCTTGCATTA 58.707 39.130 0.61 0.00 0.00 1.90
1271 1272 4.344679 TGGCCAAATATTCCCTTGCATTAG 59.655 41.667 0.61 0.00 0.00 1.73
1272 1273 4.588528 GGCCAAATATTCCCTTGCATTAGA 59.411 41.667 0.00 0.00 0.00 2.10
1278 1279 3.550437 TTCCCTTGCATTAGAGAGCTC 57.450 47.619 5.27 5.27 0.00 4.09
1279 1280 2.470990 TCCCTTGCATTAGAGAGCTCA 58.529 47.619 17.77 0.00 0.00 4.26
1280 1281 2.433604 TCCCTTGCATTAGAGAGCTCAG 59.566 50.000 17.77 0.39 0.00 3.35
1287 1288 4.119136 GCATTAGAGAGCTCAGTTTCCTC 58.881 47.826 17.77 2.36 0.00 3.71
1288 1289 4.382470 GCATTAGAGAGCTCAGTTTCCTCA 60.382 45.833 17.77 0.00 0.00 3.86
1289 1290 4.792521 TTAGAGAGCTCAGTTTCCTCAC 57.207 45.455 17.77 0.00 0.00 3.51
1305 1306 2.120909 CACCCGAATCCACATGCCC 61.121 63.158 0.00 0.00 0.00 5.36
1308 1309 0.969917 CCCGAATCCACATGCCCAAA 60.970 55.000 0.00 0.00 0.00 3.28
1314 1315 1.500474 TCCACATGCCCAAAAACCAA 58.500 45.000 0.00 0.00 0.00 3.67
1342 1343 2.248248 GTCATATCTCCCCCGACATCA 58.752 52.381 0.00 0.00 0.00 3.07
1344 1345 2.158310 TCATATCTCCCCCGACATCAGT 60.158 50.000 0.00 0.00 0.00 3.41
1383 1384 6.006275 ACATACCTCAACCTTAGCATGAAT 57.994 37.500 0.00 0.00 0.00 2.57
1387 1388 4.018050 ACCTCAACCTTAGCATGAATTCCT 60.018 41.667 2.27 0.00 0.00 3.36
1389 1390 5.067023 CCTCAACCTTAGCATGAATTCCTTC 59.933 44.000 2.27 0.00 0.00 3.46
1390 1391 5.569355 TCAACCTTAGCATGAATTCCTTCA 58.431 37.500 2.27 0.00 45.15 3.02
1392 1393 3.950395 ACCTTAGCATGAATTCCTTCAGC 59.050 43.478 2.27 0.11 44.32 4.26
1396 1397 2.092968 AGCATGAATTCCTTCAGCGGTA 60.093 45.455 2.27 0.00 44.32 4.02
1397 1398 2.880890 GCATGAATTCCTTCAGCGGTAT 59.119 45.455 2.27 0.00 44.32 2.73
1398 1399 3.304257 GCATGAATTCCTTCAGCGGTATG 60.304 47.826 2.27 0.00 44.32 2.39
1401 1402 4.780815 TGAATTCCTTCAGCGGTATGATT 58.219 39.130 2.27 0.00 36.46 2.57
1404 1405 2.115427 TCCTTCAGCGGTATGATTCCA 58.885 47.619 0.00 0.00 0.00 3.53
1407 1408 2.890808 TCAGCGGTATGATTCCAGAC 57.109 50.000 0.00 0.00 33.95 3.51
1408 1409 2.107366 TCAGCGGTATGATTCCAGACA 58.893 47.619 0.00 0.00 36.29 3.41
1414 1415 4.742440 GCGGTATGATTCCAGACACCATAA 60.742 45.833 0.00 0.00 36.29 1.90
1419 1420 5.497464 TGATTCCAGACACCATAACTTCA 57.503 39.130 0.00 0.00 0.00 3.02
1420 1421 5.491070 TGATTCCAGACACCATAACTTCAG 58.509 41.667 0.00 0.00 0.00 3.02
1427 1428 3.926616 ACACCATAACTTCAGGTTCTCG 58.073 45.455 0.00 0.00 39.17 4.04
1428 1429 3.262420 CACCATAACTTCAGGTTCTCGG 58.738 50.000 0.00 0.00 39.17 4.63
1429 1430 3.056107 CACCATAACTTCAGGTTCTCGGA 60.056 47.826 0.00 0.00 39.17 4.55
1444 1445 1.687563 TCGGATCGAGGTTATCAGCA 58.312 50.000 0.00 0.00 0.00 4.41
1452 1453 2.625314 CGAGGTTATCAGCATGGAGAGA 59.375 50.000 0.00 0.00 36.16 3.10
1474 1475 4.448537 AACTCTCTTGAAGGTGAGATCG 57.551 45.455 17.92 0.00 38.46 3.69
1477 1478 2.165234 TCTCTTGAAGGTGAGATCGCTG 59.835 50.000 0.00 0.00 34.77 5.18
1480 1481 3.006859 TCTTGAAGGTGAGATCGCTGAAA 59.993 43.478 0.00 0.00 0.00 2.69
1481 1482 3.401033 TGAAGGTGAGATCGCTGAAAA 57.599 42.857 0.00 0.00 0.00 2.29
1485 1486 4.213564 AGGTGAGATCGCTGAAAATCTT 57.786 40.909 0.00 0.00 32.43 2.40
1491 1492 4.005650 AGATCGCTGAAAATCTTGCTCAA 58.994 39.130 0.00 0.00 0.00 3.02
1494 1495 2.597305 CGCTGAAAATCTTGCTCAATGC 59.403 45.455 0.00 0.00 43.25 3.56
1496 1497 3.858238 GCTGAAAATCTTGCTCAATGCTC 59.142 43.478 0.00 0.00 43.37 4.26
1497 1498 4.617530 GCTGAAAATCTTGCTCAATGCTCA 60.618 41.667 0.00 0.00 43.37 4.26
1498 1499 5.651530 CTGAAAATCTTGCTCAATGCTCAT 58.348 37.500 0.00 0.00 43.37 2.90
1503 1504 5.916661 ATCTTGCTCAATGCTCATTTCTT 57.083 34.783 0.00 0.00 43.37 2.52
1510 1511 5.055642 TCAATGCTCATTTCTTCAGCAAG 57.944 39.130 0.00 0.00 45.99 4.01
1512 1513 4.698583 ATGCTCATTTCTTCAGCAAGTC 57.301 40.909 0.00 0.00 45.99 3.01
1518 1519 4.816385 TCATTTCTTCAGCAAGTCGTTCTT 59.184 37.500 0.00 0.00 36.75 2.52
1536 1537 6.037720 TCGTTCTTAGCAACAACAATCTTCAA 59.962 34.615 0.00 0.00 0.00 2.69
1539 1540 5.241506 TCTTAGCAACAACAATCTTCAAGGG 59.758 40.000 0.00 0.00 0.00 3.95
1541 1542 3.319122 AGCAACAACAATCTTCAAGGGAC 59.681 43.478 0.00 0.00 0.00 4.46
1586 1587 3.071874 TCCCAACCTTTCTGTGCTATG 57.928 47.619 0.00 0.00 0.00 2.23
1617 1618 3.854784 GCAACAAGCTCACTGGAAACATC 60.855 47.826 0.00 0.00 39.36 3.06
1620 1621 1.366319 AGCTCACTGGAAACATCCCT 58.634 50.000 0.00 0.00 41.51 4.20
1621 1622 1.280421 AGCTCACTGGAAACATCCCTC 59.720 52.381 0.00 0.00 41.51 4.30
1622 1623 2.009042 GCTCACTGGAAACATCCCTCG 61.009 57.143 0.00 0.00 41.51 4.63
1626 1627 2.027561 CACTGGAAACATCCCTCGGTTA 60.028 50.000 0.00 0.00 41.51 2.85
1627 1628 2.027469 ACTGGAAACATCCCTCGGTTAC 60.027 50.000 0.00 0.00 41.51 2.50
1635 1636 2.732619 CCCTCGGTTACTGGGGAGC 61.733 68.421 12.49 0.00 41.25 4.70
1637 1638 1.550130 CCTCGGTTACTGGGGAGCAA 61.550 60.000 3.48 0.00 0.00 3.91
1643 1644 0.475044 TTACTGGGGAGCAACGGTTT 59.525 50.000 0.00 0.00 0.00 3.27
1647 1648 0.106419 TGGGGAGCAACGGTTTTCTT 60.106 50.000 0.00 0.00 0.00 2.52
1648 1649 0.313987 GGGGAGCAACGGTTTTCTTG 59.686 55.000 0.00 0.00 0.00 3.02
1650 1651 0.383949 GGAGCAACGGTTTTCTTGCA 59.616 50.000 8.61 0.00 44.42 4.08
1653 1654 1.052287 GCAACGGTTTTCTTGCATCG 58.948 50.000 1.70 0.00 42.05 3.84
1656 1657 2.172851 ACGGTTTTCTTGCATCGGTA 57.827 45.000 0.00 0.00 0.00 4.02
1664 1665 7.309920 GGTTTTCTTGCATCGGTAAATCTAAA 58.690 34.615 0.00 0.00 0.00 1.85
1689 1690 5.717119 ACAATAGCCTTAGTGGAGGAATT 57.283 39.130 0.00 0.00 39.25 2.17
1690 1691 6.824958 ACAATAGCCTTAGTGGAGGAATTA 57.175 37.500 0.00 0.00 39.25 1.40
1692 1693 5.827326 ATAGCCTTAGTGGAGGAATTACC 57.173 43.478 0.00 0.00 39.25 2.85
1696 1697 3.786450 CCTTAGTGGAGGAATTACCCCTT 59.214 47.826 0.00 0.00 39.25 3.95
1713 1714 4.145052 CCCCTTCCTTATTCAATAGCACC 58.855 47.826 0.00 0.00 0.00 5.01
1714 1715 4.141158 CCCCTTCCTTATTCAATAGCACCT 60.141 45.833 0.00 0.00 0.00 4.00
1725 1726 5.912149 TCAATAGCACCTCCATTTCCTAT 57.088 39.130 0.00 0.00 0.00 2.57
1726 1727 5.624159 TCAATAGCACCTCCATTTCCTATG 58.376 41.667 0.00 0.00 0.00 2.23
1732 1733 5.012561 AGCACCTCCATTTCCTATGTAGATC 59.987 44.000 0.00 0.00 0.00 2.75
1739 1740 5.923114 CCATTTCCTATGTAGATCTGTCACG 59.077 44.000 5.18 0.66 0.00 4.35
1740 1741 4.569761 TTCCTATGTAGATCTGTCACGC 57.430 45.455 5.18 0.00 0.00 5.34
1744 1745 4.683320 CCTATGTAGATCTGTCACGCAATG 59.317 45.833 5.18 0.00 0.00 2.82
1746 1747 4.186856 TGTAGATCTGTCACGCAATGAA 57.813 40.909 5.18 0.00 39.72 2.57
1752 1753 3.466836 TCTGTCACGCAATGAACTTTCT 58.533 40.909 0.00 0.00 39.72 2.52
1755 1756 1.879380 TCACGCAATGAACTTTCTGGG 59.121 47.619 0.00 0.00 33.02 4.45
1758 1759 1.879380 CGCAATGAACTTTCTGGGTCA 59.121 47.619 0.00 0.00 0.00 4.02
1772 1773 3.170360 GGTCAATCCCGTCTTTCCC 57.830 57.895 0.00 0.00 0.00 3.97
1788 1792 1.518367 TCCCTCAAACCTCACCACTT 58.482 50.000 0.00 0.00 0.00 3.16
1791 1795 2.498167 CCTCAAACCTCACCACTTCAG 58.502 52.381 0.00 0.00 0.00 3.02
1797 1801 2.690840 ACCTCACCACTTCAGTACCTT 58.309 47.619 0.00 0.00 0.00 3.50
1798 1802 2.368875 ACCTCACCACTTCAGTACCTTG 59.631 50.000 0.00 0.00 0.00 3.61
1800 1804 2.037772 CTCACCACTTCAGTACCTTGCT 59.962 50.000 0.00 0.00 0.00 3.91
1807 1811 4.926238 CACTTCAGTACCTTGCTCTAACTG 59.074 45.833 0.00 0.00 39.10 3.16
1812 1816 6.769512 TCAGTACCTTGCTCTAACTGAAAAT 58.230 36.000 1.21 0.00 42.53 1.82
1814 1818 7.719633 TCAGTACCTTGCTCTAACTGAAAATTT 59.280 33.333 1.21 0.00 42.53 1.82
1818 1822 7.231467 ACCTTGCTCTAACTGAAAATTTCCTA 58.769 34.615 3.00 0.00 0.00 2.94
1821 1825 8.862325 TTGCTCTAACTGAAAATTTCCTATCA 57.138 30.769 3.00 0.00 0.00 2.15
1836 1840 1.074566 CTATCAGGGGGCATTCCTTCC 59.925 57.143 0.00 0.00 35.33 3.46
1849 1853 4.221482 GCATTCCTTCCTCAATTGGAAACT 59.779 41.667 5.42 0.00 44.49 2.66
1862 1866 4.781775 TTGGAAACTTGTCTTCCCTGTA 57.218 40.909 0.00 0.00 41.54 2.74
1866 1870 5.073144 TGGAAACTTGTCTTCCCTGTATTCT 59.927 40.000 0.00 0.00 41.54 2.40
1875 1879 6.103330 GTCTTCCCTGTATTCTCTTCAACTC 58.897 44.000 0.00 0.00 0.00 3.01
1876 1880 6.019748 TCTTCCCTGTATTCTCTTCAACTCT 58.980 40.000 0.00 0.00 0.00 3.24
1893 1897 6.122277 TCAACTCTCTCAAAACAACTTCCAT 58.878 36.000 0.00 0.00 0.00 3.41
1912 1916 1.571955 TGGAAGCATACCAGAGAGCA 58.428 50.000 0.00 0.00 33.22 4.26
1915 1919 3.711190 TGGAAGCATACCAGAGAGCATAA 59.289 43.478 0.00 0.00 33.22 1.90
1920 1924 4.406972 AGCATACCAGAGAGCATAAGTCAA 59.593 41.667 0.00 0.00 0.00 3.18
1921 1925 4.509600 GCATACCAGAGAGCATAAGTCAAC 59.490 45.833 0.00 0.00 0.00 3.18
1927 1931 5.702670 CCAGAGAGCATAAGTCAACTTTCAA 59.297 40.000 0.00 0.00 37.40 2.69
1968 1972 8.463930 ACTTGAAAGATAACAATTTGTCAGGA 57.536 30.769 1.83 0.00 0.00 3.86
1969 1973 8.571336 ACTTGAAAGATAACAATTTGTCAGGAG 58.429 33.333 1.83 0.00 0.00 3.69
1978 1982 2.638480 TTTGTCAGGAGTTGTCCCAG 57.362 50.000 0.00 0.00 45.26 4.45
1979 1983 0.108585 TTGTCAGGAGTTGTCCCAGC 59.891 55.000 0.00 0.00 45.26 4.85
1990 1994 2.284754 TGTCCCAGCAGCAATTTACA 57.715 45.000 0.00 0.00 0.00 2.41
1998 2002 3.490526 CAGCAGCAATTTACACAAACACC 59.509 43.478 0.00 0.00 0.00 4.16
2031 2035 5.606348 ATCTTAGCCTTAGTCTCAACCAG 57.394 43.478 0.00 0.00 0.00 4.00
2034 2038 1.552792 AGCCTTAGTCTCAACCAGCTC 59.447 52.381 0.00 0.00 0.00 4.09
2035 2039 1.276421 GCCTTAGTCTCAACCAGCTCA 59.724 52.381 0.00 0.00 0.00 4.26
2037 2041 3.791245 CCTTAGTCTCAACCAGCTCATC 58.209 50.000 0.00 0.00 0.00 2.92
2040 2044 0.460987 GTCTCAACCAGCTCATCGGG 60.461 60.000 0.00 0.00 36.01 5.14
2042 2046 0.250234 CTCAACCAGCTCATCGGGAA 59.750 55.000 0.00 0.00 33.91 3.97
2061 2065 3.756434 GGAAAATTCCAACTGACATCGGA 59.244 43.478 7.32 0.00 46.76 4.55
2082 2086 5.245531 GGATACACTCTTCCAAACATCACA 58.754 41.667 0.00 0.00 31.99 3.58
2085 2089 4.130118 ACACTCTTCCAAACATCACAGAC 58.870 43.478 0.00 0.00 0.00 3.51
2100 2104 4.537751 TCACAGACTTGATACTAGGAGGG 58.462 47.826 0.00 0.00 0.00 4.30
2117 2121 3.191182 GGAACCAATTCGATGGCCT 57.809 52.632 3.32 0.00 44.75 5.19
2133 2137 2.843730 TGGCCTAATTCCTGCTTCACTA 59.156 45.455 3.32 0.00 0.00 2.74
2136 2140 3.134804 GCCTAATTCCTGCTTCACTAGGA 59.865 47.826 0.00 0.00 41.20 2.94
2151 2155 6.061022 TCACTAGGAAATGCATCAAACCTA 57.939 37.500 0.00 9.82 0.00 3.08
2158 2162 7.099120 AGGAAATGCATCAAACCTACAAAATC 58.901 34.615 0.00 0.00 0.00 2.17
2177 2181 8.630037 ACAAAATCTAGACCTTCGTCAAAATTT 58.370 29.630 0.00 0.00 41.87 1.82
2184 2188 5.469084 AGACCTTCGTCAAAATTTACTCACC 59.531 40.000 0.00 0.00 41.87 4.02
2197 2201 4.895668 TTACTCACCGGTGTTATTCCTT 57.104 40.909 32.74 12.18 0.00 3.36
2200 2204 3.000727 CTCACCGGTGTTATTCCTTCAC 58.999 50.000 32.74 0.00 0.00 3.18
2233 2237 5.368145 TGAGCAAGTTGACAAACATAGACT 58.632 37.500 7.16 0.00 38.88 3.24
2251 2255 3.821033 AGACTTGGGTACAAACATGCTTC 59.179 43.478 0.00 0.00 35.89 3.86
2252 2256 2.552315 ACTTGGGTACAAACATGCTTCG 59.448 45.455 0.00 0.00 35.89 3.79
2256 2260 3.006940 GGGTACAAACATGCTTCGATCA 58.993 45.455 0.00 0.00 0.00 2.92
2266 2270 1.833630 TGCTTCGATCAGGAGATTGGT 59.166 47.619 0.00 0.00 36.47 3.67
2286 2290 5.529791 TGGTCTTTCTTGTCTTCTCTAACG 58.470 41.667 0.00 0.00 0.00 3.18
2296 2300 8.021973 TCTTGTCTTCTCTAACGAATTGTACTC 58.978 37.037 0.00 0.00 0.00 2.59
2302 2306 8.961294 TTCTCTAACGAATTGTACTCAACTAC 57.039 34.615 0.00 0.00 36.33 2.73
2319 2323 7.387948 ACTCAACTACAGATGTTATGTTTGGAC 59.612 37.037 0.00 0.00 32.02 4.02
2328 2332 8.739039 CAGATGTTATGTTTGGACTTTAATGGA 58.261 33.333 0.00 0.00 0.00 3.41
2353 2357 0.398664 GGGGGCACTTCCTAGCTCTA 60.399 60.000 0.00 0.00 34.39 2.43
2356 2360 2.439880 GGGGCACTTCCTAGCTCTATTT 59.560 50.000 0.00 0.00 34.39 1.40
2357 2361 3.495276 GGGGCACTTCCTAGCTCTATTTC 60.495 52.174 0.00 0.00 34.39 2.17
2361 2365 5.047188 GCACTTCCTAGCTCTATTTCTGAC 58.953 45.833 0.00 0.00 0.00 3.51
2370 2374 7.607991 CCTAGCTCTATTTCTGACCTTTCAAAA 59.392 37.037 0.00 0.00 0.00 2.44
2394 2398 4.873010 ACTTAGAGGTGCTTCTCCTATCA 58.127 43.478 3.80 0.00 35.20 2.15
2401 2405 4.287067 AGGTGCTTCTCCTATCAGAAAACA 59.713 41.667 0.00 0.00 31.86 2.83
2403 2407 5.106515 GGTGCTTCTCCTATCAGAAAACAAC 60.107 44.000 0.00 0.00 31.86 3.32
2408 2412 5.794894 TCTCCTATCAGAAAACAACCTGAC 58.205 41.667 0.00 0.00 41.59 3.51
2441 2445 4.570930 CCTTCAGAGGTAGGAAAACTCAC 58.429 47.826 0.00 0.00 38.32 3.51
2463 2467 5.353394 CAGGCCTAACTGTCCTTGTAATA 57.647 43.478 3.98 0.00 33.81 0.98
2466 2470 5.104900 AGGCCTAACTGTCCTTGTAATACAG 60.105 44.000 1.29 0.00 44.89 2.74
2468 2472 5.811100 GCCTAACTGTCCTTGTAATACAGAC 59.189 44.000 8.57 6.01 42.59 3.51
2481 2485 9.227490 CTTGTAATACAGACTAATTCACTCTCG 57.773 37.037 0.00 0.00 0.00 4.04
2486 2490 1.480954 GACTAATTCACTCTCGGGGCA 59.519 52.381 0.00 0.00 0.00 5.36
2487 2491 2.103263 GACTAATTCACTCTCGGGGCAT 59.897 50.000 0.00 0.00 0.00 4.40
2490 2494 3.409026 AATTCACTCTCGGGGCATATC 57.591 47.619 0.00 0.00 0.00 1.63
2506 2510 4.018960 GGCATATCCCTGATACACTTGGAT 60.019 45.833 0.00 0.00 39.16 3.41
2507 2511 4.940046 GCATATCCCTGATACACTTGGATG 59.060 45.833 0.00 0.00 36.52 3.51
2513 2517 4.080919 CCCTGATACACTTGGATGTCTTCA 60.081 45.833 0.00 0.00 33.85 3.02
2517 2521 7.202016 TGATACACTTGGATGTCTTCAAAAC 57.798 36.000 0.00 0.00 33.85 2.43
2518 2522 6.998074 TGATACACTTGGATGTCTTCAAAACT 59.002 34.615 0.00 0.00 33.85 2.66
2523 2527 5.888161 ACTTGGATGTCTTCAAAACTTGTCT 59.112 36.000 0.00 0.00 0.00 3.41
2526 2530 5.760253 TGGATGTCTTCAAAACTTGTCTCTC 59.240 40.000 0.00 0.00 0.00 3.20
2531 2535 7.509546 TGTCTTCAAAACTTGTCTCTCCTAAT 58.490 34.615 0.00 0.00 0.00 1.73
2537 2541 9.712305 TCAAAACTTGTCTCTCCTAATCTTAAG 57.288 33.333 0.00 0.00 0.00 1.85
2541 2545 6.213600 ACTTGTCTCTCCTAATCTTAAGCCAA 59.786 38.462 0.00 0.00 0.00 4.52
2550 2554 7.657336 TCCTAATCTTAAGCCAAAACAAACTG 58.343 34.615 0.00 0.00 0.00 3.16
2563 2567 3.771577 ACAAACTGTCCGGAGAAATCT 57.228 42.857 3.06 0.00 0.00 2.40
2568 2572 2.834549 ACTGTCCGGAGAAATCTCACAT 59.165 45.455 3.06 0.00 44.60 3.21
2571 2575 3.260632 TGTCCGGAGAAATCTCACATTCA 59.739 43.478 3.06 0.00 44.60 2.57
2579 2583 6.183360 GGAGAAATCTCACATTCAATTGGGAG 60.183 42.308 12.21 0.00 46.52 4.30
2587 2591 5.721480 TCACATTCAATTGGGAGACTAGAGA 59.279 40.000 5.42 0.00 0.00 3.10
2588 2592 6.213397 TCACATTCAATTGGGAGACTAGAGAA 59.787 38.462 5.42 0.00 0.00 2.87
2589 2593 6.538021 CACATTCAATTGGGAGACTAGAGAAG 59.462 42.308 5.42 0.00 0.00 2.85
2594 2598 3.458044 TGGGAGACTAGAGAAGCTCAA 57.542 47.619 0.00 0.00 32.91 3.02
2597 2601 3.069443 GGGAGACTAGAGAAGCTCAATGG 59.931 52.174 0.00 0.00 32.91 3.16
2616 2620 8.055279 TCAATGGACTTTATCTCATGGAAAAC 57.945 34.615 0.00 0.00 0.00 2.43
2628 2632 2.517650 TGGAAAACAATTTGACCGGC 57.482 45.000 0.00 0.00 0.00 6.13
2638 2642 1.540267 TTTGACCGGCCAAATACCTG 58.460 50.000 12.32 0.00 31.73 4.00
2669 2673 7.835634 TGGAAGGTTGTAAAAATTTGTTGTC 57.164 32.000 0.00 0.00 0.00 3.18
