Multiple sequence alignment - TraesCS1A01G006700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G006700 chr1A 100.000 5615 0 0 1 5615 3619379 3613765 0.000000e+00 10370
1 TraesCS1A01G006700 chr1B 80.174 2648 451 47 2083 4683 1781009 1783629 0.000000e+00 1914
2 TraesCS1A01G006700 chr1B 79.162 2601 448 56 2145 4683 1846762 1844194 0.000000e+00 1714
3 TraesCS1A01G006700 chr1B 79.461 2488 428 48 2258 4678 1731315 1728844 0.000000e+00 1687
4 TraesCS1A01G006700 chr1B 79.303 2382 418 48 2145 4478 724239 721885 0.000000e+00 1598
5 TraesCS1A01G006700 chr1B 77.464 2445 442 59 2147 4526 2755204 2752804 0.000000e+00 1362
6 TraesCS1A01G006700 chr1B 76.219 2359 475 59 2148 4466 171157 168845 0.000000e+00 1170
7 TraesCS1A01G006700 chr1B 75.698 1469 288 38 3026 4451 2303486 2302044 0.000000e+00 671
8 TraesCS1A01G006700 chr1B 73.758 1147 251 37 3367 4483 2005205 2004079 6.770000e-109 405
9 TraesCS1A01G006700 chr1B 81.979 283 38 7 845 1116 1848366 1848086 1.570000e-55 228
10 TraesCS1A01G006700 chr1B 78.704 324 53 12 806 1116 725576 725256 9.540000e-48 202
11 TraesCS1A01G006700 chr1B 80.159 252 37 8 868 1109 3162831 3163079 5.780000e-40 176
12 TraesCS1A01G006700 chr3B 77.693 2358 443 36 2159 4467 801314923 801317246 0.000000e+00 1363
13 TraesCS1A01G006700 chr3B 74.967 1522 277 61 3008 4453 815478491 815479984 6.220000e-169 604
14 TraesCS1A01G006700 chr1D 80.127 1731 292 31 2145 3834 2498223 2496504 0.000000e+00 1243
15 TraesCS1A01G006700 chr3A 81.212 1485 241 25 2105 3558 52198813 52197336 0.000000e+00 1162
16 TraesCS1A01G006700 chr3A 74.734 1504 293 59 3008 4453 737799698 737801172 4.840000e-165 592
17 TraesCS1A01G006700 chr3A 77.039 932 185 23 3559 4472 52196927 52196007 5.020000e-140 508
18 TraesCS1A01G006700 chr6B 75.818 2291 460 65 2251 4478 10747289 10745030 0.000000e+00 1075
19 TraesCS1A01G006700 chr6B 92.746 193 13 1 5221 5413 120134430 120134621 1.540000e-70 278
20 TraesCS1A01G006700 chr4B 74.949 1465 260 73 3066 4475 604003686 604005098 1.750000e-159 573
21 TraesCS1A01G006700 chr2A 92.839 391 28 0 5225 5615 694812383 694812773 8.160000e-158 568
22 TraesCS1A01G006700 chr2A 85.459 392 50 5 5230 5615 19485006 19485396 8.760000e-108 401
23 TraesCS1A01G006700 chr4A 91.184 397 35 0 5219 5615 4875255 4874859 1.780000e-149 540
24 TraesCS1A01G006700 chr5A 91.371 394 31 1 5222 5615 558972252 558971862 2.300000e-148 536
25 TraesCS1A01G006700 chr5A 88.627 255 29 0 5361 5615 455549545 455549291 1.520000e-80 311
26 TraesCS1A01G006700 chr5A 89.231 195 13 4 8 202 654112807 654112621 2.610000e-58 237
27 TraesCS1A01G006700 chr4D 74.231 1463 277 69 3066 4475 477866573 477867988 6.450000e-144 521
28 TraesCS1A01G006700 chr4D 95.050 202 9 1 1 202 15960821 15960621 3.260000e-82 316
29 TraesCS1A01G006700 chr7A 91.530 366 31 0 5250 5615 672860786 672861151 6.490000e-139 505
30 TraesCS1A01G006700 chr3D 89.487 390 39 2 5224 5612 388341759 388342147 5.050000e-135 492
31 TraesCS1A01G006700 chr3D 91.045 201 16 1 1 201 529872600 529872798 2.580000e-68 270
32 TraesCS1A01G006700 chr3D 92.000 175 14 0 1 175 480414587 480414761 4.340000e-61 246
33 TraesCS1A01G006700 chrUn 95.050 202 10 0 1 202 68204803 68204602 9.080000e-83 318
34 TraesCS1A01G006700 chr5D 89.020 255 28 0 5361 5615 354545000 354544746 3.260000e-82 316
35 TraesCS1A01G006700 chr2B 94.000 200 12 0 1 200 778967000 778967199 2.540000e-78 303
36 TraesCS1A01G006700 chr7D 92.079 202 16 0 1 202 535773889 535773688 9.210000e-73 285
37 TraesCS1A01G006700 chr6D 91.089 202 18 0 1 202 349105947 349105746 1.990000e-69 274
38 TraesCS1A01G006700 chr5B 93.182 176 11 1 27 202 518474005 518474179 2.010000e-64 257


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G006700 chr1A 3613765 3619379 5614 True 10370 10370 100.0000 1 5615 1 chr1A.!!$R1 5614
1 TraesCS1A01G006700 chr1B 1781009 1783629 2620 False 1914 1914 80.1740 2083 4683 1 chr1B.!!$F1 2600
2 TraesCS1A01G006700 chr1B 1728844 1731315 2471 True 1687 1687 79.4610 2258 4678 1 chr1B.!!$R2 2420
3 TraesCS1A01G006700 chr1B 2752804 2755204 2400 True 1362 1362 77.4640 2147 4526 1 chr1B.!!$R5 2379
4 TraesCS1A01G006700 chr1B 168845 171157 2312 True 1170 1170 76.2190 2148 4466 1 chr1B.!!$R1 2318
5 TraesCS1A01G006700 chr1B 1844194 1848366 4172 True 971 1714 80.5705 845 4683 2 chr1B.!!$R7 3838
6 TraesCS1A01G006700 chr1B 721885 725576 3691 True 900 1598 79.0035 806 4478 2 chr1B.!!$R6 3672
7 TraesCS1A01G006700 chr1B 2302044 2303486 1442 True 671 671 75.6980 3026 4451 1 chr1B.!!$R4 1425
8 TraesCS1A01G006700 chr1B 2004079 2005205 1126 True 405 405 73.7580 3367 4483 1 chr1B.!!$R3 1116
9 TraesCS1A01G006700 chr3B 801314923 801317246 2323 False 1363 1363 77.6930 2159 4467 1 chr3B.!!$F1 2308
10 TraesCS1A01G006700 chr3B 815478491 815479984 1493 False 604 604 74.9670 3008 4453 1 chr3B.!!$F2 1445
11 TraesCS1A01G006700 chr1D 2496504 2498223 1719 True 1243 1243 80.1270 2145 3834 1 chr1D.!!$R1 1689
12 TraesCS1A01G006700 chr3A 52196007 52198813 2806 True 835 1162 79.1255 2105 4472 2 chr3A.!!$R1 2367
13 TraesCS1A01G006700 chr3A 737799698 737801172 1474 False 592 592 74.7340 3008 4453 1 chr3A.!!$F1 1445
14 TraesCS1A01G006700 chr6B 10745030 10747289 2259 True 1075 1075 75.8180 2251 4478 1 chr6B.!!$R1 2227
15 TraesCS1A01G006700 chr4B 604003686 604005098 1412 False 573 573 74.9490 3066 4475 1 chr4B.!!$F1 1409
16 TraesCS1A01G006700 chr4D 477866573 477867988 1415 False 521 521 74.2310 3066 4475 1 chr4D.!!$F1 1409


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
166 167 0.025898 CAATGCTCACTCATCGCACG 59.974 55.0 0.00 0.00 36.37 5.34 F
327 328 0.031994 CGGCCACTTTTGGTCCTTTG 59.968 55.0 2.24 0.00 45.85 2.77 F
546 547 0.034616 ATGGCTCTTGCTATCTCCGC 59.965 55.0 0.00 0.00 35.39 5.54 F
904 905 0.034670 GCTCTTGCCCAACATCCTCT 60.035 55.0 0.00 0.00 0.00 3.69 F
1165 1176 0.043566 CACGAGAATTGAGCGCATCG 60.044 55.0 11.47 9.22 36.32 3.84 F
1235 1286 0.101399 CGTAGGTCAGAAGATGCGCT 59.899 55.0 9.73 0.00 0.00 5.92 F
1316 1577 0.106894 GATTCCTCGGGATGGTGGTC 59.893 60.0 0.00 0.00 0.00 4.02 F
1920 2470 0.107081 TCCCGTTTTTCAGGAAGCGA 59.893 50.0 0.00 0.00 35.62 4.93 F
2119 2722 0.613260 ACGGCTTACAGGAGAATGCA 59.387 50.0 0.00 0.00 0.00 3.96 F
3998 5142 0.518636 CAAGGAACGGCTCACATGTG 59.481 55.0 20.18 20.18 0.00 3.21 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1146 1157 0.043566 CGATGCGCTCAATTCTCGTG 60.044 55.000 9.73 0.00 0.00 4.35 R
1216 1267 0.101399 AGCGCATCTTCTGACCTACG 59.899 55.000 11.47 0.00 0.00 3.51 R
2129 2732 0.107456 ATAGCCGCACCCAGAGAATG 59.893 55.000 0.00 0.00 0.00 2.67 R
2869 3484 0.029300 CAGCACCAACACTTGTTCCG 59.971 55.000 0.00 0.00 35.83 4.30 R
2950 3568 1.814527 CCGTCCTGCCACTACTACC 59.185 63.158 0.00 0.00 0.00 3.18 R
3198 3816 0.249657 GCCCTCAGCTACATCTTCCG 60.250 60.000 0.00 0.00 38.99 4.30 R
3236 3854 3.192001 TCTGGTTGAAGAAATGAGCATGC 59.808 43.478 10.51 10.51 0.00 4.06 R
3358 4027 1.279271 ACATCTCCTTTCCACCCTTCG 59.721 52.381 0.00 0.00 0.00 3.79 R
4016 5169 2.198827 TTGCACCTTGTATCACCAGG 57.801 50.000 0.00 0.00 0.00 4.45 R
5223 6452 0.039978 CGCCAGAGCTAGACATACCG 60.040 60.000 0.00 0.00 36.60 4.02 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
17 18 4.436515 TTGTGGTGTGTCAGCTCG 57.563 55.556 0.00 0.00 32.61 5.03
18 19 1.520192 TTGTGGTGTGTCAGCTCGT 59.480 52.632 0.00 0.00 32.61 4.18
19 20 0.107897 TTGTGGTGTGTCAGCTCGTT 60.108 50.000 0.00 0.00 32.61 3.85
20 21 0.809636 TGTGGTGTGTCAGCTCGTTG 60.810 55.000 0.00 0.00 32.61 4.10
21 22 0.810031 GTGGTGTGTCAGCTCGTTGT 60.810 55.000 0.00 0.00 32.61 3.32
22 23 0.809636 TGGTGTGTCAGCTCGTTGTG 60.810 55.000 0.00 0.00 32.61 3.33
23 24 0.810031 GGTGTGTCAGCTCGTTGTGT 60.810 55.000 0.00 0.00 0.00 3.72
24 25 1.537348 GGTGTGTCAGCTCGTTGTGTA 60.537 52.381 0.00 0.00 0.00 2.90
25 26 1.521423 GTGTGTCAGCTCGTTGTGTAC 59.479 52.381 0.00 0.00 0.00 2.90
26 27 1.135333 TGTGTCAGCTCGTTGTGTACA 59.865 47.619 0.00 0.00 0.00 2.90
27 28 2.223947 TGTGTCAGCTCGTTGTGTACAT 60.224 45.455 0.00 0.00 0.00 2.29
28 29 2.155732 GTGTCAGCTCGTTGTGTACATG 59.844 50.000 0.00 0.00 0.00 3.21
29 30 1.126846 GTCAGCTCGTTGTGTACATGC 59.873 52.381 0.00 0.00 0.00 4.06
30 31 0.443869 CAGCTCGTTGTGTACATGCC 59.556 55.000 0.00 0.00 0.00 4.40
31 32 0.034756 AGCTCGTTGTGTACATGCCA 59.965 50.000 0.00 0.00 0.00 4.92
32 33 0.871722 GCTCGTTGTGTACATGCCAA 59.128 50.000 0.00 0.00 0.00 4.52
33 34 1.135972 GCTCGTTGTGTACATGCCAAG 60.136 52.381 0.00 0.00 0.00 3.61
34 35 2.143122 CTCGTTGTGTACATGCCAAGT 58.857 47.619 0.00 0.00 0.00 3.16
35 36 2.548057 CTCGTTGTGTACATGCCAAGTT 59.452 45.455 0.00 0.00 0.00 2.66
36 37 2.546368 TCGTTGTGTACATGCCAAGTTC 59.454 45.455 0.00 0.00 0.00 3.01
37 38 2.548057 CGTTGTGTACATGCCAAGTTCT 59.452 45.455 0.00 0.00 0.00 3.01
38 39 3.363970 CGTTGTGTACATGCCAAGTTCTC 60.364 47.826 0.00 0.00 0.00 2.87
39 40 2.778299 TGTGTACATGCCAAGTTCTCC 58.222 47.619 0.00 0.00 0.00 3.71
40 41 2.105649 TGTGTACATGCCAAGTTCTCCA 59.894 45.455 0.00 0.00 0.00 3.86
41 42 3.244875 TGTGTACATGCCAAGTTCTCCAT 60.245 43.478 0.00 0.00 0.00 3.41
42 43 4.019771 TGTGTACATGCCAAGTTCTCCATA 60.020 41.667 0.00 0.00 0.00 2.74
43 44 4.572389 GTGTACATGCCAAGTTCTCCATAG 59.428 45.833 0.00 0.00 0.00 2.23
44 45 4.225042 TGTACATGCCAAGTTCTCCATAGT 59.775 41.667 0.00 0.00 0.00 2.12
45 46 3.614092 ACATGCCAAGTTCTCCATAGTG 58.386 45.455 0.00 0.00 0.00 2.74
46 47 3.009473 ACATGCCAAGTTCTCCATAGTGT 59.991 43.478 0.00 0.00 0.00 3.55
47 48 3.334583 TGCCAAGTTCTCCATAGTGTC 57.665 47.619 0.00 0.00 0.00 3.67
48 49 2.637382 TGCCAAGTTCTCCATAGTGTCA 59.363 45.455 0.00 0.00 0.00 3.58
49 50 3.264193 TGCCAAGTTCTCCATAGTGTCAT 59.736 43.478 0.00 0.00 0.00 3.06
50 51 3.873952 GCCAAGTTCTCCATAGTGTCATC 59.126 47.826 0.00 0.00 0.00 2.92
51 52 4.623886 GCCAAGTTCTCCATAGTGTCATCA 60.624 45.833 0.00 0.00 0.00 3.07
52 53 5.491070 CCAAGTTCTCCATAGTGTCATCAA 58.509 41.667 0.00 0.00 0.00 2.57
53 54 6.118170 CCAAGTTCTCCATAGTGTCATCAAT 58.882 40.000 0.00 0.00 0.00 2.57
54 55 7.275183 CCAAGTTCTCCATAGTGTCATCAATA 58.725 38.462 0.00 0.00 0.00 1.90
55 56 7.935755 CCAAGTTCTCCATAGTGTCATCAATAT 59.064 37.037 0.00 0.00 35.61 1.28
56 57 9.987272 CAAGTTCTCCATAGTGTCATCAATATA 57.013 33.333 0.00 0.00 33.86 0.86
58 59 8.811017 AGTTCTCCATAGTGTCATCAATATAGG 58.189 37.037 0.00 0.00 33.86 2.57
59 60 8.807118 GTTCTCCATAGTGTCATCAATATAGGA 58.193 37.037 0.00 0.00 33.86 2.94
60 61 8.956446 TCTCCATAGTGTCATCAATATAGGAA 57.044 34.615 0.00 0.00 34.70 3.36
61 62 9.029368 TCTCCATAGTGTCATCAATATAGGAAG 57.971 37.037 0.00 0.00 34.70 3.46
62 63 8.727100 TCCATAGTGTCATCAATATAGGAAGT 57.273 34.615 0.00 0.00 33.86 3.01
63 64 8.807118 TCCATAGTGTCATCAATATAGGAAGTC 58.193 37.037 0.00 0.00 33.86 3.01
64 65 7.757173 CCATAGTGTCATCAATATAGGAAGTCG 59.243 40.741 0.00 0.00 33.86 4.18
65 66 6.716934 AGTGTCATCAATATAGGAAGTCGT 57.283 37.500 0.00 0.00 0.00 4.34
66 67 7.113658 AGTGTCATCAATATAGGAAGTCGTT 57.886 36.000 0.00 0.00 0.00 3.85
67 68 7.203910 AGTGTCATCAATATAGGAAGTCGTTC 58.796 38.462 0.00 0.00 0.00 3.95
77 78 2.355717 GAAGTCGTTCCTCCTCACTG 57.644 55.000 0.00 0.00 0.00 3.66
78 79 0.318762 AAGTCGTTCCTCCTCACTGC 59.681 55.000 0.00 0.00 0.00 4.40
79 80 0.540830 AGTCGTTCCTCCTCACTGCT 60.541 55.000 0.00 0.00 0.00 4.24
80 81 0.109039 GTCGTTCCTCCTCACTGCTC 60.109 60.000 0.00 0.00 0.00 4.26
81 82 0.251386 TCGTTCCTCCTCACTGCTCT 60.251 55.000 0.00 0.00 0.00 4.09
82 83 0.605589 CGTTCCTCCTCACTGCTCTT 59.394 55.000 0.00 0.00 0.00 2.85
83 84 1.671261 CGTTCCTCCTCACTGCTCTTG 60.671 57.143 0.00 0.00 0.00 3.02
84 85 1.346068 GTTCCTCCTCACTGCTCTTGT 59.654 52.381 0.00 0.00 0.00 3.16
85 86 1.722034 TCCTCCTCACTGCTCTTGTT 58.278 50.000 0.00 0.00 0.00 2.83
86 87 1.345741 TCCTCCTCACTGCTCTTGTTG 59.654 52.381 0.00 0.00 0.00 3.33
87 88 1.345741 CCTCCTCACTGCTCTTGTTGA 59.654 52.381 0.00 0.00 0.00 3.18
88 89 2.612471 CCTCCTCACTGCTCTTGTTGAG 60.612 54.545 0.00 0.00 45.33 3.02
89 90 2.298446 CTCCTCACTGCTCTTGTTGAGA 59.702 50.000 0.00 0.00 45.39 3.27
90 91 2.700371 TCCTCACTGCTCTTGTTGAGAA 59.300 45.455 0.00 0.00 45.39 2.87
96 97 3.130280 TGCTCTTGTTGAGAAGATGCA 57.870 42.857 0.00 0.00 45.39 3.96
97 98 3.072211 TGCTCTTGTTGAGAAGATGCAG 58.928 45.455 0.00 0.00 45.39 4.41
98 99 2.159544 GCTCTTGTTGAGAAGATGCAGC 60.160 50.000 0.00 0.00 45.39 5.25
99 100 3.072211 CTCTTGTTGAGAAGATGCAGCA 58.928 45.455 4.07 0.00 45.39 4.41
100 101 3.479489 TCTTGTTGAGAAGATGCAGCAA 58.521 40.909 4.07 0.00 34.73 3.91
101 102 3.251729 TCTTGTTGAGAAGATGCAGCAAC 59.748 43.478 4.07 0.00 39.29 4.17
102 103 1.881973 TGTTGAGAAGATGCAGCAACC 59.118 47.619 4.07 0.00 38.36 3.77
103 104 1.881973 GTTGAGAAGATGCAGCAACCA 59.118 47.619 4.07 0.00 34.36 3.67
104 105 1.527034 TGAGAAGATGCAGCAACCAC 58.473 50.000 4.07 0.00 0.00 4.16
105 106 1.072806 TGAGAAGATGCAGCAACCACT 59.927 47.619 4.07 0.00 0.00 4.00
106 107 1.736681 GAGAAGATGCAGCAACCACTC 59.263 52.381 4.07 5.11 0.00 3.51
107 108 0.807496 GAAGATGCAGCAACCACTCC 59.193 55.000 4.07 0.00 0.00 3.85
108 109 0.610232 AAGATGCAGCAACCACTCCC 60.610 55.000 4.07 0.00 0.00 4.30
109 110 2.360350 ATGCAGCAACCACTCCCG 60.360 61.111 0.00 0.00 0.00 5.14
110 111 3.196207 ATGCAGCAACCACTCCCGT 62.196 57.895 0.00 0.00 0.00 5.28
111 112 3.050275 GCAGCAACCACTCCCGTC 61.050 66.667 0.00 0.00 0.00 4.79
112 113 2.358737 CAGCAACCACTCCCGTCC 60.359 66.667 0.00 0.00 0.00 4.79
113 114 2.526873 AGCAACCACTCCCGTCCT 60.527 61.111 0.00 0.00 0.00 3.85
114 115 2.358737 GCAACCACTCCCGTCCTG 60.359 66.667 0.00 0.00 0.00 3.86
115 116 3.148084 CAACCACTCCCGTCCTGT 58.852 61.111 0.00 0.00 0.00 4.00
116 117 1.823169 GCAACCACTCCCGTCCTGTA 61.823 60.000 0.00 0.00 0.00 2.74
117 118 0.902531 CAACCACTCCCGTCCTGTAT 59.097 55.000 0.00 0.00 0.00 2.29
118 119 0.902531 AACCACTCCCGTCCTGTATG 59.097 55.000 0.00 0.00 0.00 2.39
119 120 1.144057 CCACTCCCGTCCTGTATGC 59.856 63.158 0.00 0.00 0.00 3.14
120 121 1.330655 CCACTCCCGTCCTGTATGCT 61.331 60.000 0.00 0.00 0.00 3.79
121 122 0.103208 CACTCCCGTCCTGTATGCTC 59.897 60.000 0.00 0.00 0.00 4.26
122 123 1.360551 CTCCCGTCCTGTATGCTCG 59.639 63.158 0.00 0.00 0.00 5.03
123 124 1.077285 TCCCGTCCTGTATGCTCGA 60.077 57.895 0.00 0.00 0.00 4.04
124 125 0.467474 TCCCGTCCTGTATGCTCGAT 60.467 55.000 0.00 0.00 0.00 3.59
125 126 0.319040 CCCGTCCTGTATGCTCGATG 60.319 60.000 0.00 0.00 0.00 3.84
126 127 0.385751 CCGTCCTGTATGCTCGATGT 59.614 55.000 0.00 0.00 0.00 3.06
127 128 1.202417 CCGTCCTGTATGCTCGATGTT 60.202 52.381 0.00 0.00 0.00 2.71
128 129 2.540515 CGTCCTGTATGCTCGATGTTT 58.459 47.619 0.00 0.00 0.00 2.83
129 130 2.930040 CGTCCTGTATGCTCGATGTTTT 59.070 45.455 0.00 0.00 0.00 2.43
130 131 3.000322 CGTCCTGTATGCTCGATGTTTTC 60.000 47.826 0.00 0.00 0.00 2.29
131 132 3.309954 GTCCTGTATGCTCGATGTTTTCC 59.690 47.826 0.00 0.00 0.00 3.13
132 133 3.055458 TCCTGTATGCTCGATGTTTTCCA 60.055 43.478 0.00 0.00 0.00 3.53
133 134 3.689161 CCTGTATGCTCGATGTTTTCCAA 59.311 43.478 0.00 0.00 0.00 3.53
134 135 4.437390 CCTGTATGCTCGATGTTTTCCAAC 60.437 45.833 0.00 0.00 0.00 3.77
135 136 4.323417 TGTATGCTCGATGTTTTCCAACT 58.677 39.130 0.00 0.00 33.58 3.16
136 137 5.483811 TGTATGCTCGATGTTTTCCAACTA 58.516 37.500 0.00 0.00 33.58 2.24
137 138 5.580691 TGTATGCTCGATGTTTTCCAACTAG 59.419 40.000 0.00 0.00 33.58 2.57
138 139 3.334691 TGCTCGATGTTTTCCAACTAGG 58.665 45.455 0.00 0.00 39.47 3.02
139 140 2.678336 GCTCGATGTTTTCCAACTAGGG 59.322 50.000 0.00 0.00 38.24 3.53
140 141 2.678336 CTCGATGTTTTCCAACTAGGGC 59.322 50.000 0.00 0.00 38.24 5.19
141 142 2.039216 TCGATGTTTTCCAACTAGGGCA 59.961 45.455 0.00 0.00 38.24 5.36
142 143 3.016736 CGATGTTTTCCAACTAGGGCAT 58.983 45.455 0.00 0.00 38.24 4.40
143 144 3.443681 CGATGTTTTCCAACTAGGGCATT 59.556 43.478 0.00 0.00 38.24 3.56
144 145 4.438744 CGATGTTTTCCAACTAGGGCATTC 60.439 45.833 0.00 0.00 38.24 2.67
145 146 4.112634 TGTTTTCCAACTAGGGCATTCT 57.887 40.909 0.00 0.00 38.24 2.40
146 147 4.079253 TGTTTTCCAACTAGGGCATTCTC 58.921 43.478 0.00 0.00 38.24 2.87
147 148 3.366052 TTTCCAACTAGGGCATTCTCC 57.634 47.619 0.00 0.00 38.24 3.71
148 149 1.965414 TCCAACTAGGGCATTCTCCA 58.035 50.000 0.00 0.00 38.24 3.86
149 150 2.274542 TCCAACTAGGGCATTCTCCAA 58.725 47.619 0.00 0.00 38.24 3.53
150 151 2.852449 TCCAACTAGGGCATTCTCCAAT 59.148 45.455 0.00 0.00 38.24 3.16
151 152 2.954318 CCAACTAGGGCATTCTCCAATG 59.046 50.000 0.00 0.00 42.26 2.82
161 162 4.815040 CATTCTCCAATGCTCACTCATC 57.185 45.455 0.00 0.00 33.19 2.92
162 163 2.591571 TCTCCAATGCTCACTCATCG 57.408 50.000 0.00 0.00 0.00 3.84
163 164 0.935898 CTCCAATGCTCACTCATCGC 59.064 55.000 0.00 0.00 0.00 4.58
164 165 0.249955 TCCAATGCTCACTCATCGCA 59.750 50.000 0.00 0.00 38.14 5.10
165 166 0.376152 CCAATGCTCACTCATCGCAC 59.624 55.000 0.00 0.00 36.37 5.34
166 167 0.025898 CAATGCTCACTCATCGCACG 59.974 55.000 0.00 0.00 36.37 5.34
167 168 1.699656 AATGCTCACTCATCGCACGC 61.700 55.000 0.00 0.00 36.37 5.34
168 169 3.558411 GCTCACTCATCGCACGCC 61.558 66.667 0.00 0.00 0.00 5.68
169 170 2.125952 CTCACTCATCGCACGCCA 60.126 61.111 0.00 0.00 0.00 5.69
170 171 2.125952 TCACTCATCGCACGCCAG 60.126 61.111 0.00 0.00 0.00 4.85
171 172 2.125952 CACTCATCGCACGCCAGA 60.126 61.111 0.00 0.00 0.00 3.86
172 173 2.163390 CACTCATCGCACGCCAGAG 61.163 63.158 0.00 0.00 0.00 3.35
173 174 2.182791 CTCATCGCACGCCAGAGT 59.817 61.111 0.00 0.00 0.00 3.24
174 175 1.875813 CTCATCGCACGCCAGAGTC 60.876 63.158 0.00 0.00 0.00 3.36
175 176 2.887568 CATCGCACGCCAGAGTCC 60.888 66.667 0.00 0.00 0.00 3.85
176 177 3.071206 ATCGCACGCCAGAGTCCT 61.071 61.111 0.00 0.00 0.00 3.85
177 178 2.650116 ATCGCACGCCAGAGTCCTT 61.650 57.895 0.00 0.00 0.00 3.36
178 179 2.842394 ATCGCACGCCAGAGTCCTTG 62.842 60.000 0.00 0.00 0.00 3.61
179 180 2.743928 GCACGCCAGAGTCCTTGG 60.744 66.667 0.00 0.00 0.00 3.61
180 181 2.046892 CACGCCAGAGTCCTTGGG 60.047 66.667 0.93 0.00 0.00 4.12
181 182 4.021925 ACGCCAGAGTCCTTGGGC 62.022 66.667 0.93 2.22 42.98 5.36
182 183 4.785453 CGCCAGAGTCCTTGGGCC 62.785 72.222 0.00 0.00 43.50 5.80
183 184 3.650950 GCCAGAGTCCTTGGGCCA 61.651 66.667 0.00 0.00 40.55 5.36