2670 2674 7.386851 TGGAAGGTTGTAAAAATTTGTTGTCA 58.613 30.769 0.00 0.00 0.00 3.58
2679 2683 7.757624 TGTAAAAATTTGTTGTCACTGAACCTC 59.242 33.333 0.00 0.00 0.00 3.85
2684 2688 4.487714 TGTTGTCACTGAACCTCTCTTT 57.512 40.909 0.00 0.00 0.00 2.52
2685 2689 4.843728 TGTTGTCACTGAACCTCTCTTTT 58.156 39.130 0.00 0.00 0.00 2.27
2690 2694 8.713271 GTTGTCACTGAACCTCTCTTTTAATAG 58.287 37.037 0.00 0.00 0.00 1.73
2691 2695 6.874134 TGTCACTGAACCTCTCTTTTAATAGC 59.126 38.462 0.00 0.00 0.00 2.97
2694 2698 7.604164 TCACTGAACCTCTCTTTTAATAGCTTG 59.396 37.037 0.00 0.00 0.00 4.01
2697 2701 8.773404 TGAACCTCTCTTTTAATAGCTTGTAC 57.227 34.615 0.00 0.00 0.00 2.90
2719 2723 3.427161 GAAGCATTCCCAAGGAAATCG 57.573 47.619 0.00 0.00 45.41 3.34
2748 2752 5.767816 TTTCCACACTTTCTAAAGGCTTC 57.232 39.130 0.00 0.00 40.31 3.86
2771 2775 6.570692 TCGATCTTTCCTATAACCAACTCAC 58.429 40.000 0.00 0.00 0.00 3.51
2772 2776 5.459107 CGATCTTTCCTATAACCAACTCACG 59.541 44.000 0.00 0.00 0.00 4.35
2790 2794 0.037139 CGGGGAACATACCGTCACAA 60.037 55.000 0.00 0.00 44.85 3.33
2798 2802 6.108015 GGAACATACCGTCACAAATAGGTAA 58.892 40.000 0.00 0.00 41.84 2.85
2800 2804 7.042254 GGAACATACCGTCACAAATAGGTAATC 60.042 40.741 0.00 0.00 41.84 1.75
2809 2813 8.491152 CGTCACAAATAGGTAATCTGATGAATC 58.509 37.037 0.00 0.00 0.00 2.52
2817 2821 7.959689 AGGTAATCTGATGAATCTGAATTCG 57.040 36.000 0.04 0.00 43.61 3.34
2826 2830 8.893219 TGATGAATCTGAATTCGCTTAGTATT 57.107 30.769 0.04 0.00 43.61 1.89
2832 2836 8.682936 ATCTGAATTCGCTTAGTATTTCCAAT 57.317 30.769 0.04 0.00 0.00 3.16
2839 2843 7.925043 TCGCTTAGTATTTCCAATAACCAAA 57.075 32.000 0.00 0.00 0.00 3.28
2865 2869 1.339151 GGTGAGATTCCTTCCGCACTT 60.339 52.381 0.00 0.00 33.16 3.16
2868 2872 0.693049 AGATTCCTTCCGCACTTGGT 59.307 50.000 0.00 0.00 0.00 3.67
2869 2873 0.804989 GATTCCTTCCGCACTTGGTG 59.195 55.000 0.00 0.00 36.51 4.17
2878 2882 0.387622 CGCACTTGGTGAATGCCTTG 60.388 55.000 1.57 0.00 35.23 3.61
2888 2892 4.590647 TGGTGAATGCCTTGTTTTGGAATA 59.409 37.500 0.00 0.00 0.00 1.75
2893 2897 5.859205 ATGCCTTGTTTTGGAATATCTCC 57.141 39.130 0.00 0.00 45.64 3.71
2910 2914 2.806945 TCCATTTGGAGGCGAATCTT 57.193 45.000 0.00 0.00 39.78 2.40
2925 2929 5.389830 GGCGAATCTTTTGCAAGGAAAAATC 60.390 40.000 0.00 0.97 42.00 2.17
2930 2934 5.367302 TCTTTTGCAAGGAAAAATCCCAAG 58.633 37.500 0.00 0.00 0.00 3.61
2931 2935 4.769345 TTTGCAAGGAAAAATCCCAAGT 57.231 36.364 0.00 0.00 0.00 3.16
2934 2938 3.708631 TGCAAGGAAAAATCCCAAGTTCA 59.291 39.130 0.00 0.00 0.00 3.18
2937 2941 5.532557 CAAGGAAAAATCCCAAGTTCACTC 58.467 41.667 0.00 0.00 0.00 3.51
2938 2942 4.803452 AGGAAAAATCCCAAGTTCACTCA 58.197 39.130 0.00 0.00 0.00 3.41
2940 2944 4.550422 GAAAAATCCCAAGTTCACTCAGC 58.450 43.478 0.00 0.00 0.00 4.26
2943 2947 0.108585 TCCCAAGTTCACTCAGCACC 59.891 55.000 0.00 0.00 0.00 5.01
2975 2979 5.611128 ATCAATGAGATGGATCTATCCCG 57.389 43.478 14.88 0.91 46.59 5.14
2989 2993 5.988310 TCTATCCCGAAACAACTTGTCTA 57.012 39.130 0.00 0.00 0.00 2.59
2992 2996 5.733620 ATCCCGAAACAACTTGTCTAGTA 57.266 39.130 0.00 0.00 35.54 1.82
2993 2997 4.874970 TCCCGAAACAACTTGTCTAGTAC 58.125 43.478 0.00 0.00 35.54 2.73
2997 3001 6.204108 CCCGAAACAACTTGTCTAGTACAATT 59.796 38.462 0.00 1.79 46.81 2.32
3007 3011 9.220767 ACTTGTCTAGTACAATTCCAGATTTTC 57.779 33.333 0.00 0.00 46.81 2.29
3042 3046 8.948631 TTAGCTCCTTGTATATTCTCAACTTG 57.051 34.615 0.00 0.00 0.00 3.16
3045 3049 7.044798 GCTCCTTGTATATTCTCAACTTGTCT 58.955 38.462 0.00 0.00 0.00 3.41
3049 3053 8.383619 CCTTGTATATTCTCAACTTGTCTTTCG 58.616 37.037 0.00 0.00 0.00 3.46
3051 3055 8.462143 TGTATATTCTCAACTTGTCTTTCGAC 57.538 34.615 0.00 0.00 40.64 4.20
3055 3059 2.466846 TCAACTTGTCTTTCGACGACC 58.533 47.619 0.00 0.00 43.21 4.79
3090 3094 0.597568 CAAGAGGTGGCATTTTCGCA 59.402 50.000 0.00 0.00 0.00 5.10
3093 3097 1.000274 AGAGGTGGCATTTTCGCAAAC 60.000 47.619 0.00 0.00 0.00 2.93
3105 3109 2.232756 TCGCAAACTCAAGTGCAGTA 57.767 45.000 0.00 0.00 40.94 2.74
3167 3171 2.228138 CAACAAGTGCCACTTTGCAT 57.772 45.000 7.51 0.00 44.30 3.96
3168 3172 1.862201 CAACAAGTGCCACTTTGCATG 59.138 47.619 7.51 0.00 44.30 4.06
3169 3173 0.390124 ACAAGTGCCACTTTGCATGG 59.610 50.000 7.51 0.11 44.30 3.66
3175 3179 3.919163 CCACTTTGCATGGCATTGT 57.081 47.368 0.00 0.00 38.76 2.71
3186 3190 2.818130 TGGCATTGTCTTCCAAAAGC 57.182 45.000 0.00 0.00 36.44 3.51
3194 3198 5.913137 TTGTCTTCCAAAAGCAAGAAGAA 57.087 34.783 3.43 0.00 45.52 2.52
3195 3199 5.505173 TGTCTTCCAAAAGCAAGAAGAAG 57.495 39.130 3.43 0.00 45.52 2.85
3196 3200 4.949856 TGTCTTCCAAAAGCAAGAAGAAGT 59.050 37.500 3.43 0.00 45.52 3.01
3199 3203 5.829924 TCTTCCAAAAGCAAGAAGAAGTCAT 59.170 36.000 0.00 0.00 42.20 3.06
3202 3206 8.862325 TTCCAAAAGCAAGAAGAAGTCATATA 57.138 30.769 0.00 0.00 0.00 0.86
3228 3232 6.704310 TGTAACTATAGTGGTTCCAGTTTCC 58.296 40.000 6.06 0.00 32.09 3.13
3232 3236 2.327228 GTGGTTCCAGTTTCCACGG 58.673 57.895 0.00 0.00 41.37 4.94
3233 3237 1.527380 TGGTTCCAGTTTCCACGGC 60.527 57.895 0.00 0.00 0.00 5.68
3234 3238 1.527380 GGTTCCAGTTTCCACGGCA 60.527 57.895 0.00 0.00 0.00 5.69
3238 3242 1.243902 TCCAGTTTCCACGGCAATTC 58.756 50.000 0.00 0.00 0.00 2.17
3241 3245 2.161609 CCAGTTTCCACGGCAATTCTAC 59.838 50.000 0.00 0.00 0.00 2.59
3243 3247 3.125316 CAGTTTCCACGGCAATTCTACTC 59.875 47.826 0.00 0.00 0.00 2.59
3244 3248 3.008049 AGTTTCCACGGCAATTCTACTCT 59.992 43.478 0.00 0.00 0.00 3.24
3247 3251 1.207089 CCACGGCAATTCTACTCTCCA 59.793 52.381 0.00 0.00 0.00 3.86
3248 3252 2.271800 CACGGCAATTCTACTCTCCAC 58.728 52.381 0.00 0.00 0.00 4.02
3249 3253 1.899814 ACGGCAATTCTACTCTCCACA 59.100 47.619 0.00 0.00 0.00 4.17
3250 3254 2.501723 ACGGCAATTCTACTCTCCACAT 59.498 45.455 0.00 0.00 0.00 3.21
3251 3255 3.055094 ACGGCAATTCTACTCTCCACATT 60.055 43.478 0.00 0.00 0.00 2.71
3255 3259 6.058183 GGCAATTCTACTCTCCACATTATGT 58.942 40.000 0.00 0.00 0.00 2.29
3256 3260 6.543831 GGCAATTCTACTCTCCACATTATGTT 59.456 38.462 0.00 0.00 0.00 2.71
3264 3268 6.392354 ACTCTCCACATTATGTTTTGCATTG 58.608 36.000 0.00 0.00 38.94 2.82
3268 3272 8.747471 TCTCCACATTATGTTTTGCATTGATTA 58.253 29.630 0.00 0.00 38.94 1.75
3270 3274 9.315525 TCCACATTATGTTTTGCATTGATTATG 57.684 29.630 0.00 0.00 38.94 1.90
3292 3296 4.512944 TGCTAAAGAAGAAGCACACAGAAG 59.487 41.667 0.00 0.00 43.56 2.85
3298 3302 0.516439 GAAGCACACAGAAGCTGAGC 59.484 55.000 0.00 0.00 41.70 4.26
3299 3303 0.179037 AAGCACACAGAAGCTGAGCA 60.179 50.000 7.39 0.00 41.70 4.26
3300 3304 0.179037 AGCACACAGAAGCTGAGCAA 60.179 50.000 7.39 0.00 40.13 3.91
3301 3305 0.879765 GCACACAGAAGCTGAGCAAT 59.120 50.000 7.39 0.00 35.18 3.56
3302 3306 1.135746 GCACACAGAAGCTGAGCAATC 60.136 52.381 7.39 4.53 35.18 2.67
3308 3312 3.215151 CAGAAGCTGAGCAATCCATCAT 58.785 45.455 7.39 0.00 32.44 2.45
3309 3313 3.003793 CAGAAGCTGAGCAATCCATCATG 59.996 47.826 7.39 0.00 32.44 3.07
3312 3316 1.407618 GCTGAGCAATCCATCATGCAA 59.592 47.619 0.00 0.00 44.95 4.08
3315 3319 3.292460 TGAGCAATCCATCATGCAATCA 58.708 40.909 0.00 0.00 44.95 2.57
3320 3324 5.053811 GCAATCCATCATGCAATCATTCAA 58.946 37.500 0.00 0.00 42.12 2.69
3323 3327 3.639561 TCCATCATGCAATCATTCAAGGG 59.360 43.478 0.00 0.00 0.00 3.95
3324 3328 3.390135 CATCATGCAATCATTCAAGGGC 58.610 45.455 0.00 0.00 0.00 5.19
3328 3332 1.483004 TGCAATCATTCAAGGGCCATG 59.517 47.619 6.18 3.65 0.00 3.66
3330 3334 2.223971 GCAATCATTCAAGGGCCATGAG 60.224 50.000 11.74 1.59 30.52 2.90
3335 3339 3.203710 TCATTCAAGGGCCATGAGAGATT 59.796 43.478 11.74 0.00 0.00 2.40
3336 3340 4.413189 TCATTCAAGGGCCATGAGAGATTA 59.587 41.667 11.74 0.00 0.00 1.75
3342 3346 6.446110 TCAAGGGCCATGAGAGATTATCATAT 59.554 38.462 7.49 0.00 35.64 1.78
3343 3347 6.249911 AGGGCCATGAGAGATTATCATATG 57.750 41.667 6.18 0.00 35.64 1.78
3344 3348 5.968784 AGGGCCATGAGAGATTATCATATGA 59.031 40.000 8.10 8.10 35.64 2.15
3345 3349 6.620267 AGGGCCATGAGAGATTATCATATGAT 59.380 38.462 21.50 21.50 35.64 2.45
3378 3382 3.837355 AGCAACAAATGGTTTCTCTCCT 58.163 40.909 0.00 0.00 37.72 3.69
3379 3383 3.571401 AGCAACAAATGGTTTCTCTCCTG 59.429 43.478 0.00 0.00 37.72 3.86
3383 3387 2.892852 CAAATGGTTTCTCTCCTGCCAA 59.107 45.455 0.00 0.00 32.54 4.52
3388 3392 5.708736 TGGTTTCTCTCCTGCCAATATTA 57.291 39.130 0.00 0.00 0.00 0.98
3396 3400 5.063204 TCTCCTGCCAATATTATTGGTTCG 58.937 41.667 28.05 18.86 41.53 3.95
3401 3405 4.956700 TGCCAATATTATTGGTTCGGGAAA 59.043 37.500 28.05 8.71 41.53 3.13
3409 3413 2.668144 TGGTTCGGGAAACTTTGGAT 57.332 45.000 0.00 0.00 38.02 3.41
3428 3432 5.276440 TGGATTGGTATACAAAGGCCATTT 58.724 37.500 5.01 0.00 43.46 2.32
3429 3433 5.362430 TGGATTGGTATACAAAGGCCATTTC 59.638 40.000 5.01 0.00 43.46 2.17
3430 3434 5.362430 GGATTGGTATACAAAGGCCATTTCA 59.638 40.000 5.01 0.00 43.46 2.69
3431 3435 5.913137 TTGGTATACAAAGGCCATTTCAG 57.087 39.130 5.01 0.00 35.79 3.02
3436 3440 6.980397 GGTATACAAAGGCCATTTCAGATTTG 59.020 38.462 5.01 6.91 34.61 2.32
3459 3463 7.296628 TGAAACAGTTGCCATTAAGGTATTT 57.703 32.000 0.00 0.00 40.61 1.40
3461 3465 8.519526 TGAAACAGTTGCCATTAAGGTATTTAG 58.480 33.333 0.00 0.00 40.61 1.85
3472 3476 7.287696 CCATTAAGGTATTTAGGCTTGACCAAT 59.712 37.037 0.00 0.00 43.14 3.16
3473 3477 7.875327 TTAAGGTATTTAGGCTTGACCAATC 57.125 36.000 0.00 0.00 43.14 2.67
3489 3493 1.329906 CAATCTGGTGCATCGAAGAGC 59.670 52.381 0.00 0.00 43.63 4.09
3507 3511 2.344950 AGCTTCTTCGCTGAATGTGAG 58.655 47.619 0.00 0.00 39.16 3.51
3511 3515 1.065926 TCTTCGCTGAATGTGAGGCAT 60.066 47.619 0.00 0.00 40.03 4.40
3513 3517 1.089112 TCGCTGAATGTGAGGCATTG 58.911 50.000 0.00 0.00 46.90 2.82
3516 3520 1.404391 GCTGAATGTGAGGCATTGAGG 59.596 52.381 8.10 0.00 46.90 3.86
3528 3532 1.406539 GCATTGAGGAACATTCGCCAT 59.593 47.619 0.00 0.00 0.00 4.40
3535 3539 1.264288 GGAACATTCGCCATCGGAATC 59.736 52.381 0.00 0.00 36.13 2.52
3537 3541 1.871080 ACATTCGCCATCGGAATCTC 58.129 50.000 0.00 0.00 36.13 2.75
3540 3544 3.006859 ACATTCGCCATCGGAATCTCATA 59.993 43.478 0.00 0.00 36.13 2.15
3549 3553 4.873746 TCGGAATCTCATAAGGGTGATC 57.126 45.455 0.00 0.00 0.00 2.92
3551 3555 4.653801 TCGGAATCTCATAAGGGTGATCAA 59.346 41.667 0.00 0.00 0.00 2.57
3560 3564 7.016957 TCTCATAAGGGTGATCAATCTATGCTT 59.983 37.037 0.00 0.00 0.00 3.91
3576 3580 3.788227 TGCTTAACCACTGATCCAAGT 57.212 42.857 0.00 0.00 0.00 3.16
3627 3631 7.504926 TGAGTATAAGGAACATGGTAACCTT 57.495 36.000 8.66 8.66 43.75 3.50
3632 3636 9.016438 GTATAAGGAACATGGTAACCTTGAAAA 57.984 33.333 12.86 0.00 41.86 2.29
3633 3637 6.800072 AAGGAACATGGTAACCTTGAAAAA 57.200 33.333 2.98 0.00 40.59 1.94
3639 3643 4.864704 TGGTAACCTTGAAAAATGGCTC 57.135 40.909 0.00 0.00 0.00 4.70
3640 3644 3.576550 TGGTAACCTTGAAAAATGGCTCC 59.423 43.478 0.00 0.00 0.00 4.70
3642 3646 4.039852 GGTAACCTTGAAAAATGGCTCCAA 59.960 41.667 0.00 0.00 0.00 3.53
3644 3648 3.037549 ACCTTGAAAAATGGCTCCAACA 58.962 40.909 0.00 0.00 0.00 3.33
3646 3650 3.809279 CCTTGAAAAATGGCTCCAACAAC 59.191 43.478 0.00 0.00 0.00 3.32
3647 3651 3.467374 TGAAAAATGGCTCCAACAACC 57.533 42.857 0.00 0.00 0.00 3.77
3650 3678 2.086610 AAATGGCTCCAACAACCACT 57.913 45.000 0.00 0.00 35.99 4.00
3652 3680 2.200373 ATGGCTCCAACAACCACTAC 57.800 50.000 0.00 0.00 35.99 2.73
3654 3682 2.331166 TGGCTCCAACAACCACTACTA 58.669 47.619 0.00 0.00 0.00 1.82
3657 3685 2.742589 GCTCCAACAACCACTACTAAGC 59.257 50.000 0.00 0.00 0.00 3.09
3660 3688 5.790593 CTCCAACAACCACTACTAAGCTTA 58.209 41.667 5.94 5.94 0.00 3.09
3705 3733 3.256879 TGGATATAGCTGCAGCACTAGAC 59.743 47.826 38.24 23.77 45.16 2.59
3725 3753 6.596309 AGACTATCTCCATAATCGATGCAA 57.404 37.500 0.00 0.00 33.79 4.08
3738 3766 2.503765 TCGATGCAATCCTCCTTTGGTA 59.496 45.455 0.00 0.00 41.39 3.25
3757 3785 6.471233 TGGTACATTGTGATTTGAAACCAA 57.529 33.333 0.00 0.00 33.03 3.67
3765 3793 5.426504 TGTGATTTGAAACCAAGCAATGTT 58.573 33.333 0.00 0.00 0.00 2.71
3773 3801 4.751767 AACCAAGCAATGTTCTTTTGGA 57.248 36.364 8.42 0.00 40.52 3.53
3777 3805 5.012354 ACCAAGCAATGTTCTTTTGGATGAT 59.988 36.000 8.42 0.00 40.52 2.45
3804 3832 4.065088 TGGTTGCATGTCTTAGTGACTTC 58.935 43.478 0.00 0.00 45.54 3.01
3807 3835 2.271800 GCATGTCTTAGTGACTTCGGG 58.728 52.381 0.00 0.00 45.54 5.14
3810 3838 1.968493 TGTCTTAGTGACTTCGGGCTT 59.032 47.619 0.00 0.00 45.54 4.35
3812 3840 1.275291 TCTTAGTGACTTCGGGCTTGG 59.725 52.381 0.00 0.00 0.00 3.61
3819 3847 2.556622 TGACTTCGGGCTTGGAAAATTC 59.443 45.455 0.00 0.00 0.00 2.17
3834 3862 4.436986 GGAAAATTCCTTCACGACGAATCC 60.437 45.833 0.00 0.00 44.11 3.01
3838 3866 1.201647 TCCTTCACGACGAATCCTCAC 59.798 52.381 0.00 0.00 31.69 3.51
3840 3868 0.963225 TTCACGACGAATCCTCACCA 59.037 50.000 0.00 0.00 0.00 4.17
3842 3870 0.526211 CACGACGAATCCTCACCAGA 59.474 55.000 0.00 0.00 0.00 3.86
3844 3872 1.616865 ACGACGAATCCTCACCAGAAA 59.383 47.619 0.00 0.00 0.00 2.52
3845 3873 2.036733 ACGACGAATCCTCACCAGAAAA 59.963 45.455 0.00 0.00 0.00 2.29
3851 3879 7.385205 CGACGAATCCTCACCAGAAAATAATAT 59.615 37.037 0.00 0.00 0.00 1.28
3861 3889 8.623903 TCACCAGAAAATAATATGTCATCAAGC 58.376 33.333 0.00 0.00 0.00 4.01
3879 3907 0.244721 GCATTGTTGGACCAAGAGGC 59.755 55.000 7.31 10.48 39.06 4.70
3885 3913 0.687354 TTGGACCAAGAGGCTCAGTC 59.313 55.000 18.26 18.46 39.06 3.51
3891 3919 1.067821 CCAAGAGGCTCAGTCGGATAC 59.932 57.143 18.26 0.00 0.00 2.24
3904 3932 1.280710 TCGGATACATTGCACCTGGTT 59.719 47.619 0.00 0.00 0.00 3.67
3909 3937 2.220653 ACATTGCACCTGGTTAGCAT 57.779 45.000 12.04 1.63 38.19 3.79
3913 3941 3.643199 TTGCACCTGGTTAGCATATGA 57.357 42.857 12.04 0.00 38.19 2.15
3914 3942 2.917933 TGCACCTGGTTAGCATATGAC 58.082 47.619 6.97 0.00 32.55 3.06
3917 3945 3.384668 CACCTGGTTAGCATATGACTCG 58.615 50.000 6.97 0.00 0.00 4.18
3919 3947 3.181475 ACCTGGTTAGCATATGACTCGTG 60.181 47.826 6.97 0.00 0.00 4.35
3921 3949 4.041740 TGGTTAGCATATGACTCGTGTC 57.958 45.455 6.97 10.62 43.20 3.67
3925 3953 6.713450 TGGTTAGCATATGACTCGTGTCTATA 59.287 38.462 17.64 13.32 43.29 1.31
3926 3954 7.393515 TGGTTAGCATATGACTCGTGTCTATAT 59.606 37.037 17.64 14.64 43.29 0.86
3928 3956 9.279904 GTTAGCATATGACTCGTGTCTATATTC 57.720 37.037 17.64 12.61 43.29 1.75
3929 3957 7.695480 AGCATATGACTCGTGTCTATATTCT 57.305 36.000 17.64 14.15 43.29 2.40
3930 3958 8.116651 AGCATATGACTCGTGTCTATATTCTT 57.883 34.615 17.64 5.90 43.29 2.52
3931 3959 8.240682 AGCATATGACTCGTGTCTATATTCTTC 58.759 37.037 17.64 8.54 43.29 2.87
3933 3961 9.899226 CATATGACTCGTGTCTATATTCTTCAA 57.101 33.333 17.64 0.00 43.29 2.69
3936 3964 8.858003 TGACTCGTGTCTATATTCTTCAAATC 57.142 34.615 17.64 0.00 43.29 2.17
3937 3965 8.687242 TGACTCGTGTCTATATTCTTCAAATCT 58.313 33.333 17.64 0.00 43.29 2.40
3983 4011 7.879070 ACATCAATAATGTGCATATGTCTTCC 58.121 34.615 4.29 0.00 47.00 3.46
3984 4012 6.882610 TCAATAATGTGCATATGTCTTCCC 57.117 37.500 4.29 0.00 0.00 3.97
3986 4014 7.744733 TCAATAATGTGCATATGTCTTCCCTA 58.255 34.615 4.29 0.00 0.00 3.53
3988 4016 8.849168 CAATAATGTGCATATGTCTTCCCTAAA 58.151 33.333 4.29 0.00 0.00 1.85
3989 4017 8.995027 ATAATGTGCATATGTCTTCCCTAAAA 57.005 30.769 4.29 0.00 0.00 1.52
3992 4020 7.716799 TGTGCATATGTCTTCCCTAAAAATT 57.283 32.000 4.29 0.00 0.00 1.82
3993 4021 8.133024 TGTGCATATGTCTTCCCTAAAAATTT 57.867 30.769 4.29 0.00 0.00 1.82
3994 4022 9.249053 TGTGCATATGTCTTCCCTAAAAATTTA 57.751 29.630 4.29 0.00 0.00 1.40
4024 4052 9.927081 ATCTTCCTTGAACCAATTATAGTGAAT 57.073 29.630 0.00 0.00 0.00 2.57
4044 4072 9.631452 AGTGAATATTTTCTTAAGCAGCTTTTC 57.369 29.630 14.29 8.12 32.78 2.29
4086 4114 5.105635 TGGAACAGGATGCAAAATCTCAATC 60.106 40.000 0.00 0.00 42.53 2.67
4096 4124 4.497006 GCAAAATCTCAATCGAGGGTGATG 60.497 45.833 0.00 0.00 39.95 3.07
4098 4126 2.967599 TCTCAATCGAGGGTGATGTG 57.032 50.000 0.00 0.00 39.95 3.21
4101 4129 3.130516 TCTCAATCGAGGGTGATGTGTAC 59.869 47.826 0.00 0.00 39.95 2.90
4119 4147 7.337480 TGTGTACAGCTACGGAATTATTCTA 57.663 36.000 4.87 0.00 0.00 2.10
4120 4148 7.198390 TGTGTACAGCTACGGAATTATTCTAC 58.802 38.462 4.87 0.00 0.00 2.59
4123 4151 8.562892 TGTACAGCTACGGAATTATTCTACTAC 58.437 37.037 4.87 0.00 0.00 2.73
4142 4170 2.625737 ACAGATGATCACAGGAAAGCG 58.374 47.619 0.00 0.00 0.00 4.68
4161 4189 4.122776 AGCGTCCAACAGATGATATGTTC 58.877 43.478 1.94 0.00 38.80 3.18
4173 4201 8.099537 ACAGATGATATGTTCAAGGATGGTATC 58.900 37.037 0.00 0.00 38.03 2.24
4191 4219 4.514066 GGTATCAACCTTCACAACTTCGTT 59.486 41.667 0.00 0.00 43.08 3.85
4194 4222 4.196193 TCAACCTTCACAACTTCGTTGAT 58.804 39.130 13.11 0.00 45.28 2.57
4199 4227 2.832563 TCACAACTTCGTTGATGCAGA 58.167 42.857 13.11 1.59 45.28 4.26
4201 4229 3.814842 TCACAACTTCGTTGATGCAGAAT 59.185 39.130 13.11 0.00 45.28 2.40
4209 4237 5.375417 TCGTTGATGCAGAATTTTCACAT 57.625 34.783 0.00 0.00 0.00 3.21
4211 4239 4.325204 CGTTGATGCAGAATTTTCACATGG 59.675 41.667 0.00 0.00 0.00 3.66
4218 4246 5.011840 TGCAGAATTTTCACATGGAATTGGA 59.988 36.000 0.00 0.00 34.91 3.53
4221 4249 7.553334 CAGAATTTTCACATGGAATTGGAGAT 58.447 34.615 0.00 0.00 34.91 2.75
4235 4263 8.966868 TGGAATTGGAGATATTTTAGAACCAAC 58.033 33.333 0.00 0.00 38.45 3.77
4241 4269 9.886132 TGGAGATATTTTAGAACCAACTCTTAC 57.114 33.333 0.00 0.00 0.00 2.34
4251 4279 6.407202 AGAACCAACTCTTACCACATATGAC 58.593 40.000 10.38 0.00 0.00 3.06
4253 4281 4.464951 ACCAACTCTTACCACATATGACGA 59.535 41.667 10.38 0.00 0.00 4.20
4256 4284 5.263968 ACTCTTACCACATATGACGAAGG 57.736 43.478 10.38 5.65 0.00 3.46
4259 4287 5.198207 TCTTACCACATATGACGAAGGAGA 58.802 41.667 10.38 1.39 0.00 3.71
4264 4292 4.141937 CCACATATGACGAAGGAGAAGGAA 60.142 45.833 10.38 0.00 0.00 3.36
4265 4293 5.046529 CACATATGACGAAGGAGAAGGAAG 58.953 45.833 10.38 0.00 0.00 3.46
4266 4294 4.712337 ACATATGACGAAGGAGAAGGAAGT 59.288 41.667 10.38 0.00 0.00 3.01
4267 4295 5.187967 ACATATGACGAAGGAGAAGGAAGTT 59.812 40.000 10.38 0.00 0.00 2.66
4268 4296 4.625607 ATGACGAAGGAGAAGGAAGTTT 57.374 40.909 0.00 0.00 0.00 2.66
4270 4298 5.540400 TGACGAAGGAGAAGGAAGTTTTA 57.460 39.130 0.00 0.00 0.00 1.52
4272 4300 6.164176 TGACGAAGGAGAAGGAAGTTTTATC 58.836 40.000 0.00 0.00 0.00 1.75
4273 4301 6.014499 TGACGAAGGAGAAGGAAGTTTTATCT 60.014 38.462 0.00 0.00 0.00 1.98
4274 4302 6.399743 ACGAAGGAGAAGGAAGTTTTATCTC 58.600 40.000 0.00 0.00 36.62 2.75
4276 4304 6.311690 CGAAGGAGAAGGAAGTTTTATCTCAC 59.688 42.308 12.13 5.04 38.58 3.51
4280 4308 6.441088 AGAAGGAAGTTTTATCTCACTGGT 57.559 37.500 0.00 0.00 0.00 4.00
4281 4309 6.468543 AGAAGGAAGTTTTATCTCACTGGTC 58.531 40.000 0.00 0.00 0.00 4.02
4282 4310 6.271159 AGAAGGAAGTTTTATCTCACTGGTCT 59.729 38.462 0.00 0.00 0.00 3.85
4291 4319 9.447040 GTTTTATCTCACTGGTCTAAACAAAAC 57.553 33.333 0.00 0.00 0.00 2.43
4292 4320 8.974060 TTTATCTCACTGGTCTAAACAAAACT 57.026 30.769 0.00 0.00 0.00 2.66
4298 4326 6.017440 TCACTGGTCTAAACAAAACTATGTGC 60.017 38.462 0.00 0.00 32.81 4.57
4301 4329 5.594725 TGGTCTAAACAAAACTATGTGCCAA 59.405 36.000 0.00 0.00 32.81 4.52
4302 4330 6.096987 TGGTCTAAACAAAACTATGTGCCAAA 59.903 34.615 0.00 0.00 32.81 3.28
4304 4332 6.975772 GTCTAAACAAAACTATGTGCCAAACA 59.024 34.615 0.00 0.00 44.79 2.83
4311 4339 4.021102 ACTATGTGCCAAACAACTAGCT 57.979 40.909 0.00 0.00 43.61 3.32
4312 4340 3.753272 ACTATGTGCCAAACAACTAGCTG 59.247 43.478 0.00 0.00 43.61 4.24
4333 4361 0.771127 ACTTGGCCTAAAGTGCTCCA 59.229 50.000 7.64 0.00 38.95 3.86
4337 4365 1.271379 TGGCCTAAAGTGCTCCAAGAC 60.271 52.381 3.32 0.00 0.00 3.01
4342 4370 3.686726 CCTAAAGTGCTCCAAGACATCAC 59.313 47.826 0.00 0.00 0.00 3.06
4349 4377 2.553028 GCTCCAAGACATCACCAAAGGA 60.553 50.000 0.00 0.00 0.00 3.36
4353 4381 3.599343 CAAGACATCACCAAAGGATCGA 58.401 45.455 0.00 0.00 0.00 3.59
4356 4384 1.628340 ACATCACCAAAGGATCGACCA 59.372 47.619 6.78 0.00 42.04 4.02
4361 4389 2.819608 CACCAAAGGATCGACCAACAAT 59.180 45.455 6.78 0.00 42.04 2.71
4362 4390 2.819608 ACCAAAGGATCGACCAACAATG 59.180 45.455 6.78 0.00 42.04 2.82
4384 4412 6.435430 TGGAGGATGTTTATGTTGAAATCG 57.565 37.500 0.00 0.00 0.00 3.34
4388 4416 7.361713 GGAGGATGTTTATGTTGAAATCGTCAA 60.362 37.037 0.00 0.00 44.20 3.18
4401 4429 7.818493 TGAAATCGTCAACATCAAACAAAAA 57.182 28.000 0.00 0.00 31.51 1.94
4476 4504 8.747538 TCTCTACTTTATTATCTTTTTGCCCC 57.252 34.615 0.00 0.00 0.00 5.80
4477 4505 8.333235 TCTCTACTTTATTATCTTTTTGCCCCA 58.667 33.333 0.00 0.00 0.00 4.96
4478 4506 8.288689 TCTACTTTATTATCTTTTTGCCCCAC 57.711 34.615 0.00 0.00 0.00 4.61
4479 4507 6.926630 ACTTTATTATCTTTTTGCCCCACA 57.073 33.333 0.00 0.00 0.00 4.17
4480 4508 7.494922 ACTTTATTATCTTTTTGCCCCACAT 57.505 32.000 0.00 0.00 0.00 3.21
4481 4509 7.330262 ACTTTATTATCTTTTTGCCCCACATG 58.670 34.615 0.00 0.00 0.00 3.21
4482 4510 7.180051 ACTTTATTATCTTTTTGCCCCACATGA 59.820 33.333 0.00 0.00 0.00 3.07
4483 4511 7.673641 TTATTATCTTTTTGCCCCACATGAT 57.326 32.000 0.00 0.00 0.00 2.45
4484 4512 6.564557 ATTATCTTTTTGCCCCACATGATT 57.435 33.333 0.00 0.00 0.00 2.57
4485 4513 7.673641 ATTATCTTTTTGCCCCACATGATTA 57.326 32.000 0.00 0.00 0.00 1.75
4486 4514 7.487822 TTATCTTTTTGCCCCACATGATTAA 57.512 32.000 0.00 0.00 0.00 1.40
4487 4515 5.404466 TCTTTTTGCCCCACATGATTAAG 57.596 39.130 0.00 0.00 0.00 1.85
4488 4516 3.608316 TTTTGCCCCACATGATTAAGC 57.392 42.857 0.00 0.00 0.00 3.09
4489 4517 2.530460 TTGCCCCACATGATTAAGCT 57.470 45.000 0.00 0.00 0.00 3.74
4490 4518 2.530460 TGCCCCACATGATTAAGCTT 57.470 45.000 3.48 3.48 0.00 3.74
4491 4519 2.101783 TGCCCCACATGATTAAGCTTG 58.898 47.619 9.86 5.16 0.00 4.01
4492 4520 2.102578 GCCCCACATGATTAAGCTTGT 58.897 47.619 9.86 6.44 0.00 3.16
4493 4521 2.099756 GCCCCACATGATTAAGCTTGTC 59.900 50.000 9.86 7.95 0.00 3.18
4494 4522 3.355378 CCCCACATGATTAAGCTTGTCA 58.645 45.455 9.86 13.57 0.00 3.58
4495 4523 3.763360 CCCCACATGATTAAGCTTGTCAA 59.237 43.478 16.96 1.93 0.00 3.18
4496 4524 4.403432 CCCCACATGATTAAGCTTGTCAAT 59.597 41.667 16.96 6.56 0.00 2.57
4497 4525 5.593909 CCCCACATGATTAAGCTTGTCAATA 59.406 40.000 16.96 0.00 0.00 1.90
4498 4526 6.096705 CCCCACATGATTAAGCTTGTCAATAA 59.903 38.462 16.96 1.01 0.00 1.40
4499 4527 7.198390 CCCACATGATTAAGCTTGTCAATAAG 58.802 38.462 16.96 11.28 0.00 1.73
4500 4528 7.148018 CCCACATGATTAAGCTTGTCAATAAGT 60.148 37.037 16.96 11.73 0.00 2.24
4501 4529 7.699391 CCACATGATTAAGCTTGTCAATAAGTG 59.301 37.037 16.96 18.81 0.00 3.16
4502 4530 8.453320 CACATGATTAAGCTTGTCAATAAGTGA 58.547 33.333 16.96 0.00 0.00 3.41
4503 4531 9.182214 ACATGATTAAGCTTGTCAATAAGTGAT 57.818 29.630 16.96 0.28 38.90 3.06
4504 4532 9.661187 CATGATTAAGCTTGTCAATAAGTGATC 57.339 33.333 16.96 0.00 38.90 2.92
4505 4533 9.624373 ATGATTAAGCTTGTCAATAAGTGATCT 57.376 29.630 16.96 0.00 38.90 2.75
4511 4539 9.757227 AAGCTTGTCAATAAGTGATCTACTATC 57.243 33.333 0.00 0.00 39.18 2.08
4512 4540 9.142014 AGCTTGTCAATAAGTGATCTACTATCT 57.858 33.333 0.00 0.00 39.18 1.98
4522 4550 8.472007 AAGTGATCTACTATCTAGAAGTTGGG 57.528 38.462 11.25 5.24 39.18 4.12
4523 4551 7.007723 AGTGATCTACTATCTAGAAGTTGGGG 58.992 42.308 11.25 3.55 38.04 4.96
4524 4552 6.209788 GTGATCTACTATCTAGAAGTTGGGGG 59.790 46.154 11.25 1.88 0.00 5.40
4525 4553 4.481072 TCTACTATCTAGAAGTTGGGGGC 58.519 47.826 11.25 0.00 0.00 5.80
4526 4554 3.423058 ACTATCTAGAAGTTGGGGGCT 57.577 47.619 0.00 0.00 0.00 5.19
4527 4555 3.737263 ACTATCTAGAAGTTGGGGGCTT 58.263 45.455 0.00 0.00 0.00 4.35
4528 4556 3.456277 ACTATCTAGAAGTTGGGGGCTTG 59.544 47.826 0.00 0.00 0.00 4.01
4529 4557 0.328258 TCTAGAAGTTGGGGGCTTGC 59.672 55.000 0.00 0.00 0.00 4.01
4530 4558 0.329596 CTAGAAGTTGGGGGCTTGCT 59.670 55.000 0.00 0.00 0.00 3.91
4531 4559 1.559682 CTAGAAGTTGGGGGCTTGCTA 59.440 52.381 0.00 0.00 0.00 3.49
4532 4560 0.038310 AGAAGTTGGGGGCTTGCTAC 59.962 55.000 0.00 0.00 0.00 3.58
4533 4561 0.038310 GAAGTTGGGGGCTTGCTACT 59.962 55.000 0.00 0.00 0.00 2.57
4534 4562 1.280998 GAAGTTGGGGGCTTGCTACTA 59.719 52.381 0.00 0.00 0.00 1.82
4535 4563 1.596496 AGTTGGGGGCTTGCTACTAT 58.404 50.000 0.00 0.00 0.00 2.12
4536 4564 1.923148 AGTTGGGGGCTTGCTACTATT 59.077 47.619 0.00 0.00 0.00 1.73
4537 4565 2.311841 AGTTGGGGGCTTGCTACTATTT 59.688 45.455 0.00 0.00 0.00 1.40
4538 4566 3.096852 GTTGGGGGCTTGCTACTATTTT 58.903 45.455 0.00 0.00 0.00 1.82
4539 4567 3.466395 TGGGGGCTTGCTACTATTTTT 57.534 42.857 0.00 0.00 0.00 1.94
4561 4589 7.856145 TTTTTGATAAATGTGTGTTGCCTTT 57.144 28.000 0.00 0.00 0.00 3.11
4562 4590 7.856145 TTTTGATAAATGTGTGTTGCCTTTT 57.144 28.000 0.00 0.00 0.00 2.27
4563 4591 6.841443 TTGATAAATGTGTGTTGCCTTTTG 57.159 33.333 0.00 0.00 0.00 2.44
4564 4592 5.911752 TGATAAATGTGTGTTGCCTTTTGT 58.088 33.333 0.00 0.00 0.00 2.83
4565 4593 7.043961 TGATAAATGTGTGTTGCCTTTTGTA 57.956 32.000 0.00 0.00 0.00 2.41
4566 4594 7.492524 TGATAAATGTGTGTTGCCTTTTGTAA 58.507 30.769 0.00 0.00 0.00 2.41
4567 4595 7.436673 TGATAAATGTGTGTTGCCTTTTGTAAC 59.563 33.333 0.00 0.00 39.72 2.50
4568 4596 5.337578 AATGTGTGTTGCCTTTTGTAACT 57.662 34.783 0.00 0.00 39.94 2.24
4569 4597 4.792521 TGTGTGTTGCCTTTTGTAACTT 57.207 36.364 0.00 0.00 39.94 2.66
4570 4598 4.739195 TGTGTGTTGCCTTTTGTAACTTC 58.261 39.130 0.00 0.00 39.94 3.01
4571 4599 4.461081 TGTGTGTTGCCTTTTGTAACTTCT 59.539 37.500 0.00 0.00 39.94 2.85
4572 4600 5.034797 GTGTGTTGCCTTTTGTAACTTCTC 58.965 41.667 0.00 0.00 39.94 2.87
4573 4601 4.097286 TGTGTTGCCTTTTGTAACTTCTCC 59.903 41.667 0.00 0.00 39.94 3.71
4574 4602 3.634910 TGTTGCCTTTTGTAACTTCTCCC 59.365 43.478 0.00 0.00 39.94 4.30
4575 4603 3.876309 TGCCTTTTGTAACTTCTCCCT 57.124 42.857 0.00 0.00 0.00 4.20
4576 4604 4.178956 TGCCTTTTGTAACTTCTCCCTT 57.821 40.909 0.00 0.00 0.00 3.95
4577 4605 4.142038 TGCCTTTTGTAACTTCTCCCTTC 58.858 43.478 0.00 0.00 0.00 3.46
4578 4606 4.142038 GCCTTTTGTAACTTCTCCCTTCA 58.858 43.478 0.00 0.00 0.00 3.02
4579 4607 4.216472 GCCTTTTGTAACTTCTCCCTTCAG 59.784 45.833 0.00 0.00 0.00 3.02
4580 4608 4.216472 CCTTTTGTAACTTCTCCCTTCAGC 59.784 45.833 0.00 0.00 0.00 4.26
4581 4609 4.706842 TTTGTAACTTCTCCCTTCAGCT 57.293 40.909 0.00 0.00 0.00 4.24
4582 4610 5.818678 TTTGTAACTTCTCCCTTCAGCTA 57.181 39.130 0.00 0.00 0.00 3.32
4583 4611 6.374417 TTTGTAACTTCTCCCTTCAGCTAT 57.626 37.500 0.00 0.00 0.00 2.97
4584 4612 5.344743 TGTAACTTCTCCCTTCAGCTATG 57.655 43.478 0.00 0.00 0.00 2.23
4585 4613 4.777896 TGTAACTTCTCCCTTCAGCTATGT 59.222 41.667 0.00 0.00 0.00 2.29
4586 4614 3.902881 ACTTCTCCCTTCAGCTATGTG 57.097 47.619 0.00 0.00 0.00 3.21
4587 4615 2.093235 ACTTCTCCCTTCAGCTATGTGC 60.093 50.000 0.00 0.00 43.29 4.57
4588 4616 1.571955 TCTCCCTTCAGCTATGTGCA 58.428 50.000 0.00 0.00 45.94 4.57
4589 4617 1.908619 TCTCCCTTCAGCTATGTGCAA 59.091 47.619 0.00 0.00 45.94 4.08
4590 4618 2.507058 TCTCCCTTCAGCTATGTGCAAT 59.493 45.455 0.00 0.00 45.94 3.56
4591 4619 3.054139 TCTCCCTTCAGCTATGTGCAATT 60.054 43.478 0.00 0.00 45.94 2.32
4592 4620 3.282021 TCCCTTCAGCTATGTGCAATTC 58.718 45.455 0.00 0.00 45.94 2.17
4593 4621 3.018856 CCCTTCAGCTATGTGCAATTCA 58.981 45.455 0.00 0.00 45.94 2.57
4744 4772 5.479724 TGATATTCAGGTTGAATGCCAAACA 59.520 36.000 13.13 0.00 45.77 2.83
4813 4841 2.598565 CGGAGATTAGGATGGAGGTGA 58.401 52.381 0.00 0.00 0.00 4.02
4882 4912 1.609783 GGCAAGATGGGCTACCTGT 59.390 57.895 0.00 0.00 37.76 4.00
4892 4922 3.001514 CTACCTGTGCCTGGCCAT 58.998 61.111 17.53 2.64 0.00 4.40
4900 4930 0.680921 GTGCCTGGCCATTGAAGCTA 60.681 55.000 17.53 0.00 0.00 3.32
4917 4947 1.382009 TAGGGGTGGATGCACGCTA 60.382 57.895 28.68 17.89 38.00 4.26
4923 4953 2.105128 GGATGCACGCTAGTCGCT 59.895 61.111 6.50 0.00 43.23 4.93
4924 4954 1.359117 GGATGCACGCTAGTCGCTA 59.641 57.895 6.50 0.00 43.23 4.26
4935 4965 2.350388 GCTAGTCGCTAGATCTCAGTGC 60.350 54.545 15.28 0.00 36.26 4.40
4955 4985 2.470938 GAAAGCAGGGCGGGAGAGTT 62.471 60.000 0.00 0.00 0.00 3.01
4978 5008 4.388499 GGCCGCTGGAACTCGGAA 62.388 66.667 4.73 0.00 44.91 4.30
4981 5011 1.218047 CCGCTGGAACTCGGAATGA 59.782 57.895 0.00 0.00 44.91 2.57
4986 5016 0.035439 TGGAACTCGGAATGAAGGCC 60.035 55.000 0.00 0.00 0.00 5.19
5013 5043 3.170362 CCAGAGCTTGGGGTGGAA 58.830 61.111 6.96 0.00 43.75 3.53
5049 5123 2.045242 ACCGACGGCTAGAGCTCA 60.045 61.111 17.77 0.82 41.70 4.26
5050 5124 1.454111 ACCGACGGCTAGAGCTCAT 60.454 57.895 17.77 3.63 41.70 2.90
5080 5155 0.828343 GTCGGGATAGGCTACCTGCT 60.828 60.000 13.85 0.00 42.39 4.24
5089 5164 3.458163 CTACCTGCTTCGGGCCGA 61.458 66.667 27.46 27.46 40.92 5.54
5140 5215 1.979693 GAGCTCGAGGTGGAGGTGT 60.980 63.158 23.97 0.00 44.25 4.16
5141 5216 2.219325 GAGCTCGAGGTGGAGGTGTG 62.219 65.000 23.97 0.00 44.25 3.82
5142 5217 2.574955 GCTCGAGGTGGAGGTGTGT 61.575 63.158 15.58 0.00 34.56 3.72
5143 5218 2.050269 CTCGAGGTGGAGGTGTGTT 58.950 57.895 3.91 0.00 0.00 3.32
5144 5219 0.319900 CTCGAGGTGGAGGTGTGTTG 60.320 60.000 3.91 0.00 0.00 3.33
5145 5220 1.301716 CGAGGTGGAGGTGTGTTGG 60.302 63.158 0.00 0.00 0.00 3.77
5146 5221 1.754380 CGAGGTGGAGGTGTGTTGGA 61.754 60.000 0.00 0.00 0.00 3.53
5147 5222 0.035458 GAGGTGGAGGTGTGTTGGAG 59.965 60.000 0.00 0.00 0.00 3.86
5148 5223 0.694444 AGGTGGAGGTGTGTTGGAGT 60.694 55.000 0.00 0.00 0.00 3.85
5149 5224 0.182775 GGTGGAGGTGTGTTGGAGTT 59.817 55.000 0.00 0.00 0.00 3.01
5150 5225 1.308998 GTGGAGGTGTGTTGGAGTTG 58.691 55.000 0.00 0.00 0.00 3.16
5151 5226 0.916086 TGGAGGTGTGTTGGAGTTGT 59.084 50.000 0.00 0.00 0.00 3.32
5152 5227 1.308998 GGAGGTGTGTTGGAGTTGTG 58.691 55.000 0.00 0.00 0.00 3.33