184 185 2.988839 GCCAGAGTCCTTGGGCCAT 61.989 63.158 7.26 0.00 40.55 4.40
185 186 1.693640 CCAGAGTCCTTGGGCCATT 59.306 57.895 7.26 0.00 0.00 3.16
186 187 0.682209 CCAGAGTCCTTGGGCCATTG 60.682 60.000 7.26 3.18 0.00 2.82
187 188 0.682209 CAGAGTCCTTGGGCCATTGG 60.682 60.000 7.26 13.63 0.00 3.16
188 189 0.846427 AGAGTCCTTGGGCCATTGGA 60.846 55.000 20.56 20.56 0.00 3.53
189 190 0.681243 GAGTCCTTGGGCCATTGGAC 60.681 60.000 33.85 33.85 46.67 4.02
190 191 1.076549 GTCCTTGGGCCATTGGACA 59.923 57.895 34.87 15.31 45.87 4.02
191 192 0.324645 GTCCTTGGGCCATTGGACAT 60.325 55.000 34.87 0.00 45.87 3.06
192 193 0.033208 TCCTTGGGCCATTGGACATC 60.033 55.000 20.56 0.00 27.52 3.06
193 194 0.032813 CCTTGGGCCATTGGACATCT 60.033 55.000 18.04 0.00 27.52 2.90
194 195 1.108776 CTTGGGCCATTGGACATCTG 58.891 55.000 11.55 0.00 27.52 2.90
195 196 0.971959 TTGGGCCATTGGACATCTGC 60.972 55.000 11.55 0.00 27.52 4.26
196 197 1.380246 GGGCCATTGGACATCTGCA 60.380 57.895 11.55 0.00 27.52 4.41
197 198 0.971959 GGGCCATTGGACATCTGCAA 60.972 55.000 11.55 0.00 27.52 4.08
198 199 0.896923 GGCCATTGGACATCTGCAAA 59.103 50.000 6.95 0.00 30.57 3.68
199 200 1.275856 GGCCATTGGACATCTGCAAAA 59.724 47.619 6.95 0.00 30.57 2.44
200 201 2.289569 GGCCATTGGACATCTGCAAAAA 60.290 45.455 6.95 0.00 30.57 1.94
201 202 2.997986 GCCATTGGACATCTGCAAAAAG 59.002 45.455 6.95 0.00 30.57 2.27
202 203 3.555586 GCCATTGGACATCTGCAAAAAGT 60.556 43.478 6.95 0.00 30.57 2.66
203 204 3.991773 CCATTGGACATCTGCAAAAAGTG 59.008 43.478 0.00 0.00 30.57 3.16
204 205 4.262121 CCATTGGACATCTGCAAAAAGTGA 60.262 41.667 0.00 0.00 30.57 3.41
205 206 3.988379 TGGACATCTGCAAAAAGTGAC 57.012 42.857 0.00 0.00 0.00 3.67
206 207 3.286353 TGGACATCTGCAAAAAGTGACA 58.714 40.909 0.00 0.00 0.00 3.58
207 208 3.316029 TGGACATCTGCAAAAAGTGACAG 59.684 43.478 0.00 0.00 34.54 3.51
208 209 3.565482 GGACATCTGCAAAAAGTGACAGA 59.435 43.478 0.00 0.00 41.49 3.41
209 210 4.036734 GGACATCTGCAAAAAGTGACAGAA 59.963 41.667 0.00 0.00 40.99 3.02
210 211 5.450412 GGACATCTGCAAAAAGTGACAGAAA 60.450 40.000 0.00 0.00 40.99 2.52
211 212 5.964758 ACATCTGCAAAAAGTGACAGAAAA 58.035 33.333 0.00 0.00 40.99 2.29
212 213 6.397272 ACATCTGCAAAAAGTGACAGAAAAA 58.603 32.000 0.00 0.00 40.99 1.94
213 214 7.043565 ACATCTGCAAAAAGTGACAGAAAAAT 58.956 30.769 0.00 0.00 40.99 1.82
214 215 8.196771 ACATCTGCAAAAAGTGACAGAAAAATA 58.803 29.630 0.00 0.00 40.99 1.40
215 216 7.985634 TCTGCAAAAAGTGACAGAAAAATAC 57.014 32.000 0.00 0.00 37.41 1.89
216 217 7.542890 TCTGCAAAAAGTGACAGAAAAATACA 58.457 30.769 0.00 0.00 37.41 2.29
217 218 8.031864 TCTGCAAAAAGTGACAGAAAAATACAA 58.968 29.630 0.00 0.00 37.41 2.41
218 219 7.958674 TGCAAAAAGTGACAGAAAAATACAAC 58.041 30.769 0.00 0.00 0.00 3.32
219 220 7.816995 TGCAAAAAGTGACAGAAAAATACAACT 59.183 29.630 0.00 0.00 0.00 3.16
220 221 8.655970 GCAAAAAGTGACAGAAAAATACAACTT 58.344 29.630 0.00 0.00 0.00 2.66
221 222 9.956797 CAAAAAGTGACAGAAAAATACAACTTG 57.043 29.630 0.00 0.00 0.00 3.16
222 223 8.702163 AAAAGTGACAGAAAAATACAACTTGG 57.298 30.769 0.00 0.00 0.00 3.61
223 224 5.831997 AGTGACAGAAAAATACAACTTGGC 58.168 37.500 0.00 0.00 0.00 4.52
224 225 5.359576 AGTGACAGAAAAATACAACTTGGCA 59.640 36.000 0.00 0.00 0.00 4.92
225 226 6.040842 AGTGACAGAAAAATACAACTTGGCAT 59.959 34.615 0.00 0.00 0.00 4.40
226 227 7.230510 AGTGACAGAAAAATACAACTTGGCATA 59.769 33.333 0.00 0.00 0.00 3.14
227 228 7.538678 GTGACAGAAAAATACAACTTGGCATAG 59.461 37.037 0.00 0.00 0.00 2.23
228 229 7.446931 TGACAGAAAAATACAACTTGGCATAGA 59.553 33.333 0.00 0.00 0.00 1.98
229 230 8.353423 ACAGAAAAATACAACTTGGCATAGAT 57.647 30.769 0.00 0.00 0.00 1.98
230 231 8.246180 ACAGAAAAATACAACTTGGCATAGATG 58.754 33.333 0.00 0.00 0.00 2.90
231 232 7.703621 CAGAAAAATACAACTTGGCATAGATGG 59.296 37.037 10.11 1.40 0.00 3.51
232 233 7.397192 AGAAAAATACAACTTGGCATAGATGGT 59.603 33.333 10.11 5.54 0.00 3.55
233 234 8.588290 AAAAATACAACTTGGCATAGATGGTA 57.412 30.769 10.11 6.91 0.00 3.25
234 235 8.766994 AAAATACAACTTGGCATAGATGGTAT 57.233 30.769 10.11 8.23 0.00 2.73
235 236 7.750229 AATACAACTTGGCATAGATGGTATG 57.250 36.000 10.11 0.00 0.00 2.39
236 237 3.885297 ACAACTTGGCATAGATGGTATGC 59.115 43.478 8.24 8.24 46.94 3.14
237 238 4.139786 CAACTTGGCATAGATGGTATGCT 58.860 43.478 14.83 0.00 46.85 3.79
238 239 5.163205 ACAACTTGGCATAGATGGTATGCTA 60.163 40.000 14.83 7.77 46.85 3.49
239 240 5.768980 ACTTGGCATAGATGGTATGCTAT 57.231 39.130 14.83 0.00 46.85 2.97
240 241 5.738909 ACTTGGCATAGATGGTATGCTATC 58.261 41.667 14.83 0.00 46.85 2.08
241 242 5.486775 ACTTGGCATAGATGGTATGCTATCT 59.513 40.000 13.85 13.85 46.85 1.98
242 243 6.669591 ACTTGGCATAGATGGTATGCTATCTA 59.330 38.462 16.99 16.99 46.85 1.98
243 244 7.180946 ACTTGGCATAGATGGTATGCTATCTAA 59.819 37.037 18.23 5.36 44.58 2.10
244 245 7.494922 TGGCATAGATGGTATGCTATCTAAA 57.505 36.000 18.23 2.08 44.58 1.85
245 246 7.917003 TGGCATAGATGGTATGCTATCTAAAA 58.083 34.615 18.23 1.42 44.58 1.52
246 247 8.382405 TGGCATAGATGGTATGCTATCTAAAAA 58.618 33.333 18.23 1.09 44.58 1.94
262 263 3.615709 AAAAAGGCAGCCCGGTGC 61.616 61.111 8.22 10.35 43.19 5.01
263 264 4.912395 AAAAGGCAGCCCGGTGCA 62.912 61.111 19.47 0.00 45.93 4.57
267 268 4.794648 GGCAGCCCGGTGCACATA 62.795 66.667 20.43 0.00 45.93 2.29
268 269 2.516930 GCAGCCCGGTGCACATAT 60.517 61.111 20.43 0.00 43.41 1.78
269 270 2.546494 GCAGCCCGGTGCACATATC 61.546 63.158 20.43 4.74 43.41 1.63
270 271 1.146930 CAGCCCGGTGCACATATCT 59.853 57.895 20.43 7.12 44.83 1.98
271 272 0.882042 CAGCCCGGTGCACATATCTC 60.882 60.000 20.43 0.00 44.83 2.75
272 273 1.598130 GCCCGGTGCACATATCTCC 60.598 63.158 20.43 0.00 40.77 3.71
273 274 1.829456 CCCGGTGCACATATCTCCA 59.171 57.895 20.43 0.00 0.00 3.86
274 275 0.250038 CCCGGTGCACATATCTCCAG 60.250 60.000 20.43 0.00 0.00 3.86
275 276 0.882042 CCGGTGCACATATCTCCAGC 60.882 60.000 20.43 0.00 0.00 4.85
276 277 0.105593 CGGTGCACATATCTCCAGCT 59.894 55.000 20.43 0.00 0.00 4.24
277 278 1.473965 CGGTGCACATATCTCCAGCTT 60.474 52.381 20.43 0.00 0.00 3.74
278 279 1.945394 GGTGCACATATCTCCAGCTTG 59.055 52.381 20.43 0.00 0.00 4.01
279 280 1.332997 GTGCACATATCTCCAGCTTGC 59.667 52.381 13.17 0.00 0.00 4.01
280 281 0.585357 GCACATATCTCCAGCTTGCG 59.415 55.000 0.00 0.00 0.00 4.85
281 282 1.945387 CACATATCTCCAGCTTGCGT 58.055 50.000 0.00 0.00 0.00 5.24
282 283 2.803133 GCACATATCTCCAGCTTGCGTA 60.803 50.000 0.00 0.00 0.00 4.42
283 284 3.055591 CACATATCTCCAGCTTGCGTAG 58.944 50.000 0.00 0.00 0.00 3.51
284 285 2.036475 ACATATCTCCAGCTTGCGTAGG 59.964 50.000 0.00 0.00 0.00 3.18
285 286 1.040646 TATCTCCAGCTTGCGTAGGG 58.959 55.000 0.00 0.00 0.00 3.53
286 287 0.978146 ATCTCCAGCTTGCGTAGGGT 60.978 55.000 0.00 0.00 0.00 4.34
287 288 0.323999 TCTCCAGCTTGCGTAGGGTA 60.324 55.000 0.00 0.00 0.00 3.69
288 289 0.179108 CTCCAGCTTGCGTAGGGTAC 60.179 60.000 0.00 0.00 0.00 3.34
289 290 0.613853 TCCAGCTTGCGTAGGGTACT 60.614 55.000 0.00 0.00 0.00 2.73
290 291 1.108776 CCAGCTTGCGTAGGGTACTA 58.891 55.000 0.00 0.00 0.00 1.82
291 292 1.067212 CCAGCTTGCGTAGGGTACTAG 59.933 57.143 0.00 0.00 0.00 2.57
292 293 1.067212 CAGCTTGCGTAGGGTACTAGG 59.933 57.143 0.00 0.00 37.95 3.02
293 294 0.388294 GCTTGCGTAGGGTACTAGGG 59.612 60.000 0.00 0.00 35.99 3.53
294 295 1.772836 CTTGCGTAGGGTACTAGGGT 58.227 55.000 0.00 0.00 35.99 4.34
295 296 2.105766 CTTGCGTAGGGTACTAGGGTT 58.894 52.381 0.00 0.00 35.99 4.11
296 297 2.236489 TGCGTAGGGTACTAGGGTTT 57.764 50.000 0.00 0.00 35.99 3.27
297 298 1.826720 TGCGTAGGGTACTAGGGTTTG 59.173 52.381 0.00 0.00 35.99 2.93
298 299 1.137675 GCGTAGGGTACTAGGGTTTGG 59.862 57.143 0.00 0.00 35.99 3.28
299 300 1.758862 CGTAGGGTACTAGGGTTTGGG 59.241 57.143 0.00 0.00 32.74 4.12
300 301 2.624029 CGTAGGGTACTAGGGTTTGGGA 60.624 54.545 0.00 0.00 32.74 4.37
301 302 2.747083 AGGGTACTAGGGTTTGGGAA 57.253 50.000 0.00 0.00 0.00 3.97
302 303 3.008340 AGGGTACTAGGGTTTGGGAAA 57.992 47.619 0.00 0.00 0.00 3.13
303 304 2.917600 AGGGTACTAGGGTTTGGGAAAG 59.082 50.000 0.00 0.00 0.00 2.62
304 305 2.025605 GGGTACTAGGGTTTGGGAAAGG 60.026 54.545 0.00 0.00 0.00 3.11
305 306 2.914941 GGTACTAGGGTTTGGGAAAGGA 59.085 50.000 0.00 0.00 0.00 3.36
306 307 3.526430 GGTACTAGGGTTTGGGAAAGGAT 59.474 47.826 0.00 0.00 0.00 3.24
307 308 4.017775 GGTACTAGGGTTTGGGAAAGGATT 60.018 45.833 0.00 0.00 0.00 3.01
308 309 4.317530 ACTAGGGTTTGGGAAAGGATTC 57.682 45.455 0.00 0.00 34.66 2.52
309 310 2.215942 AGGGTTTGGGAAAGGATTCG 57.784 50.000 0.00 0.00 36.36 3.34
310 311 1.182667 GGGTTTGGGAAAGGATTCGG 58.817 55.000 0.00 0.00 36.36 4.30
311 312 0.530744 GGTTTGGGAAAGGATTCGGC 59.469 55.000 0.00 0.00 36.36 5.54
312 313 0.530744 GTTTGGGAAAGGATTCGGCC 59.469 55.000 0.00 0.00 36.36 6.13
313 314 0.113385 TTTGGGAAAGGATTCGGCCA 59.887 50.000 2.24 0.00 36.36 5.36
314 315 0.610785 TTGGGAAAGGATTCGGCCAC 60.611 55.000 2.24 0.00 36.36 5.01
315 316 1.303282 GGGAAAGGATTCGGCCACT 59.697 57.895 2.24 0.00 36.36 4.00
316 317 0.323451 GGGAAAGGATTCGGCCACTT 60.323 55.000 2.24 0.00 36.36 3.16
317 318 1.545841 GGAAAGGATTCGGCCACTTT 58.454 50.000 2.24 4.80 36.36 2.66
318 319 1.893137 GGAAAGGATTCGGCCACTTTT 59.107 47.619 2.24 0.00 36.36 2.27
319 320 2.352715 GGAAAGGATTCGGCCACTTTTG 60.353 50.000 2.24 0.00 36.36 2.44
320 321 5.476047 GGAAAGGATTCGGCCACTTTTGG 62.476 52.174 2.24 0.00 40.16 3.28
321 322 0.112412 AGGATTCGGCCACTTTTGGT 59.888 50.000 2.24 0.00 45.98 3.67
322 323 0.526211 GGATTCGGCCACTTTTGGTC 59.474 55.000 2.24 0.00 45.98 4.02
323 324 0.526211 GATTCGGCCACTTTTGGTCC 59.474 55.000 2.24 0.00 45.85 4.46
324 325 0.112412 ATTCGGCCACTTTTGGTCCT 59.888 50.000 2.24 0.00 45.85 3.85
325 326 0.106419 TTCGGCCACTTTTGGTCCTT 60.106 50.000 2.24 0.00 45.85 3.36
326 327 0.106419 TCGGCCACTTTTGGTCCTTT 60.106 50.000 2.24 0.00 45.85 3.11
327 328 0.031994 CGGCCACTTTTGGTCCTTTG 59.968 55.000 2.24 0.00 45.85 2.77
328 329 1.119684 GGCCACTTTTGGTCCTTTGT 58.880 50.000 0.00 0.00 42.35 2.83
329 330 2.312390 GGCCACTTTTGGTCCTTTGTA 58.688 47.619 0.00 0.00 42.35 2.41
330 331 2.296190 GGCCACTTTTGGTCCTTTGTAG 59.704 50.000 0.00 0.00 42.35 2.74
331 332 2.296190 GCCACTTTTGGTCCTTTGTAGG 59.704 50.000 0.00 0.00 45.98 3.18
332 333 2.296190 CCACTTTTGGTCCTTTGTAGGC 59.704 50.000 0.00 0.00 38.23 3.93
333 334 2.955660 CACTTTTGGTCCTTTGTAGGCA 59.044 45.455 0.00 0.00 41.69 4.75
334 335 3.004734 CACTTTTGGTCCTTTGTAGGCAG 59.995 47.826 0.00 0.00 41.69 4.85
335 336 3.222603 CTTTTGGTCCTTTGTAGGCAGT 58.777 45.455 0.00 0.00 41.69 4.40
336 337 2.561478 TTGGTCCTTTGTAGGCAGTC 57.439 50.000 0.00 0.00 41.69 3.51
337 338 1.729586 TGGTCCTTTGTAGGCAGTCT 58.270 50.000 0.00 0.00 41.69 3.24
338 339 2.054799 TGGTCCTTTGTAGGCAGTCTT 58.945 47.619 0.00 0.00 41.69 3.01
339 340 2.441750 TGGTCCTTTGTAGGCAGTCTTT 59.558 45.455 0.00 0.00 41.69 2.52
340 341 3.075148 GGTCCTTTGTAGGCAGTCTTTC 58.925 50.000 0.00 0.00 41.69 2.62
341 342 3.075148 GTCCTTTGTAGGCAGTCTTTCC 58.925 50.000 0.00 0.00 41.69 3.13
342 343 2.708861 TCCTTTGTAGGCAGTCTTTCCA 59.291 45.455 0.00 0.00 41.69 3.53
343 344 3.330701 TCCTTTGTAGGCAGTCTTTCCAT 59.669 43.478 0.00 0.00 41.69 3.41
344 345 3.441572 CCTTTGTAGGCAGTCTTTCCATG 59.558 47.826 0.00 0.00 33.99 3.66
345 346 2.113860 TGTAGGCAGTCTTTCCATGC 57.886 50.000 0.00 0.00 39.25 4.06
346 347 1.350684 TGTAGGCAGTCTTTCCATGCA 59.649 47.619 0.00 0.00 41.78 3.96
347 348 2.025981 TGTAGGCAGTCTTTCCATGCAT 60.026 45.455 0.00 0.00 41.78 3.96
348 349 2.226962 AGGCAGTCTTTCCATGCATT 57.773 45.000 0.00 0.00 41.78 3.56
349 350 2.532843 AGGCAGTCTTTCCATGCATTT 58.467 42.857 0.00 0.00 41.78 2.32
350 351 2.494870 AGGCAGTCTTTCCATGCATTTC 59.505 45.455 0.00 0.00 41.78 2.17
351 352 2.231964 GGCAGTCTTTCCATGCATTTCA 59.768 45.455 0.00 0.00 41.78 2.69
352 353 3.118884 GGCAGTCTTTCCATGCATTTCAT 60.119 43.478 0.00 0.00 41.78 2.57
387 388 5.523369 AACAAAATGTTTCAGCTCAGTAGC 58.477 37.500 0.00 0.00 42.87 3.58
395 396 4.598257 GCTCAGTAGCTGCGGAAA 57.402 55.556 6.10 0.00 45.85 3.13
396 397 2.378028 GCTCAGTAGCTGCGGAAAG 58.622 57.895 6.10 0.00 45.85 2.62
397 398 0.108615 GCTCAGTAGCTGCGGAAAGA 60.109 55.000 6.10 0.00 45.85 2.52
398 399 1.673033 GCTCAGTAGCTGCGGAAAGAA 60.673 52.381 6.10 0.00 45.85 2.52
399 400 2.688507 CTCAGTAGCTGCGGAAAGAAA 58.311 47.619 6.10 0.00 0.00 2.52
400 401 3.265791 CTCAGTAGCTGCGGAAAGAAAT 58.734 45.455 6.10 0.00 0.00 2.17
401 402 4.433615 CTCAGTAGCTGCGGAAAGAAATA 58.566 43.478 6.10 0.00 0.00 1.40
402 403 4.827692 TCAGTAGCTGCGGAAAGAAATAA 58.172 39.130 1.54 0.00 0.00 1.40
403 404 4.870426 TCAGTAGCTGCGGAAAGAAATAAG 59.130 41.667 1.54 0.00 0.00 1.73
404 405 4.034510 CAGTAGCTGCGGAAAGAAATAAGG 59.965 45.833 0.00 0.00 0.00 2.69
405 406 3.350219 AGCTGCGGAAAGAAATAAGGA 57.650 42.857 0.00 0.00 0.00 3.36
406 407 3.686016 AGCTGCGGAAAGAAATAAGGAA 58.314 40.909 0.00 0.00 0.00 3.36
407 408 3.440522 AGCTGCGGAAAGAAATAAGGAAC 59.559 43.478 0.00 0.00 0.00 3.62
408 409 3.727970 GCTGCGGAAAGAAATAAGGAACG 60.728 47.826 0.00 0.00 0.00 3.95
409 410 3.666274 TGCGGAAAGAAATAAGGAACGA 58.334 40.909 0.00 0.00 0.00 3.85
410 411 3.434299 TGCGGAAAGAAATAAGGAACGAC 59.566 43.478 0.00 0.00 0.00 4.34
411 412 3.434299 GCGGAAAGAAATAAGGAACGACA 59.566 43.478 0.00 0.00 0.00 4.35
412 413 4.083696 GCGGAAAGAAATAAGGAACGACAA 60.084 41.667 0.00 0.00 0.00 3.18
413 414 5.561339 GCGGAAAGAAATAAGGAACGACAAA 60.561 40.000 0.00 0.00 0.00 2.83
414 415 5.849604 CGGAAAGAAATAAGGAACGACAAAC 59.150 40.000 0.00 0.00 0.00 2.93
415 416 6.512091 CGGAAAGAAATAAGGAACGACAAACA 60.512 38.462 0.00 0.00 0.00 2.83
416 417 7.197703 GGAAAGAAATAAGGAACGACAAACAA 58.802 34.615 0.00 0.00 0.00 2.83
417 418 7.703197 GGAAAGAAATAAGGAACGACAAACAAA 59.297 33.333 0.00 0.00 0.00 2.83
418 419 8.628882 AAAGAAATAAGGAACGACAAACAAAG 57.371 30.769 0.00 0.00 0.00 2.77
419 420 7.329588 AGAAATAAGGAACGACAAACAAAGT 57.670 32.000 0.00 0.00 0.00 2.66
420 421 7.193595 AGAAATAAGGAACGACAAACAAAGTG 58.806 34.615 0.00 0.00 0.00 3.16
421 422 6.687081 AATAAGGAACGACAAACAAAGTGA 57.313 33.333 0.00 0.00 0.00 3.41
422 423 4.351131 AAGGAACGACAAACAAAGTGAC 57.649 40.909 0.00 0.00 0.00 3.67
423 424 3.340034 AGGAACGACAAACAAAGTGACA 58.660 40.909 0.00 0.00 0.00 3.58
424 425 3.754323 AGGAACGACAAACAAAGTGACAA 59.246 39.130 0.00 0.00 0.00 3.18
425 426 4.216687 AGGAACGACAAACAAAGTGACAAA 59.783 37.500 0.00 0.00 0.00 2.83
426 427 4.918583 GGAACGACAAACAAAGTGACAAAA 59.081 37.500 0.00 0.00 0.00 2.44
427 428 5.060446 GGAACGACAAACAAAGTGACAAAAG 59.940 40.000 0.00 0.00 0.00 2.27
428 429 4.481463 ACGACAAACAAAGTGACAAAAGG 58.519 39.130 0.00 0.00 0.00 3.11
429 430 3.303229 CGACAAACAAAGTGACAAAAGGC 59.697 43.478 0.00 0.00 0.00 4.35
430 431 3.595173 ACAAACAAAGTGACAAAAGGCC 58.405 40.909 0.00 0.00 0.00 5.19
431 432 2.577449 AACAAAGTGACAAAAGGCCG 57.423 45.000 0.00 0.00 0.00 6.13
432 433 0.744281 ACAAAGTGACAAAAGGCCGG 59.256 50.000 0.00 0.00 0.00 6.13
433 434 0.597377 CAAAGTGACAAAAGGCCGGC 60.597 55.000 21.18 21.18 0.00 6.13
434 435 0.755327 AAAGTGACAAAAGGCCGGCT 60.755 50.000 28.56 9.77 0.00 5.52
435 436 1.455383 AAGTGACAAAAGGCCGGCTG 61.455 55.000 28.56 19.38 0.00 4.85
436 437 2.597217 TGACAAAAGGCCGGCTGG 60.597 61.111 28.56 7.41 38.77 4.85
448 449 3.752339 GGCTGGCCGGCTTCTTTG 61.752 66.667 34.76 11.07 34.85 2.77
449 450 2.672996 GCTGGCCGGCTTCTTTGA 60.673 61.111 30.01 0.62 0.00 2.69
450 451 2.048603 GCTGGCCGGCTTCTTTGAT 61.049 57.895 30.01 0.00 0.00 2.57
451 452 1.805254 CTGGCCGGCTTCTTTGATG 59.195 57.895 28.56 2.25 0.00 3.07
452 453 0.962356 CTGGCCGGCTTCTTTGATGT 60.962 55.000 28.56 0.00 0.00 3.06
453 454 0.326595 TGGCCGGCTTCTTTGATGTA 59.673 50.000 28.56 0.00 0.00 2.29
454 455 1.064758 TGGCCGGCTTCTTTGATGTAT 60.065 47.619 28.56 0.00 0.00 2.29
455 456 2.171659 TGGCCGGCTTCTTTGATGTATA 59.828 45.455 28.56 0.00 0.00 1.47
456 457 3.181445 TGGCCGGCTTCTTTGATGTATAT 60.181 43.478 28.56 0.00 0.00 0.86
457 458 3.821033 GGCCGGCTTCTTTGATGTATATT 59.179 43.478 28.56 0.00 0.00 1.28
458 459 4.278419 GGCCGGCTTCTTTGATGTATATTT 59.722 41.667 28.56 0.00 0.00 1.40
459 460 5.221244 GGCCGGCTTCTTTGATGTATATTTT 60.221 40.000 28.56 0.00 0.00 1.82
460 461 6.273071 GCCGGCTTCTTTGATGTATATTTTT 58.727 36.000 22.15 0.00 0.00 1.94
499 500 9.639563 TGTAATTAAAGATAGATGGATTTGGCA 57.360 29.630 0.00 0.00 0.00 4.92
501 502 7.771927 ATTAAAGATAGATGGATTTGGCAGG 57.228 36.000 0.00 0.00 0.00 4.85
502 503 3.151912 AGATAGATGGATTTGGCAGGC 57.848 47.619 0.00 0.00 0.00 4.85
503 504 2.444388 AGATAGATGGATTTGGCAGGCA 59.556 45.455 0.00 0.00 0.00 4.75
504 505 2.824689 TAGATGGATTTGGCAGGCAA 57.175 45.000 5.03 5.03 0.00 4.52
505 506 1.941377 AGATGGATTTGGCAGGCAAA 58.059 45.000 23.26 23.26 0.00 3.68
506 507 1.829222 AGATGGATTTGGCAGGCAAAG 59.171 47.619 24.80 0.00 0.00 2.77
507 508 0.906775 ATGGATTTGGCAGGCAAAGG 59.093 50.000 24.80 0.00 0.00 3.11
508 509 1.078918 GGATTTGGCAGGCAAAGGC 60.079 57.895 24.80 18.75 40.13 4.35
509 510 1.672898 GATTTGGCAGGCAAAGGCA 59.327 52.632 24.80 4.83 43.71 4.75
510 511 0.251073 GATTTGGCAGGCAAAGGCAT 59.749 50.000 24.80 10.27 43.71 4.40
511 512 0.251073 ATTTGGCAGGCAAAGGCATC 59.749 50.000 24.80 0.00 43.71 3.91
512 513 1.120184 TTTGGCAGGCAAAGGCATCA 61.120 50.000 17.86 0.00 43.71 3.07
513 514 1.818959 TTGGCAGGCAAAGGCATCAC 61.819 55.000 7.00 0.00 43.71 3.06
514 515 2.180017 GCAGGCAAAGGCATCACG 59.820 61.111 0.00 0.00 43.71 4.35
515 516 2.180017 CAGGCAAAGGCATCACGC 59.820 61.111 0.00 0.00 43.71 5.34
516 517 3.434319 AGGCAAAGGCATCACGCG 61.434 61.111 3.53 3.53 43.84 6.01
518 519 4.107051 GCAAAGGCATCACGCGCT 62.107 61.111 5.73 0.00 43.84 5.92
519 520 2.562912 CAAAGGCATCACGCGCTT 59.437 55.556 5.73 0.00 43.84 4.68
520 521 1.081242 CAAAGGCATCACGCGCTTT 60.081 52.632 5.73 3.34 43.84 3.51
521 522 1.067199 CAAAGGCATCACGCGCTTTC 61.067 55.000 5.73 0.00 43.84 2.62
522 523 1.237285 AAAGGCATCACGCGCTTTCT 61.237 50.000 5.73 0.00 43.84 2.52
523 524 1.639298 AAGGCATCACGCGCTTTCTC 61.639 55.000 5.73 0.00 43.84 2.87
524 525 2.390599 GGCATCACGCGCTTTCTCA 61.391 57.895 5.73 0.00 43.84 3.27
525 526 1.225854 GCATCACGCGCTTTCTCAC 60.226 57.895 5.73 0.00 0.00 3.51
526 527 1.421485 CATCACGCGCTTTCTCACC 59.579 57.895 5.73 0.00 0.00 4.02