5153 5228 1.408266 GGAGGTGTGTTGGAGTTGTGT 60.408 52.381 0.00 0.00 0.00 3.72
5154 5229 1.940613 GAGGTGTGTTGGAGTTGTGTC 59.059 52.381 0.00 0.00 0.00 3.67
5155 5230 0.655733 GGTGTGTTGGAGTTGTGTCG 59.344 55.000 0.00 0.00 0.00 4.35
5156 5231 1.647346 GTGTGTTGGAGTTGTGTCGA 58.353 50.000 0.00 0.00 0.00 4.20
5157 5232 2.004017 GTGTGTTGGAGTTGTGTCGAA 58.996 47.619 0.00 0.00 0.00 3.71
5158 5233 2.612212 GTGTGTTGGAGTTGTGTCGAAT 59.388 45.455 0.00 0.00 0.00 3.34
5159 5234 3.805422 GTGTGTTGGAGTTGTGTCGAATA 59.195 43.478 0.00 0.00 0.00 1.75
5160 5235 4.451096 GTGTGTTGGAGTTGTGTCGAATAT 59.549 41.667 0.00 0.00 0.00 1.28
5161 5236 5.049680 GTGTGTTGGAGTTGTGTCGAATATT 60.050 40.000 0.00 0.00 0.00 1.28
5162 5237 5.049749 TGTGTTGGAGTTGTGTCGAATATTG 60.050 40.000 0.00 0.00 0.00 1.90
5163 5238 5.049680 GTGTTGGAGTTGTGTCGAATATTGT 60.050 40.000 0.00 0.00 0.00 2.71
5164 5239 5.049749 TGTTGGAGTTGTGTCGAATATTGTG 60.050 40.000 0.00 0.00 0.00 3.33
5165 5240 4.637276 TGGAGTTGTGTCGAATATTGTGT 58.363 39.130 0.00 0.00 0.00 3.72
5166 5241 5.785243 TGGAGTTGTGTCGAATATTGTGTA 58.215 37.500 0.00 0.00 0.00 2.90
5167 5242 5.636121 TGGAGTTGTGTCGAATATTGTGTAC 59.364 40.000 0.00 0.00 0.00 2.90
5168 5243 5.636121 GGAGTTGTGTCGAATATTGTGTACA 59.364 40.000 0.00 0.00 0.00 2.90
5169 5244 6.146510 GGAGTTGTGTCGAATATTGTGTACAA 59.853 38.462 0.00 0.00 40.51 2.41
5170 5245 7.117241 AGTTGTGTCGAATATTGTGTACAAG 57.883 36.000 0.00 0.00 39.47 3.16
5171 5246 6.147164 AGTTGTGTCGAATATTGTGTACAAGG 59.853 38.462 0.00 0.00 39.47 3.61
5172 5247 5.543714 TGTGTCGAATATTGTGTACAAGGT 58.456 37.500 0.00 0.00 39.47 3.50
5173 5248 6.689554 TGTGTCGAATATTGTGTACAAGGTA 58.310 36.000 0.00 0.00 39.47 3.08
5174 5249 6.809689 TGTGTCGAATATTGTGTACAAGGTAG 59.190 38.462 0.00 0.00 39.47 3.18
5175 5250 6.255020 GTGTCGAATATTGTGTACAAGGTAGG 59.745 42.308 0.00 0.00 39.47 3.18
5176 5251 6.071221 TGTCGAATATTGTGTACAAGGTAGGT 60.071 38.462 0.00 0.00 39.47 3.08
5177 5252 6.815142 GTCGAATATTGTGTACAAGGTAGGTT 59.185 38.462 0.00 0.00 39.47 3.50
5178 5253 7.975616 GTCGAATATTGTGTACAAGGTAGGTTA 59.024 37.037 0.00 0.00 39.47 2.85
5179 5254 7.975616 TCGAATATTGTGTACAAGGTAGGTTAC 59.024 37.037 0.00 0.00 39.47 2.50
5180 5255 7.760794 CGAATATTGTGTACAAGGTAGGTTACA 59.239 37.037 0.00 0.00 39.47 2.41
5181 5256 9.439500 GAATATTGTGTACAAGGTAGGTTACAA 57.561 33.333 0.00 0.00 39.47 2.41
5182 5257 9.969001 AATATTGTGTACAAGGTAGGTTACAAT 57.031 29.630 0.00 0.00 39.47 2.71
5183 5258 9.969001 ATATTGTGTACAAGGTAGGTTACAATT 57.031 29.630 0.00 0.00 39.47 2.32
5184 5259 7.499321 TTGTGTACAAGGTAGGTTACAATTG 57.501 36.000 3.24 3.24 34.79 2.32
5185 5260 5.998981 TGTGTACAAGGTAGGTTACAATTGG 59.001 40.000 10.83 0.00 33.66 3.16
5186 5261 6.183361 TGTGTACAAGGTAGGTTACAATTGGA 60.183 38.462 10.83 0.00 33.66 3.53
5187 5262 6.882678 GTGTACAAGGTAGGTTACAATTGGAT 59.117 38.462 10.83 0.00 33.66 3.41
5188 5263 7.392393 GTGTACAAGGTAGGTTACAATTGGATT 59.608 37.037 10.83 0.00 33.66 3.01
5189 5264 7.945664 TGTACAAGGTAGGTTACAATTGGATTT 59.054 33.333 10.83 0.00 33.66 2.17
5190 5265 7.227049 ACAAGGTAGGTTACAATTGGATTTG 57.773 36.000 10.83 4.10 33.66 2.32
5191 5266 6.780522 ACAAGGTAGGTTACAATTGGATTTGT 59.219 34.615 10.83 4.65 42.31 2.83
5192 5267 7.945664 ACAAGGTAGGTTACAATTGGATTTGTA 59.054 33.333 10.83 0.00 40.25 2.41
5193 5268 8.458843 CAAGGTAGGTTACAATTGGATTTGTAG 58.541 37.037 10.83 0.00 41.65 2.74
5194 5269 7.696017 AGGTAGGTTACAATTGGATTTGTAGT 58.304 34.615 10.83 0.00 41.65 2.73
5195 5270 8.168058 AGGTAGGTTACAATTGGATTTGTAGTT 58.832 33.333 10.83 0.00 41.65 2.24
5196 5271 8.799367 GGTAGGTTACAATTGGATTTGTAGTTT 58.201 33.333 10.83 0.00 41.65 2.66
5221 5296 9.976511 TTTATTGTGTTTAGATAGGATACGGAG 57.023 33.333 0.00 0.00 46.39 4.63
5223 5298 7.414222 TTGTGTTTAGATAGGATACGGAGTT 57.586 36.000 0.00 0.00 37.78 3.01
5224 5299 6.802608 TGTGTTTAGATAGGATACGGAGTTG 58.197 40.000 0.00 0.00 37.78 3.16
5225 5300 6.379133 TGTGTTTAGATAGGATACGGAGTTGT 59.621 38.462 0.00 0.00 37.78 3.32
5226 5301 6.696148 GTGTTTAGATAGGATACGGAGTTGTG 59.304 42.308 0.00 0.00 37.78 3.33
5227 5302 6.379133 TGTTTAGATAGGATACGGAGTTGTGT 59.621 38.462 0.00 0.00 37.78 3.72
5228 5303 6.630444 TTAGATAGGATACGGAGTTGTGTC 57.370 41.667 0.00 0.00 37.78 3.67
5229 5304 3.890147 AGATAGGATACGGAGTTGTGTCC 59.110 47.826 1.88 1.88 47.00 4.02
5231 5306 2.754946 GGATACGGAGTTGTGTCCAA 57.245 50.000 4.99 0.00 46.19 3.53
5232 5307 2.618053 GGATACGGAGTTGTGTCCAAG 58.382 52.381 4.99 0.00 46.19 3.61
5233 5308 2.028385 GGATACGGAGTTGTGTCCAAGT 60.028 50.000 4.99 0.00 46.19 3.16
5234 5309 3.194116 GGATACGGAGTTGTGTCCAAGTA 59.806 47.826 4.99 0.00 46.19 2.24
5235 5310 4.322198 GGATACGGAGTTGTGTCCAAGTAA 60.322 45.833 4.99 0.00 46.19 2.24
5236 5311 3.107642 ACGGAGTTGTGTCCAAGTAAG 57.892 47.619 0.00 0.00 37.78 2.34
5237 5312 2.696707 ACGGAGTTGTGTCCAAGTAAGA 59.303 45.455 0.00 0.00 37.78 2.10
5238 5313 3.057734 CGGAGTTGTGTCCAAGTAAGAC 58.942 50.000 0.00 0.00 36.23 3.01
5239 5314 3.491964 CGGAGTTGTGTCCAAGTAAGACA 60.492 47.826 0.00 0.00 41.84 3.41
5252 5327 5.470047 AAGTAAGACACTTGTGTCCTAGG 57.530 43.478 24.78 0.82 46.01 3.02
5253 5328 2.841442 AAGACACTTGTGTCCTAGGC 57.159 50.000 24.78 0.00 39.50 3.93
5254 5329 0.977395 AGACACTTGTGTCCTAGGCC 59.023 55.000 24.78 0.00 39.50 5.19
5255 5330 0.977395 GACACTTGTGTCCTAGGCCT 59.023 55.000 19.77 11.78 32.97 5.19
5256 5331 0.977395 ACACTTGTGTCCTAGGCCTC 59.023 55.000 9.68 0.00 0.00 4.70
5257 5332 1.270907 CACTTGTGTCCTAGGCCTCT 58.729 55.000 9.68 0.00 0.00 3.69
5258 5333 2.225293 ACACTTGTGTCCTAGGCCTCTA 60.225 50.000 9.68 0.00 0.00 2.43
5259 5334 2.832129 CACTTGTGTCCTAGGCCTCTAA 59.168 50.000 9.68 0.00 0.00 2.10
5260 5335 3.452627 CACTTGTGTCCTAGGCCTCTAAT 59.547 47.826 9.68 0.00 0.00 1.73
5261 5336 4.649674 CACTTGTGTCCTAGGCCTCTAATA 59.350 45.833 9.68 0.00 0.00 0.98
5262 5337 5.305644 CACTTGTGTCCTAGGCCTCTAATAT 59.694 44.000 9.68 0.00 0.00 1.28
5263 5338 6.493802 CACTTGTGTCCTAGGCCTCTAATATA 59.506 42.308 9.68 0.00 0.00 0.86
5264 5339 7.179338 CACTTGTGTCCTAGGCCTCTAATATAT 59.821 40.741 9.68 0.00 0.00 0.86
5265 5340 8.399529 ACTTGTGTCCTAGGCCTCTAATATATA 58.600 37.037 9.68 0.00 0.00 0.86
5266 5341 8.824756 TTGTGTCCTAGGCCTCTAATATATAG 57.175 38.462 9.68 0.00 0.00 1.31
5267 5342 6.834451 TGTGTCCTAGGCCTCTAATATATAGC 59.166 42.308 9.68 0.00 0.00 2.97
5268 5343 6.016943 GTGTCCTAGGCCTCTAATATATAGCG 60.017 46.154 9.68 0.00 0.00 4.26
5269 5344 5.474189 GTCCTAGGCCTCTAATATATAGCGG 59.526 48.000 9.68 0.00 0.00 5.52
5270 5345 4.767928 CCTAGGCCTCTAATATATAGCGGG 59.232 50.000 9.68 0.00 0.00 6.13
5271 5346 3.577919 AGGCCTCTAATATATAGCGGGG 58.422 50.000 0.00 0.00 0.00 5.73
5272 5347 2.633481 GGCCTCTAATATATAGCGGGGG 59.367 54.545 0.00 0.00 0.00 5.40
5273 5348 3.306613 GCCTCTAATATATAGCGGGGGT 58.693 50.000 0.00 0.00 0.00 4.95
5274 5349 4.477249 GCCTCTAATATATAGCGGGGGTA 58.523 47.826 0.00 0.00 0.00 3.69
5275 5350 4.523558 GCCTCTAATATATAGCGGGGGTAG 59.476 50.000 0.00 0.00 0.00 3.18
5276 5351 5.692242 GCCTCTAATATATAGCGGGGGTAGA 60.692 48.000 0.00 0.00 0.00 2.59
5277 5352 5.769162 CCTCTAATATATAGCGGGGGTAGAC 59.231 48.000 0.00 0.00 0.00 2.59
5278 5353 6.331577 TCTAATATATAGCGGGGGTAGACA 57.668 41.667 0.00 0.00 0.00 3.41
5279 5354 6.125029 TCTAATATATAGCGGGGGTAGACAC 58.875 44.000 0.00 0.00 0.00 3.67
5280 5355 2.688902 ATATAGCGGGGGTAGACACA 57.311 50.000 0.00 0.00 0.00 3.72
5281 5356 1.991121 TATAGCGGGGGTAGACACAG 58.009 55.000 0.00 0.00 0.00 3.66
5282 5357 0.260816 ATAGCGGGGGTAGACACAGA 59.739 55.000 0.00 0.00 0.00 3.41
5283 5358 0.040058 TAGCGGGGGTAGACACAGAA 59.960 55.000 0.00 0.00 0.00 3.02
5284 5359 0.617820 AGCGGGGGTAGACACAGAAT 60.618 55.000 0.00 0.00 0.00 2.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 3.330853 CGACTCGCCGGCTTATGC 61.331 66.667 26.68 8.96 38.76 3.14
1 2 2.104331 ACGACTCGCCGGCTTATG 59.896 61.111 26.68 13.69 0.00 1.90
2 3 2.104331 CACGACTCGCCGGCTTAT 59.896 61.111 26.68 9.14 0.00 1.73
3 4 4.124351 CCACGACTCGCCGGCTTA 62.124 66.667 26.68 11.82 0.00 3.09
12 13 1.852067 AAATGCAACGCCCACGACTC 61.852 55.000 0.00 0.00 43.93 3.36
13 14 1.452145 AAAATGCAACGCCCACGACT 61.452 50.000 0.00 0.00 43.93 4.18
14 15 0.596341 AAAAATGCAACGCCCACGAC 60.596 50.000 0.00 0.00 43.93 4.34
15 16 0.596083 CAAAAATGCAACGCCCACGA 60.596 50.000 0.00 0.00 43.93 4.35
16 17 2.156846 GCAAAAATGCAACGCCCACG 62.157 55.000 0.00 0.00 39.02 4.94
17 18 1.569003 GCAAAAATGCAACGCCCAC 59.431 52.632 0.00 0.00 34.41 4.61
18 19 1.953138 CGCAAAAATGCAACGCCCA 60.953 52.632 0.00 0.00 34.41 5.36
19 20 2.852507 CGCAAAAATGCAACGCCC 59.147 55.556 0.00 0.00 34.41 6.13
20 21 2.170747 GCGCAAAAATGCAACGCC 59.829 55.556 0.30 0.00 43.58 5.68
21 22 2.201910 CGCGCAAAAATGCAACGC 60.202 55.556 8.75 0.00 45.72 4.84
22 23 2.201910 GCGCGCAAAAATGCAACG 60.202 55.556 29.10 8.36 37.17 4.10
23 24 1.154800 CAGCGCGCAAAAATGCAAC 60.155 52.632 35.10 0.00 34.41 4.17
24 25 2.941081 GCAGCGCGCAAAAATGCAA 61.941 52.632 35.10 0.00 41.79 4.08
25 26 2.469373 TAGCAGCGCGCAAAAATGCA 62.469 50.000 33.97 21.48 46.13 3.96
26 27 1.736249 CTAGCAGCGCGCAAAAATGC 61.736 55.000 35.10 31.28 46.13 3.56
27 28 0.179192 TCTAGCAGCGCGCAAAAATG 60.179 50.000 35.10 23.04 46.13 2.32
28 29 0.097674 CTCTAGCAGCGCGCAAAAAT 59.902 50.000 35.10 16.25 46.13 1.82
29 30 1.497278 CTCTAGCAGCGCGCAAAAA 59.503 52.632 35.10 14.87 46.13 1.94
30 31 3.027170 GCTCTAGCAGCGCGCAAAA 62.027 57.895 35.10 14.47 46.13 2.44
31 32 3.490759 GCTCTAGCAGCGCGCAAA 61.491 61.111 35.10 14.09 46.13 3.68
51 52 2.202285 TAAAATGCAGCGCGCGTG 60.202 55.556 32.35 26.47 46.97 5.34
52 53 2.098298 CTAAAATGCAGCGCGCGT 59.902 55.556 32.35 15.53 46.97 6.01
53 54 3.307262 GCTAAAATGCAGCGCGCG 61.307 61.111 28.44 28.44 46.97 6.86
58 59 2.951227 GCCGCGCTAAAATGCAGC 60.951 61.111 5.56 0.00 35.61 5.25
59 60 1.584483 CAGCCGCGCTAAAATGCAG 60.584 57.895 5.56 0.00 36.40 4.41
60 61 2.484662 CAGCCGCGCTAAAATGCA 59.515 55.556 5.56 0.00 36.40 3.96
61 62 2.951227 GCAGCCGCGCTAAAATGC 60.951 61.111 5.56 4.97 36.40 3.56
62 63 1.584483 CAGCAGCCGCGCTAAAATG 60.584 57.895 5.56 0.00 45.49 2.32
63 64 2.764314 CCAGCAGCCGCGCTAAAAT 61.764 57.895 5.56 0.00 45.49 1.82
64 65 3.430862 CCAGCAGCCGCGCTAAAA 61.431 61.111 5.56 0.00 45.49 1.52
65 66 4.386951 TCCAGCAGCCGCGCTAAA 62.387 61.111 5.56 0.00 45.49 1.85
66 67 4.819761 CTCCAGCAGCCGCGCTAA 62.820 66.667 5.56 1.87 45.49 3.09
102 103 3.451894 GCCCATCGCCTGGTTTGG 61.452 66.667 0.00 0.14 44.30 3.28
103 104 3.814268 CGCCCATCGCCTGGTTTG 61.814 66.667 0.00 0.00 44.30 2.93
113 114 4.776647 GTTTGCCGTGCGCCCATC 62.777 66.667 4.18 0.00 36.24 3.51
114 115 3.910914 TAGTTTGCCGTGCGCCCAT 62.911 57.895 4.18 0.00 36.24 4.00
115 116 4.627801 TAGTTTGCCGTGCGCCCA 62.628 61.111 4.18 0.00 36.24 5.36
116 117 3.799755 CTAGTTTGCCGTGCGCCC 61.800 66.667 4.18 0.00 36.24 6.13
117 118 3.023591 GACTAGTTTGCCGTGCGCC 62.024 63.158 4.18 0.00 36.24 6.53
118 119 1.566018 AAGACTAGTTTGCCGTGCGC 61.566 55.000 0.00 0.00 38.31 6.09
119 120 0.865769 AAAGACTAGTTTGCCGTGCG 59.134 50.000 0.00 0.00 0.00 5.34
120 121 2.650608 CAAAAGACTAGTTTGCCGTGC 58.349 47.619 0.00 0.00 0.00 5.34
126 127 1.318251 GCGCGCAAAAGACTAGTTTG 58.682 50.000 29.10 0.00 38.69 2.93
127 128 0.110823 CGCGCGCAAAAGACTAGTTT 60.111 50.000 32.61 0.00 0.00 2.66
128 129 1.491563 CGCGCGCAAAAGACTAGTT 59.508 52.632 32.61 0.00 0.00 2.24
129 130 2.380410 CCGCGCGCAAAAGACTAGT 61.380 57.895 32.61 0.00 0.00 2.57
130 131 2.395690 CCGCGCGCAAAAGACTAG 59.604 61.111 32.61 11.04 0.00 2.57
131 132 3.784412 GCCGCGCGCAAAAGACTA 61.784 61.111 32.61 0.00 37.47 2.59
151 152 3.423154 CTCCAACAGCCGCCGAAC 61.423 66.667 0.00 0.00 0.00 3.95
152 153 2.954684 ATCTCCAACAGCCGCCGAA 61.955 57.895 0.00 0.00 0.00 4.30
153 154 3.390521 ATCTCCAACAGCCGCCGA 61.391 61.111 0.00 0.00 0.00 5.54
154 155 3.197790 CATCTCCAACAGCCGCCG 61.198 66.667 0.00 0.00 0.00 6.46
155 156 3.512516 GCATCTCCAACAGCCGCC 61.513 66.667 0.00 0.00 0.00 6.13
156 157 2.437359 AGCATCTCCAACAGCCGC 60.437 61.111 0.00 0.00 0.00 6.53
157 158 3.805267 GAGCATCTCCAACAGCCG 58.195 61.111 0.00 0.00 0.00 5.52
168 169 5.805994 AGTTTGTAAGCTACGTAAGAGCATC 59.194 40.000 11.19 2.25 41.10 3.91
169 170 5.721232 AGTTTGTAAGCTACGTAAGAGCAT 58.279 37.500 11.19 1.87 41.10 3.79
170 171 5.130292 AGTTTGTAAGCTACGTAAGAGCA 57.870 39.130 11.19 0.00 41.10 4.26
171 172 7.328005 ACTTTAGTTTGTAAGCTACGTAAGAGC 59.672 37.037 0.35 0.35 43.62 4.09
172 173 8.739649 ACTTTAGTTTGTAAGCTACGTAAGAG 57.260 34.615 0.00 0.00 43.62 2.85
173 174 9.533253 AAACTTTAGTTTGTAAGCTACGTAAGA 57.467 29.630 7.05 0.00 45.55 2.10
177 178 9.097257 TGTTAAACTTTAGTTTGTAAGCTACGT 57.903 29.630 16.10 0.00 46.56 3.57
178 179 9.919348 TTGTTAAACTTTAGTTTGTAAGCTACG 57.081 29.630 16.10 0.00 46.56 3.51
204 205 9.453572 TGTGTCTGCATCTCTAAGAATTTTATT 57.546 29.630 0.00 0.00 0.00 1.40
205 206 9.624373 ATGTGTCTGCATCTCTAAGAATTTTAT 57.376 29.630 0.00 0.00 0.00 1.40
206 207 9.102757 GATGTGTCTGCATCTCTAAGAATTTTA 57.897 33.333 0.00 0.00 41.35 1.52
207 208 7.066766 GGATGTGTCTGCATCTCTAAGAATTTT 59.933 37.037 6.11 0.00 43.41 1.82
208 209 6.541641 GGATGTGTCTGCATCTCTAAGAATTT 59.458 38.462 6.11 0.00 43.41 1.82
209 210 6.054295 GGATGTGTCTGCATCTCTAAGAATT 58.946 40.000 6.11 0.00 43.41 2.17
210 211 5.366186 AGGATGTGTCTGCATCTCTAAGAAT 59.634 40.000 6.11 0.00 43.41 2.40
211 212 4.713814 AGGATGTGTCTGCATCTCTAAGAA 59.286 41.667 6.11 0.00 43.41 2.52
212 213 4.285020 AGGATGTGTCTGCATCTCTAAGA 58.715 43.478 6.11 0.00 43.41 2.10
213 214 4.669206 AGGATGTGTCTGCATCTCTAAG 57.331 45.455 6.11 0.00 43.41 2.18
214 215 4.223700 ACAAGGATGTGTCTGCATCTCTAA 59.776 41.667 6.11 0.00 43.41 2.10
215 216 3.771479 ACAAGGATGTGTCTGCATCTCTA 59.229 43.478 6.11 0.00 43.41 2.43
216 217 2.570752 ACAAGGATGTGTCTGCATCTCT 59.429 45.455 6.11 0.33 43.41 3.10
217 218 2.983229 ACAAGGATGTGTCTGCATCTC 58.017 47.619 6.11 0.00 43.41 2.75
218 219 3.261643 TGTACAAGGATGTGTCTGCATCT 59.738 43.478 0.00 0.00 43.41 2.90
219 220 3.599343 TGTACAAGGATGTGTCTGCATC 58.401 45.455 0.00 0.00 43.22 3.91
220 221 3.701205 TGTACAAGGATGTGTCTGCAT 57.299 42.857 0.00 0.00 40.84 3.96
221 222 3.244526 ACATGTACAAGGATGTGTCTGCA 60.245 43.478 0.00 0.00 40.84 4.41
222 223 3.125829 CACATGTACAAGGATGTGTCTGC 59.874 47.826 15.96 0.00 42.97 4.26
223 224 4.568956 TCACATGTACAAGGATGTGTCTG 58.431 43.478 20.97 5.88 46.39 3.51
224 225 4.284490 ACTCACATGTACAAGGATGTGTCT 59.716 41.667 20.97 9.26 46.39 3.41
225 226 4.389992 CACTCACATGTACAAGGATGTGTC 59.610 45.833 20.97 0.00 46.39 3.67
226 227 4.202357 ACACTCACATGTACAAGGATGTGT 60.202 41.667 20.97 18.53 46.39 3.72
228 229 4.202357 ACACACTCACATGTACAAGGATGT 60.202 41.667 0.00 0.00 43.74 3.06