527 528 1.005037 ATCACGCGCTTTCTCACCA 60.005 52.632 5.73 0.00 0.00 4.17
528 529 0.391661 ATCACGCGCTTTCTCACCAT 60.392 50.000 5.73 0.00 0.00 3.55
529 530 1.133253 CACGCGCTTTCTCACCATG 59.867 57.895 5.73 0.00 0.00 3.66
530 531 2.034879 ACGCGCTTTCTCACCATGG 61.035 57.895 11.19 11.19 0.00 3.66
531 532 2.486966 GCGCTTTCTCACCATGGC 59.513 61.111 13.04 0.00 0.00 4.40
532 533 2.042831 GCGCTTTCTCACCATGGCT 61.043 57.895 13.04 0.00 0.00 4.75
533 534 1.986575 GCGCTTTCTCACCATGGCTC 61.987 60.000 13.04 0.00 0.00 4.70
534 535 0.392193 CGCTTTCTCACCATGGCTCT 60.392 55.000 13.04 0.00 0.00 4.09
535 536 1.831580 GCTTTCTCACCATGGCTCTT 58.168 50.000 13.04 0.00 0.00 2.85
536 537 1.471684 GCTTTCTCACCATGGCTCTTG 59.528 52.381 13.04 2.13 0.00 3.02
537 538 1.471684 CTTTCTCACCATGGCTCTTGC 59.528 52.381 13.04 0.00 38.76 4.01
538 539 0.694771 TTCTCACCATGGCTCTTGCT 59.305 50.000 13.04 0.00 39.59 3.91
539 540 1.571955 TCTCACCATGGCTCTTGCTA 58.428 50.000 13.04 0.00 39.59 3.49
540 541 2.121948 TCTCACCATGGCTCTTGCTAT 58.878 47.619 13.04 0.00 41.16 2.97
541 542 2.103771 TCTCACCATGGCTCTTGCTATC 59.896 50.000 13.04 0.00 38.36 2.08
542 543 2.104451 CTCACCATGGCTCTTGCTATCT 59.896 50.000 13.04 0.00 38.36 1.98
543 544 2.103771 TCACCATGGCTCTTGCTATCTC 59.896 50.000 13.04 0.00 38.36 2.75
544 545 1.419387 ACCATGGCTCTTGCTATCTCC 59.581 52.381 13.04 0.00 38.36 3.71
545 546 1.607509 CCATGGCTCTTGCTATCTCCG 60.608 57.143 0.00 0.00 38.36 4.63
546 547 0.034616 ATGGCTCTTGCTATCTCCGC 59.965 55.000 0.00 0.00 35.39 5.54
547 548 1.329913 TGGCTCTTGCTATCTCCGCA 61.330 55.000 0.00 0.00 39.59 5.69
548 549 0.599728 GGCTCTTGCTATCTCCGCAG 60.600 60.000 0.00 0.00 38.80 5.18
549 550 1.220817 GCTCTTGCTATCTCCGCAGC 61.221 60.000 0.00 0.00 38.80 5.25
550 551 0.103755 CTCTTGCTATCTCCGCAGCA 59.896 55.000 0.00 0.00 45.72 4.41
551 552 0.179100 TCTTGCTATCTCCGCAGCAC 60.179 55.000 0.00 0.00 46.97 4.40
552 553 1.485838 CTTGCTATCTCCGCAGCACG 61.486 60.000 0.00 0.00 46.97 5.34
553 554 2.105128 GCTATCTCCGCAGCACGT 59.895 61.111 0.00 0.00 41.42 4.49
554 555 1.946650 GCTATCTCCGCAGCACGTC 60.947 63.158 0.00 0.00 41.42 4.34
555 556 1.299468 CTATCTCCGCAGCACGTCC 60.299 63.158 0.00 0.00 41.42 4.79
556 557 2.990674 CTATCTCCGCAGCACGTCCG 62.991 65.000 0.00 0.00 41.42 4.79
562 563 2.740826 GCAGCACGTCCGGCTTTA 60.741 61.111 0.00 0.00 40.23 1.85
563 564 2.322081 GCAGCACGTCCGGCTTTAA 61.322 57.895 0.00 0.00 40.23 1.52
564 565 1.847890 GCAGCACGTCCGGCTTTAAA 61.848 55.000 0.00 0.00 40.23 1.52
565 566 0.110373 CAGCACGTCCGGCTTTAAAC 60.110 55.000 0.00 0.00 40.23 2.01
566 567 1.208358 GCACGTCCGGCTTTAAACC 59.792 57.895 0.00 0.00 0.00 3.27
567 568 1.508808 GCACGTCCGGCTTTAAACCA 61.509 55.000 0.00 0.00 0.00 3.67
568 569 0.236449 CACGTCCGGCTTTAAACCAC 59.764 55.000 0.00 0.00 0.00 4.16
569 570 0.886043 ACGTCCGGCTTTAAACCACC 60.886 55.000 0.00 0.00 0.00 4.61
570 571 0.885596 CGTCCGGCTTTAAACCACCA 60.886 55.000 0.00 0.00 0.00 4.17
571 572 0.594602 GTCCGGCTTTAAACCACCAC 59.405 55.000 0.00 0.00 0.00 4.16
572 573 0.885596 TCCGGCTTTAAACCACCACG 60.886 55.000 0.00 0.00 0.00 4.94
573 574 1.081708 CGGCTTTAAACCACCACGC 60.082 57.895 7.35 0.00 0.00 5.34
574 575 1.081708 GGCTTTAAACCACCACGCG 60.082 57.895 3.53 3.53 0.00 6.01
575 576 1.081708 GCTTTAAACCACCACGCGG 60.082 57.895 12.47 0.00 38.77 6.46
577 578 0.664224 CTTTAAACCACCACGCGGTT 59.336 50.000 12.47 0.58 46.31 4.44
580 581 2.191109 AACCACCACGCGGTTTCT 59.809 55.556 12.47 0.00 46.31 2.52
581 582 1.890510 AACCACCACGCGGTTTCTC 60.891 57.895 12.47 0.00 46.31 2.87
582 583 2.030562 CCACCACGCGGTTTCTCT 59.969 61.111 12.47 0.00 46.31 3.10
583 584 2.027625 CCACCACGCGGTTTCTCTC 61.028 63.158 12.47 0.00 46.31 3.20
584 585 2.027625 CACCACGCGGTTTCTCTCC 61.028 63.158 12.47 0.00 46.31 3.71
585 586 2.434359 CCACGCGGTTTCTCTCCC 60.434 66.667 12.47 0.00 0.00 4.30
586 587 2.342279 CACGCGGTTTCTCTCCCA 59.658 61.111 12.47 0.00 0.00 4.37
587 588 2.027625 CACGCGGTTTCTCTCCCAC 61.028 63.158 12.47 0.00 0.00 4.61
588 589 2.809601 CGCGGTTTCTCTCCCACG 60.810 66.667 0.00 0.00 0.00 4.94
589 590 3.119096 GCGGTTTCTCTCCCACGC 61.119 66.667 0.00 0.00 40.19 5.34
590 591 2.434359 CGGTTTCTCTCCCACGCC 60.434 66.667 0.00 0.00 0.00 5.68
591 592 2.943978 CGGTTTCTCTCCCACGCCT 61.944 63.158 0.00 0.00 0.00 5.52
592 593 1.376037 GGTTTCTCTCCCACGCCTG 60.376 63.158 0.00 0.00 0.00 4.85
593 594 1.671742 GTTTCTCTCCCACGCCTGA 59.328 57.895 0.00 0.00 0.00 3.86
594 595 0.390472 GTTTCTCTCCCACGCCTGAG 60.390 60.000 0.00 0.00 0.00 3.35
595 596 0.541998 TTTCTCTCCCACGCCTGAGA 60.542 55.000 0.00 0.00 36.28 3.27
596 597 0.541998 TTCTCTCCCACGCCTGAGAA 60.542 55.000 0.00 0.00 41.46 2.87
597 598 1.216710 CTCTCCCACGCCTGAGAAC 59.783 63.158 0.00 0.00 37.19 3.01
598 599 2.232298 CTCTCCCACGCCTGAGAACC 62.232 65.000 0.00 0.00 37.19 3.62
599 600 3.316573 CTCCCACGCCTGAGAACCC 62.317 68.421 0.00 0.00 0.00 4.11
600 601 4.410400 CCCACGCCTGAGAACCCC 62.410 72.222 0.00 0.00 0.00 4.95
601 602 3.636231 CCACGCCTGAGAACCCCA 61.636 66.667 0.00 0.00 0.00 4.96
602 603 2.358737 CACGCCTGAGAACCCCAC 60.359 66.667 0.00 0.00 0.00 4.61
603 604 2.847234 ACGCCTGAGAACCCCACA 60.847 61.111 0.00 0.00 0.00 4.17
604 605 2.358737 CGCCTGAGAACCCCACAC 60.359 66.667 0.00 0.00 0.00 3.82
605 606 2.883828 CGCCTGAGAACCCCACACT 61.884 63.158 0.00 0.00 0.00 3.55
606 607 1.302832 GCCTGAGAACCCCACACTG 60.303 63.158 0.00 0.00 0.00 3.66
607 608 1.302832 CCTGAGAACCCCACACTGC 60.303 63.158 0.00 0.00 0.00 4.40
608 609 1.757306 CTGAGAACCCCACACTGCT 59.243 57.895 0.00 0.00 0.00 4.24
609 610 0.321122 CTGAGAACCCCACACTGCTC 60.321 60.000 0.00 0.00 0.00 4.26
610 611 1.003233 GAGAACCCCACACTGCTCC 60.003 63.158 0.00 0.00 0.00 4.70
611 612 2.034221 GAACCCCACACTGCTCCC 59.966 66.667 0.00 0.00 0.00 4.30
612 613 3.901797 GAACCCCACACTGCTCCCG 62.902 68.421 0.00 0.00 0.00 5.14
613 614 4.954118 ACCCCACACTGCTCCCGA 62.954 66.667 0.00 0.00 0.00 5.14
614 615 4.087892 CCCCACACTGCTCCCGAG 62.088 72.222 0.00 0.00 0.00 4.63
615 616 4.087892 CCCACACTGCTCCCGAGG 62.088 72.222 0.00 0.00 0.00 4.63
616 617 2.997315 CCACACTGCTCCCGAGGA 60.997 66.667 0.00 0.00 0.00 3.71
617 618 2.262915 CACACTGCTCCCGAGGAC 59.737 66.667 0.00 0.00 0.00 3.85
618 619 3.374402 ACACTGCTCCCGAGGACG 61.374 66.667 0.00 0.00 39.43 4.79
619 620 4.803426 CACTGCTCCCGAGGACGC 62.803 72.222 0.00 0.00 38.29 5.19
624 625 4.148825 CTCCCGAGGACGCCCTTG 62.149 72.222 0.00 0.00 44.53 3.61
658 659 4.470170 CGGACGGTGCGACATCGA 62.470 66.667 17.47 0.00 40.81 3.59
659 660 2.879462 GGACGGTGCGACATCGAC 60.879 66.667 17.21 11.65 40.81 4.20
660 661 3.238241 GACGGTGCGACATCGACG 61.238 66.667 17.21 8.48 40.81 5.12
661 662 3.656243 GACGGTGCGACATCGACGA 62.656 63.158 17.21 0.00 40.81 4.20
662 663 2.503158 CGGTGCGACATCGACGAA 60.503 61.111 0.00 0.00 40.81 3.85
663 664 2.084101 CGGTGCGACATCGACGAAA 61.084 57.895 0.00 0.00 40.81 3.46
664 665 1.702299 GGTGCGACATCGACGAAAG 59.298 57.895 0.00 0.00 43.02 2.62
665 666 1.057361 GTGCGACATCGACGAAAGC 59.943 57.895 0.00 5.97 43.02 3.51
666 667 1.080772 TGCGACATCGACGAAAGCT 60.081 52.632 0.00 0.00 43.02 3.74
667 668 0.666274 TGCGACATCGACGAAAGCTT 60.666 50.000 0.00 0.00 43.02 3.74
668 669 0.438830 GCGACATCGACGAAAGCTTT 59.561 50.000 12.53 12.53 43.02 3.51
669 670 1.136336 GCGACATCGACGAAAGCTTTT 60.136 47.619 14.05 0.00 43.02 2.27
670 671 2.486128 CGACATCGACGAAAGCTTTTG 58.514 47.619 22.51 22.51 43.02 2.44
671 672 2.096909 CGACATCGACGAAAGCTTTTGT 60.097 45.455 28.41 28.41 43.02 2.83
672 673 3.603857 CGACATCGACGAAAGCTTTTGTT 60.604 43.478 28.60 15.40 43.02 2.83
673 674 3.873529 ACATCGACGAAAGCTTTTGTTC 58.126 40.909 28.60 20.49 35.00 3.18
674 675 3.560068 ACATCGACGAAAGCTTTTGTTCT 59.440 39.130 28.60 15.74 35.00 3.01
675 676 3.854286 TCGACGAAAGCTTTTGTTCTC 57.146 42.857 28.60 17.17 35.00 2.87
676 677 2.542595 TCGACGAAAGCTTTTGTTCTCC 59.457 45.455 28.60 16.86 35.00 3.71
677 678 2.544267 CGACGAAAGCTTTTGTTCTCCT 59.456 45.455 28.60 8.85 35.00 3.69
678 679 3.363084 CGACGAAAGCTTTTGTTCTCCTC 60.363 47.826 28.60 15.93 35.00 3.71
679 680 3.541632 ACGAAAGCTTTTGTTCTCCTCA 58.458 40.909 23.82 0.00 30.75 3.86
680 681 3.945285 ACGAAAGCTTTTGTTCTCCTCAA 59.055 39.130 23.82 0.00 30.75 3.02
681 682 4.201920 ACGAAAGCTTTTGTTCTCCTCAAC 60.202 41.667 23.82 1.37 30.75 3.18
682 683 4.201910 CGAAAGCTTTTGTTCTCCTCAACA 60.202 41.667 14.05 0.00 34.36 3.33
683 684 5.650543 GAAAGCTTTTGTTCTCCTCAACAA 58.349 37.500 14.05 0.00 43.10 2.83
684 685 4.907879 AGCTTTTGTTCTCCTCAACAAG 57.092 40.909 0.00 0.00 44.92 3.16
685 686 3.633986 AGCTTTTGTTCTCCTCAACAAGG 59.366 43.478 0.00 0.00 44.92 3.61
686 687 3.381590 GCTTTTGTTCTCCTCAACAAGGT 59.618 43.478 0.00 0.00 44.92 3.50
687 688 4.142160 GCTTTTGTTCTCCTCAACAAGGTT 60.142 41.667 0.00 0.00 44.92 3.50
688 689 5.067283 GCTTTTGTTCTCCTCAACAAGGTTA 59.933 40.000 0.00 0.00 44.92 2.85
689 690 6.445357 TTTTGTTCTCCTCAACAAGGTTAC 57.555 37.500 0.00 0.00 44.92 2.50
690 691 5.367945 TTGTTCTCCTCAACAAGGTTACT 57.632 39.130 0.00 0.00 46.32 2.24
691 692 4.957296 TGTTCTCCTCAACAAGGTTACTC 58.043 43.478 0.00 0.00 46.32 2.59
692 693 4.407621 TGTTCTCCTCAACAAGGTTACTCA 59.592 41.667 0.00 0.00 46.32 3.41
693 694 5.104693 TGTTCTCCTCAACAAGGTTACTCAA 60.105 40.000 0.00 0.00 46.32 3.02
694 695 5.215252 TCTCCTCAACAAGGTTACTCAAG 57.785 43.478 0.00 0.00 46.32 3.02
695 696 4.899457 TCTCCTCAACAAGGTTACTCAAGA 59.101 41.667 0.00 0.00 46.32 3.02
696 697 5.544176 TCTCCTCAACAAGGTTACTCAAGAT 59.456 40.000 0.00 0.00 46.32 2.40
697 698 5.794894 TCCTCAACAAGGTTACTCAAGATC 58.205 41.667 0.00 0.00 46.32 2.75
698 699 5.306937 TCCTCAACAAGGTTACTCAAGATCA 59.693 40.000 0.00 0.00 46.32 2.92
699 700 5.997746 CCTCAACAAGGTTACTCAAGATCAA 59.002 40.000 0.00 0.00 40.67 2.57
700 701 6.073003 CCTCAACAAGGTTACTCAAGATCAAC 60.073 42.308 0.00 0.00 40.67 3.18
701 702 6.353323 TCAACAAGGTTACTCAAGATCAACA 58.647 36.000 0.00 0.00 0.00 3.33
702 703 6.998074 TCAACAAGGTTACTCAAGATCAACAT 59.002 34.615 0.00 0.00 0.00 2.71
703 704 6.808008 ACAAGGTTACTCAAGATCAACATG 57.192 37.500 0.00 0.00 0.00 3.21
704 705 6.299141 ACAAGGTTACTCAAGATCAACATGT 58.701 36.000 0.00 0.00 0.00 3.21
705 706 6.428159 ACAAGGTTACTCAAGATCAACATGTC 59.572 38.462 0.00 0.00 0.00 3.06
706 707 6.365970 AGGTTACTCAAGATCAACATGTCT 57.634 37.500 0.00 0.00 0.00 3.41
707 708 6.773638 AGGTTACTCAAGATCAACATGTCTT 58.226 36.000 0.00 0.00 35.15 3.01
708 709 6.876257 AGGTTACTCAAGATCAACATGTCTTC 59.124 38.462 0.00 0.00 32.60 2.87
709 710 6.092807 GGTTACTCAAGATCAACATGTCTTCC 59.907 42.308 0.00 0.00 32.60 3.46
710 711 4.583871 ACTCAAGATCAACATGTCTTCCC 58.416 43.478 0.00 0.00 32.60 3.97
711 712 3.599343 TCAAGATCAACATGTCTTCCCG 58.401 45.455 0.00 0.00 32.60 5.14
712 713 3.260632 TCAAGATCAACATGTCTTCCCGA 59.739 43.478 0.00 0.00 32.60 5.14
713 714 3.981071 AGATCAACATGTCTTCCCGAA 57.019 42.857 0.00 0.00 0.00 4.30
714 715 3.600388 AGATCAACATGTCTTCCCGAAC 58.400 45.455 0.00 0.00 0.00 3.95
715 716 3.261897 AGATCAACATGTCTTCCCGAACT 59.738 43.478 0.00 0.00 0.00 3.01
716 717 2.766313 TCAACATGTCTTCCCGAACTG 58.234 47.619 0.00 0.00 0.00 3.16
717 718 1.197721 CAACATGTCTTCCCGAACTGC 59.802 52.381 0.00 0.00 0.00 4.40
718 719 0.687354 ACATGTCTTCCCGAACTGCT 59.313 50.000 0.00 0.00 0.00 4.24
719 720 1.338200 ACATGTCTTCCCGAACTGCTC 60.338 52.381 0.00 0.00 0.00 4.26
720 721 0.250513 ATGTCTTCCCGAACTGCTCC 59.749 55.000 0.00 0.00 0.00 4.70
721 722 0.832135 TGTCTTCCCGAACTGCTCCT 60.832 55.000 0.00 0.00 0.00 3.69
722 723 0.108567 GTCTTCCCGAACTGCTCCTC 60.109 60.000 0.00 0.00 0.00 3.71
723 724 0.251832 TCTTCCCGAACTGCTCCTCT 60.252 55.000 0.00 0.00 0.00 3.69
724 725 0.174617 CTTCCCGAACTGCTCCTCTC 59.825 60.000 0.00 0.00 0.00 3.20
725 726 0.251832 TTCCCGAACTGCTCCTCTCT 60.252 55.000 0.00 0.00 0.00 3.10
726 727 0.967887 TCCCGAACTGCTCCTCTCTG 60.968 60.000 0.00 0.00 0.00 3.35
727 728 1.254284 CCCGAACTGCTCCTCTCTGT 61.254 60.000 0.00 0.00 0.00 3.41
728 729 0.172352 CCGAACTGCTCCTCTCTGTC 59.828 60.000 0.00 0.00 0.00 3.51
729 730 1.173043 CGAACTGCTCCTCTCTGTCT 58.827 55.000 0.00 0.00 0.00 3.41
730 731 2.360844 CGAACTGCTCCTCTCTGTCTA 58.639 52.381 0.00 0.00 0.00 2.59
731 732 2.354510 CGAACTGCTCCTCTCTGTCTAG 59.645 54.545 0.00 0.00 0.00 2.43
732 733 3.352648 GAACTGCTCCTCTCTGTCTAGT 58.647 50.000 0.00 0.00 0.00 2.57
733 734 2.999331 ACTGCTCCTCTCTGTCTAGTC 58.001 52.381 0.00 0.00 0.00 2.59
734 735 2.576191 ACTGCTCCTCTCTGTCTAGTCT 59.424 50.000 0.00 0.00 0.00 3.24
735 736 3.778075 ACTGCTCCTCTCTGTCTAGTCTA 59.222 47.826 0.00 0.00 0.00 2.59
736 737 4.127171 CTGCTCCTCTCTGTCTAGTCTAC 58.873 52.174 0.00 0.00 0.00 2.59
737 738 3.118186 TGCTCCTCTCTGTCTAGTCTACC 60.118 52.174 0.00 0.00 0.00 3.18
738 739 3.135895 GCTCCTCTCTGTCTAGTCTACCT 59.864 52.174 0.00 0.00 0.00 3.08
739 740 4.703897 CTCCTCTCTGTCTAGTCTACCTG 58.296 52.174 0.00 0.00 0.00 4.00
740 741 3.456644 TCCTCTCTGTCTAGTCTACCTGG 59.543 52.174 0.00 0.00 0.00 4.45
741 742 3.211045 CTCTCTGTCTAGTCTACCTGGC 58.789 54.545 0.00 0.00 0.00 4.85
742 743 2.092321 TCTCTGTCTAGTCTACCTGGCC 60.092 54.545 0.00 0.00 0.00 5.36
743 744 1.025812 CTGTCTAGTCTACCTGGCCG 58.974 60.000 0.00 0.00 0.00 6.13
744 745 1.035932 TGTCTAGTCTACCTGGCCGC 61.036 60.000 0.00 0.00 0.00 6.53
745 746 1.455217 TCTAGTCTACCTGGCCGCC 60.455 63.158 1.04 1.04 0.00 6.13
746 747 1.455959 CTAGTCTACCTGGCCGCCT 60.456 63.158 11.61 0.00 0.00 5.52
747 748 1.001248 TAGTCTACCTGGCCGCCTT 59.999 57.895 11.61 0.00 0.00 4.35
748 749 1.327690 TAGTCTACCTGGCCGCCTTG 61.328 60.000 11.61 4.03 0.00 3.61
749 750 2.606519 TCTACCTGGCCGCCTTGT 60.607 61.111 11.61 10.09 0.00 3.16
750 751 2.436646 CTACCTGGCCGCCTTGTG 60.437 66.667 11.61 0.00 0.00 3.33
751 752 2.925706 TACCTGGCCGCCTTGTGA 60.926 61.111 11.61 0.00 0.00 3.58
752 753 2.257409 CTACCTGGCCGCCTTGTGAT 62.257 60.000 11.61 0.00 0.00 3.06
753 754 1.847798 TACCTGGCCGCCTTGTGATT 61.848 55.000 11.61 0.00 0.00 2.57
754 755 1.978617 CCTGGCCGCCTTGTGATTT 60.979 57.895 11.61 0.00 0.00 2.17
755 756 1.535204 CCTGGCCGCCTTGTGATTTT 61.535 55.000 11.61 0.00 0.00 1.82
756 757 0.318120 CTGGCCGCCTTGTGATTTTT 59.682 50.000 11.61 0.00 0.00 1.94
757 758 0.316841 TGGCCGCCTTGTGATTTTTC 59.683 50.000 11.61 0.00 0.00 2.29
758 759 0.389817 GGCCGCCTTGTGATTTTTCC 60.390 55.000 0.71 0.00 0.00 3.13
759 760 0.389817 GCCGCCTTGTGATTTTTCCC 60.390 55.000 0.00 0.00 0.00 3.97
760 761 0.246360 CCGCCTTGTGATTTTTCCCC 59.754 55.000 0.00 0.00 0.00 4.81
761 762 0.246360 CGCCTTGTGATTTTTCCCCC 59.754 55.000 0.00 0.00 0.00 5.40
762 763 1.644509 GCCTTGTGATTTTTCCCCCT 58.355 50.000 0.00 0.00 0.00 4.79
763 764 2.815158 GCCTTGTGATTTTTCCCCCTA 58.185 47.619 0.00 0.00 0.00 3.53
764 765 3.374764 GCCTTGTGATTTTTCCCCCTAT 58.625 45.455 0.00 0.00 0.00 2.57
765 766 3.774766 GCCTTGTGATTTTTCCCCCTATT 59.225 43.478 0.00 0.00 0.00 1.73
766 767 4.225042 GCCTTGTGATTTTTCCCCCTATTT 59.775 41.667 0.00 0.00 0.00 1.40
767 768 5.626809 GCCTTGTGATTTTTCCCCCTATTTC 60.627 44.000 0.00 0.00 0.00 2.17
768 769 5.483583 CCTTGTGATTTTTCCCCCTATTTCA 59.516 40.000 0.00 0.00 0.00 2.69
769 770 5.993748 TGTGATTTTTCCCCCTATTTCAC 57.006 39.130 0.00 0.00 34.33 3.18
770 771 5.398236 TGTGATTTTTCCCCCTATTTCACA 58.602 37.500 0.00 0.00 39.71 3.58
771 772 5.245075 TGTGATTTTTCCCCCTATTTCACAC 59.755 40.000 0.00 0.00 37.79 3.82
772 773 5.480422 GTGATTTTTCCCCCTATTTCACACT 59.520 40.000 0.00 0.00 34.01 3.55
773 774 5.714806 TGATTTTTCCCCCTATTTCACACTC 59.285 40.000 0.00 0.00 0.00 3.51
774 775 5.333566 TTTTTCCCCCTATTTCACACTCT 57.666 39.130 0.00 0.00 0.00 3.24
775 776 5.333566 TTTTCCCCCTATTTCACACTCTT 57.666 39.130 0.00 0.00 0.00 2.85
776 777 4.569719 TTCCCCCTATTTCACACTCTTC 57.430 45.455 0.00 0.00 0.00 2.87
777 778 3.526899 TCCCCCTATTTCACACTCTTCA 58.473 45.455 0.00 0.00 0.00 3.02
778 779 4.111577 TCCCCCTATTTCACACTCTTCAT 58.888 43.478 0.00 0.00 0.00 2.57
779 780 4.540099 TCCCCCTATTTCACACTCTTCATT 59.460 41.667 0.00 0.00 0.00 2.57
780 781 4.884164 CCCCCTATTTCACACTCTTCATTC 59.116 45.833 0.00 0.00 0.00 2.67
781 782 5.500234 CCCCTATTTCACACTCTTCATTCA 58.500 41.667 0.00 0.00 0.00 2.57
782 783 6.125029 CCCCTATTTCACACTCTTCATTCAT 58.875 40.000 0.00 0.00 0.00 2.57
783 784 6.261826 CCCCTATTTCACACTCTTCATTCATC 59.738 42.308 0.00 0.00 0.00 2.92
784 785 7.052873 CCCTATTTCACACTCTTCATTCATCT 58.947 38.462 0.00 0.00 0.00 2.90
785 786 7.555554 CCCTATTTCACACTCTTCATTCATCTT 59.444 37.037 0.00 0.00 0.00 2.40
786 787 8.954350 CCTATTTCACACTCTTCATTCATCTTT 58.046 33.333 0.00 0.00 0.00 2.52
787 788 9.985318 CTATTTCACACTCTTCATTCATCTTTC 57.015 33.333 0.00 0.00 0.00 2.62
788 789 6.471976 TTCACACTCTTCATTCATCTTTCG 57.528 37.500 0.00 0.00 0.00 3.46
789 790 4.931601 TCACACTCTTCATTCATCTTTCGG 59.068 41.667 0.00 0.00 0.00 4.30
790 791 3.686726 ACACTCTTCATTCATCTTTCGGC 59.313 43.478 0.00 0.00 0.00 5.54
791 792 3.686241 CACTCTTCATTCATCTTTCGGCA 59.314 43.478 0.00 0.00 0.00 5.69
792 793 3.937706 ACTCTTCATTCATCTTTCGGCAG 59.062 43.478 0.00 0.00 0.00 4.85
793 794 2.679837 TCTTCATTCATCTTTCGGCAGC 59.320 45.455 0.00 0.00 0.00 5.25
794 795 2.112380 TCATTCATCTTTCGGCAGCA 57.888 45.000 0.00 0.00 0.00 4.41
795 796 2.435422 TCATTCATCTTTCGGCAGCAA 58.565 42.857 0.00 0.00 0.00 3.91
796 797 2.819019 TCATTCATCTTTCGGCAGCAAA 59.181 40.909 0.00 0.00 0.00 3.68
797 798 3.444742 TCATTCATCTTTCGGCAGCAAAT 59.555 39.130 0.00 0.00 0.00 2.32
798 799 3.492421 TTCATCTTTCGGCAGCAAATC 57.508 42.857 0.00 0.00 0.00 2.17
799 800 1.398041 TCATCTTTCGGCAGCAAATCG 59.602 47.619 0.00 0.00 0.00 3.34
800 801 1.398041 CATCTTTCGGCAGCAAATCGA 59.602 47.619 0.00 0.00 0.00 3.59
801 802 1.737838 TCTTTCGGCAGCAAATCGAT 58.262 45.000 0.00 0.00 32.80 3.59
802 803 1.665679 TCTTTCGGCAGCAAATCGATC 59.334 47.619 0.00 0.00 32.80 3.69
803 804 0.373370 TTTCGGCAGCAAATCGATCG 59.627 50.000 9.36 9.36 32.80 3.69
804 805 0.459411 TTCGGCAGCAAATCGATCGA 60.459 50.000 21.86 21.86 32.80 3.59
815 816 1.536073 ATCGATCGATCCATGGCCGT 61.536 55.000 24.60 0.00 0.00 5.68
818 819 1.227943 ATCGATCCATGGCCGTTGG 60.228 57.895 20.54 16.64 35.45 3.77
821 822 1.809207 GATCCATGGCCGTTGGTTG 59.191 57.895 20.68 0.00 35.64 3.77
825 826 2.282887 ATGGCCGTTGGTTGGGAC 60.283 61.111 0.00 0.00 0.00 4.46
829 830 2.282180 CCGTTGGTTGGGACTGGG 60.282 66.667 0.00 0.00 0.00 4.45
831 832 1.378762 CGTTGGTTGGGACTGGGAT 59.621 57.895 0.00 0.00 0.00 3.85
832 833 0.251165 CGTTGGTTGGGACTGGGATT 60.251 55.000 0.00 0.00 0.00 3.01
837 838 1.026718 GTTGGGACTGGGATTCTGCG 61.027 60.000 0.00 0.00 0.00 5.18
839 840 2.514824 GGACTGGGATTCTGCGGC 60.515 66.667 0.00 0.00 0.00 6.53
840 841 2.268920 GACTGGGATTCTGCGGCA 59.731 61.111 1.29 1.29 0.00 5.69
841 842 1.153086 GACTGGGATTCTGCGGCAT 60.153 57.895 1.75 0.00 0.00 4.40
882 883 3.452627 GGTTAGTCTCACCCATCATCACT 59.547 47.826 0.00 0.00 0.00 3.41
889 890 2.306805 TCACCCATCATCACTTTGCTCT 59.693 45.455 0.00 0.00 0.00 4.09
897 898 1.032014 TCACTTTGCTCTTGCCCAAC 58.968 50.000 0.00 0.00 38.71 3.77
903 904 0.322816 TGCTCTTGCCCAACATCCTC 60.323 55.000 0.00 0.00 38.71 3.71
904 905 0.034670 GCTCTTGCCCAACATCCTCT 60.035 55.000 0.00 0.00 0.00 3.69
910 911 1.153289 CCCAACATCCTCTCCTGCG 60.153 63.158 0.00 0.00 0.00 5.18
911 912 1.153289 CCAACATCCTCTCCTGCGG 60.153 63.158 0.00 0.00 0.00 5.69
912 913 1.153289 CAACATCCTCTCCTGCGGG 60.153 63.158 4.71 4.71 0.00 6.13
969 973 0.175073 ACGTTATCCCGGAGCTGAAC 59.825 55.000 0.73 0.00 0.00 3.18
980 984 0.948141 GAGCTGAACAAGACGCTGCT 60.948 55.000 0.00 0.00 39.12 4.24
981 985 0.533755 AGCTGAACAAGACGCTGCTT 60.534 50.000 0.00 0.00 33.85 3.91
993 997 2.334946 GCTGCTTGCCGTGGATCAA 61.335 57.895 0.00 0.00 35.15 2.57
994 998 1.865788 GCTGCTTGCCGTGGATCAAA 61.866 55.000 0.00 0.00 35.15 2.69
1003 1007 1.672881 CCGTGGATCAAAAGAGGATGC 59.327 52.381 0.00 0.00 34.14 3.91
1008 1012 2.957006 GGATCAAAAGAGGATGCTGCAT 59.043 45.455 16.20 16.20 31.26 3.96
1011 1015 3.548770 TCAAAAGAGGATGCTGCATAGG 58.451 45.455 16.23 0.00 0.00 2.57
1016 1020 1.132554 AGGATGCTGCATAGGGGAGG 61.133 60.000 16.23 0.00 35.12 4.30
1017 1021 1.130054 GGATGCTGCATAGGGGAGGA 61.130 60.000 16.23 0.00 40.13 3.71
1019 1023 1.353694 GATGCTGCATAGGGGAGGAAT 59.646 52.381 16.23 0.00 39.09 3.01
1021 1025 2.636005 TGCTGCATAGGGGAGGAATAT 58.364 47.619 0.00 0.00 35.12 1.28
1022 1026 2.573462 TGCTGCATAGGGGAGGAATATC 59.427 50.000 0.00 0.00 35.12 1.63
1023 1027 2.092699 GCTGCATAGGGGAGGAATATCC 60.093 54.545 0.00 0.00 38.76 2.59
1024 1028 2.169352 CTGCATAGGGGAGGAATATCCG 59.831 54.545 0.00 0.00 42.75 4.18
1026 1030 3.041946 GCATAGGGGAGGAATATCCGAT 58.958 50.000 0.00 0.00 42.75 4.18
1027 1031 3.181461 GCATAGGGGAGGAATATCCGATG 60.181 52.174 0.00 0.00 42.75 3.84
1031 1041 1.339151 GGGAGGAATATCCGATGTGGC 60.339 57.143 0.00 0.00 42.75 5.01
1033 1043 1.347707 GAGGAATATCCGATGTGGCCA 59.652 52.381 0.00 0.00 42.75 5.36
1038 1048 2.363711 TATCCGATGTGGCCACGCTC 62.364 60.000 30.07 25.67 37.80 5.03
1054 1064 4.812476 TCGACAAGATGGCCGCCG 62.812 66.667 4.58 0.00 0.00 6.46
1111 1122 0.733909 CGACGATGCTCAGCACAAGA 60.734 55.000 0.00 0.00 43.04 3.02
1116 1127 1.592081 GATGCTCAGCACAAGATCGTC 59.408 52.381 0.00 0.00 43.04 4.20
1117 1128 0.733909 TGCTCAGCACAAGATCGTCG 60.734 55.000 0.00 0.00 31.71 5.12
1118 1129 1.416813 GCTCAGCACAAGATCGTCGG 61.417 60.000 0.00 0.00 0.00 4.79
1122 1133 3.554692 CACAAGATCGTCGGCGGC 61.555 66.667 10.62 3.25 38.89 6.53
1124 1135 4.847516 CAAGATCGTCGGCGGCGA 62.848 66.667 38.81 38.81 42.75 5.54
1154 1165 1.800805 CAGACCTGCAACACGAGAAT 58.199 50.000 0.00 0.00 0.00 2.40
1156 1167 2.096069 CAGACCTGCAACACGAGAATTG 60.096 50.000 0.00 0.00 0.00 2.32
1157 1168 2.143122 GACCTGCAACACGAGAATTGA 58.857 47.619 0.00 0.00 0.00 2.57
1158 1169 2.146342 ACCTGCAACACGAGAATTGAG 58.854 47.619 0.00 0.00 0.00 3.02
1159 1170 1.135859 CCTGCAACACGAGAATTGAGC 60.136 52.381 0.00 0.00 0.00 4.26
1160 1171 0.512518 TGCAACACGAGAATTGAGCG 59.487 50.000 0.00 0.00 0.00 5.03
1161 1172 0.790866 GCAACACGAGAATTGAGCGC 60.791 55.000 0.00 0.00 0.00 5.92
1162 1173 0.512518 CAACACGAGAATTGAGCGCA 59.487 50.000 11.47 0.00 0.00 6.09
1163 1174 1.129251 CAACACGAGAATTGAGCGCAT 59.871 47.619 11.47 0.00 0.00 4.73
1165 1176 0.043566 CACGAGAATTGAGCGCATCG 60.044 55.000 11.47 9.22 36.32 3.84
1211 1262 0.532862 CAGTGGGCGCGGAATATCTT 60.533 55.000 8.83 0.00 0.00 2.40
1216 1267 0.235926 GGCGCGGAATATCTTCTTGC 59.764 55.000 8.83 0.00 32.77 4.01
1218 1269 1.209128 CGCGGAATATCTTCTTGCGT 58.791 50.000 16.74 0.00 44.04 5.24
1219 1270 2.390938 CGCGGAATATCTTCTTGCGTA 58.609 47.619 16.74 0.00 44.04 4.42
1223 1274 3.982058 CGGAATATCTTCTTGCGTAGGTC 59.018 47.826 0.00 0.00 33.47 3.85
1226 1277 5.221263 GGAATATCTTCTTGCGTAGGTCAGA 60.221 44.000 0.00 0.00 0.00 3.27
1227 1278 5.854010 ATATCTTCTTGCGTAGGTCAGAA 57.146 39.130 0.00 0.00 0.00 3.02
1228 1279 3.577649 TCTTCTTGCGTAGGTCAGAAG 57.422 47.619 14.69 14.69 35.45 2.85
1229 1280 3.154710 TCTTCTTGCGTAGGTCAGAAGA 58.845 45.455 17.52 17.52 39.25 2.87
1230 1281 3.764434 TCTTCTTGCGTAGGTCAGAAGAT 59.236 43.478 17.52 0.00 37.45 2.40
1231 1282 3.510388 TCTTGCGTAGGTCAGAAGATG 57.490 47.619 0.00 0.00 0.00 2.90
1233 1284 0.179137 TGCGTAGGTCAGAAGATGCG 60.179 55.000 0.00 0.00 0.00 4.73
1234 1285 1.483424 GCGTAGGTCAGAAGATGCGC 61.483 60.000 0.00 0.00 36.97 6.09
1235 1286 0.101399 CGTAGGTCAGAAGATGCGCT 59.899 55.000 9.73 0.00 0.00 5.92
1236 1287 1.469940 CGTAGGTCAGAAGATGCGCTT 60.470 52.381 9.73 0.55 40.25 4.68
1246 1363 2.119801 AGATGCGCTTCCAGTGATTT 57.880 45.000 18.70 0.00 0.00 2.17
1248 1365 1.064654 GATGCGCTTCCAGTGATTTCC 59.935 52.381 9.73 0.00 0.00 3.13
1249 1366 0.250684 TGCGCTTCCAGTGATTTCCA 60.251 50.000 9.73 0.00 0.00 3.53
1261 1378 0.730494 GATTTCCACTGCTGTTGCGC 60.730 55.000 0.00 0.00 43.34 6.09
1308 1569 0.687757 CACCCTCTGATTCCTCGGGA 60.688 60.000 4.57 0.00 38.30 5.14
1309 1570 0.266152 ACCCTCTGATTCCTCGGGAT 59.734 55.000 4.57 0.00 38.30 3.85
1315 1576 0.620410 TGATTCCTCGGGATGGTGGT 60.620 55.000 0.00 0.00 0.00 4.16
1316 1577 0.106894 GATTCCTCGGGATGGTGGTC 59.893 60.000 0.00 0.00 0.00 4.02
1325 1586 0.393537 GGATGGTGGTCCTCTTGCTG 60.394 60.000 0.00 0.00 35.32 4.41
1345 1606 1.082690 GTGCAGCTCCTTCTACTTGC 58.917 55.000 0.00 0.00 0.00 4.01
1397 1661 5.163301 ACTCAGTAGTTGATGTGTTCAAGGT 60.163 40.000 0.00 0.00 44.89 3.50
1407 1671 1.953686 GTGTTCAAGGTTGCCTGCTTA 59.046 47.619 0.00 0.00 32.13 3.09
1416 1680 3.713764 AGGTTGCCTGCTTATACAGAGAT 59.286 43.478 0.00 0.00 40.25 2.75
1422 1686 4.636249 CCTGCTTATACAGAGATTGGTCC 58.364 47.826 0.00 0.00 40.25 4.46
1426 1690 6.997655 TGCTTATACAGAGATTGGTCCTATG 58.002 40.000 0.00 0.00 0.00 2.23
1428 1692 7.093992 GCTTATACAGAGATTGGTCCTATGAC 58.906 42.308 0.00 0.00 40.98 3.06
1442 1706 1.665679 CTATGACGTGGTTGGCATCAC 59.334 52.381 0.00 10.32 0.00 3.06
1445 1709 0.238289 GACGTGGTTGGCATCACAAG 59.762 55.000 17.53 9.22 33.83 3.16
1446 1710 0.465460 ACGTGGTTGGCATCACAAGT 60.465 50.000 17.53 9.73 33.83 3.16
1448 1712 1.876799 CGTGGTTGGCATCACAAGTTA 59.123 47.619 17.53 0.00 33.83 2.24
1449 1713 2.487762 CGTGGTTGGCATCACAAGTTAT 59.512 45.455 17.53 0.00 33.83 1.89
1451 1715 3.505680 GTGGTTGGCATCACAAGTTATCA 59.494 43.478 14.10 0.00 34.32 2.15
1456 1720 4.513442 TGGCATCACAAGTTATCAGGTAC 58.487 43.478 0.00 0.00 0.00 3.34
1458 1722 5.423931 TGGCATCACAAGTTATCAGGTACTA 59.576 40.000 0.00 0.00 36.02 1.82
1459 1723 5.753921 GGCATCACAAGTTATCAGGTACTAC 59.246 44.000 0.00 0.00 36.02 2.73
1460 1724 6.338146 GCATCACAAGTTATCAGGTACTACA 58.662 40.000 0.00 0.00 36.02 2.74
1474 1738 5.622770 GGTACTACACCCAATTCAAAGTG 57.377 43.478 0.00 0.00 42.07 3.16
1475 1739 4.457949 GGTACTACACCCAATTCAAAGTGG 59.542 45.833 2.27 2.27 43.46 4.00
1476 1740 4.178956 ACTACACCCAATTCAAAGTGGT 57.821 40.909 8.28 0.00 42.34 4.16
1477 1741 5.313280 ACTACACCCAATTCAAAGTGGTA 57.687 39.130 8.28 0.00 42.34 3.25
1478 1742 5.067954 ACTACACCCAATTCAAAGTGGTAC 58.932 41.667 8.28 0.00 42.34 3.34
1479 1743 4.178956 ACACCCAATTCAAAGTGGTACT 57.821 40.909 8.28 0.00 42.34 2.73
1480 1744 5.313280 ACACCCAATTCAAAGTGGTACTA 57.687 39.130 8.28 0.00 42.34 1.82
1481 1745 5.067954 ACACCCAATTCAAAGTGGTACTAC 58.932 41.667 8.28 0.19 42.34 2.73
1482 1746 5.163131 ACACCCAATTCAAAGTGGTACTACT 60.163 40.000 5.98 5.98 42.34 2.57
1483 1747 5.411669 CACCCAATTCAAAGTGGTACTACTC 59.588 44.000 12.75 0.00 42.34 2.59
1484 1748 5.072600 ACCCAATTCAAAGTGGTACTACTCA 59.927 40.000 12.75 0.00 42.34 3.41
1485 1749 6.180472 CCCAATTCAAAGTGGTACTACTCAT 58.820 40.000 12.75 2.16 42.34 2.90
1486 1750 6.316390 CCCAATTCAAAGTGGTACTACTCATC 59.684 42.308 12.75 0.00 42.34 2.92
1487 1751 7.106239 CCAATTCAAAGTGGTACTACTCATCT 58.894 38.462 12.75 0.00 39.22 2.90
1488 1752 8.258007 CCAATTCAAAGTGGTACTACTCATCTA 58.742 37.037 12.75 0.00 39.22 1.98
1489 1753 9.088512 CAATTCAAAGTGGTACTACTCATCTAC 57.911 37.037 12.75 0.00 0.00 2.59
1490 1754 7.770366 TTCAAAGTGGTACTACTCATCTACA 57.230 36.000 12.75 0.00 0.00 2.74
1491 1755 7.154435 TCAAAGTGGTACTACTCATCTACAC 57.846 40.000 12.75 0.00 0.00 2.90
1492 1756 6.946583 TCAAAGTGGTACTACTCATCTACACT 59.053 38.462 12.75 0.43 39.38 3.55
1493 1757 8.105197 TCAAAGTGGTACTACTCATCTACACTA 58.895 37.037 12.75 0.00 36.98 2.74
1494 1758 7.862512 AAGTGGTACTACTCATCTACACTAC 57.137 40.000 12.75 0.00 36.98 2.73
1495 1759 6.955364 AGTGGTACTACTCATCTACACTACA 58.045 40.000 5.98 0.00 36.30 2.74
1496 1760 6.822676 AGTGGTACTACTCATCTACACTACAC 59.177 42.308 5.98 0.00 36.30 2.90
1497 1761 6.822676 GTGGTACTACTCATCTACACTACACT 59.177 42.308 1.48 0.00 0.00 3.55
1498 1762 6.822170 TGGTACTACTCATCTACACTACACTG 59.178 42.308 0.00 0.00 0.00 3.66
1499 1763 5.821516 ACTACTCATCTACACTACACTGC 57.178 43.478 0.00 0.00 0.00 4.40
1500 1764 4.641094 ACTACTCATCTACACTACACTGCC 59.359 45.833 0.00 0.00 0.00 4.85
1501 1765 3.702792 ACTCATCTACACTACACTGCCT 58.297 45.455 0.00 0.00 0.00 4.75
1502 1766 3.697045 ACTCATCTACACTACACTGCCTC 59.303 47.826 0.00 0.00 0.00 4.70
1503 1767 3.696548 CTCATCTACACTACACTGCCTCA 59.303 47.826 0.00 0.00 0.00 3.86
1504 1768 3.444034 TCATCTACACTACACTGCCTCAC 59.556 47.826 0.00 0.00 0.00 3.51
1505 1769 2.168496 TCTACACTACACTGCCTCACC 58.832 52.381 0.00 0.00 0.00 4.02
1506 1770 1.893137 CTACACTACACTGCCTCACCA 59.107 52.381 0.00 0.00 0.00 4.17
1507 1771 1.128200 ACACTACACTGCCTCACCAA 58.872 50.000 0.00 0.00 0.00 3.67
1508 1772 1.488812 ACACTACACTGCCTCACCAAA 59.511 47.619 0.00 0.00 0.00 3.28
1509 1773 2.092646 ACACTACACTGCCTCACCAAAA 60.093 45.455 0.00 0.00 0.00 2.44
1510 1774 3.149196 CACTACACTGCCTCACCAAAAT 58.851 45.455 0.00 0.00 0.00 1.82
1511 1775 4.202419 ACACTACACTGCCTCACCAAAATA 60.202 41.667 0.00 0.00 0.00 1.40
1512 1776 4.759693 CACTACACTGCCTCACCAAAATAA 59.240 41.667 0.00 0.00 0.00 1.40
1513 1777 5.003804 ACTACACTGCCTCACCAAAATAAG 58.996 41.667 0.00 0.00 0.00 1.73
1514 1778 2.558359 ACACTGCCTCACCAAAATAAGC 59.442 45.455 0.00 0.00 0.00 3.09
1515 1779 2.557924 CACTGCCTCACCAAAATAAGCA 59.442 45.455 0.00 0.00 0.00 3.91
1516 1780 3.498927 CTGCCTCACCAAAATAAGCAG 57.501 47.619 0.00 0.00 40.13 4.24
1517 1781 2.821969 CTGCCTCACCAAAATAAGCAGT 59.178 45.455 0.00 0.00 40.96 4.40
1518 1782 2.557924 TGCCTCACCAAAATAAGCAGTG 59.442 45.455 0.00 0.00 0.00 3.66
1519 1783 2.558359 GCCTCACCAAAATAAGCAGTGT 59.442 45.455 0.00 0.00 0.00 3.55
1520 1784 3.756434 GCCTCACCAAAATAAGCAGTGTA 59.244 43.478 0.00 0.00 0.00 2.90
1521 1785 4.379499 GCCTCACCAAAATAAGCAGTGTAC 60.379 45.833 0.00 0.00 0.00 2.90
1522 1786 4.142902 CCTCACCAAAATAAGCAGTGTACG 60.143 45.833 0.00 0.00 0.00 3.67
1523 1787 4.382291 TCACCAAAATAAGCAGTGTACGT 58.618 39.130 0.00 0.00 0.00 3.57
1524 1788 4.212425 TCACCAAAATAAGCAGTGTACGTG 59.788 41.667 0.00 0.00 0.00 4.49
1525 1789 3.500680 ACCAAAATAAGCAGTGTACGTGG 59.499 43.478 0.00 0.00 0.00 4.94
1526 1790 3.749088 CCAAAATAAGCAGTGTACGTGGA 59.251 43.478 0.00 0.00 0.00 4.02
1527 1791 4.394920 CCAAAATAAGCAGTGTACGTGGAT 59.605 41.667 0.00 0.00 0.00 3.41
1528 1792 5.583061 CCAAAATAAGCAGTGTACGTGGATA 59.417 40.000 0.00 0.00 0.00 2.59
1529 1793 6.260050 CCAAAATAAGCAGTGTACGTGGATAT 59.740 38.462 0.00 0.00 0.00 1.63
1530 1794 7.201696 CCAAAATAAGCAGTGTACGTGGATATT 60.202 37.037 0.00 0.00 0.00 1.28
1531 1795 8.822855 CAAAATAAGCAGTGTACGTGGATATTA 58.177 33.333 0.00 0.00 0.00 0.98
1532 1796 8.951787 AAATAAGCAGTGTACGTGGATATTAA 57.048 30.769 0.00 0.00 0.00 1.40
1533 1797 8.589335 AATAAGCAGTGTACGTGGATATTAAG 57.411 34.615 0.00 0.00 0.00 1.85
1534 1798 5.593679 AGCAGTGTACGTGGATATTAAGT 57.406 39.130 0.00 0.00 0.00 2.24
1535 1799 5.974108 AGCAGTGTACGTGGATATTAAGTT 58.026 37.500 0.00 0.00 0.00 2.66
1536 1800 6.403878 AGCAGTGTACGTGGATATTAAGTTT 58.596 36.000 0.00 0.00 0.00 2.66
1537 1801 6.534079 AGCAGTGTACGTGGATATTAAGTTTC 59.466 38.462 0.00 0.00 0.00 2.78
1538 1802 6.534079 GCAGTGTACGTGGATATTAAGTTTCT 59.466 38.462 0.00 0.00 0.00 2.52
1539 1803 7.703621 GCAGTGTACGTGGATATTAAGTTTCTA 59.296 37.037 0.00 0.00 0.00 2.10
1540 1804 9.745880 CAGTGTACGTGGATATTAAGTTTCTAT 57.254 33.333 0.00 0.00 0.00 1.98
1596 1860 6.288294 TCTGTAAGAACTAAACAGTGCATGT 58.712 36.000 13.22 0.00 42.31 3.21
1598 1862 6.288294 TGTAAGAACTAAACAGTGCATGTCT 58.712 36.000 0.00 0.00 43.00 3.41
1599 1863 7.438564 TGTAAGAACTAAACAGTGCATGTCTA 58.561 34.615 0.00 0.00 43.00 2.59
1600 1864 6.787085 AAGAACTAAACAGTGCATGTCTAC 57.213 37.500 0.00 0.00 43.00 2.59
1601 1865 5.853936 AGAACTAAACAGTGCATGTCTACA 58.146 37.500 0.00 0.00 43.00 2.74
1602 1866 6.467677 AGAACTAAACAGTGCATGTCTACAT 58.532 36.000 0.00 0.00 43.00 2.29
1603 1867 7.611770 AGAACTAAACAGTGCATGTCTACATA 58.388 34.615 0.00 0.00 43.00 2.29
1604 1868 7.761704 AGAACTAAACAGTGCATGTCTACATAG 59.238 37.037 0.00 0.64 43.00 2.23
1605 1869 7.170393 ACTAAACAGTGCATGTCTACATAGA 57.830 36.000 0.00 0.00 43.00 1.98
1606 1870 7.786030 ACTAAACAGTGCATGTCTACATAGAT 58.214 34.615 0.00 0.00 43.00 1.98
1607 1871 8.260818 ACTAAACAGTGCATGTCTACATAGATT 58.739 33.333 0.00 0.00 43.00 2.40
1609 1873 6.225981 ACAGTGCATGTCTACATAGATTCA 57.774 37.500 0.00 0.00 37.75 2.57
1610 1874 6.643388 ACAGTGCATGTCTACATAGATTCAA 58.357 36.000 0.00 0.00 37.75 2.69
1611 1875 7.105588 ACAGTGCATGTCTACATAGATTCAAA 58.894 34.615 0.00 0.00 37.75 2.69
1612 1876 7.279536 ACAGTGCATGTCTACATAGATTCAAAG 59.720 37.037 0.00 0.00 37.75 2.77
1614 1878 7.826252 AGTGCATGTCTACATAGATTCAAAGTT 59.174 33.333 0.00 0.00 34.26 2.66
1615 1879 9.098355 GTGCATGTCTACATAGATTCAAAGTTA 57.902 33.333 0.00 0.00 34.26 2.24
1617 1881 8.552034 GCATGTCTACATAGATTCAAAGTTACC 58.448 37.037 0.00 0.00 34.26 2.85
1619 1883 8.058667 TGTCTACATAGATTCAAAGTTACCGA 57.941 34.615 0.00 0.00 34.39 4.69
1620 1884 8.525316 TGTCTACATAGATTCAAAGTTACCGAA 58.475 33.333 0.00 0.00 34.39 4.30
1621 1885 9.362539 GTCTACATAGATTCAAAGTTACCGAAA 57.637 33.333 0.00 0.00 34.39 3.46
1634 1898 9.729023 CAAAGTTACCGAAATAATTCATATGCA 57.271 29.630 0.00 0.00 35.15 3.96
1635 1899 9.730420 AAAGTTACCGAAATAATTCATATGCAC 57.270 29.630 0.00 0.00 35.15 4.57
1638 1902 4.215399 ACCGAAATAATTCATATGCACCCG 59.785 41.667 0.00 0.00 35.15 5.28
1639 1903 4.158384 CGAAATAATTCATATGCACCCGC 58.842 43.478 0.00 0.00 35.15 6.13
1640 1904 4.320129 CGAAATAATTCATATGCACCCGCA 60.320 41.667 0.00 0.00 43.59 5.69
1641 1905 5.713025 GAAATAATTCATATGCACCCGCAT 58.287 37.500 5.16 5.16 46.58 4.73
1642 1906 5.574055 GAAATAATTCATATGCACCCGCATG 59.426 40.000 10.10 0.00 45.57 4.06
1644 1908 8.000282 GAAATAATTCATATGCACCCGCATGAA 61.000 37.037 10.10 7.87 46.04 2.57
1650 1914 2.700722 TGCACCCGCATGAATAGTAA 57.299 45.000 0.00 0.00 45.36 2.24
1651 1915 2.992593 TGCACCCGCATGAATAGTAAA 58.007 42.857 0.00 0.00 45.36 2.01
1652 1916 3.348119 TGCACCCGCATGAATAGTAAAA 58.652 40.909 0.00 0.00 45.36 1.52
1653 1917 3.127895 TGCACCCGCATGAATAGTAAAAC 59.872 43.478 0.00 0.00 45.36 2.43
1655 1919 4.380023 GCACCCGCATGAATAGTAAAACAA 60.380 41.667 0.00 0.00 38.36 2.83
1656 1920 5.704888 CACCCGCATGAATAGTAAAACAAA 58.295 37.500 0.00 0.00 0.00 2.83
1657 1921 6.153067 CACCCGCATGAATAGTAAAACAAAA 58.847 36.000 0.00 0.00 0.00 2.44
1658 1922 6.642950 CACCCGCATGAATAGTAAAACAAAAA 59.357 34.615 0.00 0.00 0.00 1.94
1716 2051 7.807977 TTTTTAGAACATGCTCTTGTCTTCT 57.192 32.000 3.52 0.26 0.00 2.85
1719 2054 7.891183 TTAGAACATGCTCTTGTCTTCTAAC 57.109 36.000 3.52 0.00 29.97 2.34
1720 2055 6.107901 AGAACATGCTCTTGTCTTCTAACT 57.892 37.500 0.00 0.00 0.00 2.24
1722 2057 5.220710 ACATGCTCTTGTCTTCTAACTGT 57.779 39.130 0.00 0.00 0.00 3.55
1723 2058 6.346477 ACATGCTCTTGTCTTCTAACTGTA 57.654 37.500 0.00 0.00 0.00 2.74
1725 2060 5.784578 TGCTCTTGTCTTCTAACTGTACA 57.215 39.130 0.00 0.00 0.00 2.90
1727 2062 7.462571 TGCTCTTGTCTTCTAACTGTACATA 57.537 36.000 0.00 0.00 0.00 2.29
1728 2063 7.892609 TGCTCTTGTCTTCTAACTGTACATAA 58.107 34.615 0.00 0.00 0.00 1.90
1729 2064 8.364894 TGCTCTTGTCTTCTAACTGTACATAAA 58.635 33.333 0.00 0.00 0.00 1.40
1739 2289 7.891782 TCTAACTGTACATAAATTTTCGCGAG 58.108 34.615 9.59 0.00 0.00 5.03
1750 2300 4.988065 TCGCGAGAAAGGACAAGG 57.012 55.556 3.71 0.00 37.03 3.61
1751 2301 1.292223 TCGCGAGAAAGGACAAGGG 59.708 57.895 3.71 0.00 37.03 3.95
1752 2302 1.004918 CGCGAGAAAGGACAAGGGT 60.005 57.895 0.00 0.00 0.00 4.34
1753 2303 0.245539 CGCGAGAAAGGACAAGGGTA 59.754 55.000 0.00 0.00 0.00 3.69
1754 2304 1.736032 CGCGAGAAAGGACAAGGGTAG 60.736 57.143 0.00 0.00 0.00 3.18
1755 2305 1.275573 GCGAGAAAGGACAAGGGTAGT 59.724 52.381 0.00 0.00 0.00 2.73
1756 2306 2.931320 GCGAGAAAGGACAAGGGTAGTG 60.931 54.545 0.00 0.00 0.00 2.74
1757 2307 2.701107 GAGAAAGGACAAGGGTAGTGC 58.299 52.381 0.00 0.00 0.00 4.40
1758 2308 1.351350 AGAAAGGACAAGGGTAGTGCC 59.649 52.381 0.00 0.00 0.00 5.01
1761 2311 1.201429 AGGACAAGGGTAGTGCCTGG 61.201 60.000 0.00 0.00 37.43 4.45
1762 2312 1.299976 GACAAGGGTAGTGCCTGGG 59.700 63.158 0.00 0.00 37.43 4.45
1763 2313 1.463410 ACAAGGGTAGTGCCTGGGT 60.463 57.895 0.00 0.00 37.43 4.51
1765 2315 0.609131 CAAGGGTAGTGCCTGGGTTG 60.609 60.000 0.00 0.00 37.43 3.77
1766 2316 1.789576 AAGGGTAGTGCCTGGGTTGG 61.790 60.000 0.00 0.00 37.43 3.77
1767 2317 2.228480 GGGTAGTGCCTGGGTTGGA 61.228 63.158 0.00 0.00 37.43 3.53
1769 2319 0.322546 GGTAGTGCCTGGGTTGGAAG 60.323 60.000 0.00 0.00 0.00 3.46
1770 2320 0.690762 GTAGTGCCTGGGTTGGAAGA 59.309 55.000 0.00 0.00 0.00 2.87
1771 2321 0.690762 TAGTGCCTGGGTTGGAAGAC 59.309 55.000 0.00 0.00 0.00 3.01
1773 2323 0.690762 GTGCCTGGGTTGGAAGACTA 59.309 55.000 0.00 0.00 0.00 2.59