229 230 4.318332 ACACACTCACATGTACAAGGATG 58.682 43.478 0.00 0.00 0.00 3.51
230 231 4.623932 ACACACTCACATGTACAAGGAT 57.376 40.909 0.00 0.00 0.00 3.24
231 232 4.415881 AACACACTCACATGTACAAGGA 57.584 40.909 0.00 0.00 0.00 3.36
232 233 4.261155 CCAAACACACTCACATGTACAAGG 60.261 45.833 0.00 0.00 0.00 3.61
233 234 4.261155 CCCAAACACACTCACATGTACAAG 60.261 45.833 0.00 0.00 0.00 3.16
234 235 3.629855 CCCAAACACACTCACATGTACAA 59.370 43.478 0.00 0.00 0.00 2.41
235 236 3.210227 CCCAAACACACTCACATGTACA 58.790 45.455 0.00 0.00 0.00 2.90
236 237 2.552315 CCCCAAACACACTCACATGTAC 59.448 50.000 0.00 0.00 0.00 2.90
237 238 2.173782 ACCCCAAACACACTCACATGTA 59.826 45.455 0.00 0.00 0.00 2.29
238 239 1.064017 ACCCCAAACACACTCACATGT 60.064 47.619 0.00 0.00 0.00 3.21
239 240 1.608590 GACCCCAAACACACTCACATG 59.391 52.381 0.00 0.00 0.00 3.21
240 241 1.813862 CGACCCCAAACACACTCACAT 60.814 52.381 0.00 0.00 0.00 3.21
241 242 0.462937 CGACCCCAAACACACTCACA 60.463 55.000 0.00 0.00 0.00 3.58
242 243 1.782028 GCGACCCCAAACACACTCAC 61.782 60.000 0.00 0.00 0.00 3.51
243 244 1.525077 GCGACCCCAAACACACTCA 60.525 57.895 0.00 0.00 0.00 3.41
244 245 2.604174 CGCGACCCCAAACACACTC 61.604 63.158 0.00 0.00 0.00 3.51
245 246 2.590575 CGCGACCCCAAACACACT 60.591 61.111 0.00 0.00 0.00 3.55
246 247 3.656045 CCGCGACCCCAAACACAC 61.656 66.667 8.23 0.00 0.00 3.82
247 248 4.178169 ACCGCGACCCCAAACACA 62.178 61.111 8.23 0.00 0.00 3.72
248 249 3.656045 CACCGCGACCCCAAACAC 61.656 66.667 8.23 0.00 0.00 3.32
249 250 4.178169 ACACCGCGACCCCAAACA 62.178 61.111 8.23 0.00 0.00 2.83
250 251 3.656045 CACACCGCGACCCCAAAC 61.656 66.667 8.23 0.00 0.00 2.93
251 252 4.178169 ACACACCGCGACCCCAAA 62.178 61.111 8.23 0.00 0.00 3.28
252 253 4.920112 CACACACCGCGACCCCAA 62.920 66.667 8.23 0.00 0.00 4.12
260 261 4.000557 CAGACGCACACACACCGC 62.001 66.667 0.00 0.00 0.00 5.68
261 262 4.000557 GCAGACGCACACACACCG 62.001 66.667 0.00 0.00 38.36 4.94
262 263 2.894879 TGCAGACGCACACACACC 60.895 61.111 0.00 0.00 45.36 4.16
279 280 3.469008 TTTCTCGGAACACACAGATGT 57.531 42.857 0.00 0.00 40.80 3.06
280 281 4.811555 TTTTTCTCGGAACACACAGATG 57.188 40.909 0.00 0.00 0.00 2.90
300 301 5.163416 CCCTCTCAAGTGTTCAACCATTTTT 60.163 40.000 0.00 0.00 0.00 1.94
301 302 4.342092 CCCTCTCAAGTGTTCAACCATTTT 59.658 41.667 0.00 0.00 0.00 1.82
302 303 3.891366 CCCTCTCAAGTGTTCAACCATTT 59.109 43.478 0.00 0.00 0.00 2.32
303 304 3.138283 TCCCTCTCAAGTGTTCAACCATT 59.862 43.478 0.00 0.00 0.00 3.16
304 305 2.711009 TCCCTCTCAAGTGTTCAACCAT 59.289 45.455 0.00 0.00 0.00 3.55
305 306 2.123589 TCCCTCTCAAGTGTTCAACCA 58.876 47.619 0.00 0.00 0.00 3.67
306 307 2.930826 TCCCTCTCAAGTGTTCAACC 57.069 50.000 0.00 0.00 0.00 3.77
307 308 5.305585 TGTTATCCCTCTCAAGTGTTCAAC 58.694 41.667 0.00 0.00 0.00 3.18
308 309 5.306937 TCTGTTATCCCTCTCAAGTGTTCAA 59.693 40.000 0.00 0.00 0.00 2.69
309 310 4.838423 TCTGTTATCCCTCTCAAGTGTTCA 59.162 41.667 0.00 0.00 0.00 3.18
310 311 5.172205 GTCTGTTATCCCTCTCAAGTGTTC 58.828 45.833 0.00 0.00 0.00 3.18
311 312 4.020128 GGTCTGTTATCCCTCTCAAGTGTT 60.020 45.833 0.00 0.00 0.00 3.32
312 313 3.515901 GGTCTGTTATCCCTCTCAAGTGT 59.484 47.826 0.00 0.00 0.00 3.55
313 314 3.429547 CGGTCTGTTATCCCTCTCAAGTG 60.430 52.174 0.00 0.00 0.00 3.16
314 315 2.761208 CGGTCTGTTATCCCTCTCAAGT 59.239 50.000 0.00 0.00 0.00 3.16
315 316 2.482142 GCGGTCTGTTATCCCTCTCAAG 60.482 54.545 0.00 0.00 0.00 3.02
316 317 1.480954 GCGGTCTGTTATCCCTCTCAA 59.519 52.381 0.00 0.00 0.00 3.02
317 318 1.112113 GCGGTCTGTTATCCCTCTCA 58.888 55.000 0.00 0.00 0.00 3.27
318 319 0.389757 GGCGGTCTGTTATCCCTCTC 59.610 60.000 0.00 0.00 0.00 3.20
319 320 1.049289 GGGCGGTCTGTTATCCCTCT 61.049 60.000 0.00 0.00 34.19 3.69
320 321 1.446366 GGGCGGTCTGTTATCCCTC 59.554 63.158 0.00 0.00 34.19 4.30
321 322 2.070650 GGGGCGGTCTGTTATCCCT 61.071 63.158 0.00 0.00 37.16 4.20
322 323 2.509422 GGGGCGGTCTGTTATCCC 59.491 66.667 0.00 0.00 36.25 3.85
323 324 2.108362 CGGGGCGGTCTGTTATCC 59.892 66.667 0.00 0.00 0.00 2.59
324 325 1.520787 CACGGGGCGGTCTGTTATC 60.521 63.158 0.00 0.00 0.00 1.75
325 326 2.234913 GACACGGGGCGGTCTGTTAT 62.235 60.000 0.00 0.00 0.00 1.89
326 327 2.918802 ACACGGGGCGGTCTGTTA 60.919 61.111 0.00 0.00 0.00 2.41
327 328 4.309950 GACACGGGGCGGTCTGTT 62.310 66.667 0.00 0.00 0.00 3.16
329 330 3.702284 TATTTGACACGGGGCGGTCTG 62.702 57.143 0.00 0.00 35.11 3.51
330 331 1.546589 TATTTGACACGGGGCGGTCT 61.547 55.000 0.00 0.00 35.11 3.85
331 332 0.674269 TTATTTGACACGGGGCGGTC 60.674 55.000 0.00 0.00 34.63 4.79
332 333 0.250814 TTTATTTGACACGGGGCGGT 60.251 50.000 0.00 0.00 0.00 5.68
333 334 0.882474 TTTTATTTGACACGGGGCGG 59.118 50.000 0.00 0.00 0.00 6.13
334 335 2.162608 TGATTTTATTTGACACGGGGCG 59.837 45.455 0.00 0.00 0.00 6.13
335 336 3.192633 ACTGATTTTATTTGACACGGGGC 59.807 43.478 0.00 0.00 0.00 5.80
336 337 5.385509 AACTGATTTTATTTGACACGGGG 57.614 39.130 0.00 0.00 0.00 5.73
337 338 8.980143 AATAAACTGATTTTATTTGACACGGG 57.020 30.769 0.00 0.00 44.66 5.28
349 350 9.934190 GCAAATTCACACAAATAAACTGATTTT 57.066 25.926 0.00 0.00 0.00 1.82
350 351 8.558700 GGCAAATTCACACAAATAAACTGATTT 58.441 29.630 0.00 0.00 0.00 2.17
351 352 7.933033 AGGCAAATTCACACAAATAAACTGATT 59.067 29.630 0.00 0.00 0.00 2.57
352 353 7.444299 AGGCAAATTCACACAAATAAACTGAT 58.556 30.769 0.00 0.00 0.00 2.90
353 354 6.815089 AGGCAAATTCACACAAATAAACTGA 58.185 32.000 0.00 0.00 0.00 3.41
354 355 7.224362 TCAAGGCAAATTCACACAAATAAACTG 59.776 33.333 0.00 0.00 0.00 3.16
355 356 7.271511 TCAAGGCAAATTCACACAAATAAACT 58.728 30.769 0.00 0.00 0.00 2.66
356 357 7.475771 TCAAGGCAAATTCACACAAATAAAC 57.524 32.000 0.00 0.00 0.00 2.01
357 358 8.674263 ATTCAAGGCAAATTCACACAAATAAA 57.326 26.923 0.00 0.00 0.00 1.40
358 359 9.421806 CTATTCAAGGCAAATTCACACAAATAA 57.578 29.630 0.00 0.00 0.00 1.40
359 360 8.801299 TCTATTCAAGGCAAATTCACACAAATA 58.199 29.630 0.00 0.00 0.00 1.40
360 361 7.669427 TCTATTCAAGGCAAATTCACACAAAT 58.331 30.769 0.00 0.00 0.00 2.32
361 362 7.048629 TCTATTCAAGGCAAATTCACACAAA 57.951 32.000 0.00 0.00 0.00 2.83
362 363 6.647334 TCTATTCAAGGCAAATTCACACAA 57.353 33.333 0.00 0.00 0.00 3.33
363 364 6.647334 TTCTATTCAAGGCAAATTCACACA 57.353 33.333 0.00 0.00 0.00 3.72
364 365 6.753744 GGATTCTATTCAAGGCAAATTCACAC 59.246 38.462 0.00 0.00 0.00 3.82
365 366 6.436847 TGGATTCTATTCAAGGCAAATTCACA 59.563 34.615 0.00 0.00 0.00 3.58
366 367 6.866480 TGGATTCTATTCAAGGCAAATTCAC 58.134 36.000 0.00 0.00 0.00 3.18
367 368 7.479352 TTGGATTCTATTCAAGGCAAATTCA 57.521 32.000 0.00 0.00 0.00 2.57
368 369 8.953368 AATTGGATTCTATTCAAGGCAAATTC 57.047 30.769 0.00 0.00 0.00 2.17
369 370 7.707893 CGAATTGGATTCTATTCAAGGCAAATT 59.292 33.333 8.61 0.00 35.74 1.82
370 371 7.147846 ACGAATTGGATTCTATTCAAGGCAAAT 60.148 33.333 8.61 0.00 35.74 2.32
371 372 6.152661 ACGAATTGGATTCTATTCAAGGCAAA 59.847 34.615 8.61 0.00 35.74 3.68
372 373 5.652014 ACGAATTGGATTCTATTCAAGGCAA 59.348 36.000 8.61 0.00 35.74 4.52
373 374 5.192927 ACGAATTGGATTCTATTCAAGGCA 58.807 37.500 8.61 0.00 35.74 4.75
374 375 5.278022 GGACGAATTGGATTCTATTCAAGGC 60.278 44.000 8.61 0.00 35.74 4.35
375 376 5.050091 CGGACGAATTGGATTCTATTCAAGG 60.050 44.000 8.61 0.00 35.74 3.61
376 377 5.559035 GCGGACGAATTGGATTCTATTCAAG 60.559 44.000 8.61 0.00 35.74 3.02
377 378 4.272504 GCGGACGAATTGGATTCTATTCAA 59.727 41.667 8.61 0.00 35.74 2.69
378 379 3.807622 GCGGACGAATTGGATTCTATTCA 59.192 43.478 8.61 0.00 35.74 2.57
379 380 3.807622 TGCGGACGAATTGGATTCTATTC 59.192 43.478 0.00 0.00 37.13 1.75
380 381 3.804036 TGCGGACGAATTGGATTCTATT 58.196 40.909 0.00 0.00 37.13 1.73
381 382 3.393800 CTGCGGACGAATTGGATTCTAT 58.606 45.455 0.00 0.00 37.13 1.98
382 383 2.821546 CTGCGGACGAATTGGATTCTA 58.178 47.619 0.00 0.00 37.13 2.10
383 384 1.656652 CTGCGGACGAATTGGATTCT 58.343 50.000 0.00 0.00 37.13 2.40
384 385 0.028110 GCTGCGGACGAATTGGATTC 59.972 55.000 0.00 0.00 35.94 2.52
385 386 0.392998 AGCTGCGGACGAATTGGATT 60.393 50.000 0.00 0.00 0.00 3.01
386 387 0.392998 AAGCTGCGGACGAATTGGAT 60.393 50.000 0.00 0.00 0.00 3.41
387 388 0.605319 AAAGCTGCGGACGAATTGGA 60.605 50.000 0.00 0.00 0.00 3.53
388 389 0.179189 GAAAGCTGCGGACGAATTGG 60.179 55.000 0.00 0.00 0.00 3.16
389 390 0.516877 TGAAAGCTGCGGACGAATTG 59.483 50.000 0.00 0.00 0.00 2.32
390 391 0.798776 CTGAAAGCTGCGGACGAATT 59.201 50.000 0.00 0.00 0.00 2.17
391 392 0.037326 TCTGAAAGCTGCGGACGAAT 60.037 50.000 0.00 0.00 0.00 3.34
392 393 0.667487 CTCTGAAAGCTGCGGACGAA 60.667 55.000 0.00 0.00 0.00 3.85
393 394 1.080501 CTCTGAAAGCTGCGGACGA 60.081 57.895 0.00 0.00 0.00 4.20
394 395 0.667487 TTCTCTGAAAGCTGCGGACG 60.667 55.000 0.00 0.00 0.00 4.79
395 396 1.663135 GATTCTCTGAAAGCTGCGGAC 59.337 52.381 0.00 0.00 0.00 4.79
396 397 1.552337 AGATTCTCTGAAAGCTGCGGA 59.448 47.619 0.00 0.00 0.00 5.54
397 398 2.021355 AGATTCTCTGAAAGCTGCGG 57.979 50.000 0.00 0.00 0.00 5.69
408 409 4.169508 CACATTTCGACGACAGATTCTCT 58.830 43.478 0.00 0.00 0.00 3.10
409 410 3.921021 ACACATTTCGACGACAGATTCTC 59.079 43.478 0.00 0.00 0.00 2.87
410 411 3.675225 CACACATTTCGACGACAGATTCT 59.325 43.478 0.00 0.00 0.00 2.40
411 412 3.673338 TCACACATTTCGACGACAGATTC 59.327 43.478 0.00 0.00 0.00 2.52
412 413 3.428870 GTCACACATTTCGACGACAGATT 59.571 43.478 0.00 0.00 0.00 2.40
413 414 2.987149 GTCACACATTTCGACGACAGAT 59.013 45.455 0.00 0.00 0.00 2.90
414 415 2.223618 TGTCACACATTTCGACGACAGA 60.224 45.455 0.00 0.00 32.17 3.41
415 416 2.124122 TGTCACACATTTCGACGACAG 58.876 47.619 0.00 0.00 32.17 3.51
416 417 2.211353 TGTCACACATTTCGACGACA 57.789 45.000 0.00 0.00 32.17 4.35
417 418 4.896562 TTATGTCACACATTTCGACGAC 57.103 40.909 0.00 0.00 39.88 4.34
418 419 5.908916 TTTTATGTCACACATTTCGACGA 57.091 34.783 0.00 0.00 39.88 4.20
419 420 6.577055 ACAATTTTATGTCACACATTTCGACG 59.423 34.615 0.00 0.00 39.88 5.12
420 421 7.851822 ACAATTTTATGTCACACATTTCGAC 57.148 32.000 0.00 0.00 39.88 4.20
425 426 8.924691 GCACATAACAATTTTATGTCACACATT 58.075 29.630 16.46 0.28 41.99 2.71
426 427 7.273164 CGCACATAACAATTTTATGTCACACAT 59.727 33.333 16.46 0.00 41.99 3.21
427 428 6.580416 CGCACATAACAATTTTATGTCACACA 59.420 34.615 16.46 0.00 41.99 3.72
428 429 6.580791 ACGCACATAACAATTTTATGTCACAC 59.419 34.615 16.46 9.89 41.99 3.82
429 430 6.580416 CACGCACATAACAATTTTATGTCACA 59.420 34.615 16.46 0.00 41.99 3.58
430 431 6.033407 CCACGCACATAACAATTTTATGTCAC 59.967 38.462 16.46 12.85 41.99 3.67
431 432 6.089476 CCACGCACATAACAATTTTATGTCA 58.911 36.000 16.46 0.00 41.99 3.58
432 433 5.004345 GCCACGCACATAACAATTTTATGTC 59.996 40.000 16.46 12.61 41.99 3.06
433 434 4.862018 GCCACGCACATAACAATTTTATGT 59.138 37.500 14.81 14.81 43.97 2.29
434 435 4.861462 TGCCACGCACATAACAATTTTATG 59.139 37.500 13.95 13.95 38.12 1.90
435 436 5.065704 TGCCACGCACATAACAATTTTAT 57.934 34.783 0.00 0.00 31.71 1.40
436 437 4.216472 TCTGCCACGCACATAACAATTTTA 59.784 37.500 0.00 0.00 33.79 1.52
437 438 3.005261 TCTGCCACGCACATAACAATTTT 59.995 39.130 0.00 0.00 33.79 1.82
438 439 2.556189 TCTGCCACGCACATAACAATTT 59.444 40.909 0.00 0.00 33.79 1.82
439 440 2.158559 TCTGCCACGCACATAACAATT 58.841 42.857 0.00 0.00 33.79 2.32
440 441 1.739466 CTCTGCCACGCACATAACAAT 59.261 47.619 0.00 0.00 33.79 2.71
441 442 1.155889 CTCTGCCACGCACATAACAA 58.844 50.000 0.00 0.00 33.79 2.83
442 443 0.320050 TCTCTGCCACGCACATAACA 59.680 50.000 0.00 0.00 33.79 2.41
443 444 1.656652 ATCTCTGCCACGCACATAAC 58.343 50.000 0.00 0.00 33.79 1.89
444 445 2.401583 AATCTCTGCCACGCACATAA 57.598 45.000 0.00 0.00 33.79 1.90
445 446 2.009051 CAAATCTCTGCCACGCACATA 58.991 47.619 0.00 0.00 33.79 2.29
446 447 0.806868 CAAATCTCTGCCACGCACAT 59.193 50.000 0.00 0.00 33.79 3.21
447 448 0.534877 ACAAATCTCTGCCACGCACA 60.535 50.000 0.00 0.00 33.79 4.57
448 449 1.128692 GTACAAATCTCTGCCACGCAC 59.871 52.381 0.00 0.00 33.79 5.34
449 450 1.270571 TGTACAAATCTCTGCCACGCA 60.271 47.619 0.00 0.00 36.92 5.24
450 451 1.128692 GTGTACAAATCTCTGCCACGC 59.871 52.381 0.00 0.00 0.00 5.34
451 452 1.390123 CGTGTACAAATCTCTGCCACG 59.610 52.381 0.00 0.00 38.08 4.94
452 453 2.412089 GTCGTGTACAAATCTCTGCCAC 59.588 50.000 0.00 0.00 0.00 5.01
453 454 2.299013 AGTCGTGTACAAATCTCTGCCA 59.701 45.455 0.00 0.00 0.00 4.92
454 455 2.960819 AGTCGTGTACAAATCTCTGCC 58.039 47.619 0.00 0.00 0.00 4.85
455 456 3.741344 ACAAGTCGTGTACAAATCTCTGC 59.259 43.478 0.00 0.00 39.29 4.26
456 457 4.386049 GGACAAGTCGTGTACAAATCTCTG 59.614 45.833 0.00 0.00 41.29 3.35
457 458 4.557205 GGACAAGTCGTGTACAAATCTCT 58.443 43.478 0.00 0.00 41.29 3.10
458 459 4.905412 GGACAAGTCGTGTACAAATCTC 57.095 45.455 0.00 0.00 41.29 2.75
465 466 2.217167 GTCGTTTGGACAAGTCGTGTAC 59.783 50.000 0.00 0.00 45.36 2.90
466 467 2.462889 GTCGTTTGGACAAGTCGTGTA 58.537 47.619 0.00 0.00 45.36 2.90
467 468 1.283736 GTCGTTTGGACAAGTCGTGT 58.716 50.000 0.00 0.00 45.36 4.49
476 477 1.808945 TCGAGGACTAGTCGTTTGGAC 59.191 52.381 18.54 5.50 46.45 4.02
477 478 2.189594 TCGAGGACTAGTCGTTTGGA 57.810 50.000 18.54 13.30 38.60 3.53
478 479 2.798680 CATCGAGGACTAGTCGTTTGG 58.201 52.381 18.54 11.46 38.60 3.28
479 480 2.186076 GCATCGAGGACTAGTCGTTTG 58.814 52.381 18.54 16.20 38.60 2.93
480 481 1.134560 GGCATCGAGGACTAGTCGTTT 59.865 52.381 18.54 6.23 38.60 3.60
481 482 0.739561 GGCATCGAGGACTAGTCGTT 59.260 55.000 18.54 8.74 38.60 3.85
482 483 0.107116 AGGCATCGAGGACTAGTCGT 60.107 55.000 17.63 17.63 38.60 4.34
483 484 1.025812 AAGGCATCGAGGACTAGTCG 58.974 55.000 5.55 6.46 38.84 4.18
484 485 3.551250 GCTTAAGGCATCGAGGACTAGTC 60.551 52.174 5.55 14.87 41.35 2.59
485 486 2.362717 GCTTAAGGCATCGAGGACTAGT 59.637 50.000 5.55 0.00 41.35 2.57
486 487 2.288518 GGCTTAAGGCATCGAGGACTAG 60.289 54.545 23.15 1.23 44.01 2.57
487 488 1.687123 GGCTTAAGGCATCGAGGACTA 59.313 52.381 23.15 0.00 44.01 2.59
488 489 0.466124 GGCTTAAGGCATCGAGGACT 59.534 55.000 23.15 0.00 44.01 3.85
489 490 0.178068 TGGCTTAAGGCATCGAGGAC 59.822 55.000 26.43 0.00 46.12 3.85
490 491 2.602890 TGGCTTAAGGCATCGAGGA 58.397 52.632 26.43 3.20 46.12 3.71
498 499 0.250727 TGTGACCACTGGCTTAAGGC 60.251 55.000 21.52 21.52 41.50 4.35
499 500 2.496899 ATGTGACCACTGGCTTAAGG 57.503 50.000 4.29 0.00 0.00 2.69
500 501 5.957842 TTTTATGTGACCACTGGCTTAAG 57.042 39.130 0.00 0.00 0.00 1.85
501 502 6.150976 CAGATTTTATGTGACCACTGGCTTAA 59.849 38.462 0.00 0.00 0.00 1.85
502 503 5.647658 CAGATTTTATGTGACCACTGGCTTA 59.352 40.000 0.00 0.00 0.00 3.09
503 504 4.460382 CAGATTTTATGTGACCACTGGCTT 59.540 41.667 0.00 0.00 0.00 4.35
504 505 4.012374 CAGATTTTATGTGACCACTGGCT 58.988 43.478 0.00 0.00 0.00 4.75