1774 2324 0.984230 TGCCTGGGTTGGAAGACTAG 59.016 55.000 0.00 0.00 0.00 2.57
1775 2325 1.276622 GCCTGGGTTGGAAGACTAGA 58.723 55.000 0.00 0.00 0.00 2.43
1776 2326 1.208293 GCCTGGGTTGGAAGACTAGAG 59.792 57.143 0.00 0.00 0.00 2.43
1777 2327 1.208293 CCTGGGTTGGAAGACTAGAGC 59.792 57.143 0.00 0.00 0.00 4.09
1778 2328 1.902508 CTGGGTTGGAAGACTAGAGCA 59.097 52.381 0.00 0.00 0.00 4.26
1779 2329 2.503356 CTGGGTTGGAAGACTAGAGCAT 59.497 50.000 0.00 0.00 0.00 3.79
1780 2330 2.912956 TGGGTTGGAAGACTAGAGCATT 59.087 45.455 0.00 0.00 0.00 3.56
1781 2331 3.055094 TGGGTTGGAAGACTAGAGCATTC 60.055 47.826 0.00 0.00 0.00 2.67
1782 2332 3.055094 GGGTTGGAAGACTAGAGCATTCA 60.055 47.826 0.00 0.00 0.00 2.57
1783 2333 4.187694 GGTTGGAAGACTAGAGCATTCAG 58.812 47.826 0.00 0.00 0.00 3.02
1785 2335 5.396213 GGTTGGAAGACTAGAGCATTCAGAT 60.396 44.000 0.00 0.00 0.00 2.90
1787 2337 6.305272 TGGAAGACTAGAGCATTCAGATTT 57.695 37.500 0.00 0.00 0.00 2.17
1788 2338 6.111382 TGGAAGACTAGAGCATTCAGATTTG 58.889 40.000 0.00 0.00 0.00 2.32
1789 2339 6.112058 GGAAGACTAGAGCATTCAGATTTGT 58.888 40.000 0.00 0.00 0.00 2.83
1790 2340 6.597280 GGAAGACTAGAGCATTCAGATTTGTT 59.403 38.462 0.00 0.00 0.00 2.83
1791 2341 7.120432 GGAAGACTAGAGCATTCAGATTTGTTT 59.880 37.037 0.00 0.00 0.00 2.83
1792 2342 7.375106 AGACTAGAGCATTCAGATTTGTTTG 57.625 36.000 0.00 0.00 0.00 2.93
1794 2344 7.663081 AGACTAGAGCATTCAGATTTGTTTGAA 59.337 33.333 0.00 0.00 37.68 2.69
1795 2345 7.588512 ACTAGAGCATTCAGATTTGTTTGAAC 58.411 34.615 0.00 0.00 36.26 3.18
1796 2346 6.645790 AGAGCATTCAGATTTGTTTGAACT 57.354 33.333 0.00 0.00 36.26 3.01
1799 2349 7.983484 AGAGCATTCAGATTTGTTTGAACTTTT 59.017 29.630 0.00 0.00 36.26 2.27
1800 2350 8.496707 AGCATTCAGATTTGTTTGAACTTTTT 57.503 26.923 0.00 0.00 36.26 1.94
1801 2351 9.598517 AGCATTCAGATTTGTTTGAACTTTTTA 57.401 25.926 0.00 0.00 36.26 1.52
1802 2352 9.636965 GCATTCAGATTTGTTTGAACTTTTTAC 57.363 29.630 0.00 0.00 36.26 2.01
1808 2358 9.511144 AGATTTGTTTGAACTTTTTACTTACCG 57.489 29.630 0.00 0.00 0.00 4.02
1809 2359 9.292846 GATTTGTTTGAACTTTTTACTTACCGT 57.707 29.630 0.00 0.00 0.00 4.83
1811 2361 8.672214 TTGTTTGAACTTTTTACTTACCGTTC 57.328 30.769 0.00 0.00 33.34 3.95
1812 2362 6.960431 TGTTTGAACTTTTTACTTACCGTTCG 59.040 34.615 0.00 0.00 34.93 3.95
1814 2364 6.035070 TGAACTTTTTACTTACCGTTCGTG 57.965 37.500 0.00 0.00 34.93 4.35
1816 2366 3.060339 ACTTTTTACTTACCGTTCGTGCG 60.060 43.478 0.00 0.00 0.00 5.34
1833 2383 1.941325 GCGGGTGCATATATAGGAGC 58.059 55.000 0.00 0.00 42.15 4.70
1834 2384 1.802880 GCGGGTGCATATATAGGAGCG 60.803 57.143 0.00 0.00 42.15 5.03
1835 2385 1.802880 CGGGTGCATATATAGGAGCGC 60.803 57.143 0.00 0.00 36.81 5.92
1837 2387 1.134367 GGTGCATATATAGGAGCGCGA 59.866 52.381 12.10 0.00 38.31 5.87
1838 2388 2.455032 GTGCATATATAGGAGCGCGAG 58.545 52.381 12.10 0.00 0.00 5.03
1851 2401 2.720688 CGCGAGCTTAGAAACGTCA 58.279 52.632 0.00 0.00 0.00 4.35
1852 2402 0.362512 CGCGAGCTTAGAAACGTCAC 59.637 55.000 0.00 0.00 0.00 3.67
1853 2403 0.714439 GCGAGCTTAGAAACGTCACC 59.286 55.000 0.00 0.00 0.00 4.02
1854 2404 1.347320 CGAGCTTAGAAACGTCACCC 58.653 55.000 0.00 0.00 0.00 4.61
1855 2405 1.067776 CGAGCTTAGAAACGTCACCCT 60.068 52.381 0.00 0.00 0.00 4.34
1856 2406 2.608268 GAGCTTAGAAACGTCACCCTC 58.392 52.381 0.00 0.00 0.00 4.30
1857 2407 1.968493 AGCTTAGAAACGTCACCCTCA 59.032 47.619 0.00 0.00 0.00 3.86
1858 2408 2.367567 AGCTTAGAAACGTCACCCTCAA 59.632 45.455 0.00 0.00 0.00 3.02
1859 2409 3.135994 GCTTAGAAACGTCACCCTCAAA 58.864 45.455 0.00 0.00 0.00 2.69
1860 2410 3.562557 GCTTAGAAACGTCACCCTCAAAA 59.437 43.478 0.00 0.00 0.00 2.44
1861 2411 4.035909 GCTTAGAAACGTCACCCTCAAAAA 59.964 41.667 0.00 0.00 0.00 1.94
1862 2412 5.744666 TTAGAAACGTCACCCTCAAAAAG 57.255 39.130 0.00 0.00 0.00 2.27
1863 2413 3.617284 AGAAACGTCACCCTCAAAAAGT 58.383 40.909 0.00 0.00 0.00 2.66
1864 2414 4.014406 AGAAACGTCACCCTCAAAAAGTT 58.986 39.130 0.00 0.00 0.00 2.66
1865 2415 5.187687 AGAAACGTCACCCTCAAAAAGTTA 58.812 37.500 0.00 0.00 0.00 2.24
1866 2416 5.296035 AGAAACGTCACCCTCAAAAAGTTAG 59.704 40.000 0.00 0.00 0.00 2.34
1867 2417 4.411256 ACGTCACCCTCAAAAAGTTAGA 57.589 40.909 0.00 0.00 0.00 2.10
1868 2418 4.773013 ACGTCACCCTCAAAAAGTTAGAA 58.227 39.130 0.00 0.00 0.00 2.10
1869 2419 4.573607 ACGTCACCCTCAAAAAGTTAGAAC 59.426 41.667 0.00 0.00 0.00 3.01
1870 2420 4.814771 CGTCACCCTCAAAAAGTTAGAACT 59.185 41.667 0.00 0.00 42.04 3.01
1871 2421 5.277345 CGTCACCCTCAAAAAGTTAGAACTG 60.277 44.000 0.00 0.00 39.66 3.16
1872 2422 5.589050 GTCACCCTCAAAAAGTTAGAACTGT 59.411 40.000 0.00 0.00 39.66 3.55
1873 2423 5.588648 TCACCCTCAAAAAGTTAGAACTGTG 59.411 40.000 0.00 0.00 39.66 3.66
1874 2424 4.338400 ACCCTCAAAAAGTTAGAACTGTGC 59.662 41.667 0.00 0.00 39.66 4.57
1875 2425 4.338118 CCCTCAAAAAGTTAGAACTGTGCA 59.662 41.667 0.00 0.00 39.66 4.57
1876 2426 5.010012 CCCTCAAAAAGTTAGAACTGTGCAT 59.990 40.000 0.00 0.00 39.66 3.96
1877 2427 5.916883 CCTCAAAAAGTTAGAACTGTGCATG 59.083 40.000 0.00 0.00 39.66 4.06
1878 2428 6.238731 CCTCAAAAAGTTAGAACTGTGCATGA 60.239 38.462 0.00 0.00 39.66 3.07
1879 2429 7.275888 TCAAAAAGTTAGAACTGTGCATGAT 57.724 32.000 0.00 0.00 39.66 2.45
1880 2430 7.362662 TCAAAAAGTTAGAACTGTGCATGATC 58.637 34.615 0.00 0.00 39.66 2.92
1881 2431 5.886960 AAAGTTAGAACTGTGCATGATCC 57.113 39.130 0.00 0.00 39.66 3.36
1882 2432 4.558226 AGTTAGAACTGTGCATGATCCA 57.442 40.909 0.00 0.00 37.98 3.41
1883 2433 5.108187 AGTTAGAACTGTGCATGATCCAT 57.892 39.130 0.00 0.00 37.98 3.41
1884 2434 5.503927 AGTTAGAACTGTGCATGATCCATT 58.496 37.500 0.00 0.00 37.98 3.16
1885 2435 5.356190 AGTTAGAACTGTGCATGATCCATTG 59.644 40.000 0.00 0.00 37.98 2.82
1886 2436 3.693807 AGAACTGTGCATGATCCATTGT 58.306 40.909 0.00 0.00 0.00 2.71
1887 2437 4.084287 AGAACTGTGCATGATCCATTGTT 58.916 39.130 0.00 0.00 0.00 2.83
1888 2438 5.255687 AGAACTGTGCATGATCCATTGTTA 58.744 37.500 0.00 0.00 0.00 2.41
1889 2439 5.889853 AGAACTGTGCATGATCCATTGTTAT 59.110 36.000 0.00 0.00 0.00 1.89
1890 2440 5.762825 ACTGTGCATGATCCATTGTTATC 57.237 39.130 0.00 0.00 0.00 1.75
1891 2441 5.195185 ACTGTGCATGATCCATTGTTATCA 58.805 37.500 0.00 2.49 36.60 2.15
1892 2442 5.298527 ACTGTGCATGATCCATTGTTATCAG 59.701 40.000 0.00 0.00 35.67 2.90
1893 2443 4.037089 TGTGCATGATCCATTGTTATCAGC 59.963 41.667 0.00 8.32 35.67 4.26
1894 2444 3.570975 TGCATGATCCATTGTTATCAGCC 59.429 43.478 0.00 1.22 35.67 4.85
1895 2445 3.365666 GCATGATCCATTGTTATCAGCCG 60.366 47.826 0.00 0.00 35.67 5.52
1896 2446 3.836365 TGATCCATTGTTATCAGCCGA 57.164 42.857 0.00 0.00 0.00 5.54
1897 2447 4.149511 TGATCCATTGTTATCAGCCGAA 57.850 40.909 0.00 0.00 0.00 4.30
1898 2448 4.717877 TGATCCATTGTTATCAGCCGAAT 58.282 39.130 0.00 0.00 0.00 3.34
1899 2449 4.756642 TGATCCATTGTTATCAGCCGAATC 59.243 41.667 0.00 0.00 0.00 2.52
1900 2450 4.149511 TCCATTGTTATCAGCCGAATCA 57.850 40.909 0.00 0.00 0.00 2.57
1901 2451 4.717877 TCCATTGTTATCAGCCGAATCAT 58.282 39.130 0.00 0.00 0.00 2.45
1902 2452 4.756642 TCCATTGTTATCAGCCGAATCATC 59.243 41.667 0.00 0.00 0.00 2.92
1903 2453 4.083110 CCATTGTTATCAGCCGAATCATCC 60.083 45.833 0.00 0.00 0.00 3.51
1904 2454 3.126001 TGTTATCAGCCGAATCATCCC 57.874 47.619 0.00 0.00 0.00 3.85
1905 2455 2.069273 GTTATCAGCCGAATCATCCCG 58.931 52.381 0.00 0.00 0.00 5.14
1906 2456 1.338107 TATCAGCCGAATCATCCCGT 58.662 50.000 0.00 0.00 0.00 5.28
1907 2457 0.469917 ATCAGCCGAATCATCCCGTT 59.530 50.000 0.00 0.00 0.00 4.44
1908 2458 0.251916 TCAGCCGAATCATCCCGTTT 59.748 50.000 0.00 0.00 0.00 3.60
1909 2459 1.094785 CAGCCGAATCATCCCGTTTT 58.905 50.000 0.00 0.00 0.00 2.43
1910 2460 1.472480 CAGCCGAATCATCCCGTTTTT 59.528 47.619 0.00 0.00 0.00 1.94
1911 2461 1.743394 AGCCGAATCATCCCGTTTTTC 59.257 47.619 0.00 0.00 0.00 2.29
1912 2462 1.470890 GCCGAATCATCCCGTTTTTCA 59.529 47.619 0.00 0.00 0.00 2.69
1913 2463 2.477863 GCCGAATCATCCCGTTTTTCAG 60.478 50.000 0.00 0.00 0.00 3.02
1914 2464 2.097466 CCGAATCATCCCGTTTTTCAGG 59.903 50.000 0.00 0.00 0.00 3.86
1915 2465 3.006940 CGAATCATCCCGTTTTTCAGGA 58.993 45.455 0.00 0.00 0.00 3.86
1916 2466 3.438781 CGAATCATCCCGTTTTTCAGGAA 59.561 43.478 0.00 0.00 32.26 3.36
1917 2467 4.437390 CGAATCATCCCGTTTTTCAGGAAG 60.437 45.833 0.00 0.00 32.26 3.46
1918 2468 2.159382 TCATCCCGTTTTTCAGGAAGC 58.841 47.619 0.00 0.00 32.26 3.86
1919 2469 1.135689 CATCCCGTTTTTCAGGAAGCG 60.136 52.381 0.00 0.00 32.26 4.68
1920 2470 0.107081 TCCCGTTTTTCAGGAAGCGA 59.893 50.000 0.00 0.00 35.62 4.93
1921 2471 1.165270 CCCGTTTTTCAGGAAGCGAT 58.835 50.000 0.00 0.00 35.62 4.58
1922 2472 1.130561 CCCGTTTTTCAGGAAGCGATC 59.869 52.381 0.00 0.00 35.62 3.69
1923 2473 2.076863 CCGTTTTTCAGGAAGCGATCT 58.923 47.619 0.00 0.00 35.62 2.75
1924 2474 2.484264 CCGTTTTTCAGGAAGCGATCTT 59.516 45.455 0.00 0.00 35.62 2.40
1925 2475 3.424962 CCGTTTTTCAGGAAGCGATCTTC 60.425 47.826 0.00 0.00 46.15 2.87
1941 2491 9.994432 AAGCGATCTTCAAAATAAGATAAGTTG 57.006 29.630 0.00 0.00 44.38 3.16
1942 2492 9.167311 AGCGATCTTCAAAATAAGATAAGTTGT 57.833 29.630 0.00 0.00 44.38 3.32
1974 2524 7.931578 TTCGGATAAACCTTTAATCACATGT 57.068 32.000 0.00 0.00 36.31 3.21
1975 2525 7.548196 TCGGATAAACCTTTAATCACATGTC 57.452 36.000 0.00 0.00 36.31 3.06
1976 2526 7.106890 TCGGATAAACCTTTAATCACATGTCA 58.893 34.615 0.00 0.00 36.31 3.58
1977 2527 7.065324 TCGGATAAACCTTTAATCACATGTCAC 59.935 37.037 0.00 0.00 36.31 3.67
1978 2528 7.148323 CGGATAAACCTTTAATCACATGTCACA 60.148 37.037 0.00 0.00 36.31 3.58
1979 2529 8.686334 GGATAAACCTTTAATCACATGTCACAT 58.314 33.333 0.00 0.00 35.41 3.21
1980 2530 9.507280 GATAAACCTTTAATCACATGTCACATG 57.493 33.333 16.68 16.68 0.00 3.21
1981 2531 6.899393 AACCTTTAATCACATGTCACATGT 57.101 33.333 18.20 18.20 0.00 3.21
1982 2532 6.899393 ACCTTTAATCACATGTCACATGTT 57.101 33.333 21.30 9.68 0.00 2.71
1983 2533 7.288810 ACCTTTAATCACATGTCACATGTTT 57.711 32.000 21.30 15.79 0.00 2.83
1984 2534 8.402798 ACCTTTAATCACATGTCACATGTTTA 57.597 30.769 21.30 14.79 0.00 2.01
1985 2535 9.023962 ACCTTTAATCACATGTCACATGTTTAT 57.976 29.630 21.30 14.24 0.00 1.40
1986 2536 9.859427 CCTTTAATCACATGTCACATGTTTATT 57.141 29.630 21.30 22.29 0.00 1.40
2011 2561 3.140325 TCCCTCATGGTCTGTTTTGTC 57.860 47.619 0.00 0.00 34.77 3.18
2012 2562 2.162681 CCCTCATGGTCTGTTTTGTCC 58.837 52.381 0.00 0.00 0.00 4.02
2015 2565 4.003648 CCTCATGGTCTGTTTTGTCCTAC 58.996 47.826 0.00 0.00 0.00 3.18
2029 2579 7.708752 TGTTTTGTCCTACCAATGATTTTTGTC 59.291 33.333 0.00 0.00 0.00 3.18
2057 2619 2.634453 CTGCATTTCCCTTTTTCCCACT 59.366 45.455 0.00 0.00 0.00 4.00
2068 2630 7.136885 TCCCTTTTTCCCACTAGTGATATCTA 58.863 38.462 24.68 4.68 0.00 1.98
2076 2638 8.331931 TCCCACTAGTGATATCTAATTGGTTT 57.668 34.615 24.68 0.00 0.00 3.27
2077 2639 8.210946 TCCCACTAGTGATATCTAATTGGTTTG 58.789 37.037 24.68 0.88 0.00 2.93
2078 2640 7.041098 CCCACTAGTGATATCTAATTGGTTTGC 60.041 40.741 24.68 0.00 0.00 3.68
2079 2641 7.498900 CCACTAGTGATATCTAATTGGTTTGCA 59.501 37.037 24.68 0.00 0.00 4.08
2080 2642 8.338259 CACTAGTGATATCTAATTGGTTTGCAC 58.662 37.037 18.45 0.00 0.00 4.57
2088 2691 7.715265 ATCTAATTGGTTTGCACTATACTCG 57.285 36.000 0.00 0.00 0.00 4.18
2093 2696 4.382291 TGGTTTGCACTATACTCGTTTGT 58.618 39.130 0.00 0.00 0.00 2.83
2102 2705 8.374728 TGCACTATACTCGTTTGTTATTTTACG 58.625 33.333 0.00 0.00 35.46 3.18
2103 2706 7.842721 GCACTATACTCGTTTGTTATTTTACGG 59.157 37.037 0.00 0.00 34.93 4.02
2107 2710 6.783892 ACTCGTTTGTTATTTTACGGCTTA 57.216 33.333 0.00 0.00 34.93 3.09
2119 2722 0.613260 ACGGCTTACAGGAGAATGCA 59.387 50.000 0.00 0.00 0.00 3.96
2137 2740 3.132629 GCAAGTGCATCACATTCTCTG 57.867 47.619 0.00 0.00 41.59 3.35
2139 2742 2.414994 AGTGCATCACATTCTCTGGG 57.585 50.000 0.00 0.00 36.74 4.45
2143 2755 1.012086 CATCACATTCTCTGGGTGCG 58.988 55.000 0.00 0.00 32.69 5.34
2152 2764 2.028190 CTGGGTGCGGCTATCTCG 59.972 66.667 0.00 0.00 0.00 4.04
2169 2781 4.710423 TCTCGAGATGGAACTTGAAGAG 57.290 45.455 12.08 0.00 31.01 2.85
2180 2792 6.940739 TGGAACTTGAAGAGAAGAATAGAGG 58.059 40.000 0.00 0.00 0.00 3.69
2183 2795 7.093509 GGAACTTGAAGAGAAGAATAGAGGAGT 60.094 40.741 0.00 0.00 0.00 3.85
2192 2804 9.408648 AGAGAAGAATAGAGGAGTTAGAAAGAG 57.591 37.037 0.00 0.00 0.00 2.85
2216 2828 4.984785 TCGTCAATGAAGTGAAGAAGTCAG 59.015 41.667 0.00 0.00 36.74 3.51
2231 2843 5.593010 AGAAGTCAGAACTCTTGTGTGTAC 58.407 41.667 0.00 0.00 33.48 2.90
2239 2851 2.979678 ACTCTTGTGTGTACCAAGGGAT 59.020 45.455 14.81 0.40 41.94 3.85
2241 2853 4.783227 ACTCTTGTGTGTACCAAGGGATAT 59.217 41.667 14.81 0.00 41.94 1.63
2248 2860 2.849943 TGTACCAAGGGATATTGCACCT 59.150 45.455 0.00 0.00 35.78 4.00
2329 2941 0.729816 GTCGAGAGGAGTTGCGTGAC 60.730 60.000 0.00 0.00 0.00 3.67
2345 2957 3.706698 CGTGACGATATCATGACAAGGT 58.293 45.455 0.00 0.00 45.96 3.50
2349 2961 4.161377 TGACGATATCATGACAAGGTTCCA 59.839 41.667 0.00 0.00 29.99 3.53
2359 2971 1.270839 ACAAGGTTCCATGAGACACCG 60.271 52.381 0.00 0.00 33.41 4.94
2428 3040 2.091939 TGGCATATATGGTGTTGCAGGT 60.092 45.455 14.51 0.00 36.82 4.00
2486 3098 5.835113 TTACATAAAGGAGGAATGCAAGC 57.165 39.130 0.00 0.00 0.00 4.01
2578 3193 8.906867 CATGAAATGTTGAAGGATATTACCAGT 58.093 33.333 0.00 0.00 40.20 4.00
2612 3227 7.072202 ACTCCAATATTTCAGATCATGAGGAGT 59.928 37.037 15.40 15.40 44.88 3.85
2617 3232 4.750021 TTCAGATCATGAGGAGTTGGAG 57.250 45.455 0.09 0.00 39.68 3.86
2632 3247 3.326297 AGTTGGAGGAGAAGTTGAAGGAG 59.674 47.826 0.00 0.00 0.00 3.69
2641 3256 3.817647 AGAAGTTGAAGGAGTCATTGTGC 59.182 43.478 0.00 0.00 35.70 4.57
2657 3272 0.933047 GTGCGGCAAACGTTTCTTCC 60.933 55.000 11.37 11.44 46.52 3.46
2663 3278 3.424433 CGGCAAACGTTTCTTCCTGATAC 60.424 47.826 11.37 0.00 37.93 2.24
2685 3300 3.036819 TGGATGATCTCTGGGTGAAGAG 58.963 50.000 0.00 0.00 44.34 2.85
2696 3311 2.106338 TGGGTGAAGAGCAAGAATGACA 59.894 45.455 0.00 0.00 0.00 3.58
2700 3315 4.033358 GGTGAAGAGCAAGAATGACATACG 59.967 45.833 0.00 0.00 0.00 3.06
2716 3331 3.454812 ACATACGGCTGGAGGAACTAATT 59.545 43.478 0.00 0.00 41.55 1.40
2730 3345 7.201741 GGAGGAACTAATTTCTCCACTTAATGC 60.202 40.741 6.37 0.00 41.55 3.56
2737 3352 3.845781 TCTCCACTTAATGCTGGGATC 57.154 47.619 0.00 0.00 0.00 3.36
2748 3363 0.813821 GCTGGGATCAAAGGAAGCAC 59.186 55.000 0.00 0.00 0.00 4.40
2749 3364 1.467920 CTGGGATCAAAGGAAGCACC 58.532 55.000 0.00 0.00 39.35 5.01
2755 3370 2.496899 TCAAAGGAAGCACCATCCTC 57.503 50.000 0.00 0.00 46.65 3.71
2770 3385 2.504244 CTCGTGACGGCTCGAACC 60.504 66.667 17.05 0.00 39.23 3.62
2789 3404 1.891150 CCAAAGATGCAGCTGGAGTTT 59.109 47.619 17.12 13.66 0.00 2.66
2800 3415 1.268743 GCTGGAGTTTTGTGTGCTGAC 60.269 52.381 0.00 0.00 0.00 3.51
2813 3428 4.449743 TGTGTGCTGACGAACCTATTAAAC 59.550 41.667 0.00 0.00 0.00 2.01
2818 3433 4.250464 CTGACGAACCTATTAAACTGCCA 58.750 43.478 0.00 0.00 0.00 4.92
2883 3498 1.388065 TTGGGCGGAACAAGTGTTGG 61.388 55.000 0.42 0.00 38.56 3.77
2886 3504 1.299089 GCGGAACAAGTGTTGGTGC 60.299 57.895 0.42 0.00 38.56 5.01
2890 3508 1.956477 GGAACAAGTGTTGGTGCTGAT 59.044 47.619 0.42 0.00 38.56 2.90
2902 3520 2.746904 TGGTGCTGATGAATTTGTACGG 59.253 45.455 0.00 0.00 0.00 4.02
2912 3530 3.009695 TGAATTTGTACGGGTTGGGAGAT 59.990 43.478 0.00 0.00 0.00 2.75
2917 3535 3.376636 TGTACGGGTTGGGAGATTGATA 58.623 45.455 0.00 0.00 0.00 2.15
2923 3541 3.381590 GGGTTGGGAGATTGATAGCAAAC 59.618 47.826 0.00 0.00 37.59 2.93
2950 3568 3.657634 ACATAGATCACCTATTGCAGCG 58.342 45.455 0.00 0.00 35.96 5.18
3085 3703 2.413837 CTTAATCCGGACATTAGGCGG 58.586 52.381 6.12 0.00 0.00 6.13
3099 3717 5.303589 ACATTAGGCGGTGCTTAGAATACTA 59.696 40.000 0.00 0.00 0.00 1.82
3160 3778 0.756903 TAGTCCGCCTTTGGATAGCC 59.243 55.000 0.00 0.00 40.91 3.93
3177 3795 3.322191 AGCCCAAGGGTTTGTAAAGAA 57.678 42.857 7.05 0.00 37.65 2.52
3198 3816 0.814010 AGTTGTGCAACGGAGGACAC 60.814 55.000 9.10 0.00 45.50 3.67
3236 3854 4.080863 AGGGCTACATTCAAGAGTTAGTGG 60.081 45.833 0.00 0.00 0.00 4.00
3302 3971 8.398878 TCATGATCTTATGCATGATTTAGCAA 57.601 30.769 10.16 0.00 44.17 3.91
3355 4024 6.647067 GGATCGAGAATAAATGGATCGAAAGT 59.353 38.462 0.00 0.00 44.55 2.66
3358 4027 5.559035 CGAGAATAAATGGATCGAAAGTGGC 60.559 44.000 0.00 0.00 35.47 5.01
3364 4036 1.090052 GGATCGAAAGTGGCGAAGGG 61.090 60.000 0.00 0.00 41.52 3.95
3457 4132 7.800155 GGAGAAGATCCTTAGATTGGAAAAG 57.200 40.000 0.00 0.00 45.64 2.27
3494 4178 4.202388 ACGTTGTTGAAAGGGGTACACTAT 60.202 41.667 0.00 0.00 0.00 2.12
3496 4180 5.933463 CGTTGTTGAAAGGGGTACACTATTA 59.067 40.000 0.00 0.00 0.00 0.98
3502 4186 6.449956 TGAAAGGGGTACACTATTAGAGGAT 58.550 40.000 0.00 0.00 0.00 3.24
3544 4228 4.120331 AGGCTGCCGAAATTGCGC 62.120 61.111 13.96 0.00 0.00 6.09
3583 4679 7.701539 TTGGAGTAATCAATATTGTGCACTT 57.298 32.000 19.41 8.24 0.00 3.16
3716 4827 8.041323 CACTAAGTAAACTTCACCATATCCAGT 58.959 37.037 0.00 0.00 37.40 4.00
3721 4832 3.614092 ACTTCACCATATCCAGTTGCTG 58.386 45.455 0.00 0.00 0.00 4.41
3752 4866 8.986929 TGGTTATGGTGAAATTTTGGAATTTT 57.013 26.923 0.00 0.00 43.61 1.82
3775 4892 3.476552 CTTTGCTGACCTTGTCAACCTA 58.523 45.455 0.00 0.00 42.26 3.08
3778 4895 2.171659 TGCTGACCTTGTCAACCTACAA 59.828 45.455 0.00 0.00 42.26 2.41
3818 4950 4.081087 GTGACTTTCCTAACATAGGCAGGA 60.081 45.833 0.00 0.00 45.82 3.86
3850 4991 2.406130 CAAACGTTGCCATGCTTCATT 58.594 42.857 0.00 0.00 0.00 2.57
3855 4996 3.005261 ACGTTGCCATGCTTCATTGTAAA 59.995 39.130 0.00 0.00 0.00 2.01
3874 5018 8.698973 TTGTAAAGAATGAACAAGGGTATGAA 57.301 30.769 0.00 0.00 0.00 2.57
3911 5055 1.144969 TCTAAACAAGCTTCGTGGCG 58.855 50.000 0.00 0.00 37.29 5.69
3916 5060 1.080093 CAAGCTTCGTGGCGACCTA 60.080 57.895 0.00 0.00 34.89 3.08
3932 5076 3.744214 CGACCTATGCATTCTTGGCCTTA 60.744 47.826 3.54 0.00 0.00 2.69
3934 5078 3.954258 ACCTATGCATTCTTGGCCTTAAC 59.046 43.478 3.54 0.00 0.00 2.01
3996 5140 1.926511 GCCAAGGAACGGCTCACATG 61.927 60.000 0.00 0.00 46.56 3.21
3998 5142 0.518636 CAAGGAACGGCTCACATGTG 59.481 55.000 20.18 20.18 0.00 3.21
4016 5169 4.465632 TGTGTGTCACTATGGTGGTATC 57.534 45.455 9.56 0.00 43.17 2.24
4017 5170 3.196901 TGTGTGTCACTATGGTGGTATCC 59.803 47.826 9.56 0.00 43.17 2.59
4035 5206 1.702401 TCCTGGTGATACAAGGTGCAA 59.298 47.619 2.48 0.00 0.00 4.08
4043 5214 5.048083 GGTGATACAAGGTGCAATTCAGAAA 60.048 40.000 0.00 0.00 0.00 2.52
4058 5229 4.908601 TCAGAAATCCAAGCAGAGGTAA 57.091 40.909 0.00 0.00 0.00 2.85
4060 5231 5.431765 TCAGAAATCCAAGCAGAGGTAATC 58.568 41.667 0.00 0.00 0.00 1.75
4141 5314 3.314693 GAGGTACCCAGATTGGATGGTA 58.685 50.000 8.74 0.00 40.96 3.25
4150 5326 4.130118 CAGATTGGATGGTAGGTAAGCAC 58.870 47.826 0.00 0.00 38.70 4.40
4187 5369 3.634910 GGACCTGCAAGAACTTTGGTTAA 59.365 43.478 0.00 0.00 35.58 2.01
4207 5389 3.567478 AATGGATGGAGTCAACTAGGC 57.433 47.619 0.00 0.00 0.00 3.93
4229 5420 2.125350 GCCCTGAACTCGAGGCTG 60.125 66.667 18.41 11.76 42.34 4.85
4253 5444 1.446792 CATCTTCGTGTGCTCCGCT 60.447 57.895 0.00 0.00 0.00 5.52
4273 5464 2.974692 TTTCGGCCTGCAGCTGGAAA 62.975 55.000 22.08 13.33 42.77 3.13
4275 5466 2.345760 CGGCCTGCAGCTGGAAATT 61.346 57.895 22.08 0.00 44.85 1.82
4276 5467 1.880819 CGGCCTGCAGCTGGAAATTT 61.881 55.000 22.08 0.00 44.85 1.82
4316 5507 1.556911 ACCTCACATCGCTCAAGGAAT 59.443 47.619 0.00 0.00 0.00 3.01
4321 5512 2.096496 CACATCGCTCAAGGAATTGTCC 59.904 50.000 0.00 0.00 45.35 4.02
4366 5566 1.814772 CGCTTCCAACATTGCCCCAA 61.815 55.000 0.00 0.00 0.00 4.12
4376 5576 4.591321 ACATTGCCCCAATCTCTTAAGA 57.409 40.909 4.81 4.81 31.05 2.10
4391 5591 6.390721 TCTCTTAAGATGTTTCGTCTTGAGG 58.609 40.000 17.25 11.35 40.88 3.86
4393 5593 3.771577 AAGATGTTTCGTCTTGAGGGT 57.228 42.857 3.81 0.00 38.17 4.34
4463 5663 2.097825 GGCAAAAGATCAGGCACATCT 58.902 47.619 0.00 0.00 31.51 2.90
4480 5680 5.351465 GCACATCTCCGAGAAAACATTTAGA 59.649 40.000 1.27 0.00 0.00 2.10
4498 5708 8.211629 ACATTTAGATGTAAGACTGTAATCCCC 58.788 37.037 0.00 0.00 44.51 4.81
4502 5712 7.272144 AGATGTAAGACTGTAATCCCCTTTT 57.728 36.000 0.00 0.00 0.00 2.27
4503 5713 7.112779 AGATGTAAGACTGTAATCCCCTTTTG 58.887 38.462 0.00 0.00 0.00 2.44
4504 5714 5.007682 TGTAAGACTGTAATCCCCTTTTGC 58.992 41.667 0.00 0.00 0.00 3.68
4506 5716 4.388577 AGACTGTAATCCCCTTTTGCTT 57.611 40.909 0.00 0.00 0.00 3.91
4507 5717 4.082125 AGACTGTAATCCCCTTTTGCTTG 58.918 43.478 0.00 0.00 0.00 4.01
4508 5718 4.079253 GACTGTAATCCCCTTTTGCTTGA 58.921 43.478 0.00 0.00 0.00 3.02
4509 5719 3.826729 ACTGTAATCCCCTTTTGCTTGAC 59.173 43.478 0.00 0.00 0.00 3.18
4510 5720 3.161866 TGTAATCCCCTTTTGCTTGACC 58.838 45.455 0.00 0.00 0.00 4.02
4535 5745 9.651913 CCTTTTGGTATTTGTATAAACATTGCT 57.348 29.630 0.00 0.00 32.90 3.91
4538 5748 9.988815 TTTGGTATTTGTATAAACATTGCTTGT 57.011 25.926 0.00 0.00 41.53 3.16
4539 5749 8.978564 TGGTATTTGTATAAACATTGCTTGTG 57.021 30.769 0.00 0.00 38.99 3.33
4562 5789 6.204301 GTGCAACATGATGATCTGCTACTAAT 59.796 38.462 7.22 0.00 36.32 1.73
4564 5791 7.933033 TGCAACATGATGATCTGCTACTAATTA 59.067 33.333 7.22 0.00 34.10 1.40
4568 5795 9.703892 ACATGATGATCTGCTACTAATTAACTC 57.296 33.333 0.00 0.00 0.00 3.01
4570 5797 9.926158 ATGATGATCTGCTACTAATTAACTCTG 57.074 33.333 0.00 0.00 0.00 3.35
4571 5798 7.869937 TGATGATCTGCTACTAATTAACTCTGC 59.130 37.037 0.00 0.00 0.00 4.26
4572 5799 7.353414 TGATCTGCTACTAATTAACTCTGCT 57.647 36.000 0.00 0.00 0.00 4.24
4573 5800 7.786030 TGATCTGCTACTAATTAACTCTGCTT 58.214 34.615 0.00 0.00 0.00 3.91
4574 5801 8.914011 TGATCTGCTACTAATTAACTCTGCTTA 58.086 33.333 0.00 0.00 0.00 3.09
4575 5802 9.921637 GATCTGCTACTAATTAACTCTGCTTAT 57.078 33.333 0.00 0.00 0.00 1.73
4576 5803 9.703892 ATCTGCTACTAATTAACTCTGCTTATG 57.296 33.333 0.00 0.00 0.00 1.90
4588 5815 6.882610 ACTCTGCTTATGTTTTGTTCATCA 57.117 33.333 0.00 0.00 0.00 3.07
4593 5820 9.545105 TCTGCTTATGTTTTGTTCATCAATTTT 57.455 25.926 0.00 0.00 35.84 1.82
4608 5835 8.996024 TCATCAATTTTCTACTGATTGACGTA 57.004 30.769 0.00 0.00 41.14 3.57
4619 5846 2.033424 TGATTGACGTATCAGAGAGGCG 59.967 50.000 0.00 0.00 35.83 5.52
4639 5868 1.002087 GGTGAAGGACGTCTGATGGTT 59.998 52.381 16.46 0.00 0.00 3.67
4641 5870 2.480419 GTGAAGGACGTCTGATGGTTTG 59.520 50.000 16.46 0.00 0.00 2.93
4643 5872 1.056660 AGGACGTCTGATGGTTTGGT 58.943 50.000 16.46 0.00 0.00 3.67
4652 5881 5.440610 GTCTGATGGTTTGGTATCAATCCT 58.559 41.667 15.32 3.24 41.21 3.24
4657 5886 5.512942 TGGTTTGGTATCAATCCTGAGAA 57.487 39.130 15.32 0.00 41.21 2.87
4658 5887 5.886609 TGGTTTGGTATCAATCCTGAGAAA 58.113 37.500 15.32 0.00 41.21 2.52
4663 5892 9.143631 GTTTGGTATCAATCCTGAGAAAATTTG 57.856 33.333 0.00 0.00 34.23 2.32
4669 5898 5.957168 TCAATCCTGAGAAAATTTGGGCATA 59.043 36.000 0.00 0.00 0.00 3.14
4679 5908 1.176527 TTTGGGCATAGCAAGACAGC 58.823 50.000 0.00 0.00 0.00 4.40
4683 5912 1.303309 GGCATAGCAAGACAGCGAAT 58.697 50.000 0.00 0.00 40.15 3.34
4684 5913 1.003116 GGCATAGCAAGACAGCGAATG 60.003 52.381 0.00 0.00 40.15 2.67
4685 5914 1.935873 GCATAGCAAGACAGCGAATGA 59.064 47.619 0.00 0.00 40.15 2.57
4686 5915 2.547211 GCATAGCAAGACAGCGAATGAT 59.453 45.455 0.00 0.00 40.15 2.45
4687 5916 3.606384 GCATAGCAAGACAGCGAATGATG 60.606 47.826 0.00 0.00 40.15 3.07
4689 5918 2.430465 AGCAAGACAGCGAATGATGTT 58.570 42.857 0.00 0.00 46.53 2.71
4690 5919 2.816087 AGCAAGACAGCGAATGATGTTT 59.184 40.909 0.00 0.00 46.53 2.83
4691 5920 3.120060 AGCAAGACAGCGAATGATGTTTC 60.120 43.478 0.00 0.00 46.53 2.78
4692 5921 3.365264 GCAAGACAGCGAATGATGTTTCA 60.365 43.478 0.00 0.00 46.53 2.69
4693 5922 4.786507 CAAGACAGCGAATGATGTTTCAA 58.213 39.130 0.00 0.00 46.53 2.69
4694 5923 4.410492 AGACAGCGAATGATGTTTCAAC 57.590 40.909 0.00 0.00 46.53 3.18
4695 5924 3.189287 AGACAGCGAATGATGTTTCAACC 59.811 43.478 0.00 0.00 46.53 3.77
4696 5925 2.228822 ACAGCGAATGATGTTTCAACCC 59.771 45.455 0.00 0.00 43.47 4.11
4697 5926 2.489329 CAGCGAATGATGTTTCAACCCT 59.511 45.455 0.00 0.00 34.96 4.34
4698 5927 3.057315 CAGCGAATGATGTTTCAACCCTT 60.057 43.478 0.00 0.00 34.96 3.95
4699 5928 3.573967 AGCGAATGATGTTTCAACCCTTT 59.426 39.130 0.00 0.00 34.96 3.11
4700 5929 3.674753 GCGAATGATGTTTCAACCCTTTG 59.325 43.478 0.00 0.00 34.96 2.77
4701 5930 4.558496 GCGAATGATGTTTCAACCCTTTGA 60.558 41.667 0.00 0.00 40.14 2.69
4702 5931 5.713025 CGAATGATGTTTCAACCCTTTGAT 58.287 37.500 0.00 0.00 41.50 2.57
4703 5932 6.158598 CGAATGATGTTTCAACCCTTTGATT 58.841 36.000 0.00 0.00 41.50 2.57
4704 5933 6.089820 CGAATGATGTTTCAACCCTTTGATTG 59.910 38.462 0.00 0.00 41.50 2.67
4705 5934 6.669125 ATGATGTTTCAACCCTTTGATTGA 57.331 33.333 0.00 0.00 41.50 2.57
4706 5935 6.477053 TGATGTTTCAACCCTTTGATTGAA 57.523 33.333 0.00 0.00 41.50 2.69
4711 5940 4.270245 TCAACCCTTTGATTGAAATGCC 57.730 40.909 0.00 0.00 36.79 4.40
4712 5941 3.645212 TCAACCCTTTGATTGAAATGCCA 59.355 39.130 0.00 0.00 36.79 4.92
4713 5942 4.286549 TCAACCCTTTGATTGAAATGCCAT 59.713 37.500 0.00 0.00 36.79 4.40
4714 5943 4.210724 ACCCTTTGATTGAAATGCCATG 57.789 40.909 0.00 0.00 0.00 3.66
4715 5944 2.940410 CCCTTTGATTGAAATGCCATGC 59.060 45.455 0.00 0.00 0.00 4.06
4716 5945 2.940410 CCTTTGATTGAAATGCCATGCC 59.060 45.455 0.00 0.00 0.00 4.40
4717 5946 3.601435 CTTTGATTGAAATGCCATGCCA 58.399 40.909 0.00 0.00 0.00 4.92
4718 5947 3.697619 TTGATTGAAATGCCATGCCAA 57.302 38.095 0.00 0.00 0.00 4.52
4719 5948 3.254470 TGATTGAAATGCCATGCCAAG 57.746 42.857 0.00 0.00 0.00 3.61
4720 5949 2.093394 TGATTGAAATGCCATGCCAAGG 60.093 45.455 0.00 0.00 0.00 3.61
4721 5950 1.350071 TTGAAATGCCATGCCAAGGT 58.650 45.000 0.00 0.00 0.00 3.50
4722 5951 2.228545 TGAAATGCCATGCCAAGGTA 57.771 45.000 0.00 0.00 0.00 3.08
4723 5952 2.749600 TGAAATGCCATGCCAAGGTAT 58.250 42.857 0.00 0.00 32.49 2.73
4724 5953 2.694628 TGAAATGCCATGCCAAGGTATC 59.305 45.455 0.00 0.00 30.68 2.24
4725 5954 1.708341 AATGCCATGCCAAGGTATCC 58.292 50.000 0.00 0.00 30.68 2.59
4726 5955 0.855598 ATGCCATGCCAAGGTATCCT 59.144 50.000 0.00 0.00 33.87 3.24
4727 5956 0.106569 TGCCATGCCAAGGTATCCTG 60.107 55.000 0.00 0.00 32.13 3.86
4728 5957 0.825010 GCCATGCCAAGGTATCCTGG 60.825 60.000 0.00 0.00 32.13 4.45
4729 5958 0.846015 CCATGCCAAGGTATCCTGGA 59.154 55.000 0.00 0.00 32.13 3.86
4730 5959 1.202855 CCATGCCAAGGTATCCTGGAG 60.203 57.143 1.52 0.00 32.13 3.86
4731 5960 0.475906 ATGCCAAGGTATCCTGGAGC 59.524 55.000 1.52 0.00 32.13 4.70
4732 5961 0.621571 TGCCAAGGTATCCTGGAGCT 60.622 55.000 1.52 0.00 32.13 4.09
4733 5962 0.179034 GCCAAGGTATCCTGGAGCTG 60.179 60.000 1.52 0.00 32.13 4.24
4734 5963 1.207791 CCAAGGTATCCTGGAGCTGT 58.792 55.000 1.52 0.00 32.13 4.40
4735 5964 1.134280 CCAAGGTATCCTGGAGCTGTG 60.134 57.143 1.52 0.00 32.13 3.66
4736 5965 1.556911 CAAGGTATCCTGGAGCTGTGT 59.443 52.381 1.52 0.00 32.13 3.72
4737 5966 1.198713 AGGTATCCTGGAGCTGTGTG 58.801 55.000 1.52 0.00 29.57 3.82
4738 5967 0.179000 GGTATCCTGGAGCTGTGTGG 59.821 60.000 1.52 0.00 0.00 4.17
4739 5968 0.905357 GTATCCTGGAGCTGTGTGGT 59.095 55.000 1.52 0.00 0.00 4.16
4740 5969 0.904649 TATCCTGGAGCTGTGTGGTG 59.095 55.000 1.52 0.00 0.00 4.17
4741 5970 1.845627 ATCCTGGAGCTGTGTGGTGG 61.846 60.000 1.52 0.00 0.00 4.61
4742 5971 2.822637 CCTGGAGCTGTGTGGTGGT 61.823 63.158 0.00 0.00 0.00 4.16
4743 5972 1.149174 CTGGAGCTGTGTGGTGGTT 59.851 57.895 0.00 0.00 0.00 3.67
4744 5973 0.466189 CTGGAGCTGTGTGGTGGTTT 60.466 55.000 0.00 0.00 0.00 3.27
4745 5974 0.465460 TGGAGCTGTGTGGTGGTTTC 60.465 55.000 0.00 0.00 0.00 2.78
4746 5975 0.179018 GGAGCTGTGTGGTGGTTTCT 60.179 55.000 0.00 0.00 0.00 2.52
4747 5976 1.680338 GAGCTGTGTGGTGGTTTCTT 58.320 50.000 0.00 0.00 0.00 2.52
4748 5977 1.334869 GAGCTGTGTGGTGGTTTCTTG 59.665 52.381 0.00 0.00 0.00 3.02
4749 5978 1.064758 AGCTGTGTGGTGGTTTCTTGA 60.065 47.619 0.00 0.00 0.00 3.02
4750 5979 1.956477 GCTGTGTGGTGGTTTCTTGAT 59.044 47.619 0.00 0.00 0.00 2.57
4751 5980 2.287788 GCTGTGTGGTGGTTTCTTGATG 60.288 50.000 0.00 0.00 0.00 3.07
4752 5981 3.213506 CTGTGTGGTGGTTTCTTGATGA 58.786 45.455 0.00 0.00 0.00 2.92
4753 5982 3.822735 CTGTGTGGTGGTTTCTTGATGAT 59.177 43.478 0.00 0.00 0.00 2.45
4754 5983 4.214310 TGTGTGGTGGTTTCTTGATGATT 58.786 39.130 0.00 0.00 0.00 2.57
4755 5984 4.648762 TGTGTGGTGGTTTCTTGATGATTT 59.351 37.500 0.00 0.00 0.00 2.17
4756 5985 5.128499 TGTGTGGTGGTTTCTTGATGATTTT 59.872 36.000 0.00 0.00 0.00 1.82
4757 5986 5.691754 GTGTGGTGGTTTCTTGATGATTTTC 59.308 40.000 0.00 0.00 0.00 2.29
4758 5987 5.362143 TGTGGTGGTTTCTTGATGATTTTCA 59.638 36.000 0.00 0.00 0.00 2.69
4759 5988 6.041865 TGTGGTGGTTTCTTGATGATTTTCAT 59.958 34.615 0.00 0.00 40.34 2.57
4760 5989 6.366877 GTGGTGGTTTCTTGATGATTTTCATG 59.633 38.462 0.00 0.00 37.20 3.07
4761 5990 5.870978 GGTGGTTTCTTGATGATTTTCATGG 59.129 40.000 0.00 0.00 37.20 3.66
4762 5991 5.870978 GTGGTTTCTTGATGATTTTCATGGG 59.129 40.000 0.00 0.00 37.20 4.00
4763 5992 4.872124 GGTTTCTTGATGATTTTCATGGGC 59.128 41.667 0.00 0.00 37.20 5.36
4764 5993 4.374843 TTCTTGATGATTTTCATGGGCG 57.625 40.909 0.00 0.00 37.20 6.13
4765 5994 2.099592 TCTTGATGATTTTCATGGGCGC 59.900 45.455 0.00 0.00 37.20 6.53
4766 5995 1.766494 TGATGATTTTCATGGGCGCT 58.234 45.000 7.64 0.00 37.20 5.92
4767 5996 1.406180 TGATGATTTTCATGGGCGCTG 59.594 47.619 7.64 0.00 37.20 5.18
4768 5997 1.677576 GATGATTTTCATGGGCGCTGA 59.322 47.619 7.64 0.00 37.20 4.26
4769 5998 1.543607 TGATTTTCATGGGCGCTGAA 58.456 45.000 7.64 6.95 0.00 3.02
4770 5999 1.202114 TGATTTTCATGGGCGCTGAAC 59.798 47.619 7.64 0.00 32.57 3.18
4771 6000 1.474077 GATTTTCATGGGCGCTGAACT 59.526 47.619 7.64 0.00 32.57 3.01
4772 6001 2.192664 TTTTCATGGGCGCTGAACTA 57.807 45.000 7.64 0.00 32.57 2.24
4773 6002 2.418368 TTTCATGGGCGCTGAACTAT 57.582 45.000 7.64 0.00 32.57 2.12
4774 6003 2.418368 TTCATGGGCGCTGAACTATT 57.582 45.000 7.64 0.00 0.00 1.73
4775 6004 2.418368 TCATGGGCGCTGAACTATTT 57.582 45.000 7.64 0.00 0.00 1.40
4776 6005 3.552132 TCATGGGCGCTGAACTATTTA 57.448 42.857 7.64 0.00 0.00 1.40
4777 6006 3.202906 TCATGGGCGCTGAACTATTTAC 58.797 45.455 7.64 0.00 0.00 2.01
4778 6007 2.032680 TGGGCGCTGAACTATTTACC 57.967 50.000 7.64 0.00 0.00 2.85
4779 6008 1.279558 TGGGCGCTGAACTATTTACCA 59.720 47.619 7.64 0.00 0.00 3.25
4780 6009 1.940613 GGGCGCTGAACTATTTACCAG 59.059 52.381 7.64 0.00 0.00 4.00
4781 6010 2.629051 GGCGCTGAACTATTTACCAGT 58.371 47.619 7.64 0.00 0.00 4.00
4782 6011 2.351726 GGCGCTGAACTATTTACCAGTG 59.648 50.000 7.64 0.00 39.40 3.66
4783 6012 3.000727 GCGCTGAACTATTTACCAGTGT 58.999 45.455 0.00 0.00 38.84 3.55
4784 6013 3.181520 GCGCTGAACTATTTACCAGTGTG 60.182 47.826 0.00 0.00 38.84 3.82
4785 6014 3.181520 CGCTGAACTATTTACCAGTGTGC 60.182 47.826 0.00 0.00 33.78 4.57
4786 6015 3.127030 GCTGAACTATTTACCAGTGTGCC 59.873 47.826 0.00 0.00 0.00 5.01
4787 6016 4.579869 CTGAACTATTTACCAGTGTGCCT 58.420 43.478 0.00 0.00 0.00 4.75
4788 6017 4.323417 TGAACTATTTACCAGTGTGCCTG 58.677 43.478 0.00 0.00 41.15 4.85
4789 6018 2.711542 ACTATTTACCAGTGTGCCTGC 58.288 47.619 0.00 0.00 40.06 4.85
4790 6019 2.305927 ACTATTTACCAGTGTGCCTGCT 59.694 45.455 0.00 0.00 40.06 4.24
4791 6020 1.538047 ATTTACCAGTGTGCCTGCTG 58.462 50.000 0.00 0.00 40.06 4.41
4792 6021 0.182537 TTTACCAGTGTGCCTGCTGT 59.817 50.000 0.00 0.00 40.06 4.40
4793 6022 1.052617 TTACCAGTGTGCCTGCTGTA 58.947 50.000 0.00 0.00 40.06 2.74
4794 6023 1.052617 TACCAGTGTGCCTGCTGTAA 58.947 50.000 0.00 0.00 40.06 2.41
4795 6024 0.401738 ACCAGTGTGCCTGCTGTAAT 59.598 50.000 0.00 0.00 40.06 1.89
4796 6025 1.202927 ACCAGTGTGCCTGCTGTAATT 60.203 47.619 0.00 0.00 40.06 1.40
4797 6026 1.888512 CCAGTGTGCCTGCTGTAATTT 59.111 47.619 0.00 0.00 40.06 1.82
4798 6027 2.297033 CCAGTGTGCCTGCTGTAATTTT 59.703 45.455 0.00 0.00 40.06 1.82
4799 6028 3.505680 CCAGTGTGCCTGCTGTAATTTTA 59.494 43.478 0.00 0.00 40.06 1.52
4800 6029 4.022416 CCAGTGTGCCTGCTGTAATTTTAA 60.022 41.667 0.00 0.00 40.06 1.52
4801 6030 5.336690 CCAGTGTGCCTGCTGTAATTTTAAT 60.337 40.000 0.00 0.00 40.06 1.40
4802 6031 6.127758 CCAGTGTGCCTGCTGTAATTTTAATA 60.128 38.462 0.00 0.00 40.06 0.98
4803 6032 7.312154 CAGTGTGCCTGCTGTAATTTTAATAA 58.688 34.615 0.00 0.00 33.59 1.40
4804 6033 7.273381 CAGTGTGCCTGCTGTAATTTTAATAAC 59.727 37.037 0.00 0.00 33.59 1.89
4805 6034 7.040062 AGTGTGCCTGCTGTAATTTTAATAACA 60.040 33.333 0.00 0.00 0.00 2.41
4806 6035 7.759433 GTGTGCCTGCTGTAATTTTAATAACAT 59.241 33.333 0.00 0.00 0.00 2.71
4807 6036 8.310382 TGTGCCTGCTGTAATTTTAATAACATT 58.690 29.630 0.00 0.00 0.00 2.71
4808 6037 8.594687 GTGCCTGCTGTAATTTTAATAACATTG 58.405 33.333 0.00 0.00 0.00 2.82
4809 6038 8.310382 TGCCTGCTGTAATTTTAATAACATTGT 58.690 29.630 0.00 0.00 0.00 2.71
4810 6039 9.150348 GCCTGCTGTAATTTTAATAACATTGTT 57.850 29.630 7.30 7.30 0.00 2.83
4823 6052 4.816786 AACATTGTTTCAAATGCCAAGC 57.183 36.364 0.00 0.00 40.54 4.01
4824 6053 3.140623 ACATTGTTTCAAATGCCAAGCC 58.859 40.909 0.00 0.00 40.54 4.35
4825 6054 2.996249 TTGTTTCAAATGCCAAGCCA 57.004 40.000 0.00 0.00 0.00 4.75
4826 6055 2.996249 TGTTTCAAATGCCAAGCCAA 57.004 40.000 0.00 0.00 0.00 4.52
4827 6056 3.272574 TGTTTCAAATGCCAAGCCAAA 57.727 38.095 0.00 0.00 0.00 3.28
4828 6057 3.818180 TGTTTCAAATGCCAAGCCAAAT 58.182 36.364 0.00 0.00 0.00 2.32
4829 6058 4.205587 TGTTTCAAATGCCAAGCCAAATT 58.794 34.783 0.00 0.00 0.00 1.82
4830 6059 4.643784 TGTTTCAAATGCCAAGCCAAATTT 59.356 33.333 0.00 0.00 0.00 1.82
4831 6060 5.824624 TGTTTCAAATGCCAAGCCAAATTTA 59.175 32.000 0.00 0.00 0.00 1.40
4832 6061 6.489361 TGTTTCAAATGCCAAGCCAAATTTAT 59.511 30.769 0.00 0.00 0.00 1.40
4833 6062 6.497785 TTCAAATGCCAAGCCAAATTTATG 57.502 33.333 0.00 0.00 0.00 1.90
4834 6063 4.942483 TCAAATGCCAAGCCAAATTTATGG 59.058 37.500 0.00 0.00 43.70 2.74
4844 6073 4.670896 CCAAATTTATGGCTCCGGATTT 57.329 40.909 3.57 0.00 32.78 2.17
4845 6074 5.022282 CCAAATTTATGGCTCCGGATTTT 57.978 39.130 3.57 0.00 32.78 1.82
4846 6075 5.427378 CCAAATTTATGGCTCCGGATTTTT 58.573 37.500 3.57 0.00 32.78 1.94
4847 6076 5.523552 CCAAATTTATGGCTCCGGATTTTTC 59.476 40.000 3.57 0.00 32.78 2.29
4848 6077 6.340522 CAAATTTATGGCTCCGGATTTTTCT 58.659 36.000 3.57 0.00 0.00 2.52
4849 6078 6.544928 AATTTATGGCTCCGGATTTTTCTT 57.455 33.333 3.57 0.00 0.00 2.52
4850 6079 5.993748 TTTATGGCTCCGGATTTTTCTTT 57.006 34.783 3.57 0.00 0.00 2.52
4851 6080 5.576447 TTATGGCTCCGGATTTTTCTTTC 57.424 39.130 3.57 0.00 0.00 2.62
4852 6081 1.810151 TGGCTCCGGATTTTTCTTTCG 59.190 47.619 3.57 0.00 0.00 3.46
4853 6082 1.810755 GGCTCCGGATTTTTCTTTCGT 59.189 47.619 3.57 0.00 0.00 3.85
4854 6083 3.004862 GGCTCCGGATTTTTCTTTCGTA 58.995 45.455 3.57 0.00 0.00 3.43
4855 6084 3.626217 GGCTCCGGATTTTTCTTTCGTAT 59.374 43.478 3.57 0.00 0.00 3.06
4856 6085 4.495844 GGCTCCGGATTTTTCTTTCGTATG 60.496 45.833 3.57 0.00 0.00 2.39
4857 6086 4.588278 CTCCGGATTTTTCTTTCGTATGC 58.412 43.478 3.57 0.00 0.00 3.14
4858 6087 4.004314 TCCGGATTTTTCTTTCGTATGCA 58.996 39.130 0.00 0.00 0.00 3.96
4859 6088 4.638421 TCCGGATTTTTCTTTCGTATGCAT 59.362 37.500 0.00 3.79 0.00 3.96
4860 6089 5.124776 TCCGGATTTTTCTTTCGTATGCATT 59.875 36.000 3.54 0.00 0.00 3.56
4861 6090 6.316640 TCCGGATTTTTCTTTCGTATGCATTA 59.683 34.615 3.54 0.00 0.00 1.90
4862 6091 6.970043 CCGGATTTTTCTTTCGTATGCATTAA 59.030 34.615 3.54 0.00 0.00 1.40
4863 6092 7.486551 CCGGATTTTTCTTTCGTATGCATTAAA 59.513 33.333 3.54 3.00 0.00 1.52
4864 6093 8.311120 CGGATTTTTCTTTCGTATGCATTAAAC 58.689 33.333 3.54 0.00 0.00 2.01
4865 6094 9.353999 GGATTTTTCTTTCGTATGCATTAAACT 57.646 29.630 3.54 0.00 0.00 2.66
4867 6096 7.561237 TTTTCTTTCGTATGCATTAAACTGC 57.439 32.000 3.54 0.00 42.62 4.40
4868 6097 5.229921 TCTTTCGTATGCATTAAACTGCC 57.770 39.130 3.54 0.00 41.58 4.85
4869 6098 4.697828 TCTTTCGTATGCATTAAACTGCCA 59.302 37.500 3.54 0.00 41.58 4.92
4870 6099 4.349663 TTCGTATGCATTAAACTGCCAC 57.650 40.909 3.54 0.00 41.58 5.01
4871 6100 3.605634 TCGTATGCATTAAACTGCCACT 58.394 40.909 3.54 0.00 41.58 4.00
4872 6101 4.760878 TCGTATGCATTAAACTGCCACTA 58.239 39.130 3.54 0.00 41.58 2.74
4873 6102 4.808895 TCGTATGCATTAAACTGCCACTAG 59.191 41.667 3.54 0.00 41.58 2.57
4874 6103 4.570772 CGTATGCATTAAACTGCCACTAGT 59.429 41.667 3.54 0.00 41.58 2.57
4875 6104 5.064707 CGTATGCATTAAACTGCCACTAGTT 59.935 40.000 3.54 0.00 42.43 2.24
4877 6106 5.119931 TGCATTAAACTGCCACTAGTTTG 57.880 39.130 12.65 0.64 46.98 2.93
4878 6107 4.022416 TGCATTAAACTGCCACTAGTTTGG 60.022 41.667 12.65 0.00 46.98 3.28
4879 6108 4.618227 GCATTAAACTGCCACTAGTTTGGG 60.618 45.833 12.65 0.00 46.98 4.12
4880 6109 2.748209 AAACTGCCACTAGTTTGGGT 57.252 45.000 0.00 0.00 46.15 4.51