505 506 3.758554 ACAGATTTTATGTGACCACTGGC 59.241 43.478 0.00 0.00 0.00 4.85
506 507 5.241506 ACAACAGATTTTATGTGACCACTGG 59.758 40.000 0.00 0.00 0.00 4.00
507 508 6.205464 AGACAACAGATTTTATGTGACCACTG 59.795 38.462 1.62 0.00 0.00 3.66
508 509 6.205464 CAGACAACAGATTTTATGTGACCACT 59.795 38.462 1.62 0.00 0.00 4.00
509 510 6.017109 ACAGACAACAGATTTTATGTGACCAC 60.017 38.462 0.00 0.00 0.00 4.16
510 511 6.061441 ACAGACAACAGATTTTATGTGACCA 58.939 36.000 0.00 0.00 0.00 4.02
511 512 6.348540 GGACAGACAACAGATTTTATGTGACC 60.349 42.308 0.00 0.00 0.00 4.02
512 513 6.204688 TGGACAGACAACAGATTTTATGTGAC 59.795 38.462 0.00 0.00 0.00 3.67
513 514 6.295249 TGGACAGACAACAGATTTTATGTGA 58.705 36.000 0.00 0.00 0.00 3.58
514 515 6.558771 TGGACAGACAACAGATTTTATGTG 57.441 37.500 0.00 0.00 0.00 3.21
515 516 7.502226 TCTTTGGACAGACAACAGATTTTATGT 59.498 33.333 0.00 0.00 0.00 2.29
516 517 7.874940 TCTTTGGACAGACAACAGATTTTATG 58.125 34.615 0.00 0.00 0.00 1.90
517 518 8.641498 ATCTTTGGACAGACAACAGATTTTAT 57.359 30.769 0.00 0.00 30.91 1.40
518 519 8.463930 AATCTTTGGACAGACAACAGATTTTA 57.536 30.769 0.00 0.00 36.25 1.52
519 520 6.966534 ATCTTTGGACAGACAACAGATTTT 57.033 33.333 0.00 0.00 30.91 1.82
520 521 6.966534 AATCTTTGGACAGACAACAGATTT 57.033 33.333 0.00 0.00 36.25 2.17
521 522 8.517878 CAATAATCTTTGGACAGACAACAGATT 58.482 33.333 14.48 14.48 39.15 2.40
522 523 7.362401 GCAATAATCTTTGGACAGACAACAGAT 60.362 37.037 0.00 0.00 33.62 2.90
523 524 6.072508 GCAATAATCTTTGGACAGACAACAGA 60.073 38.462 0.00 0.00 0.00 3.41
524 525 6.088824 GCAATAATCTTTGGACAGACAACAG 58.911 40.000 0.00 0.00 0.00 3.16
525 526 5.534278 TGCAATAATCTTTGGACAGACAACA 59.466 36.000 0.00 0.00 0.00 3.33
526 527 6.012658 TGCAATAATCTTTGGACAGACAAC 57.987 37.500 0.00 0.00 0.00 3.32
527 528 6.647334 TTGCAATAATCTTTGGACAGACAA 57.353 33.333 0.00 0.00 0.00 3.18
528 529 5.335897 GCTTGCAATAATCTTTGGACAGACA 60.336 40.000 0.00 0.00 0.00 3.41
529 530 5.098211 GCTTGCAATAATCTTTGGACAGAC 58.902 41.667 0.00 0.00 0.00 3.51
530 531 5.012239 AGCTTGCAATAATCTTTGGACAGA 58.988 37.500 0.00 0.00 0.00 3.41
531 532 5.320549 AGCTTGCAATAATCTTTGGACAG 57.679 39.130 0.00 0.00 0.00 3.51
532 533 5.243507 TGAAGCTTGCAATAATCTTTGGACA 59.756 36.000 2.10 0.00 0.00 4.02
533 534 5.713025 TGAAGCTTGCAATAATCTTTGGAC 58.287 37.500 2.10 0.00 0.00 4.02
534 535 5.477984 ACTGAAGCTTGCAATAATCTTTGGA 59.522 36.000 2.10 0.00 0.00 3.53
535 536 5.717119 ACTGAAGCTTGCAATAATCTTTGG 58.283 37.500 2.10 2.20 0.00 3.28
536 537 7.170320 ACAAACTGAAGCTTGCAATAATCTTTG 59.830 33.333 2.10 8.60 0.00 2.77
537 538 7.212274 ACAAACTGAAGCTTGCAATAATCTTT 58.788 30.769 2.10 0.00 0.00 2.52
538 539 6.752168 ACAAACTGAAGCTTGCAATAATCTT 58.248 32.000 2.10 1.31 0.00 2.40
539 540 6.336842 ACAAACTGAAGCTTGCAATAATCT 57.663 33.333 2.10 0.00 0.00 2.40
540 541 6.749118 CCTACAAACTGAAGCTTGCAATAATC 59.251 38.462 2.10 0.00 0.00 1.75
541 542 6.434028 TCCTACAAACTGAAGCTTGCAATAAT 59.566 34.615 2.10 0.00 0.00 1.28
542 543 5.767665 TCCTACAAACTGAAGCTTGCAATAA 59.232 36.000 2.10 0.00 0.00 1.40
543 544 5.312895 TCCTACAAACTGAAGCTTGCAATA 58.687 37.500 2.10 0.00 0.00 1.90
544 545 4.144297 TCCTACAAACTGAAGCTTGCAAT 58.856 39.130 2.10 0.00 0.00 3.56
545 546 3.550820 TCCTACAAACTGAAGCTTGCAA 58.449 40.909 2.10 0.00 0.00 4.08
546 547 3.207265 TCCTACAAACTGAAGCTTGCA 57.793 42.857 2.10 0.64 0.00 4.08
547 548 3.503748 ACATCCTACAAACTGAAGCTTGC 59.496 43.478 2.10 0.00 0.00 4.01
548 549 5.695851 AACATCCTACAAACTGAAGCTTG 57.304 39.130 2.10 0.00 0.00 4.01
549 550 5.827797 TCAAACATCCTACAAACTGAAGCTT 59.172 36.000 0.00 0.00 0.00 3.74
550 551 5.239525 GTCAAACATCCTACAAACTGAAGCT 59.760 40.000 0.00 0.00 0.00 3.74
551 552 5.239525 AGTCAAACATCCTACAAACTGAAGC 59.760 40.000 0.00 0.00 0.00 3.86
552 553 6.867662 AGTCAAACATCCTACAAACTGAAG 57.132 37.500 0.00 0.00 0.00 3.02
553 554 6.826231 TCAAGTCAAACATCCTACAAACTGAA 59.174 34.615 0.00 0.00 0.00 3.02
554 555 6.353323 TCAAGTCAAACATCCTACAAACTGA 58.647 36.000 0.00 0.00 0.00 3.41
555 556 6.618287 TCAAGTCAAACATCCTACAAACTG 57.382 37.500 0.00 0.00 0.00 3.16
556 557 6.238374 CGTTCAAGTCAAACATCCTACAAACT 60.238 38.462 0.00 0.00 0.00 2.66
557 558 5.907391 CGTTCAAGTCAAACATCCTACAAAC 59.093 40.000 0.00 0.00 0.00 2.93
558 559 5.818336 TCGTTCAAGTCAAACATCCTACAAA 59.182 36.000 0.00 0.00 0.00 2.83
559 560 5.361427 TCGTTCAAGTCAAACATCCTACAA 58.639 37.500 0.00 0.00 0.00 2.41
560 561 4.951254 TCGTTCAAGTCAAACATCCTACA 58.049 39.130 0.00 0.00 0.00 2.74
561 562 5.614887 GCTTCGTTCAAGTCAAACATCCTAC 60.615 44.000 0.00 0.00 34.13 3.18
562 563 4.451096 GCTTCGTTCAAGTCAAACATCCTA 59.549 41.667 0.00 0.00 34.13 2.94
563 564 3.251004 GCTTCGTTCAAGTCAAACATCCT 59.749 43.478 0.00 0.00 34.13 3.24
564 565 3.555518 GCTTCGTTCAAGTCAAACATCC 58.444 45.455 0.00 0.00 34.13 3.51
565 566 3.555518 GGCTTCGTTCAAGTCAAACATC 58.444 45.455 0.00 0.00 36.63 3.06
566 567 2.032030 CGGCTTCGTTCAAGTCAAACAT 60.032 45.455 0.00 0.00 36.38 2.71
567 568 1.329292 CGGCTTCGTTCAAGTCAAACA 59.671 47.619 0.00 0.00 36.38 2.83
568 569 1.595794 TCGGCTTCGTTCAAGTCAAAC 59.404 47.619 0.00 0.00 36.38 2.93
569 570 1.864711 CTCGGCTTCGTTCAAGTCAAA 59.135 47.619 0.00 0.00 36.38 2.69
570 571 1.202486 ACTCGGCTTCGTTCAAGTCAA 60.202 47.619 0.00 0.00 36.38 3.18
571 572 0.387929 ACTCGGCTTCGTTCAAGTCA 59.612 50.000 0.00 0.00 36.38 3.41
572 573 1.061485 GACTCGGCTTCGTTCAAGTC 58.939 55.000 0.00 0.00 34.13 3.01
573 574 0.387929 TGACTCGGCTTCGTTCAAGT 59.612 50.000 0.00 0.00 34.13 3.16
574 575 1.391485 CATGACTCGGCTTCGTTCAAG 59.609 52.381 0.00 0.00 33.37 3.02
575 576 1.428448 CATGACTCGGCTTCGTTCAA 58.572 50.000 0.00 0.00 33.37 2.69
576 577 0.389817 CCATGACTCGGCTTCGTTCA 60.390 55.000 0.00 0.00 33.85 3.18
577 578 1.084370 CCCATGACTCGGCTTCGTTC 61.084 60.000 0.00 0.00 35.06 3.95
578 579 1.079127 CCCATGACTCGGCTTCGTT 60.079 57.895 0.00 0.00 35.06 3.85
579 580 0.968901 TACCCATGACTCGGCTTCGT 60.969 55.000 0.00 0.00 35.06 3.85
580 581 0.527817 GTACCCATGACTCGGCTTCG 60.528 60.000 0.00 0.00 0.00 3.79
581 582 0.824759 AGTACCCATGACTCGGCTTC 59.175 55.000 0.00 0.00 0.00 3.86
582 583 0.537188 CAGTACCCATGACTCGGCTT 59.463 55.000 0.00 0.00 0.00 4.35
583 584 0.614979 ACAGTACCCATGACTCGGCT 60.615 55.000 0.00 0.00 0.00 5.52
584 585 0.249398 AACAGTACCCATGACTCGGC 59.751 55.000 0.00 0.00 0.00 5.54
585 586 2.618053 GAAACAGTACCCATGACTCGG 58.382 52.381 0.00 0.00 0.00 4.63
586 587 2.233922 AGGAAACAGTACCCATGACTCG 59.766 50.000 0.00 0.00 0.00 4.18
587 588 3.260884 TCAGGAAACAGTACCCATGACTC 59.739 47.826 0.00 0.00 0.00 3.36
588 589 3.248024 TCAGGAAACAGTACCCATGACT 58.752 45.455 0.00 0.00 0.00 3.41
589 590 3.695830 TCAGGAAACAGTACCCATGAC 57.304 47.619 0.00 0.00 0.00 3.06
590 591 4.104102 ACTTTCAGGAAACAGTACCCATGA 59.896 41.667 0.00 0.00 0.00 3.07
591 592 4.398319 ACTTTCAGGAAACAGTACCCATG 58.602 43.478 0.00 0.00 0.00 3.66
592 593 4.724279 ACTTTCAGGAAACAGTACCCAT 57.276 40.909 0.00 0.00 0.00 4.00
593 594 4.504340 GCTACTTTCAGGAAACAGTACCCA 60.504 45.833 0.00 0.00 0.00 4.51
594 595 4.001652 GCTACTTTCAGGAAACAGTACCC 58.998 47.826 0.00 0.00 0.00 3.69
595 596 4.691216 CAGCTACTTTCAGGAAACAGTACC 59.309 45.833 0.00 0.00 0.00 3.34
596 597 5.298347 ACAGCTACTTTCAGGAAACAGTAC 58.702 41.667 0.00 0.00 0.00 2.73
597 598 5.546621 ACAGCTACTTTCAGGAAACAGTA 57.453 39.130 0.00 0.00 0.00 2.74
598 599 4.423625 ACAGCTACTTTCAGGAAACAGT 57.576 40.909 0.00 0.00 0.00 3.55
599 600 4.816385 TCAACAGCTACTTTCAGGAAACAG 59.184 41.667 0.00 0.00 0.00 3.16
600 601 4.574828 GTCAACAGCTACTTTCAGGAAACA 59.425 41.667 0.00 0.00 0.00 2.83
601 602 4.574828 TGTCAACAGCTACTTTCAGGAAAC 59.425 41.667 0.00 0.00 0.00 2.78
602 603 4.776349 TGTCAACAGCTACTTTCAGGAAA 58.224 39.130 0.00 0.00 0.00 3.13
603 604 4.380531 CTGTCAACAGCTACTTTCAGGAA 58.619 43.478 0.00 0.00 37.15 3.36
604 605 3.244215 CCTGTCAACAGCTACTTTCAGGA 60.244 47.826 16.42 0.00 42.33 3.86
605 606 3.070018 CCTGTCAACAGCTACTTTCAGG 58.930 50.000 4.58 10.51 42.47 3.86
606 607 3.995199 TCCTGTCAACAGCTACTTTCAG 58.005 45.455 4.58 0.00 42.47 3.02
607 608 4.623932 ATCCTGTCAACAGCTACTTTCA 57.376 40.909 4.58 0.00 42.47 2.69
608 609 7.617041 AAATATCCTGTCAACAGCTACTTTC 57.383 36.000 4.58 0.00 42.47 2.62
609 610 8.299570 CAAAAATATCCTGTCAACAGCTACTTT 58.700 33.333 4.58 0.00 42.47 2.66
610 611 7.665559 TCAAAAATATCCTGTCAACAGCTACTT 59.334 33.333 4.58 0.00 42.47 2.24
611 612 7.119846 GTCAAAAATATCCTGTCAACAGCTACT 59.880 37.037 4.58 0.00 42.47 2.57
612 613 7.119846 AGTCAAAAATATCCTGTCAACAGCTAC 59.880 37.037 4.58 0.00 42.47 3.58
613 614 7.168219 AGTCAAAAATATCCTGTCAACAGCTA 58.832 34.615 4.58 0.00 42.47 3.32
614 615 6.006449 AGTCAAAAATATCCTGTCAACAGCT 58.994 36.000 4.58 0.00 42.47 4.24
615 616 6.259550 AGTCAAAAATATCCTGTCAACAGC 57.740 37.500 4.58 0.00 42.47 4.40
616 617 7.805071 GTGAAGTCAAAAATATCCTGTCAACAG 59.195 37.037 3.08 3.08 43.40 3.16
617 618 7.284261 TGTGAAGTCAAAAATATCCTGTCAACA 59.716 33.333 0.00 0.00 0.00 3.33
618 619 7.591426 GTGTGAAGTCAAAAATATCCTGTCAAC 59.409 37.037 0.00 0.00 0.00 3.18
619 620 7.502226 AGTGTGAAGTCAAAAATATCCTGTCAA 59.498 33.333 0.00 0.00 0.00 3.18
620 621 6.998074 AGTGTGAAGTCAAAAATATCCTGTCA 59.002 34.615 0.00 0.00 0.00 3.58
621 622 7.301054 CAGTGTGAAGTCAAAAATATCCTGTC 58.699 38.462 0.00 0.00 0.00 3.51
622 623 6.207417 CCAGTGTGAAGTCAAAAATATCCTGT 59.793 38.462 0.00 0.00 0.00 4.00
623 624 6.615088 CCAGTGTGAAGTCAAAAATATCCTG 58.385 40.000 0.00 0.00 0.00 3.86
624 625 5.183904 GCCAGTGTGAAGTCAAAAATATCCT 59.816 40.000 0.00 0.00 0.00 3.24
625 626 5.402398 GCCAGTGTGAAGTCAAAAATATCC 58.598 41.667 0.00 0.00 0.00 2.59
626 627 5.402398 GGCCAGTGTGAAGTCAAAAATATC 58.598 41.667 0.00 0.00 0.00 1.63
627 628 4.082787 CGGCCAGTGTGAAGTCAAAAATAT 60.083 41.667 2.24 0.00 0.00 1.28
628 629 3.252215 CGGCCAGTGTGAAGTCAAAAATA 59.748 43.478 2.24 0.00 0.00 1.40
629 630 2.034558 CGGCCAGTGTGAAGTCAAAAAT 59.965 45.455 2.24 0.00 0.00 1.82
630 631 1.403679 CGGCCAGTGTGAAGTCAAAAA 59.596 47.619 2.24 0.00 0.00 1.94
631 632 1.021202 CGGCCAGTGTGAAGTCAAAA 58.979 50.000 2.24 0.00 0.00 2.44
632 633 0.107410 ACGGCCAGTGTGAAGTCAAA 60.107 50.000 2.24 0.00 0.00 2.69
633 634 0.813610 CACGGCCAGTGTGAAGTCAA 60.814 55.000 16.51 0.00 45.51 3.18
634 635 1.227527 CACGGCCAGTGTGAAGTCA 60.228 57.895 16.51 0.00 45.51 3.41
635 636 3.642755 CACGGCCAGTGTGAAGTC 58.357 61.111 16.51 0.00 45.51 3.01
643 644 2.592864 TGGAAACACACGGCCAGT 59.407 55.556 2.24 0.00 33.40 4.00
654 655 2.210116 ACGACAGTCACACATGGAAAC 58.790 47.619 0.41 0.00 0.00 2.78
655 656 2.611751 CAACGACAGTCACACATGGAAA 59.388 45.455 0.41 0.00 0.00 3.13
656 657 2.159028 TCAACGACAGTCACACATGGAA 60.159 45.455 0.41 0.00 0.00 3.53
657 658 1.410882 TCAACGACAGTCACACATGGA 59.589 47.619 0.41 0.00 0.00 3.41
658 659 1.864565 TCAACGACAGTCACACATGG 58.135 50.000 0.41 0.00 0.00 3.66
659 660 3.987220 TGTATCAACGACAGTCACACATG 59.013 43.478 0.41 0.00 0.00 3.21
660 661 3.987868 GTGTATCAACGACAGTCACACAT 59.012 43.478 12.50 0.00 35.90 3.21
661 662 3.181485 TGTGTATCAACGACAGTCACACA 60.181 43.478 15.02 15.02 41.62 3.72
662 663 3.377439 TGTGTATCAACGACAGTCACAC 58.623 45.455 11.07 11.07 36.28 3.82
663 664 3.719173 TGTGTATCAACGACAGTCACA 57.281 42.857 0.41 0.00 33.06 3.58
664 665 4.370620 GTTGTGTATCAACGACAGTCAC 57.629 45.455 0.41 0.00 45.23 3.67
674 675 2.552599 TTCAGCCGGTTGTGTATCAA 57.447 45.000 18.51 0.74 0.00 2.57
675 676 2.552599 TTTCAGCCGGTTGTGTATCA 57.447 45.000 18.51 0.00 0.00 2.15
676 677 3.006940 TCATTTCAGCCGGTTGTGTATC 58.993 45.455 18.51 0.00 0.00 2.24
677 678 2.747446 GTCATTTCAGCCGGTTGTGTAT 59.253 45.455 18.51 7.37 0.00 2.29
678 679 2.147958 GTCATTTCAGCCGGTTGTGTA 58.852 47.619 18.51 5.29 0.00 2.90
679 680 0.951558 GTCATTTCAGCCGGTTGTGT 59.048 50.000 18.51 2.73 0.00 3.72
680 681 1.238439 AGTCATTTCAGCCGGTTGTG 58.762 50.000 18.51 9.52 0.00 3.33
681 682 2.038557 ACTAGTCATTTCAGCCGGTTGT 59.961 45.455 18.51 0.00 0.00 3.32
682 683 2.673368 GACTAGTCATTTCAGCCGGTTG 59.327 50.000 18.20 12.81 0.00 3.77
683 684 2.301870 TGACTAGTCATTTCAGCCGGTT 59.698 45.455 21.74 0.00 34.14 4.44
684 685 1.899814 TGACTAGTCATTTCAGCCGGT 59.100 47.619 21.74 0.00 34.14 5.28
685 686 2.271800 GTGACTAGTCATTTCAGCCGG 58.728 52.381 27.54 0.00 42.18 6.13
686 687 2.271800 GGTGACTAGTCATTTCAGCCG 58.728 52.381 27.54 0.00 42.18 5.52
687 688 2.271800 CGGTGACTAGTCATTTCAGCC 58.728 52.381 27.54 20.45 42.18 4.85
688 689 2.271800 CCGGTGACTAGTCATTTCAGC 58.728 52.381 27.54 13.76 42.18 4.26
689 690 3.254060 CACCGGTGACTAGTCATTTCAG 58.746 50.000 31.31 15.34 42.18 3.02
690 691 2.631062 ACACCGGTGACTAGTCATTTCA 59.369 45.455 40.21 2.77 42.18 2.69
691 692 3.251571 GACACCGGTGACTAGTCATTTC 58.748 50.000 40.21 19.15 42.18 2.17
692 693 2.028385 GGACACCGGTGACTAGTCATTT 60.028 50.000 40.21 14.46 42.18 2.32
693 694 1.549170 GGACACCGGTGACTAGTCATT 59.451 52.381 40.21 15.28 42.18 2.57
694 695 1.183549 GGACACCGGTGACTAGTCAT 58.816 55.000 40.21 16.10 42.18 3.06
695 696 0.111832 AGGACACCGGTGACTAGTCA 59.888 55.000 40.21 21.74 37.24 3.41
696 697 0.526662 CAGGACACCGGTGACTAGTC 59.473 60.000 40.21 25.45 0.00 2.59
697 698 0.111832 TCAGGACACCGGTGACTAGT 59.888 55.000 40.21 18.59 0.00 2.57
698 699 1.254026 TTCAGGACACCGGTGACTAG 58.746 55.000 40.21 26.96 0.00 2.57
699 700 1.616865 CTTTCAGGACACCGGTGACTA 59.383 52.381 40.21 20.05 0.00 2.59
700 701 0.393077 CTTTCAGGACACCGGTGACT 59.607 55.000 40.21 31.06 0.00 3.41
701 702 0.106149 ACTTTCAGGACACCGGTGAC 59.894 55.000 40.21 32.84 0.00 3.67
702 703 0.391597 GACTTTCAGGACACCGGTGA 59.608 55.000 40.21 15.74 0.00 4.02
703 704 0.602905 GGACTTTCAGGACACCGGTG 60.603 60.000 32.83 32.83 0.00 4.94
704 705 1.052124 TGGACTTTCAGGACACCGGT 61.052 55.000 0.00 0.00 0.00 5.28
705 706 0.602905 GTGGACTTTCAGGACACCGG 60.603 60.000 0.00 0.00 0.00 5.28
706 707 0.105964 TGTGGACTTTCAGGACACCG 59.894 55.000 0.00 0.00 0.00 4.94
707 708 2.568623 ATGTGGACTTTCAGGACACC 57.431 50.000 0.00 0.00 0.00 4.16
708 709 4.499183 CTCTATGTGGACTTTCAGGACAC 58.501 47.826 0.00 0.00 0.00 3.67
709 710 3.055819 GCTCTATGTGGACTTTCAGGACA 60.056 47.826 0.00 0.00 0.00 4.02
710 711 3.526534 GCTCTATGTGGACTTTCAGGAC 58.473 50.000 0.00 0.00 0.00 3.85
711 712 2.501723 GGCTCTATGTGGACTTTCAGGA 59.498 50.000 0.00 0.00 0.00 3.86
712 713 2.503356 AGGCTCTATGTGGACTTTCAGG 59.497 50.000 0.00 0.00 0.00 3.86
713 714 3.902881 AGGCTCTATGTGGACTTTCAG 57.097 47.619 0.00 0.00 0.00 3.02
714 715 3.582647 TCAAGGCTCTATGTGGACTTTCA 59.417 43.478 0.00 0.00 0.00 2.69
715 716 4.207891 TCAAGGCTCTATGTGGACTTTC 57.792 45.455 0.00 0.00 0.00 2.62
716 717 4.640771 TTCAAGGCTCTATGTGGACTTT 57.359 40.909 0.00 0.00 0.00 2.66