4881 6110 2.748209 AACTGCCACTAGTTTGGGTT 57.252 45.000 0.00 0.00 37.62 4.11
4882 6111 3.868619 AACTGCCACTAGTTTGGGTTA 57.131 42.857 0.00 0.00 37.62 2.85
4883 6112 4.382386 AACTGCCACTAGTTTGGGTTAT 57.618 40.909 0.00 0.00 37.62 1.89
4884 6113 5.508280 AACTGCCACTAGTTTGGGTTATA 57.492 39.130 0.00 0.00 37.62 0.98
4885 6114 4.840271 ACTGCCACTAGTTTGGGTTATAC 58.160 43.478 0.00 0.00 37.10 1.47
4886 6115 4.534897 ACTGCCACTAGTTTGGGTTATACT 59.465 41.667 0.00 0.00 37.10 2.12
4887 6116 5.722923 ACTGCCACTAGTTTGGGTTATACTA 59.277 40.000 0.00 0.00 37.10 1.82
4888 6117 6.386050 ACTGCCACTAGTTTGGGTTATACTAT 59.614 38.462 0.00 0.00 37.10 2.12
4889 6118 7.092578 ACTGCCACTAGTTTGGGTTATACTATT 60.093 37.037 0.00 0.00 37.10 1.73
4890 6119 7.635648 TGCCACTAGTTTGGGTTATACTATTT 58.364 34.615 0.00 0.00 37.10 1.40
4891 6120 7.554835 TGCCACTAGTTTGGGTTATACTATTTG 59.445 37.037 0.00 0.00 37.10 2.32
4892 6121 7.555195 GCCACTAGTTTGGGTTATACTATTTGT 59.445 37.037 0.00 0.00 37.10 2.83
4893 6122 8.889717 CCACTAGTTTGGGTTATACTATTTGTG 58.110 37.037 0.00 0.00 32.35 3.33
4894 6123 9.661563 CACTAGTTTGGGTTATACTATTTGTGA 57.338 33.333 0.00 0.00 0.00 3.58
4895 6124 9.886132 ACTAGTTTGGGTTATACTATTTGTGAG 57.114 33.333 0.00 0.00 0.00 3.51
4896 6125 9.886132 CTAGTTTGGGTTATACTATTTGTGAGT 57.114 33.333 0.00 0.00 0.00 3.41
4897 6126 8.561738 AGTTTGGGTTATACTATTTGTGAGTG 57.438 34.615 0.00 0.00 0.00 3.51
4898 6127 8.380099 AGTTTGGGTTATACTATTTGTGAGTGA 58.620 33.333 0.00 0.00 0.00 3.41
4899 6128 9.005777 GTTTGGGTTATACTATTTGTGAGTGAA 57.994 33.333 0.00 0.00 0.00 3.18
4900 6129 9.575868 TTTGGGTTATACTATTTGTGAGTGAAA 57.424 29.630 0.00 0.00 0.00 2.69
4901 6130 9.747898 TTGGGTTATACTATTTGTGAGTGAAAT 57.252 29.630 0.00 0.00 0.00 2.17
4902 6131 9.173021 TGGGTTATACTATTTGTGAGTGAAATG 57.827 33.333 0.00 0.00 0.00 2.32
4903 6132 8.621286 GGGTTATACTATTTGTGAGTGAAATGG 58.379 37.037 0.00 0.00 0.00 3.16
4904 6133 9.391006 GGTTATACTATTTGTGAGTGAAATGGA 57.609 33.333 0.00 0.00 0.00 3.41
4907 6136 6.764308 ACTATTTGTGAGTGAAATGGATGG 57.236 37.500 0.00 0.00 0.00 3.51
4908 6137 6.248433 ACTATTTGTGAGTGAAATGGATGGT 58.752 36.000 0.00 0.00 0.00 3.55
4909 6138 6.721208 ACTATTTGTGAGTGAAATGGATGGTT 59.279 34.615 0.00 0.00 0.00 3.67
4910 6139 5.867903 TTTGTGAGTGAAATGGATGGTTT 57.132 34.783 0.00 0.00 0.00 3.27
4911 6140 4.852134 TGTGAGTGAAATGGATGGTTTG 57.148 40.909 0.00 0.00 0.00 2.93
4912 6141 4.214310 TGTGAGTGAAATGGATGGTTTGT 58.786 39.130 0.00 0.00 0.00 2.83
4913 6142 4.037803 TGTGAGTGAAATGGATGGTTTGTG 59.962 41.667 0.00 0.00 0.00 3.33
4914 6143 4.278170 GTGAGTGAAATGGATGGTTTGTGA 59.722 41.667 0.00 0.00 0.00 3.58
4915 6144 5.047802 GTGAGTGAAATGGATGGTTTGTGAT 60.048 40.000 0.00 0.00 0.00 3.06
4916 6145 5.047872 TGAGTGAAATGGATGGTTTGTGATG 60.048 40.000 0.00 0.00 0.00 3.07
4917 6146 5.078949 AGTGAAATGGATGGTTTGTGATGA 58.921 37.500 0.00 0.00 0.00 2.92
4918 6147 5.718130 AGTGAAATGGATGGTTTGTGATGAT 59.282 36.000 0.00 0.00 0.00 2.45
4919 6148 6.891361 AGTGAAATGGATGGTTTGTGATGATA 59.109 34.615 0.00 0.00 0.00 2.15
4920 6149 6.974622 GTGAAATGGATGGTTTGTGATGATAC 59.025 38.462 0.00 0.00 0.00 2.24
4921 6150 6.096705 TGAAATGGATGGTTTGTGATGATACC 59.903 38.462 0.00 0.00 0.00 2.73
4922 6151 4.582973 TGGATGGTTTGTGATGATACCA 57.417 40.909 0.00 0.00 44.17 3.25
4923 6152 4.928263 TGGATGGTTTGTGATGATACCAA 58.072 39.130 0.00 0.00 43.35 3.67
4924 6153 4.949238 TGGATGGTTTGTGATGATACCAAG 59.051 41.667 0.00 0.00 43.35 3.61
4925 6154 4.949856 GGATGGTTTGTGATGATACCAAGT 59.050 41.667 0.00 0.00 43.35 3.16
4926 6155 5.163622 GGATGGTTTGTGATGATACCAAGTG 60.164 44.000 0.00 0.00 43.35 3.16
4927 6156 4.078537 TGGTTTGTGATGATACCAAGTGG 58.921 43.478 0.00 0.00 37.71 4.00
4928 6157 4.202514 TGGTTTGTGATGATACCAAGTGGA 60.203 41.667 3.83 0.00 37.71 4.02
4929 6158 4.396166 GGTTTGTGATGATACCAAGTGGAG 59.604 45.833 3.83 0.00 38.94 3.86
4930 6159 5.245531 GTTTGTGATGATACCAAGTGGAGA 58.754 41.667 3.83 0.00 38.94 3.71
4931 6160 5.698741 TTGTGATGATACCAAGTGGAGAT 57.301 39.130 3.83 0.00 38.94 2.75
4932 6161 5.698741 TGTGATGATACCAAGTGGAGATT 57.301 39.130 3.83 0.00 38.94 2.40
4933 6162 5.430886 TGTGATGATACCAAGTGGAGATTG 58.569 41.667 3.83 0.00 38.94 2.67
4934 6163 5.189539 TGTGATGATACCAAGTGGAGATTGA 59.810 40.000 3.83 0.00 38.94 2.57
4935 6164 5.525378 GTGATGATACCAAGTGGAGATTGAC 59.475 44.000 3.83 0.00 38.94 3.18
4936 6165 5.426509 TGATGATACCAAGTGGAGATTGACT 59.573 40.000 3.83 0.00 38.94 3.41
4937 6166 5.762179 TGATACCAAGTGGAGATTGACTT 57.238 39.130 3.83 0.00 38.94 3.01
4938 6167 5.491070 TGATACCAAGTGGAGATTGACTTG 58.509 41.667 3.83 0.00 45.79 3.16
4939 6168 3.864789 ACCAAGTGGAGATTGACTTGT 57.135 42.857 3.83 0.00 45.09 3.16
4940 6169 4.974645 ACCAAGTGGAGATTGACTTGTA 57.025 40.909 3.83 0.00 45.09 2.41
4941 6170 4.899502 ACCAAGTGGAGATTGACTTGTAG 58.100 43.478 3.83 0.00 45.09 2.74
4942 6171 4.348168 ACCAAGTGGAGATTGACTTGTAGT 59.652 41.667 3.83 0.00 45.09 2.73
4943 6172 5.542635 ACCAAGTGGAGATTGACTTGTAGTA 59.457 40.000 3.83 0.00 45.09 1.82
4944 6173 6.042781 ACCAAGTGGAGATTGACTTGTAGTAA 59.957 38.462 3.83 0.00 45.09 2.24
4945 6174 6.369065 CCAAGTGGAGATTGACTTGTAGTAAC 59.631 42.308 0.00 0.00 45.09 2.50
4946 6175 5.710984 AGTGGAGATTGACTTGTAGTAACG 58.289 41.667 0.00 0.00 0.00 3.18
4947 6176 5.243283 AGTGGAGATTGACTTGTAGTAACGT 59.757 40.000 0.00 0.00 0.00 3.99
4948 6177 5.924825 GTGGAGATTGACTTGTAGTAACGTT 59.075 40.000 5.88 5.88 0.00 3.99
4949 6178 5.924254 TGGAGATTGACTTGTAGTAACGTTG 59.076 40.000 11.99 0.00 0.00 4.10
4950 6179 5.347907 GGAGATTGACTTGTAGTAACGTTGG 59.652 44.000 11.99 0.00 0.00 3.77
4951 6180 6.092955 AGATTGACTTGTAGTAACGTTGGA 57.907 37.500 11.99 0.00 0.00 3.53
4952 6181 6.518493 AGATTGACTTGTAGTAACGTTGGAA 58.482 36.000 11.99 0.00 0.00 3.53
4953 6182 6.645415 AGATTGACTTGTAGTAACGTTGGAAG 59.355 38.462 11.99 7.86 0.00 3.46
4954 6183 5.266733 TGACTTGTAGTAACGTTGGAAGT 57.733 39.130 11.99 10.85 0.00 3.01
4955 6184 5.663456 TGACTTGTAGTAACGTTGGAAGTT 58.337 37.500 11.99 0.00 35.75 2.66
4956 6185 5.521010 TGACTTGTAGTAACGTTGGAAGTTG 59.479 40.000 11.99 0.00 33.42 3.16
4957 6186 5.663456 ACTTGTAGTAACGTTGGAAGTTGA 58.337 37.500 11.99 0.00 33.42 3.18
4958 6187 6.285990 ACTTGTAGTAACGTTGGAAGTTGAT 58.714 36.000 11.99 0.00 33.42 2.57
4959 6188 6.764560 ACTTGTAGTAACGTTGGAAGTTGATT 59.235 34.615 11.99 0.00 33.42 2.57
4960 6189 7.927629 ACTTGTAGTAACGTTGGAAGTTGATTA 59.072 33.333 11.99 0.00 33.42 1.75
4961 6190 8.659925 TTGTAGTAACGTTGGAAGTTGATTAA 57.340 30.769 11.99 0.00 33.42 1.40
4962 6191 8.301730 TGTAGTAACGTTGGAAGTTGATTAAG 57.698 34.615 11.99 0.00 33.42 1.85
4963 6192 6.237313 AGTAACGTTGGAAGTTGATTAAGC 57.763 37.500 11.99 0.00 33.42 3.09
4964 6193 5.995897 AGTAACGTTGGAAGTTGATTAAGCT 59.004 36.000 11.99 0.00 33.42 3.74
4965 6194 7.156673 AGTAACGTTGGAAGTTGATTAAGCTA 58.843 34.615 11.99 0.00 33.42 3.32
4966 6195 7.822822 AGTAACGTTGGAAGTTGATTAAGCTAT 59.177 33.333 11.99 0.00 33.42 2.97
4967 6196 6.422776 ACGTTGGAAGTTGATTAAGCTATG 57.577 37.500 0.00 0.00 0.00 2.23
4968 6197 5.938125 ACGTTGGAAGTTGATTAAGCTATGT 59.062 36.000 0.00 0.00 0.00 2.29
4969 6198 7.101054 ACGTTGGAAGTTGATTAAGCTATGTA 58.899 34.615 0.00 0.00 0.00 2.29
4970 6199 7.769044 ACGTTGGAAGTTGATTAAGCTATGTAT 59.231 33.333 0.00 0.00 0.00 2.29
4971 6200 8.612619 CGTTGGAAGTTGATTAAGCTATGTATT 58.387 33.333 0.00 0.00 0.00 1.89
4986 6215 8.567285 AGCTATGTATTATTATTTCAGGGTGC 57.433 34.615 0.00 0.00 0.00 5.01
4987 6216 8.386264 AGCTATGTATTATTATTTCAGGGTGCT 58.614 33.333 0.00 0.00 0.00 4.40
4988 6217 9.667107 GCTATGTATTATTATTTCAGGGTGCTA 57.333 33.333 0.00 0.00 0.00 3.49
4996 6225 7.750229 ATTATTTCAGGGTGCTATGTATGTG 57.250 36.000 0.00 0.00 0.00 3.21
4997 6226 4.835284 TTTCAGGGTGCTATGTATGTGA 57.165 40.909 0.00 0.00 0.00 3.58
4998 6227 4.406648 TTCAGGGTGCTATGTATGTGAG 57.593 45.455 0.00 0.00 0.00 3.51
4999 6228 2.700371 TCAGGGTGCTATGTATGTGAGG 59.300 50.000 0.00 0.00 0.00 3.86
5000 6229 2.050144 AGGGTGCTATGTATGTGAGGG 58.950 52.381 0.00 0.00 0.00 4.30
5001 6230 2.047061 GGGTGCTATGTATGTGAGGGA 58.953 52.381 0.00 0.00 0.00 4.20
5002 6231 2.438021 GGGTGCTATGTATGTGAGGGAA 59.562 50.000 0.00 0.00 0.00 3.97
5003 6232 3.467803 GGTGCTATGTATGTGAGGGAAC 58.532 50.000 0.00 0.00 0.00 3.62
5005 6234 4.122776 GTGCTATGTATGTGAGGGAACTG 58.877 47.826 0.00 0.00 44.43 3.16
5006 6235 4.030216 TGCTATGTATGTGAGGGAACTGA 58.970 43.478 0.00 0.00 44.43 3.41
5007 6236 4.469586 TGCTATGTATGTGAGGGAACTGAA 59.530 41.667 0.00 0.00 44.43 3.02
5008 6237 5.130975 TGCTATGTATGTGAGGGAACTGAAT 59.869 40.000 0.00 0.00 44.43 2.57
5009 6238 6.326323 TGCTATGTATGTGAGGGAACTGAATA 59.674 38.462 0.00 0.00 44.43 1.75
5010 6239 7.147567 TGCTATGTATGTGAGGGAACTGAATAA 60.148 37.037 0.00 0.00 44.43 1.40
5011 6240 7.880195 GCTATGTATGTGAGGGAACTGAATAAT 59.120 37.037 0.00 0.00 44.43 1.28
5012 6241 9.212641 CTATGTATGTGAGGGAACTGAATAATG 57.787 37.037 0.00 0.00 44.43 1.90
5013 6242 6.957631 TGTATGTGAGGGAACTGAATAATGT 58.042 36.000 0.00 0.00 44.43 2.71
5014 6243 6.823182 TGTATGTGAGGGAACTGAATAATGTG 59.177 38.462 0.00 0.00 44.43 3.21
5015 6244 4.009675 TGTGAGGGAACTGAATAATGTGC 58.990 43.478 0.00 0.00 44.43 4.57
5016 6245 4.263462 TGTGAGGGAACTGAATAATGTGCT 60.263 41.667 0.00 0.00 44.43 4.40
5017 6246 4.333926 GTGAGGGAACTGAATAATGTGCTC 59.666 45.833 0.00 0.00 44.43 4.26
5018 6247 4.225942 TGAGGGAACTGAATAATGTGCTCT 59.774 41.667 0.00 0.00 44.43 4.09
5019 6248 4.775236 AGGGAACTGAATAATGTGCTCTC 58.225 43.478 0.00 0.00 41.13 3.20
5020 6249 4.472833 AGGGAACTGAATAATGTGCTCTCT 59.527 41.667 0.00 0.00 41.13 3.10
5021 6250 5.045286 AGGGAACTGAATAATGTGCTCTCTT 60.045 40.000 0.00 0.00 41.13 2.85
5022 6251 5.065731 GGGAACTGAATAATGTGCTCTCTTG 59.934 44.000 0.00 0.00 0.00 3.02
5023 6252 5.645497 GGAACTGAATAATGTGCTCTCTTGT 59.355 40.000 0.00 0.00 0.00 3.16
5024 6253 6.150140 GGAACTGAATAATGTGCTCTCTTGTT 59.850 38.462 0.00 0.00 0.00 2.83
5025 6254 7.308830 GGAACTGAATAATGTGCTCTCTTGTTT 60.309 37.037 0.00 0.00 0.00 2.83
5026 6255 8.621532 AACTGAATAATGTGCTCTCTTGTTTA 57.378 30.769 0.00 0.00 0.00 2.01
5027 6256 8.798859 ACTGAATAATGTGCTCTCTTGTTTAT 57.201 30.769 0.00 0.00 0.00 1.40
5028 6257 8.671921 ACTGAATAATGTGCTCTCTTGTTTATG 58.328 33.333 0.00 0.00 0.00 1.90
5029 6258 8.565896 TGAATAATGTGCTCTCTTGTTTATGT 57.434 30.769 0.00 0.00 0.00 2.29
5030 6259 9.013229 TGAATAATGTGCTCTCTTGTTTATGTT 57.987 29.630 0.00 0.00 0.00 2.71
5031 6260 9.495754 GAATAATGTGCTCTCTTGTTTATGTTC 57.504 33.333 0.00 0.00 0.00 3.18
5032 6261 8.798859 ATAATGTGCTCTCTTGTTTATGTTCT 57.201 30.769 0.00 0.00 0.00 3.01
5033 6262 7.516198 AATGTGCTCTCTTGTTTATGTTCTT 57.484 32.000 0.00 0.00 0.00 2.52
5034 6263 8.621532 AATGTGCTCTCTTGTTTATGTTCTTA 57.378 30.769 0.00 0.00 0.00 2.10
5035 6264 8.798859 ATGTGCTCTCTTGTTTATGTTCTTAT 57.201 30.769 0.00 0.00 0.00 1.73
5036 6265 8.032952 TGTGCTCTCTTGTTTATGTTCTTATG 57.967 34.615 0.00 0.00 0.00 1.90
5037 6266 7.877612 TGTGCTCTCTTGTTTATGTTCTTATGA 59.122 33.333 0.00 0.00 0.00 2.15
5038 6267 8.386606 GTGCTCTCTTGTTTATGTTCTTATGAG 58.613 37.037 0.00 0.00 0.00 2.90
5039 6268 8.314021 TGCTCTCTTGTTTATGTTCTTATGAGA 58.686 33.333 0.00 0.00 0.00 3.27
5040 6269 9.323985 GCTCTCTTGTTTATGTTCTTATGAGAT 57.676 33.333 0.00 0.00 0.00 2.75
5072 6301 9.565090 TCCTGATATATGGCAATATTATCAAGC 57.435 33.333 0.00 0.00 31.27 4.01
5073 6302 9.346005 CCTGATATATGGCAATATTATCAAGCA 57.654 33.333 0.00 0.00 31.27 3.91
5080 6309 8.611654 ATGGCAATATTATCAAGCAATTTTCC 57.388 30.769 0.00 0.00 0.00 3.13
5081 6310 7.563020 TGGCAATATTATCAAGCAATTTTCCA 58.437 30.769 0.00 0.00 0.00 3.53
5082 6311 8.045507 TGGCAATATTATCAAGCAATTTTCCAA 58.954 29.630 0.00 0.00 0.00 3.53
5083 6312 9.059260 GGCAATATTATCAAGCAATTTTCCAAT 57.941 29.630 0.00 0.00 0.00 3.16
5087 6316 9.991906 ATATTATCAAGCAATTTTCCAATCCAG 57.008 29.630 0.00 0.00 0.00 3.86
5088 6317 7.479352 TTATCAAGCAATTTTCCAATCCAGA 57.521 32.000 0.00 0.00 0.00 3.86
5089 6318 6.555463 ATCAAGCAATTTTCCAATCCAGAT 57.445 33.333 0.00 0.00 0.00 2.90
5090 6319 5.726397 TCAAGCAATTTTCCAATCCAGATG 58.274 37.500 0.00 0.00 0.00 2.90
5091 6320 5.246656 TCAAGCAATTTTCCAATCCAGATGT 59.753 36.000 0.00 0.00 0.00 3.06
5092 6321 5.080969 AGCAATTTTCCAATCCAGATGTG 57.919 39.130 0.00 0.00 0.00 3.21
5093 6322 4.773674 AGCAATTTTCCAATCCAGATGTGA 59.226 37.500 0.00 0.00 0.00 3.58
5094 6323 5.424252 AGCAATTTTCCAATCCAGATGTGAT 59.576 36.000 0.00 0.00 0.00 3.06
5095 6324 5.522460 GCAATTTTCCAATCCAGATGTGATG 59.478 40.000 0.00 0.00 0.00 3.07
5096 6325 5.864418 ATTTTCCAATCCAGATGTGATGG 57.136 39.130 0.00 0.00 39.33 3.51
5101 6330 3.692424 TCCAGATGTGATGGATGCG 57.308 52.632 0.00 0.00 41.96 4.73
5102 6331 0.832626 TCCAGATGTGATGGATGCGT 59.167 50.000 0.00 0.00 41.96 5.24
5103 6332 0.942252 CCAGATGTGATGGATGCGTG 59.058 55.000 0.00 0.00 40.51 5.34
5104 6333 0.306840 CAGATGTGATGGATGCGTGC 59.693 55.000 0.00 0.00 0.00 5.34
5105 6334 0.107557 AGATGTGATGGATGCGTGCA 60.108 50.000 1.39 1.39 0.00 4.57
5106 6335 0.949397 GATGTGATGGATGCGTGCAT 59.051 50.000 13.30 13.30 39.30 3.96
5107 6336 1.335810 GATGTGATGGATGCGTGCATT 59.664 47.619 14.62 0.00 36.44 3.56
5108 6337 1.175654 TGTGATGGATGCGTGCATTT 58.824 45.000 14.62 0.00 36.44 2.32
5109 6338 2.363683 TGTGATGGATGCGTGCATTTA 58.636 42.857 14.62 4.43 36.44 1.40
5110 6339 2.751806 TGTGATGGATGCGTGCATTTAA 59.248 40.909 14.62 1.13 36.44 1.52
5111 6340 3.108144 GTGATGGATGCGTGCATTTAAC 58.892 45.455 14.62 9.67 36.44 2.01
5112 6341 3.016031 TGATGGATGCGTGCATTTAACT 58.984 40.909 14.62 0.00 36.44 2.24
5113 6342 2.917701 TGGATGCGTGCATTTAACTG 57.082 45.000 8.98 0.00 36.70 3.16
5114 6343 2.158559 TGGATGCGTGCATTTAACTGT 58.841 42.857 8.98 0.00 36.70 3.55
5115 6344 2.556189 TGGATGCGTGCATTTAACTGTT 59.444 40.909 8.98 0.00 36.70 3.16
5116 6345 3.753797 TGGATGCGTGCATTTAACTGTTA 59.246 39.130 8.98 0.00 36.70 2.41
5117 6346 4.397730 TGGATGCGTGCATTTAACTGTTAT 59.602 37.500 8.98 0.00 36.70 1.89
5118 6347 5.105957 TGGATGCGTGCATTTAACTGTTATT 60.106 36.000 8.98 0.00 36.70 1.40
5119 6348 5.804979 GGATGCGTGCATTTAACTGTTATTT 59.195 36.000 8.98 0.00 36.70 1.40
5120 6349 6.310224 GGATGCGTGCATTTAACTGTTATTTT 59.690 34.615 8.98 0.00 36.70 1.82
5121 6350 6.683090 TGCGTGCATTTAACTGTTATTTTC 57.317 33.333 0.37 0.00 0.00 2.29
5122 6351 6.209361 TGCGTGCATTTAACTGTTATTTTCA 58.791 32.000 0.37 0.00 0.00 2.69
5123 6352 6.362016 TGCGTGCATTTAACTGTTATTTTCAG 59.638 34.615 0.37 0.00 38.68 3.02
5124 6353 6.183359 GCGTGCATTTAACTGTTATTTTCAGG 60.183 38.462 0.37 5.30 37.25 3.86
5125 6354 6.861055 CGTGCATTTAACTGTTATTTTCAGGT 59.139 34.615 0.37 0.00 37.25 4.00
5126 6355 7.381139 CGTGCATTTAACTGTTATTTTCAGGTT 59.619 33.333 0.37 0.00 37.25 3.50
5127 6356 9.040939 GTGCATTTAACTGTTATTTTCAGGTTT 57.959 29.630 0.37 0.00 37.25 3.27
5128 6357 9.039870 TGCATTTAACTGTTATTTTCAGGTTTG 57.960 29.630 0.37 0.00 37.25 2.93
5129 6358 8.009409 GCATTTAACTGTTATTTTCAGGTTTGC 58.991 33.333 0.37 0.00 37.25 3.68
5130 6359 7.687005 TTTAACTGTTATTTTCAGGTTTGCG 57.313 32.000 0.37 0.00 37.25 4.85
5131 6360 4.911514 ACTGTTATTTTCAGGTTTGCGT 57.088 36.364 0.00 0.00 37.25 5.24
5132 6361 4.606961 ACTGTTATTTTCAGGTTTGCGTG 58.393 39.130 0.00 0.00 37.25 5.34
5133 6362 4.336993 ACTGTTATTTTCAGGTTTGCGTGA 59.663 37.500 0.00 0.00 37.68 4.35
5134 6363 4.854399 TGTTATTTTCAGGTTTGCGTGAG 58.146 39.130 0.00 0.00 40.10 3.51
5135 6364 4.226761 GTTATTTTCAGGTTTGCGTGAGG 58.773 43.478 0.00 0.00 40.10 3.86
5136 6365 0.383949 TTTTCAGGTTTGCGTGAGGC 59.616 50.000 0.00 0.00 40.10 4.70
5137 6366 0.465460 TTTCAGGTTTGCGTGAGGCT 60.465 50.000 0.00 0.00 44.05 4.58
5138 6367 0.465460 TTCAGGTTTGCGTGAGGCTT 60.465 50.000 0.00 0.00 44.05 4.35
5139 6368 0.465460 TCAGGTTTGCGTGAGGCTTT 60.465 50.000 0.00 0.00 44.05 3.51
5140 6369 0.385390 CAGGTTTGCGTGAGGCTTTT 59.615 50.000 0.00 0.00 44.05 2.27
5141 6370 0.385390 AGGTTTGCGTGAGGCTTTTG 59.615 50.000 0.00 0.00 44.05 2.44
5142 6371 0.383949 GGTTTGCGTGAGGCTTTTGA 59.616 50.000 0.00 0.00 44.05 2.69
5143 6372 1.202359 GGTTTGCGTGAGGCTTTTGAA 60.202 47.619 0.00 0.00 44.05 2.69
5144 6373 2.119457 GTTTGCGTGAGGCTTTTGAAG 58.881 47.619 0.00 0.00 44.05 3.02
5145 6374 0.667993 TTGCGTGAGGCTTTTGAAGG 59.332 50.000 0.00 0.00 44.05 3.46
5152 6381 3.443588 GCTTTTGAAGGCCACCGT 58.556 55.556 5.01 0.00 0.00 4.83
5153 6382 1.007387 GCTTTTGAAGGCCACCGTG 60.007 57.895 5.01 0.00 0.00 4.94
5154 6383 1.659794 CTTTTGAAGGCCACCGTGG 59.340 57.895 13.71 13.71 41.55 4.94
5155 6384 1.805428 CTTTTGAAGGCCACCGTGGG 61.805 60.000 19.41 1.32 38.19 4.61
5156 6385 2.285889 TTTTGAAGGCCACCGTGGGA 62.286 55.000 19.41 0.00 38.19 4.37
5157 6386 2.690653 TTTGAAGGCCACCGTGGGAG 62.691 60.000 19.41 0.00 38.19 4.30
5158 6387 4.410400 GAAGGCCACCGTGGGAGG 62.410 72.222 19.41 0.00 38.19 4.30
5164 6393 3.075005 CACCGTGGGAGGGTCGAT 61.075 66.667 0.00 0.00 33.44 3.59
5165 6394 2.758737 ACCGTGGGAGGGTCGATC 60.759 66.667 0.00 0.00 28.73 3.69
5166 6395 3.900892 CCGTGGGAGGGTCGATCG 61.901 72.222 9.36 9.36 0.00 3.69
5167 6396 2.827190 CGTGGGAGGGTCGATCGA 60.827 66.667 15.15 15.15 0.00 3.59
5168 6397 2.806237 GTGGGAGGGTCGATCGAC 59.194 66.667 34.70 34.70 43.87 4.20
5179 6408 3.843426 GTCGATCGACCATTCATTCAC 57.157 47.619 33.06 8.12 39.08 3.18
5180 6409 3.186909 GTCGATCGACCATTCATTCACA 58.813 45.455 33.06 0.00 39.08 3.58
5181 6410 3.243877 GTCGATCGACCATTCATTCACAG 59.756 47.826 33.06 0.00 39.08 3.66
5182 6411 3.119137 TCGATCGACCATTCATTCACAGT 60.119 43.478 15.15 0.00 0.00 3.55
5183 6412 3.243877 CGATCGACCATTCATTCACAGTC 59.756 47.826 10.26 0.00 0.00 3.51
5184 6413 2.606108 TCGACCATTCATTCACAGTCG 58.394 47.619 4.10 4.10 46.21 4.18
5187 6416 4.590400 GACCATTCATTCACAGTCGAAG 57.410 45.455 0.00 0.00 0.00 3.79
5188 6417 3.997021 GACCATTCATTCACAGTCGAAGT 59.003 43.478 0.00 0.00 0.00 3.01
5189 6418 3.997021 ACCATTCATTCACAGTCGAAGTC 59.003 43.478 0.00 0.00 0.00 3.01
5190 6419 3.061295 CCATTCATTCACAGTCGAAGTCG 59.939 47.826 0.00 0.00 41.45 4.18
5191 6420 1.698165 TCATTCACAGTCGAAGTCGC 58.302 50.000 0.00 0.00 39.60 5.19
5192 6421 1.269723 TCATTCACAGTCGAAGTCGCT 59.730 47.619 0.00 0.00 39.60 4.93