717 718 4.384647 GGATTCAAGGCTCTATGTGGACTT 60.385 45.833 0.00 0.00 0.00 3.01
718 719 3.135530 GGATTCAAGGCTCTATGTGGACT 59.864 47.826 0.00 0.00 0.00 3.85
719 720 3.118261 TGGATTCAAGGCTCTATGTGGAC 60.118 47.826 0.00 0.00 0.00 4.02
720 721 3.114606 TGGATTCAAGGCTCTATGTGGA 58.885 45.455 0.00 0.00 0.00 4.02
721 722 3.565764 TGGATTCAAGGCTCTATGTGG 57.434 47.619 0.00 0.00 0.00 4.17
722 723 4.711399 TGATGGATTCAAGGCTCTATGTG 58.289 43.478 0.00 0.00 0.00 3.21
723 724 4.746089 GCTGATGGATTCAAGGCTCTATGT 60.746 45.833 0.00 0.00 32.78 2.29
724 725 3.752222 GCTGATGGATTCAAGGCTCTATG 59.248 47.826 0.00 0.00 32.78 2.23
725 726 3.393609 TGCTGATGGATTCAAGGCTCTAT 59.606 43.478 0.00 0.00 32.78 1.98
726 727 2.773661 TGCTGATGGATTCAAGGCTCTA 59.226 45.455 0.00 0.00 32.78 2.43
727 728 1.562942 TGCTGATGGATTCAAGGCTCT 59.437 47.619 0.00 0.00 32.78 4.09
728 729 2.048444 TGCTGATGGATTCAAGGCTC 57.952 50.000 0.00 0.00 32.78 4.70
729 730 2.519771 TTGCTGATGGATTCAAGGCT 57.480 45.000 0.00 0.00 32.78 4.58
730 731 3.598019 TTTTGCTGATGGATTCAAGGC 57.402 42.857 0.00 0.00 32.78 4.35
748 749 5.584251 AGACCGCAATGTTTGAACAATTTTT 59.416 32.000 0.10 0.00 43.03 1.94
749 750 5.115480 AGACCGCAATGTTTGAACAATTTT 58.885 33.333 0.10 0.00 43.03 1.82
750 751 4.692228 AGACCGCAATGTTTGAACAATTT 58.308 34.783 0.10 0.00 43.03 1.82
751 752 4.320608 AGACCGCAATGTTTGAACAATT 57.679 36.364 0.10 0.00 43.03 2.32
752 753 4.202101 TGAAGACCGCAATGTTTGAACAAT 60.202 37.500 0.10 0.00 43.03 2.71
753 754 3.129462 TGAAGACCGCAATGTTTGAACAA 59.871 39.130 0.10 0.00 43.03 2.83
754 755 2.685388 TGAAGACCGCAATGTTTGAACA 59.315 40.909 0.00 0.00 44.06 3.18
755 756 3.003275 TCTGAAGACCGCAATGTTTGAAC 59.997 43.478 0.00 0.00 0.00 3.18
756 757 3.210227 TCTGAAGACCGCAATGTTTGAA 58.790 40.909 0.00 0.00 0.00 2.69
757 758 2.844946 TCTGAAGACCGCAATGTTTGA 58.155 42.857 0.00 0.00 0.00 2.69
758 759 3.003689 AGTTCTGAAGACCGCAATGTTTG 59.996 43.478 0.00 0.00 0.00 2.93
759 760 3.003689 CAGTTCTGAAGACCGCAATGTTT 59.996 43.478 0.00 0.00 0.00 2.83
760 761 2.549754 CAGTTCTGAAGACCGCAATGTT 59.450 45.455 0.00 0.00 0.00 2.71
761 762 2.146342 CAGTTCTGAAGACCGCAATGT 58.854 47.619 0.00 0.00 0.00 2.71
762 763 1.135859 GCAGTTCTGAAGACCGCAATG 60.136 52.381 3.84 0.00 0.00 2.82
763 764 1.160137 GCAGTTCTGAAGACCGCAAT 58.840 50.000 3.84 0.00 0.00 3.56
764 765 0.884704 GGCAGTTCTGAAGACCGCAA 60.885 55.000 3.84 0.00 0.00 4.85
765 766 1.301716 GGCAGTTCTGAAGACCGCA 60.302 57.895 3.84 0.00 0.00 5.69
766 767 0.884704 TTGGCAGTTCTGAAGACCGC 60.885 55.000 3.84 0.00 0.00 5.68
767 768 1.593196 TTTGGCAGTTCTGAAGACCG 58.407 50.000 3.84 0.00 0.00 4.79
768 769 3.858503 GCATTTTGGCAGTTCTGAAGACC 60.859 47.826 3.84 0.00 0.00 3.85
769 770 3.243501 TGCATTTTGGCAGTTCTGAAGAC 60.244 43.478 3.84 0.00 39.25 3.01
770 771 2.957680 TGCATTTTGGCAGTTCTGAAGA 59.042 40.909 3.84 0.00 39.25 2.87
771 772 3.054878 GTGCATTTTGGCAGTTCTGAAG 58.945 45.455 3.84 0.00 45.96 3.02
772 773 2.694628 AGTGCATTTTGGCAGTTCTGAA 59.305 40.909 3.84 0.00 44.78 3.02
773 774 2.309613 AGTGCATTTTGGCAGTTCTGA 58.690 42.857 3.84 0.00 44.78 3.27
774 775 2.806608 AGTGCATTTTGGCAGTTCTG 57.193 45.000 0.00 0.00 44.78 3.02
778 779 6.444002 TGGTAACTAAGTGCATTTTGGCAGT 61.444 40.000 0.00 0.00 43.47 4.40
779 780 4.022416 TGGTAACTAAGTGCATTTTGGCAG 60.022 41.667 0.00 0.00 40.86 4.85
780 781 3.891977 TGGTAACTAAGTGCATTTTGGCA 59.108 39.130 0.00 0.00 38.62 4.92
781 782 4.513198 TGGTAACTAAGTGCATTTTGGC 57.487 40.909 0.00 0.00 37.61 4.52
782 783 6.149633 GTCTTGGTAACTAAGTGCATTTTGG 58.850 40.000 0.00 0.00 37.61 3.28
783 784 5.851177 CGTCTTGGTAACTAAGTGCATTTTG 59.149 40.000 0.00 0.19 37.61 2.44
784 785 5.529800 ACGTCTTGGTAACTAAGTGCATTTT 59.470 36.000 0.00 0.00 37.61 1.82
785 786 5.061179 ACGTCTTGGTAACTAAGTGCATTT 58.939 37.500 0.00 0.00 37.61 2.32
786 787 4.638304 ACGTCTTGGTAACTAAGTGCATT 58.362 39.130 0.00 0.00 37.61 3.56
787 788 4.267349 ACGTCTTGGTAACTAAGTGCAT 57.733 40.909 0.00 0.00 37.61 3.96
788 789 3.738830 ACGTCTTGGTAACTAAGTGCA 57.261 42.857 0.00 0.00 37.61 4.57
789 790 5.693555 ACTTAACGTCTTGGTAACTAAGTGC 59.306 40.000 3.42 0.00 37.61 4.40
790 791 6.087291 CGACTTAACGTCTTGGTAACTAAGTG 59.913 42.308 7.93 0.00 40.59 3.16
791 792 6.145535 CGACTTAACGTCTTGGTAACTAAGT 58.854 40.000 3.79 3.79 40.59 2.24
792 793 6.145535 ACGACTTAACGTCTTGGTAACTAAG 58.854 40.000 0.00 0.00 43.02 2.18
793 794 6.072112 ACGACTTAACGTCTTGGTAACTAA 57.928 37.500 0.00 0.00 43.02 2.24
794 795 5.689383 ACGACTTAACGTCTTGGTAACTA 57.311 39.130 0.00 0.00 43.02 2.24
795 796 4.574599 ACGACTTAACGTCTTGGTAACT 57.425 40.909 0.00 0.00 43.02 2.24
796 797 4.504097 ACAACGACTTAACGTCTTGGTAAC 59.496 41.667 0.00 0.00 45.83 2.50
797 798 4.503734 CACAACGACTTAACGTCTTGGTAA 59.496 41.667 0.00 0.00 45.83 2.85
798 799 4.043750 CACAACGACTTAACGTCTTGGTA 58.956 43.478 0.00 0.00 45.83 3.25
799 800 2.861935 CACAACGACTTAACGTCTTGGT 59.138 45.455 0.00 0.00 45.83 3.67
800 801 2.220133 CCACAACGACTTAACGTCTTGG 59.780 50.000 0.00 0.00 45.83 3.61
801 802 2.348218 GCCACAACGACTTAACGTCTTG 60.348 50.000 0.00 0.00 45.83 3.02
802 803 1.862827 GCCACAACGACTTAACGTCTT 59.137 47.619 0.00 0.00 45.83 3.01
803 804 1.202440 TGCCACAACGACTTAACGTCT 60.202 47.619 0.00 0.00 45.83 4.18
804 805 1.210870 TGCCACAACGACTTAACGTC 58.789 50.000 0.00 0.00 45.83 4.34
806 807 2.961522 AATGCCACAACGACTTAACG 57.038 45.000 0.00 0.00 39.31 3.18
807 808 5.695818 ACATTAATGCCACAACGACTTAAC 58.304 37.500 15.48 0.00 0.00 2.01
808 809 5.950758 ACATTAATGCCACAACGACTTAA 57.049 34.783 15.48 0.00 0.00 1.85
809 810 6.167685 AGTACATTAATGCCACAACGACTTA 58.832 36.000 15.48 0.00 0.00 2.24
810 811 5.001232 AGTACATTAATGCCACAACGACTT 58.999 37.500 15.48 0.00 0.00 3.01
811 812 4.575885 AGTACATTAATGCCACAACGACT 58.424 39.130 15.48 3.82 0.00 4.18
812 813 4.939509 AGTACATTAATGCCACAACGAC 57.060 40.909 15.48 1.77 0.00 4.34
813 814 5.726397 AGTAGTACATTAATGCCACAACGA 58.274 37.500 15.48 0.79 0.00 3.85
814 815 6.291427 CGTAGTAGTACATTAATGCCACAACG 60.291 42.308 15.48 15.34 0.00 4.10
815 816 6.753279 TCGTAGTAGTACATTAATGCCACAAC 59.247 38.462 15.48 7.70 0.00 3.32
816 817 6.753279 GTCGTAGTAGTACATTAATGCCACAA 59.247 38.462 15.48 0.00 0.00 3.33
817 818 6.095860 AGTCGTAGTAGTACATTAATGCCACA 59.904 38.462 15.48 2.97 0.00 4.17
818 819 6.501781 AGTCGTAGTAGTACATTAATGCCAC 58.498 40.000 15.48 13.00 0.00 5.01
819 820 6.704289 AGTCGTAGTAGTACATTAATGCCA 57.296 37.500 15.48 0.75 0.00 4.92
820 821 7.096722 CGAAAGTCGTAGTAGTACATTAATGCC 60.097 40.741 15.48 6.49 34.72 4.40
821 822 7.096722 CCGAAAGTCGTAGTAGTACATTAATGC 60.097 40.741 15.48 0.15 38.40 3.56
822 823 7.096722 GCCGAAAGTCGTAGTAGTACATTAATG 60.097 40.741 14.01 14.01 38.40 1.90
823 824 6.914757 GCCGAAAGTCGTAGTAGTACATTAAT 59.085 38.462 8.43 0.00 38.40 1.40
824 825 6.128035 TGCCGAAAGTCGTAGTAGTACATTAA 60.128 38.462 8.43 0.00 38.40 1.40
825 826 5.353956 TGCCGAAAGTCGTAGTAGTACATTA 59.646 40.000 8.43 0.00 38.40 1.90
826 827 4.156556 TGCCGAAAGTCGTAGTAGTACATT 59.843 41.667 8.43 0.00 38.40 2.71
827 828 3.691118 TGCCGAAAGTCGTAGTAGTACAT 59.309 43.478 8.43 0.00 38.40 2.29
828 829 3.073678 TGCCGAAAGTCGTAGTAGTACA 58.926 45.455 8.43 0.00 38.40 2.90
829 830 3.747099 TGCCGAAAGTCGTAGTAGTAC 57.253 47.619 0.00 0.00 38.40 2.73
830 831 3.940852 TGATGCCGAAAGTCGTAGTAGTA 59.059 43.478 0.00 0.00 38.40 1.82
831 832 2.751259 TGATGCCGAAAGTCGTAGTAGT 59.249 45.455 0.00 0.00 38.40 2.73
832 833 3.416119 TGATGCCGAAAGTCGTAGTAG 57.584 47.619 0.00 0.00 38.40 2.57
833 834 5.503662 TTATGATGCCGAAAGTCGTAGTA 57.496 39.130 0.00 0.00 38.40 1.82
834 835 2.961526 ATGATGCCGAAAGTCGTAGT 57.038 45.000 0.00 0.00 38.40 2.73
835 836 5.712217 TTTTATGATGCCGAAAGTCGTAG 57.288 39.130 0.00 0.00 38.40 3.51
836 837 5.163834 GGTTTTTATGATGCCGAAAGTCGTA 60.164 40.000 0.00 0.00 38.40 3.43
837 838 4.379082 GGTTTTTATGATGCCGAAAGTCGT 60.379 41.667 0.00 0.00 38.40 4.34
838 839 4.095610 GGTTTTTATGATGCCGAAAGTCG 58.904 43.478 0.00 0.00 40.07 4.18
839 840 5.054390 TGGTTTTTATGATGCCGAAAGTC 57.946 39.130 0.00 0.00 0.00 3.01
840 841 5.047377 ACATGGTTTTTATGATGCCGAAAGT 60.047 36.000 0.00 0.00 0.00 2.66
841 842 5.410067 ACATGGTTTTTATGATGCCGAAAG 58.590 37.500 0.00 0.00 0.00 2.62
842 843 5.398603 ACATGGTTTTTATGATGCCGAAA 57.601 34.783 0.00 0.00 0.00 3.46
843 844 6.151985 AGTTACATGGTTTTTATGATGCCGAA 59.848 34.615 0.00 0.00 0.00 4.30
844 845 5.650266 AGTTACATGGTTTTTATGATGCCGA 59.350 36.000 0.00 0.00 0.00 5.54
845 846 5.890334 AGTTACATGGTTTTTATGATGCCG 58.110 37.500 0.00 0.00 0.00 5.69
846 847 9.463443 GATAAGTTACATGGTTTTTATGATGCC 57.537 33.333 0.00 0.00 0.00 4.40
891 892 9.434275 ACCATGCCTAGCTACACATATATATAA 57.566 33.333 0.00 0.00 0.00 0.98
892 893 9.434275 AACCATGCCTAGCTACACATATATATA 57.566 33.333 3.93 0.00 0.00 0.86
893 894 7.921041 ACCATGCCTAGCTACACATATATAT 57.079 36.000 3.93 0.00 0.00 0.86
894 895 7.147724 GGAACCATGCCTAGCTACACATATATA 60.148 40.741 3.93 0.00 0.00 0.86
895 896 6.352222 GGAACCATGCCTAGCTACACATATAT 60.352 42.308 3.93 0.00 0.00 0.86
896 897 5.046591 GGAACCATGCCTAGCTACACATATA 60.047 44.000 3.93 0.00 0.00 0.86
897 898 4.263068 GGAACCATGCCTAGCTACACATAT 60.263 45.833 3.93 0.00 0.00 1.78
898 899 3.071023 GGAACCATGCCTAGCTACACATA 59.929 47.826 3.93 0.00 0.00 2.29
899 900 2.158755 GGAACCATGCCTAGCTACACAT 60.159 50.000 0.00 0.00 0.00 3.21
900 901 1.209504 GGAACCATGCCTAGCTACACA 59.790 52.381 0.00 0.00 0.00 3.72
901 902 1.954927 GGAACCATGCCTAGCTACAC 58.045 55.000 0.00 0.00 0.00 2.90
929 930 9.313118 CAAGAAAGCATAGTGTGTGTACATATA 57.687 33.333 0.00 0.00 39.39 0.86
930 931 7.824289 ACAAGAAAGCATAGTGTGTGTACATAT 59.176 33.333 0.00 0.00 39.39 1.78
931 932 7.158697 ACAAGAAAGCATAGTGTGTGTACATA 58.841 34.615 0.00 0.00 39.39 2.29
932 933 5.997746 ACAAGAAAGCATAGTGTGTGTACAT 59.002 36.000 0.00 0.00 39.39 2.29
933 934 5.364778 ACAAGAAAGCATAGTGTGTGTACA 58.635 37.500 0.00 0.00 0.00 2.90
934 935 5.924475 ACAAGAAAGCATAGTGTGTGTAC 57.076 39.130 0.00 0.00 0.00 2.90
935 936 6.645003 CACTACAAGAAAGCATAGTGTGTGTA 59.355 38.462 0.00 0.00 39.68 2.90
936 937 5.466728 CACTACAAGAAAGCATAGTGTGTGT 59.533 40.000 0.00 0.00 39.68 3.72
937 938 5.615544 GCACTACAAGAAAGCATAGTGTGTG 60.616 44.000 10.89 0.00 44.18 3.82
938 939 4.452455 GCACTACAAGAAAGCATAGTGTGT 59.548 41.667 10.89 0.00 44.18 3.72
939 940 4.452114 TGCACTACAAGAAAGCATAGTGTG 59.548 41.667 10.89 0.00 44.18 3.82
940 941 4.641396 TGCACTACAAGAAAGCATAGTGT 58.359 39.130 10.89 0.00 44.18 3.55
941 942 5.611796 TTGCACTACAAGAAAGCATAGTG 57.388 39.130 6.00 6.00 44.81 2.74
942 943 6.430925 TCATTTGCACTACAAGAAAGCATAGT 59.569 34.615 0.00 0.00 40.06 2.12
943 944 6.845302 TCATTTGCACTACAAGAAAGCATAG 58.155 36.000 0.00 0.00 40.06 2.23
944 945 6.816134 TCATTTGCACTACAAGAAAGCATA 57.184 33.333 0.00 0.00 40.06 3.14
945 946 5.710513 TCATTTGCACTACAAGAAAGCAT 57.289 34.783 0.00 0.00 40.06 3.79
946 947 5.241285 TGATCATTTGCACTACAAGAAAGCA 59.759 36.000 0.00 0.00 40.06 3.91
947 948 5.570589 GTGATCATTTGCACTACAAGAAAGC 59.429 40.000 0.00 0.00 40.06 3.51
948 949 6.580041 GTGTGATCATTTGCACTACAAGAAAG 59.420 38.462 0.00 0.00 40.06 2.62
949 950 6.039159 TGTGTGATCATTTGCACTACAAGAAA 59.961 34.615 13.47 0.00 40.06 2.52
950 951 5.530543 TGTGTGATCATTTGCACTACAAGAA 59.469 36.000 13.47 0.00 40.06 2.52
951 952 5.062528 TGTGTGATCATTTGCACTACAAGA 58.937 37.500 13.47 0.00 40.06 3.02
952 953 5.361135 TGTGTGATCATTTGCACTACAAG 57.639 39.130 13.47 0.00 40.06 3.16
953 954 5.963176 ATGTGTGATCATTTGCACTACAA 57.037 34.783 13.47 0.00 36.05 2.41
954 955 5.065090 GCTATGTGTGATCATTTGCACTACA 59.935 40.000 13.47 0.00 36.05 2.74
955 956 5.504665 GGCTATGTGTGATCATTTGCACTAC 60.505 44.000 13.47 3.21 36.05 2.73
956 957 4.576053 GGCTATGTGTGATCATTTGCACTA 59.424 41.667 13.47 3.42 36.05 2.74
957 958 3.379372 GGCTATGTGTGATCATTTGCACT 59.621 43.478 13.47 4.44 36.05 4.40
958 959 3.489738 GGGCTATGTGTGATCATTTGCAC 60.490 47.826 0.00 2.73 35.63 4.57
959 960 2.689471 GGGCTATGTGTGATCATTTGCA 59.311 45.455 0.00 0.00 32.29 4.08
960 961 2.689471 TGGGCTATGTGTGATCATTTGC 59.311 45.455 0.00 0.00 0.00 3.68
961 962 4.641541 TCTTGGGCTATGTGTGATCATTTG 59.358 41.667 0.00 0.00 0.00 2.32
962 963 4.641989 GTCTTGGGCTATGTGTGATCATTT 59.358 41.667 0.00 0.00 0.00 2.32
963 964 4.202441 GTCTTGGGCTATGTGTGATCATT 58.798 43.478 0.00 0.00 0.00 2.57
964 965 3.434167 GGTCTTGGGCTATGTGTGATCAT 60.434 47.826 0.00 0.00 0.00 2.45
965 966 2.092968 GGTCTTGGGCTATGTGTGATCA 60.093 50.000 0.00 0.00 0.00 2.92
966 967 2.092968 TGGTCTTGGGCTATGTGTGATC 60.093 50.000 0.00 0.00 0.00 2.92
967 968 1.915489 TGGTCTTGGGCTATGTGTGAT 59.085 47.619 0.00 0.00 0.00 3.06
968 969 1.357137 TGGTCTTGGGCTATGTGTGA 58.643 50.000 0.00 0.00 0.00 3.58
969 970 2.425143 ATGGTCTTGGGCTATGTGTG 57.575 50.000 0.00 0.00 0.00 3.82
970 971 5.155161 TCTATATGGTCTTGGGCTATGTGT 58.845 41.667 0.00 0.00 0.00 3.72
971 972 5.745312 TCTATATGGTCTTGGGCTATGTG 57.255 43.478 0.00 0.00 0.00 3.21
972 973 5.280215 GCTTCTATATGGTCTTGGGCTATGT 60.280 44.000 0.00 0.00 0.00 2.29
973 974 5.181748 GCTTCTATATGGTCTTGGGCTATG 58.818 45.833 0.00 0.00 0.00 2.23
974 975 4.846367 TGCTTCTATATGGTCTTGGGCTAT 59.154 41.667 0.00 0.00 0.00 2.97
975 976 4.231273 TGCTTCTATATGGTCTTGGGCTA 58.769 43.478 0.00 0.00 0.00 3.93
976 977 3.048600 TGCTTCTATATGGTCTTGGGCT 58.951 45.455 0.00 0.00 0.00 5.19
977 978 3.071602 TCTGCTTCTATATGGTCTTGGGC 59.928 47.826 0.00 0.00 0.00 5.36
978 979 4.963318 TCTGCTTCTATATGGTCTTGGG 57.037 45.455 0.00 0.00 0.00 4.12
979 980 5.180868 GCATTCTGCTTCTATATGGTCTTGG 59.819 44.000 0.00 0.00 40.96 3.61
980 981 5.180868 GGCATTCTGCTTCTATATGGTCTTG 59.819 44.000 0.00 0.00 44.28 3.02
981 982 5.072872 AGGCATTCTGCTTCTATATGGTCTT 59.927 40.000 0.00 0.00 44.28 3.01
982 983 4.596643 AGGCATTCTGCTTCTATATGGTCT 59.403 41.667 0.00 0.00 44.28 3.85
983 984 4.904241 AGGCATTCTGCTTCTATATGGTC 58.096 43.478 0.00 0.00 44.28 4.02
984 985 4.562347 CGAGGCATTCTGCTTCTATATGGT 60.562 45.833 9.18 0.00 45.85 3.55
985 986 3.931468 CGAGGCATTCTGCTTCTATATGG 59.069 47.826 9.18 0.00 45.85 2.74
986 987 4.564041 ACGAGGCATTCTGCTTCTATATG 58.436 43.478 9.18 0.00 45.85 1.78
987 988 4.526262 AGACGAGGCATTCTGCTTCTATAT 59.474 41.667 9.18 0.00 45.85 0.86
988 989 3.891977 AGACGAGGCATTCTGCTTCTATA 59.108 43.478 9.18 0.00 45.85 1.31
989 990 2.697751 AGACGAGGCATTCTGCTTCTAT 59.302 45.455 9.18 0.00 45.85 1.98
990 991 2.103373 AGACGAGGCATTCTGCTTCTA 58.897 47.619 9.18 0.00 45.85 2.10
991 992 0.901124 AGACGAGGCATTCTGCTTCT 59.099 50.000 9.18 0.00 45.85 2.85
992 993 2.468831 CTAGACGAGGCATTCTGCTTC 58.531 52.381 1.50 1.50 44.77 3.86
993 994 1.472376 GCTAGACGAGGCATTCTGCTT 60.472 52.381 0.00 0.00 44.28 3.91
994 995 0.103937 GCTAGACGAGGCATTCTGCT 59.896 55.000 0.00 0.00 44.28 4.24
995 996 2.599216 GCTAGACGAGGCATTCTGC 58.401 57.895 0.00 0.00 44.08 4.26
1003 1004 1.153745 GCAGTGTGGCTAGACGAGG 60.154 63.158 0.00 0.00 0.00 4.63
1004 1005 0.244994 AAGCAGTGTGGCTAGACGAG 59.755 55.000 0.00 0.00 45.07 4.18
1005 1006 0.243907 GAAGCAGTGTGGCTAGACGA 59.756 55.000 0.00 0.00 45.07 4.20
1006 1007 0.244994 AGAAGCAGTGTGGCTAGACG 59.755 55.000 0.00 0.00 45.07 4.18
1007 1008 2.072298 CAAGAAGCAGTGTGGCTAGAC 58.928 52.381 0.00 0.00 45.07 2.59
1008 1009 1.694150 ACAAGAAGCAGTGTGGCTAGA 59.306 47.619 0.00 0.00 45.07 2.43
1009 1010 2.175878 ACAAGAAGCAGTGTGGCTAG 57.824 50.000 0.00 0.00 45.07 3.42
1010 1011 2.638480 AACAAGAAGCAGTGTGGCTA 57.362 45.000 0.00 0.00 45.07 3.93
1012 1013 2.159254 TGAAAACAAGAAGCAGTGTGGC 60.159 45.455 0.00 0.00 0.00 5.01
1013 1014 3.129287 AGTGAAAACAAGAAGCAGTGTGG 59.871 43.478 0.00 0.00 0.00 4.17
1014 1015 4.100529 CAGTGAAAACAAGAAGCAGTGTG 58.899 43.478 0.00 0.00 0.00 3.82
1015 1016 3.428045 GCAGTGAAAACAAGAAGCAGTGT 60.428 43.478 0.00 0.00 33.59 3.55
1016 1017 3.111098 GCAGTGAAAACAAGAAGCAGTG 58.889 45.455 0.00 0.00 34.05 3.66
1017 1018 2.223340 CGCAGTGAAAACAAGAAGCAGT 60.223 45.455 0.00 0.00 0.00 4.40
1018 1019 2.032054 TCGCAGTGAAAACAAGAAGCAG 59.968 45.455 0.00 0.00 0.00 4.24
1019 1020 2.013400 TCGCAGTGAAAACAAGAAGCA 58.987 42.857 0.00 0.00 0.00 3.91
1020 1021 2.755836 TCGCAGTGAAAACAAGAAGC 57.244 45.000 0.00 0.00 0.00 3.86
1021 1022 4.847633 TGAATCGCAGTGAAAACAAGAAG 58.152 39.130 0.00 0.00 0.00 2.85
1022 1023 4.891627 TGAATCGCAGTGAAAACAAGAA 57.108 36.364 0.00 0.00 0.00 2.52
1023 1024 5.437289 AATGAATCGCAGTGAAAACAAGA 57.563 34.783 0.00 0.00 0.00 3.02
1035 1036 1.065199 AGGCTGAGGAAATGAATCGCA 60.065 47.619 0.00 0.00 0.00 5.10
1036 1037 1.673168 AGGCTGAGGAAATGAATCGC 58.327 50.000 0.00 0.00 0.00 4.58
1037 1038 4.708726 AAAAGGCTGAGGAAATGAATCG 57.291 40.909 0.00 0.00 0.00 3.34
1043 1044 2.820197 GACGGAAAAAGGCTGAGGAAAT 59.180 45.455 0.00 0.00 0.00 2.17
1050 1051 0.109132 GCATGGACGGAAAAAGGCTG 60.109 55.000 0.00 0.00 0.00 4.85
1052 1053 0.109132 CTGCATGGACGGAAAAAGGC 60.109 55.000 0.00 0.00 0.00 4.35
1057 1058 0.109532 TTGGACTGCATGGACGGAAA 59.890 50.000 0.00 0.00 0.00 3.13
1062 1063 0.877071 CAGTGTTGGACTGCATGGAC 59.123 55.000 0.00 0.00 45.72 4.02
1071 1072 2.092968 TGCATCCCTATCAGTGTTGGAC 60.093 50.000 0.00 0.00 0.00 4.02
1074 1075 3.272574 AGTGCATCCCTATCAGTGTTG 57.727 47.619 0.00 0.00 0.00 3.33
1075 1076 3.521126 AGAAGTGCATCCCTATCAGTGTT 59.479 43.478 0.00 0.00 0.00 3.32
1076 1077 3.110705 AGAAGTGCATCCCTATCAGTGT 58.889 45.455 0.00 0.00 0.00 3.55
1084 1085 0.913451 AGGCAGAGAAGTGCATCCCT 60.913 55.000 0.00 0.00 45.93 4.20
1085 1086 0.463474 GAGGCAGAGAAGTGCATCCC 60.463 60.000 0.00 0.00 46.19 3.85
1107 1108 6.385443 TCCTAAGGGATCAGATAGTTGTGAT 58.615 40.000 0.00 0.00 38.49 3.06
1110 1111 6.206042 AGTTCCTAAGGGATCAGATAGTTGT 58.794 40.000 0.00 0.00 41.87 3.32
1113 1114 7.015779 GCTAAAGTTCCTAAGGGATCAGATAGT 59.984 40.741 0.00 0.00 41.87 2.12
1116 1117 5.908247 AGCTAAAGTTCCTAAGGGATCAGAT 59.092 40.000 0.00 0.00 41.87 2.90
1122 1123 5.339200 CCATGAAGCTAAAGTTCCTAAGGGA 60.339 44.000 0.00 0.00 40.36 4.20
1127 1128 7.490657 TTACTCCATGAAGCTAAAGTTCCTA 57.509 36.000 0.00 0.00 0.00 2.94
1129 1130 7.201741 GGAATTACTCCATGAAGCTAAAGTTCC 60.202 40.741 0.00 0.00 44.67 3.62
1143 1144 4.747580 ACGTGAGCGAGGAATTACTCCAT 61.748 47.826 12.25 0.35 43.53 3.41
1149 1150 2.876091 CAGAACGTGAGCGAGGAATTA 58.124 47.619 0.00 0.00 42.00 1.40
1153 1154 2.258591 GCAGAACGTGAGCGAGGA 59.741 61.111 0.00 0.00 42.00 3.71
1179 1180 0.321034 GTCTGCTGCATGTCACTCCA 60.321 55.000 1.31 0.00 0.00 3.86
1187 1188 2.774126 CGTGTCGTCTGCTGCATG 59.226 61.111 1.31 0.00 0.00 4.06
1206 1207 4.707448 AGGTCTAATGAACTCACACGAGAT 59.293 41.667 0.00 0.00 42.34 2.75
1216 1217 9.606631 GTTTGATGATTCTAGGTCTAATGAACT 57.393 33.333 0.00 0.00 43.65 3.01
1217 1218 8.831550 GGTTTGATGATTCTAGGTCTAATGAAC 58.168 37.037 0.00 0.00 0.00 3.18
1230 1231 3.350833 GCCAGTGAGGTTTGATGATTCT 58.649 45.455 0.00 0.00 40.61 2.40
1232 1233 2.225091 TGGCCAGTGAGGTTTGATGATT 60.225 45.455 0.00 0.00 40.61 2.57
1233 1234 1.355381 TGGCCAGTGAGGTTTGATGAT 59.645 47.619 0.00 0.00 40.61 2.45
1237 1238 2.380064 ATTTGGCCAGTGAGGTTTGA 57.620 45.000 5.11 0.00 40.61 2.69
1238 1239 4.381932 GGAATATTTGGCCAGTGAGGTTTG 60.382 45.833 5.11 0.00 40.61 2.93
1248 1249 2.244486 TGCAAGGGAATATTTGGCCA 57.756 45.000 0.00 0.00 0.00 5.36
1260 1261 2.170187 ACTGAGCTCTCTAATGCAAGGG 59.830 50.000 16.19 0.00 0.00 3.95
1263 1264 4.019860 AGGAAACTGAGCTCTCTAATGCAA 60.020 41.667 16.19 0.00 41.13 4.08
1267 1268 4.161377 GGTGAGGAAACTGAGCTCTCTAAT 59.839 45.833 16.19 0.00 44.43 1.73
1270 1271 1.899142 GGTGAGGAAACTGAGCTCTCT 59.101 52.381 16.19 2.91 44.43 3.10
1271 1272 1.066502 GGGTGAGGAAACTGAGCTCTC 60.067 57.143 16.19 3.54 44.43 3.20
1272 1273 0.980423 GGGTGAGGAAACTGAGCTCT 59.020 55.000 16.19 0.00 44.43 4.09
1278 1279 1.003118 TGGATTCGGGTGAGGAAACTG 59.997 52.381 0.00 0.00 44.43 3.16
1280 1281 1.271163 TGTGGATTCGGGTGAGGAAAC 60.271 52.381 0.00 0.00 0.00 2.78
1287 1288 2.120909 GGGCATGTGGATTCGGGTG 61.121 63.158 0.00 0.00 0.00 4.61
1288 1289 2.148723 TTGGGCATGTGGATTCGGGT 62.149 55.000 0.00 0.00 0.00 5.28
1289 1290 0.969917 TTTGGGCATGTGGATTCGGG 60.970 55.000 0.00 0.00 0.00 5.14
1314 1315 2.982488 GGGGGAGATATGACCATTGAGT 59.018 50.000 0.00 0.00 0.00 3.41
1323 1324 2.158310 ACTGATGTCGGGGGAGATATGA 60.158 50.000 0.00 0.00 0.00 2.15
1326 1327 1.996798 GACTGATGTCGGGGGAGATA 58.003 55.000 0.00 0.00 33.15 1.98
1342 1343 6.154706 AGGTATGTAAGAAGGTTCAATCGACT 59.845 38.462 0.00 0.00 0.00 4.18
1344 1345 6.153851 TGAGGTATGTAAGAAGGTTCAATCGA 59.846 38.462 0.00 0.00 0.00 3.59
1347 1348 6.884836 GGTTGAGGTATGTAAGAAGGTTCAAT 59.115 38.462 0.00 0.00 0.00 2.57
1352 1353 6.351966 GCTAAGGTTGAGGTATGTAAGAAGGT 60.352 42.308 0.00 0.00 0.00 3.50
1355 1356 6.614694 TGCTAAGGTTGAGGTATGTAAGAA 57.385 37.500 0.00 0.00 0.00 2.52
1356 1357 6.382859 TCATGCTAAGGTTGAGGTATGTAAGA 59.617 38.462 0.00 0.00 0.00 2.10
1383 1384 2.503765 TGGAATCATACCGCTGAAGGAA 59.496 45.455 0.00 0.00 34.73 3.36
1387 1388 2.499693 TGTCTGGAATCATACCGCTGAA 59.500 45.455 0.00 0.00 0.00 3.02
1389 1390 2.205074 GTGTCTGGAATCATACCGCTG 58.795 52.381 0.00 0.00 0.00 5.18
1390 1391 1.139058 GGTGTCTGGAATCATACCGCT 59.861 52.381 0.00 0.00 0.00 5.52
1392 1393 2.979814 TGGTGTCTGGAATCATACCG 57.020 50.000 0.00 0.00 0.00 4.02
1396 1397 6.065976 TGAAGTTATGGTGTCTGGAATCAT 57.934 37.500 0.00 0.00 0.00 2.45
1397 1398 5.491070 CTGAAGTTATGGTGTCTGGAATCA 58.509 41.667 0.00 0.00 0.00 2.57
1398 1399 4.878397 CCTGAAGTTATGGTGTCTGGAATC 59.122 45.833 0.00 0.00 32.43 2.52
1401 1402 3.248024 ACCTGAAGTTATGGTGTCTGGA 58.752 45.455 0.00 0.00 34.28 3.86
1404 1405 4.322049 CGAGAACCTGAAGTTATGGTGTCT 60.322 45.833 0.64 5.90 39.40 3.41
1407 1408 3.056107 TCCGAGAACCTGAAGTTATGGTG 60.056 47.826 0.64 0.00 39.40 4.17
1408 1409 3.170717 TCCGAGAACCTGAAGTTATGGT 58.829 45.455 0.00 0.00 39.40 3.55
1414 1415 1.835494 TCGATCCGAGAACCTGAAGT 58.165 50.000 0.00 0.00 0.00 3.01
1427 1428 2.300152 TCCATGCTGATAACCTCGATCC 59.700 50.000 0.00 0.00 0.00 3.36
1428 1429 3.256879 TCTCCATGCTGATAACCTCGATC 59.743 47.826 0.00 0.00 0.00 3.69
1429 1430 3.234353 TCTCCATGCTGATAACCTCGAT 58.766 45.455 0.00 0.00 0.00 3.59
1435 1436 5.669477 AGAGTTTCTCTCCATGCTGATAAC 58.331 41.667 0.00 0.00 43.71 1.89
1436 1437 5.946942 AGAGTTTCTCTCCATGCTGATAA 57.053 39.130 0.00 0.00 43.71 1.75
1452 1453 4.815269 CGATCTCACCTTCAAGAGAGTTT 58.185 43.478 6.70 0.00 43.48 2.66
1491 1492 3.126514 CGACTTGCTGAAGAAATGAGCAT 59.873 43.478 0.00 0.00 42.17 3.79
1494 1495 4.450419 AGAACGACTTGCTGAAGAAATGAG 59.550 41.667 0.00 0.00 32.98 2.90
1496 1497 4.739046 AGAACGACTTGCTGAAGAAATG 57.261 40.909 0.00 0.00 32.98 2.32
1497 1498 5.106908 GCTAAGAACGACTTGCTGAAGAAAT 60.107 40.000 9.13 0.00 39.38 2.17
1498 1499 4.211374 GCTAAGAACGACTTGCTGAAGAAA 59.789 41.667 9.13 0.00 39.38 2.52
1503 1504 2.800544 GTTGCTAAGAACGACTTGCTGA 59.199 45.455 9.13 3.76 39.38 4.26
1510 1511 5.344207 AGATTGTTGTTGCTAAGAACGAC 57.656 39.130 0.00 0.00 39.71 4.34
1512 1513 5.747565 TGAAGATTGTTGTTGCTAAGAACG 58.252 37.500 0.00 0.00 37.46 3.95
1518 1519 4.518970 GTCCCTTGAAGATTGTTGTTGCTA 59.481 41.667 0.00 0.00 0.00 3.49
1548 1549 1.314730 GAAGCAAACCGAACCTGGAA 58.685 50.000 0.00 0.00 0.00 3.53
1601 1602 1.280421 GAGGGATGTTTCCAGTGAGCT 59.720 52.381 0.00 0.00 44.60 4.09
1617 1618 2.732619 GCTCCCCAGTAACCGAGGG 61.733 68.421 0.00 0.00 42.44 4.30
1620 1621 1.675219 GTTGCTCCCCAGTAACCGA 59.325 57.895 0.00 0.00 38.85 4.69
1621 1622 1.740296 CGTTGCTCCCCAGTAACCG 60.740 63.158 0.00 0.00 41.03 4.44
1622 1623 1.376812 CCGTTGCTCCCCAGTAACC 60.377 63.158 0.00 0.00 41.03 2.85
1626 1627 0.822121 GAAAACCGTTGCTCCCCAGT 60.822 55.000 0.00 0.00 0.00 4.00
1627 1628 0.537371 AGAAAACCGTTGCTCCCCAG 60.537 55.000 0.00 0.00 0.00 4.45
1635 1636 1.001815 ACCGATGCAAGAAAACCGTTG 60.002 47.619 0.00 0.00 0.00 4.10
1637 1638 2.172851 TACCGATGCAAGAAAACCGT 57.827 45.000 0.00 0.00 0.00 4.83
1664 1665 5.514500 TCCTCCACTAAGGCTATTGTTTT 57.486 39.130 0.00 0.00 36.29 2.43
1668 1669 5.998363 GGTAATTCCTCCACTAAGGCTATTG 59.002 44.000 0.00 0.00 36.29 1.90
1678 1679 2.206223 GGAAGGGGTAATTCCTCCACT 58.794 52.381 0.00 0.00 42.52 4.00
1689 1690 5.163131 GGTGCTATTGAATAAGGAAGGGGTA 60.163 44.000 0.00 0.00 0.00 3.69
1690 1691 4.386424 GGTGCTATTGAATAAGGAAGGGGT 60.386 45.833 0.00 0.00 0.00 4.95
1692 1693 5.053978 AGGTGCTATTGAATAAGGAAGGG 57.946 43.478 0.00 0.00 0.00 3.95
1696 1697 5.912149 ATGGAGGTGCTATTGAATAAGGA 57.088 39.130 0.00 0.00 0.00 3.36
1699 1700 6.672593 AGGAAATGGAGGTGCTATTGAATAA 58.327 36.000 0.00 0.00 0.00 1.40
1701 1702 5.134725 AGGAAATGGAGGTGCTATTGAAT 57.865 39.130 0.00 0.00 0.00 2.57
1713 1714 7.151308 GTGACAGATCTACATAGGAAATGGAG 58.849 42.308 0.00 0.00 0.00 3.86
1714 1715 6.239036 CGTGACAGATCTACATAGGAAATGGA 60.239 42.308 0.00 0.00 0.00 3.41
1725 1726 3.866883 TCATTGCGTGACAGATCTACA 57.133 42.857 0.00 0.00 0.00 2.74
1726 1727 4.177026 AGTTCATTGCGTGACAGATCTAC 58.823 43.478 0.00 0.00 36.32 2.59
1732 1733 3.548587 CAGAAAGTTCATTGCGTGACAG 58.451 45.455 0.00 0.00 36.32 3.51
1739 1740 4.488879 GATTGACCCAGAAAGTTCATTGC 58.511 43.478 0.00 0.00 0.00 3.56
1740 1741 5.064441 GGATTGACCCAGAAAGTTCATTG 57.936 43.478 0.00 0.00 0.00 2.82
1755 1756 1.278127 TGAGGGAAAGACGGGATTGAC 59.722 52.381 0.00 0.00 0.00 3.18
1758 1759 2.554564 GGTTTGAGGGAAAGACGGGATT 60.555 50.000 0.00 0.00 0.00 3.01
1765 1766 2.131854 TGGTGAGGTTTGAGGGAAAGA 58.868 47.619 0.00 0.00 0.00 2.52
1772 1773 3.199880 ACTGAAGTGGTGAGGTTTGAG 57.800 47.619 0.00 0.00 0.00 3.02
1788 1792 5.801531 TTTCAGTTAGAGCAAGGTACTGA 57.198 39.130 0.00 0.00 42.34 3.41
1791 1795 7.175119 AGGAAATTTTCAGTTAGAGCAAGGTAC 59.825 37.037 11.09 0.00 0.00 3.34
1797 1801 7.554118 CCTGATAGGAAATTTTCAGTTAGAGCA 59.446 37.037 13.81 0.00 37.67 4.26
1798 1802 7.012799 CCCTGATAGGAAATTTTCAGTTAGAGC 59.987 40.741 13.81 0.00 37.67 4.09
1800 1804 7.346471 CCCCTGATAGGAAATTTTCAGTTAGA 58.654 38.462 13.81 0.00 37.67 2.10
1807 1811 3.642141 TGCCCCCTGATAGGAAATTTTC 58.358 45.455 0.24 0.24 37.67 2.29
1812 1816 1.499007 GGAATGCCCCCTGATAGGAAA 59.501 52.381 0.00 0.00 37.67 3.13
1814 1818 0.271927 AGGAATGCCCCCTGATAGGA 59.728 55.000 0.00 0.00 33.47 2.94
1818 1822 0.628668 AGGAAGGAATGCCCCCTGAT 60.629 55.000 0.43 0.00 36.65 2.90
1821 1825 0.850883 TTGAGGAAGGAATGCCCCCT 60.851 55.000 0.84 0.84 39.59 4.79
1836 1840 4.829492 AGGGAAGACAAGTTTCCAATTGAG 59.171 41.667 7.12 0.00 44.77 3.02
1849 1853 6.043243 AGTTGAAGAGAATACAGGGAAGACAA 59.957 38.462 0.00 0.00 0.00 3.18
1862 1866 7.772757 AGTTGTTTTGAGAGAGTTGAAGAGAAT 59.227 33.333 0.00 0.00 0.00 2.40
1866 1870 6.316390 GGAAGTTGTTTTGAGAGAGTTGAAGA 59.684 38.462 0.00 0.00 0.00 2.87
1875 1879 5.766222 CTTCCATGGAAGTTGTTTTGAGAG 58.234 41.667 36.68 15.11 44.65 3.20
1876 1880 5.772825 CTTCCATGGAAGTTGTTTTGAGA 57.227 39.130 36.68 9.70 44.65 3.27
1893 1897 1.571955 TGCTCTCTGGTATGCTTCCA 58.428 50.000 0.00 0.00 0.00 3.53
1902 1906 4.899352 AAGTTGACTTATGCTCTCTGGT 57.101 40.909 0.00 0.00 33.79 4.00
1921 1925 8.911247 AAGTTTAGTACTTGCAAACTTGAAAG 57.089 30.769 24.35 8.40 45.80 2.62
1965 1969 1.708993 TTGCTGCTGGGACAACTCCT 61.709 55.000 0.00 0.00 38.70 3.69
1968 1972 1.708341 AAATTGCTGCTGGGACAACT 58.292 45.000 0.00 0.00 38.70 3.16
1969 1973 2.295909 TGTAAATTGCTGCTGGGACAAC 59.704 45.455 0.00 0.00 38.70 3.32
1978 1982 3.716601 AGGTGTTTGTGTAAATTGCTGC 58.283 40.909 0.00 0.00 0.00 5.25
1979 1983 4.298332 GGAGGTGTTTGTGTAAATTGCTG 58.702 43.478 0.00 0.00 0.00 4.41
1990 1994 6.449830 AAGATAAGTAAGGGAGGTGTTTGT 57.550 37.500 0.00 0.00 0.00 2.83
1998 2002 7.726738 AGACTAAGGCTAAGATAAGTAAGGGAG 59.273 40.741 0.00 0.00 0.00 4.30
2040 2044 5.567138 ATCCGATGTCAGTTGGAATTTTC 57.433 39.130 0.00 0.00 35.32 2.29
2042 2046 5.354234 GTGTATCCGATGTCAGTTGGAATTT 59.646 40.000 0.00 0.00 35.32 1.82
2049 2053 4.142138 GGAAGAGTGTATCCGATGTCAGTT 60.142 45.833 0.00 0.00 0.00 3.16
2050 2054 3.381908 GGAAGAGTGTATCCGATGTCAGT 59.618 47.826 0.00 0.00 0.00 3.41
2052 2056 3.361786 TGGAAGAGTGTATCCGATGTCA 58.638 45.455 0.00 0.00 38.63 3.58
2058 2062 4.330074 GTGATGTTTGGAAGAGTGTATCCG 59.670 45.833 0.00 0.00 38.63 4.18
2061 2065 5.934625 GTCTGTGATGTTTGGAAGAGTGTAT 59.065 40.000 0.00 0.00 0.00 2.29
2082 2086 4.016479 TGGTTCCCTCCTAGTATCAAGTCT 60.016 45.833 0.00 0.00 0.00 3.24
2085 2089 5.896073 ATTGGTTCCCTCCTAGTATCAAG 57.104 43.478 0.00 0.00 0.00 3.02
2100 2104 4.261614 GGAATTAGGCCATCGAATTGGTTC 60.262 45.833 5.01 2.66 39.11 3.62
2133 2137 6.418057 TTTTGTAGGTTTGATGCATTTCCT 57.582 33.333 0.00 9.12 0.00 3.36
2136 2140 9.023962 TCTAGATTTTGTAGGTTTGATGCATTT 57.976 29.630 0.00 0.00 0.00 2.32
2151 2155 7.745620 ATTTTGACGAAGGTCTAGATTTTGT 57.254 32.000 10.86 10.86 43.79 2.83
2158 2162 7.148623 GGTGAGTAAATTTTGACGAAGGTCTAG 60.149 40.741 0.00 0.00 43.79 2.43
2177 2181 3.833650 TGAAGGAATAACACCGGTGAGTA 59.166 43.478 40.21 28.70 0.00 2.59
2184 2188 2.027561 TCCCAGTGAAGGAATAACACCG 60.028 50.000 0.00 0.00 35.47 4.94
2197 2201 0.836606 TTGCTCAAGTGTCCCAGTGA 59.163 50.000 0.00 0.00 0.00 3.41
2222 2226 6.627395 TGTTTGTACCCAAGTCTATGTTTG 57.373 37.500 0.00 0.00 0.00 2.93
2225 2229 4.700213 GCATGTTTGTACCCAAGTCTATGT 59.300 41.667 0.00 0.00 0.00 2.29
2227 2231 5.179452 AGCATGTTTGTACCCAAGTCTAT 57.821 39.130 0.00 0.00 0.00 1.98
2233 2237 2.852449 TCGAAGCATGTTTGTACCCAA 58.148 42.857 0.00 0.00