5193 6422 1.388093 CATTCACAGTCGAAGTCGCTG 59.612 52.381 17.61 17.61 43.66 5.18
5194 6423 0.318699 TTCACAGTCGAAGTCGCTGG 60.319 55.000 20.93 13.68 42.96 4.85
5195 6424 1.170290 TCACAGTCGAAGTCGCTGGA 61.170 55.000 20.93 15.02 42.96 3.86
5196 6425 1.004277 CACAGTCGAAGTCGCTGGAC 61.004 60.000 20.93 6.25 42.96 4.02
5197 6426 1.444553 CAGTCGAAGTCGCTGGACC 60.445 63.158 13.73 0.00 44.54 4.46
5198 6427 1.901948 AGTCGAAGTCGCTGGACCA 60.902 57.895 0.00 0.00 44.54 4.02
5199 6428 1.444553 GTCGAAGTCGCTGGACCAG 60.445 63.158 17.83 17.83 44.54 4.00
5200 6429 1.901948 TCGAAGTCGCTGGACCAGT 60.902 57.895 22.58 1.99 44.54 4.00
5201 6430 1.444553 CGAAGTCGCTGGACCAGTC 60.445 63.158 22.58 13.59 44.54 3.51
5202 6431 1.666011 GAAGTCGCTGGACCAGTCA 59.334 57.895 22.58 6.88 44.54 3.41
5203 6432 0.247736 GAAGTCGCTGGACCAGTCAT 59.752 55.000 22.58 7.07 44.54 3.06
5204 6433 0.687354 AAGTCGCTGGACCAGTCATT 59.313 50.000 22.58 9.91 44.54 2.57
5205 6434 1.557099 AGTCGCTGGACCAGTCATTA 58.443 50.000 22.58 1.70 44.54 1.90
5206 6435 1.899814 AGTCGCTGGACCAGTCATTAA 59.100 47.619 22.58 0.01 44.54 1.40
5207 6436 2.000447 GTCGCTGGACCAGTCATTAAC 59.000 52.381 22.58 8.43 37.19 2.01
5208 6437 1.066430 TCGCTGGACCAGTCATTAACC 60.066 52.381 22.58 2.55 33.43 2.85
5209 6438 1.338674 CGCTGGACCAGTCATTAACCA 60.339 52.381 22.58 0.00 33.43 3.67
5210 6439 2.084546 GCTGGACCAGTCATTAACCAC 58.915 52.381 22.58 0.00 33.43 4.16
5211 6440 2.346803 CTGGACCAGTCATTAACCACG 58.653 52.381 13.84 0.00 0.00 4.94
5212 6441 1.695242 TGGACCAGTCATTAACCACGT 59.305 47.619 0.00 0.00 0.00 4.49
5213 6442 2.898612 TGGACCAGTCATTAACCACGTA 59.101 45.455 0.00 0.00 0.00 3.57
5214 6443 3.056393 TGGACCAGTCATTAACCACGTAG 60.056 47.826 0.00 0.00 0.00 3.51
5215 6444 3.518590 GACCAGTCATTAACCACGTAGG 58.481 50.000 0.00 0.00 45.67 3.18
5216 6445 3.167485 ACCAGTCATTAACCACGTAGGA 58.833 45.455 10.46 0.00 41.22 2.94
5217 6446 3.194968 ACCAGTCATTAACCACGTAGGAG 59.805 47.826 10.46 0.00 41.22 3.69
5218 6447 3.430374 CCAGTCATTAACCACGTAGGAGG 60.430 52.174 10.46 0.00 41.22 4.30
5219 6448 2.764572 AGTCATTAACCACGTAGGAGGG 59.235 50.000 10.46 0.00 41.22 4.30
5220 6449 2.112998 TCATTAACCACGTAGGAGGGG 58.887 52.381 10.46 0.00 41.22 4.79
5221 6450 1.140252 CATTAACCACGTAGGAGGGGG 59.860 57.143 10.46 0.00 41.22 5.40
5222 6451 0.116940 TTAACCACGTAGGAGGGGGT 59.883 55.000 10.46 0.00 41.22 4.95
5223 6452 0.324645 TAACCACGTAGGAGGGGGTC 60.325 60.000 10.46 0.00 41.22 4.46
5224 6453 3.145551 CCACGTAGGAGGGGGTCG 61.146 72.222 0.00 0.00 41.22 4.79
5225 6454 3.145551 CACGTAGGAGGGGGTCGG 61.146 72.222 0.00 0.00 0.00 4.79
5226 6455 3.665971 ACGTAGGAGGGGGTCGGT 61.666 66.667 0.00 0.00 0.00 4.69
5227 6456 2.308722 ACGTAGGAGGGGGTCGGTA 61.309 63.158 0.00 0.00 0.00 4.02
5228 6457 1.152368 CGTAGGAGGGGGTCGGTAT 59.848 63.158 0.00 0.00 0.00 2.73
5229 6458 1.177256 CGTAGGAGGGGGTCGGTATG 61.177 65.000 0.00 0.00 0.00 2.39
5230 6459 0.105811 GTAGGAGGGGGTCGGTATGT 60.106 60.000 0.00 0.00 0.00 2.29
5231 6460 0.186873 TAGGAGGGGGTCGGTATGTC 59.813 60.000 0.00 0.00 0.00 3.06
5232 6461 1.075450 GGAGGGGGTCGGTATGTCT 60.075 63.158 0.00 0.00 0.00 3.41
5233 6462 0.186873 GGAGGGGGTCGGTATGTCTA 59.813 60.000 0.00 0.00 0.00 2.59
5234 6463 1.618487 GAGGGGGTCGGTATGTCTAG 58.382 60.000 0.00 0.00 0.00 2.43
5235 6464 0.469518 AGGGGGTCGGTATGTCTAGC 60.470 60.000 0.00 0.00 0.00 3.42
5236 6465 0.469518 GGGGGTCGGTATGTCTAGCT 60.470 60.000 0.00 0.00 0.00 3.32
5237 6466 0.960286 GGGGTCGGTATGTCTAGCTC 59.040 60.000 0.00 0.00 0.00 4.09
5238 6467 1.479021 GGGGTCGGTATGTCTAGCTCT 60.479 57.143 0.00 0.00 0.00 4.09
5239 6468 1.609555 GGGTCGGTATGTCTAGCTCTG 59.390 57.143 0.00 0.00 0.00 3.35
5240 6469 1.609555 GGTCGGTATGTCTAGCTCTGG 59.390 57.143 0.00 0.00 0.00 3.86
5241 6470 1.001158 GTCGGTATGTCTAGCTCTGGC 60.001 57.143 0.00 0.00 39.06 4.85
5242 6471 0.039978 CGGTATGTCTAGCTCTGGCG 60.040 60.000 0.00 0.00 44.37 5.69
5243 6472 1.033574 GGTATGTCTAGCTCTGGCGT 58.966 55.000 0.00 0.00 44.37 5.68
5244 6473 1.001158 GGTATGTCTAGCTCTGGCGTC 60.001 57.143 0.00 0.00 44.37 5.19
5245 6474 1.001158 GTATGTCTAGCTCTGGCGTCC 60.001 57.143 0.00 0.00 44.37 4.79
5246 6475 1.395826 ATGTCTAGCTCTGGCGTCCC 61.396 60.000 0.00 0.00 44.37 4.46
5247 6476 2.442272 TCTAGCTCTGGCGTCCCC 60.442 66.667 0.00 0.00 44.37 4.81
5248 6477 3.905678 CTAGCTCTGGCGTCCCCG 61.906 72.222 0.00 0.00 44.37 5.73
5298 6527 4.925861 GCCCGATCTGCCAGCTCC 62.926 72.222 0.00 0.00 0.00 4.70
5299 6528 4.598894 CCCGATCTGCCAGCTCCG 62.599 72.222 0.00 0.00 0.00 4.63
5300 6529 3.842923 CCGATCTGCCAGCTCCGT 61.843 66.667 0.00 0.00 0.00 4.69
5301 6530 2.279120 CGATCTGCCAGCTCCGTC 60.279 66.667 0.00 0.00 0.00 4.79
5302 6531 2.107953 GATCTGCCAGCTCCGTCC 59.892 66.667 0.00 0.00 0.00 4.79
5303 6532 2.364842 ATCTGCCAGCTCCGTCCT 60.365 61.111 0.00 0.00 0.00 3.85
5304 6533 1.965754 GATCTGCCAGCTCCGTCCTT 61.966 60.000 0.00 0.00 0.00 3.36
5305 6534 1.965754 ATCTGCCAGCTCCGTCCTTC 61.966 60.000 0.00 0.00 0.00 3.46
5306 6535 3.672295 CTGCCAGCTCCGTCCTTCC 62.672 68.421 0.00 0.00 0.00 3.46
5307 6536 4.475135 GCCAGCTCCGTCCTTCCC 62.475 72.222 0.00 0.00 0.00 3.97
5308 6537 2.685380 CCAGCTCCGTCCTTCCCT 60.685 66.667 0.00 0.00 0.00 4.20
5309 6538 2.581354 CAGCTCCGTCCTTCCCTG 59.419 66.667 0.00 0.00 0.00 4.45
5310 6539 3.394836 AGCTCCGTCCTTCCCTGC 61.395 66.667 0.00 0.00 0.00 4.85
5311 6540 4.821589 GCTCCGTCCTTCCCTGCG 62.822 72.222 0.00 0.00 0.00 5.18
5312 6541 3.382832 CTCCGTCCTTCCCTGCGT 61.383 66.667 0.00 0.00 0.00 5.24
5313 6542 3.358076 CTCCGTCCTTCCCTGCGTC 62.358 68.421 0.00 0.00 0.00 5.19
5314 6543 4.452733 CCGTCCTTCCCTGCGTCC 62.453 72.222 0.00 0.00 0.00 4.79
5315 6544 3.691342 CGTCCTTCCCTGCGTCCA 61.691 66.667 0.00 0.00 0.00 4.02
5316 6545 2.047179 GTCCTTCCCTGCGTCCAC 60.047 66.667 0.00 0.00 0.00 4.02
5317 6546 3.319198 TCCTTCCCTGCGTCCACC 61.319 66.667 0.00 0.00 0.00 4.61
5318 6547 4.760047 CCTTCCCTGCGTCCACCG 62.760 72.222 0.00 0.00 40.40 4.94
5319 6548 3.691342 CTTCCCTGCGTCCACCGA 61.691 66.667 0.00 0.00 39.56 4.69
5320 6549 3.000819 TTCCCTGCGTCCACCGAT 61.001 61.111 0.00 0.00 39.56 4.18
5321 6550 2.521958 CTTCCCTGCGTCCACCGATT 62.522 60.000 0.00 0.00 39.56 3.34
5322 6551 1.259142 TTCCCTGCGTCCACCGATTA 61.259 55.000 0.00 0.00 39.56 1.75
5323 6552 1.520787 CCCTGCGTCCACCGATTAC 60.521 63.158 0.00 0.00 39.56 1.89
5324 6553 1.216977 CCTGCGTCCACCGATTACA 59.783 57.895 0.00 0.00 39.56 2.41
5325 6554 0.806102 CCTGCGTCCACCGATTACAG 60.806 60.000 0.00 0.00 39.56 2.74
5326 6555 0.172578 CTGCGTCCACCGATTACAGA 59.827 55.000 0.00 0.00 39.56 3.41
5327 6556 0.821517 TGCGTCCACCGATTACAGAT 59.178 50.000 0.00 0.00 39.56 2.90
5328 6557 1.202371 TGCGTCCACCGATTACAGATC 60.202 52.381 0.00 0.00 39.56 2.75
5329 6558 1.868519 GCGTCCACCGATTACAGATCC 60.869 57.143 0.00 0.00 39.56 3.36
5330 6559 1.599667 CGTCCACCGATTACAGATCCG 60.600 57.143 0.00 0.00 39.56 4.18
5331 6560 1.679680 GTCCACCGATTACAGATCCGA 59.320 52.381 0.00 0.00 0.00 4.55
5332 6561 1.954382 TCCACCGATTACAGATCCGAG 59.046 52.381 0.00 0.00 0.00 4.63
5333 6562 1.954382 CCACCGATTACAGATCCGAGA 59.046 52.381 0.00 0.00 0.00 4.04
5334 6563 2.287668 CCACCGATTACAGATCCGAGAC 60.288 54.545 0.00 0.00 0.00 3.36
5335 6564 1.955080 ACCGATTACAGATCCGAGACC 59.045 52.381 0.00 0.00 0.00 3.85
5336 6565 1.269998 CCGATTACAGATCCGAGACCC 59.730 57.143 0.00 0.00 0.00 4.46
5337 6566 1.269998 CGATTACAGATCCGAGACCCC 59.730 57.143 0.00 0.00 0.00 4.95
5338 6567 1.619332 GATTACAGATCCGAGACCCCC 59.381 57.143 0.00 0.00 0.00 5.40
5339 6568 0.635009 TTACAGATCCGAGACCCCCT 59.365 55.000 0.00 0.00 0.00 4.79
5340 6569 0.185416 TACAGATCCGAGACCCCCTC 59.815 60.000 0.00 0.00 38.55 4.30
5341 6570 1.075970 CAGATCCGAGACCCCCTCA 60.076 63.158 0.00 0.00 42.06 3.86
5342 6571 1.112315 CAGATCCGAGACCCCCTCAG 61.112 65.000 0.00 0.00 42.06 3.35
5343 6572 2.444895 ATCCGAGACCCCCTCAGC 60.445 66.667 0.00 0.00 42.06 4.26
5344 6573 4.779733 TCCGAGACCCCCTCAGCC 62.780 72.222 0.00 0.00 42.06 4.85
5345 6574 4.787280 CCGAGACCCCCTCAGCCT 62.787 72.222 0.00 0.00 42.06 4.58
5346 6575 3.151022 CGAGACCCCCTCAGCCTC 61.151 72.222 0.00 0.00 42.06 4.70
5347 6576 2.766229 GAGACCCCCTCAGCCTCC 60.766 72.222 0.00 0.00 41.58 4.30
5348 6577 3.288381 AGACCCCCTCAGCCTCCT 61.288 66.667 0.00 0.00 0.00 3.69
5349 6578 2.766229 GACCCCCTCAGCCTCCTC 60.766 72.222 0.00 0.00 0.00 3.71
5350 6579 3.288381 ACCCCCTCAGCCTCCTCT 61.288 66.667 0.00 0.00 0.00 3.69
5351 6580 2.445654 CCCCCTCAGCCTCCTCTC 60.446 72.222 0.00 0.00 0.00 3.20
5352 6581 2.695597 CCCCTCAGCCTCCTCTCT 59.304 66.667 0.00 0.00 0.00 3.10
5353 6582 1.457455 CCCCTCAGCCTCCTCTCTC 60.457 68.421 0.00 0.00 0.00 3.20
5354 6583 1.457455 CCCTCAGCCTCCTCTCTCC 60.457 68.421 0.00 0.00 0.00 3.71
5355 6584 1.457455 CCTCAGCCTCCTCTCTCCC 60.457 68.421 0.00 0.00 0.00 4.30
5356 6585 1.457455 CTCAGCCTCCTCTCTCCCC 60.457 68.421 0.00 0.00 0.00 4.81
5357 6586 1.938596 TCAGCCTCCTCTCTCCCCT 60.939 63.158 0.00 0.00 0.00 4.79
5358 6587 1.457455 CAGCCTCCTCTCTCCCCTC 60.457 68.421 0.00 0.00 0.00 4.30
5359 6588 2.123033 GCCTCCTCTCTCCCCTCC 60.123 72.222 0.00 0.00 0.00 4.30
5360 6589 2.612251 CCTCCTCTCTCCCCTCCC 59.388 72.222 0.00 0.00 0.00 4.30
5361 6590 2.018086 CCTCCTCTCTCCCCTCCCT 61.018 68.421 0.00 0.00 0.00 4.20
5362 6591 1.232792 CTCCTCTCTCCCCTCCCTG 59.767 68.421 0.00 0.00 0.00 4.45
5363 6592 2.445654 CCTCTCTCCCCTCCCTGC 60.446 72.222 0.00 0.00 0.00 4.85
5364 6593 2.366167 CTCTCTCCCCTCCCTGCA 59.634 66.667 0.00 0.00 0.00 4.41
5365 6594 1.761667 CTCTCTCCCCTCCCTGCAG 60.762 68.421 6.78 6.78 0.00 4.41
5366 6595 2.235602 CTCTCTCCCCTCCCTGCAGA 62.236 65.000 17.39 0.00 0.00 4.26
5367 6596 1.306482 CTCTCCCCTCCCTGCAGAA 60.306 63.158 17.39 1.42 0.00 3.02
5368 6597 1.306482 TCTCCCCTCCCTGCAGAAG 60.306 63.158 17.39 12.09 0.00 2.85
5369 6598 1.306482 CTCCCCTCCCTGCAGAAGA 60.306 63.158 17.39 10.80 0.00 2.87
5370 6599 0.693767 CTCCCCTCCCTGCAGAAGAT 60.694 60.000 17.39 0.00 0.00 2.40
5371 6600 0.253347 TCCCCTCCCTGCAGAAGATT 60.253 55.000 17.39 0.00 0.00 2.40
5372 6601 0.627986 CCCCTCCCTGCAGAAGATTT 59.372 55.000 17.39 0.00 0.00 2.17
5373 6602 1.684248 CCCCTCCCTGCAGAAGATTTG 60.684 57.143 17.39 0.00 0.00 2.32
5374 6603 1.684248 CCCTCCCTGCAGAAGATTTGG 60.684 57.143 17.39 5.88 0.00 3.28
5375 6604 1.101331 CTCCCTGCAGAAGATTTGGC 58.899 55.000 17.39 0.00 0.00 4.52
5376 6605 0.677731 TCCCTGCAGAAGATTTGGCG 60.678 55.000 17.39 0.00 0.00 5.69
5377 6606 1.138247 CCTGCAGAAGATTTGGCGC 59.862 57.895 17.39 0.00 0.00 6.53
5378 6607 1.138247 CTGCAGAAGATTTGGCGCC 59.862 57.895 22.73 22.73 0.00 6.53
5379 6608 1.588824 CTGCAGAAGATTTGGCGCCA 61.589 55.000 29.03 29.03 0.00 5.69
5380 6609 0.966875 TGCAGAAGATTTGGCGCCAT 60.967 50.000 33.25 17.92 0.00 4.40
5381 6610 0.526954 GCAGAAGATTTGGCGCCATG 60.527 55.000 33.25 24.21 0.00 3.66
5382 6611 0.101759 CAGAAGATTTGGCGCCATGG 59.898 55.000 33.25 7.63 0.00 3.66
5383 6612 1.227060 GAAGATTTGGCGCCATGGC 60.227 57.895 33.25 27.67 45.12 4.40
5394 6623 3.790437 CCATGGCGCTCCTCCAGT 61.790 66.667 7.64 0.00 36.98 4.00
5395 6624 2.513204 CATGGCGCTCCTCCAGTG 60.513 66.667 7.64 0.00 36.98 3.66
5400 6629 4.767255 CGCTCCTCCAGTGCACCC 62.767 72.222 14.63 0.00 34.56 4.61
5401 6630 4.767255 GCTCCTCCAGTGCACCCG 62.767 72.222 14.63 4.90 35.02 5.28
5402 6631 4.087892 CTCCTCCAGTGCACCCGG 62.088 72.222 14.63 15.02 0.00 5.73
5412 6641 3.434319 GCACCCGGCATGTGTCTG 61.434 66.667 10.48 0.00 43.97 3.51
5413 6642 3.434319 CACCCGGCATGTGTCTGC 61.434 66.667 0.00 0.00 41.53 4.26
5419 6648 4.107051 GCATGTGTCTGCGGCCAC 62.107 66.667 2.24 0.00 31.49 5.01
5420 6649 2.669229 CATGTGTCTGCGGCCACA 60.669 61.111 12.45 12.45 44.91 4.17
5421 6650 2.669569 ATGTGTCTGCGGCCACAC 60.670 61.111 12.31 19.92 43.75 3.82
5422 6651 4.927782 TGTGTCTGCGGCCACACC 62.928 66.667 22.41 10.43 41.99 4.16
5555 6784 4.047125 CCAACCTCCGGTGGCCAT 62.047 66.667 22.46 6.38 35.34 4.40
5556 6785 2.035626 CAACCTCCGGTGGCCATT 59.964 61.111 22.46 6.77 35.34 3.16
5557 6786 1.606313 CAACCTCCGGTGGCCATTT 60.606 57.895 22.46 6.39 35.34 2.32
5558 6787 1.304134 AACCTCCGGTGGCCATTTC 60.304 57.895 22.46 0.46 35.34 2.17
5559 6788 1.789576 AACCTCCGGTGGCCATTTCT 61.790 55.000 22.46 0.00 35.34 2.52
5560 6789 1.452108 CCTCCGGTGGCCATTTCTC 60.452 63.158 9.72 0.00 0.00 2.87
5561 6790 1.452108 CTCCGGTGGCCATTTCTCC 60.452 63.158 9.72 3.42 0.00 3.71
5562 6791 2.440247 CCGGTGGCCATTTCTCCC 60.440 66.667 9.72 2.51 0.00 4.30
5563 6792 2.354729 CGGTGGCCATTTCTCCCA 59.645 61.111 9.72 0.00 0.00 4.37
5564 6793 1.304052 CGGTGGCCATTTCTCCCAA 60.304 57.895 9.72 0.00 0.00 4.12
5565 6794 1.315257 CGGTGGCCATTTCTCCCAAG 61.315 60.000 9.72 0.00 0.00 3.61
5566 6795 1.607801 GGTGGCCATTTCTCCCAAGC 61.608 60.000 9.72 0.00 0.00 4.01
5567 6796 0.613012 GTGGCCATTTCTCCCAAGCT 60.613 55.000 9.72 0.00 0.00 3.74
5568 6797 0.612732 TGGCCATTTCTCCCAAGCTG 60.613 55.000 0.00 0.00 0.00 4.24
5569 6798 1.325476 GGCCATTTCTCCCAAGCTGG 61.325 60.000 0.00 0.00 37.25 4.85
5570 6799 1.953231 GCCATTTCTCCCAAGCTGGC 61.953 60.000 0.00 0.00 42.00 4.85
5571 6800 1.325476 CCATTTCTCCCAAGCTGGCC 61.325 60.000 0.00 0.00 35.79 5.36
5572 6801 0.612732 CATTTCTCCCAAGCTGGCCA 60.613 55.000 4.71 4.71 35.79 5.36
5573 6802 0.613012 ATTTCTCCCAAGCTGGCCAC 60.613 55.000 0.00 0.00 35.79 5.01
5574 6803 2.713531 TTTCTCCCAAGCTGGCCACC 62.714 60.000 0.00 0.00 35.79 4.61
5575 6804 3.655211 CTCCCAAGCTGGCCACCT 61.655 66.667 0.00 0.00 35.79 4.00
5576 6805 3.635268 CTCCCAAGCTGGCCACCTC 62.635 68.421 0.00 0.00 35.79 3.85
5577 6806 4.748144 CCCAAGCTGGCCACCTCC 62.748 72.222 0.00 0.00 35.79 4.30
5578 6807 4.748144 CCAAGCTGGCCACCTCCC 62.748 72.222 0.00 0.00 0.00 4.30
5579 6808 4.748144 CAAGCTGGCCACCTCCCC 62.748 72.222 0.00 0.00 0.00 4.81
5588 6817 4.087892 CACCTCCCCGTCCTGCAG 62.088 72.222 6.78 6.78 0.00 4.41
5591 6820 4.020617 CTCCCCGTCCTGCAGCAA 62.021 66.667 8.66 0.00 0.00 3.91
5592 6821 3.329889 TCCCCGTCCTGCAGCAAT 61.330 61.111 8.66 0.00 0.00 3.56
5593 6822 2.825836 CCCCGTCCTGCAGCAATC 60.826 66.667 8.66 0.00 0.00 2.67
5594 6823 2.825836 CCCGTCCTGCAGCAATCC 60.826 66.667 8.66 0.00 0.00 3.01
5595 6824 2.270205 CCGTCCTGCAGCAATCCT 59.730 61.111 8.66 0.00 0.00 3.24
5596 6825 1.817099 CCGTCCTGCAGCAATCCTC 60.817 63.158 8.66 0.00 0.00 3.71
5597 6826 2.169789 CGTCCTGCAGCAATCCTCG 61.170 63.158 8.66 0.94 0.00 4.63
5598 6827 1.078848 GTCCTGCAGCAATCCTCGT 60.079 57.895 8.66 0.00 0.00 4.18
5599 6828 1.086634 GTCCTGCAGCAATCCTCGTC 61.087 60.000 8.66 0.00 0.00 4.20
5600 6829 1.220206 CCTGCAGCAATCCTCGTCT 59.780 57.895 8.66 0.00 0.00 4.18
5601 6830 1.088340 CCTGCAGCAATCCTCGTCTG 61.088 60.000 8.66 0.00 0.00 3.51
5602 6831 0.108472 CTGCAGCAATCCTCGTCTGA 60.108 55.000 0.00 0.00 0.00 3.27
5603 6832 0.538584 TGCAGCAATCCTCGTCTGAT 59.461 50.000 0.00 0.00 0.00 2.90
5604 6833 0.935898 GCAGCAATCCTCGTCTGATG 59.064 55.000 0.00 0.00 0.00 3.07
5605 6834 0.935898 CAGCAATCCTCGTCTGATGC 59.064 55.000 0.00 0.00 0.00 3.91
5606 6835 0.829333 AGCAATCCTCGTCTGATGCT 59.171 50.000 0.00 0.00 0.00 3.79
5607 6836 1.202510 AGCAATCCTCGTCTGATGCTC 60.203 52.381 0.00 0.00 0.00 4.26
5608 6837 1.485397 CAATCCTCGTCTGATGCTCG 58.515 55.000 0.00 0.00 0.00 5.03
5609 6838 0.387202 AATCCTCGTCTGATGCTCGG 59.613 55.000 0.00 0.00 0.00 4.63
5610 6839 2.081425 ATCCTCGTCTGATGCTCGGC 62.081 60.000 0.00 0.00 0.00 5.54
5611 6840 2.279120 CTCGTCTGATGCTCGGCC 60.279 66.667 0.00 0.00 0.00 6.13
5612 6841 3.781770 CTCGTCTGATGCTCGGCCC 62.782 68.421 0.00 0.00 0.00 5.80
5614 6843 3.838271 GTCTGATGCTCGGCCCGA 61.838 66.667 5.37 5.37 0.00 5.14
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 0.107897 AACGAGCTGACACACCACAA 60.108 50.000 0.00 0.00 0.00 3.33
1 2 0.809636 CAACGAGCTGACACACCACA 60.810 55.000 0.00 0.00 0.00 4.17
2 3 0.810031 ACAACGAGCTGACACACCAC 60.810 55.000 0.00 0.00 0.00 4.16
3 4 0.809636 CACAACGAGCTGACACACCA 60.810 55.000 0.00 0.00 0.00 4.17
4 5 0.810031 ACACAACGAGCTGACACACC 60.810 55.000 0.00 0.00 0.00 4.16
5 6 1.521423 GTACACAACGAGCTGACACAC 59.479 52.381 0.00 0.00 0.00 3.82
6 7 1.135333 TGTACACAACGAGCTGACACA 59.865 47.619 0.00 0.00 0.00 3.72
7 8 1.847818 TGTACACAACGAGCTGACAC 58.152 50.000 0.00 0.00 0.00 3.67
8 9 2.403259 CATGTACACAACGAGCTGACA 58.597 47.619 0.00 0.00 0.00 3.58
9 10 1.126846 GCATGTACACAACGAGCTGAC 59.873 52.381 0.00 0.00 0.00 3.51
10 11 1.428448 GCATGTACACAACGAGCTGA 58.572 50.000 0.00 0.00 0.00 4.26
11 12 0.443869 GGCATGTACACAACGAGCTG 59.556 55.000 0.00 0.00 32.72 4.24
12 13 0.034756 TGGCATGTACACAACGAGCT 59.965 50.000 0.00 0.00 32.72 4.09
13 14 0.871722 TTGGCATGTACACAACGAGC 59.128 50.000 0.00 0.00 0.00 5.03
14 15 2.143122 ACTTGGCATGTACACAACGAG 58.857 47.619 3.94 3.02 0.00 4.18
15 16 2.248280 ACTTGGCATGTACACAACGA 57.752 45.000 3.94 0.00 0.00 3.85
16 17 2.548057 AGAACTTGGCATGTACACAACG 59.452 45.455 6.44 0.00 0.00 4.10
17 18 3.058224 GGAGAACTTGGCATGTACACAAC 60.058 47.826 6.44 0.00 0.00 3.32
18 19 3.146066 GGAGAACTTGGCATGTACACAA 58.854 45.455 6.44 0.00 0.00 3.33
19 20 2.105649 TGGAGAACTTGGCATGTACACA 59.894 45.455 6.44 1.94 0.00 3.72
20 21 2.778299 TGGAGAACTTGGCATGTACAC 58.222 47.619 6.44 2.48 0.00 2.90
21 22 3.719268 ATGGAGAACTTGGCATGTACA 57.281 42.857 6.44 0.00 0.00 2.90
22 23 4.572389 CACTATGGAGAACTTGGCATGTAC 59.428 45.833 6.44 2.30 0.00 2.90
23 24 4.225042 ACACTATGGAGAACTTGGCATGTA 59.775 41.667 6.44 0.00 0.00 2.29
24 25 3.009473 ACACTATGGAGAACTTGGCATGT 59.991 43.478 0.00 0.00 0.00 3.21
25 26 3.614092 ACACTATGGAGAACTTGGCATG 58.386 45.455 0.00 0.00 0.00 4.06
26 27 3.264193 TGACACTATGGAGAACTTGGCAT 59.736 43.478 0.00 0.00 0.00 4.40
27 28 2.637382 TGACACTATGGAGAACTTGGCA 59.363 45.455 0.00 0.00 0.00 4.92
28 29 3.334583 TGACACTATGGAGAACTTGGC 57.665 47.619 0.00 0.00 0.00 4.52
29 30 5.089970 TGATGACACTATGGAGAACTTGG 57.910 43.478 0.00 0.00 0.00 3.61
30 31 8.899427 ATATTGATGACACTATGGAGAACTTG 57.101 34.615 0.00 0.00 0.00 3.16
32 33 8.811017 CCTATATTGATGACACTATGGAGAACT 58.189 37.037 0.00 0.00 0.00 3.01
33 34 8.807118 TCCTATATTGATGACACTATGGAGAAC 58.193 37.037 0.00 0.00 0.00 3.01
34 35 8.956446 TCCTATATTGATGACACTATGGAGAA 57.044 34.615 0.00 0.00 0.00 2.87
35 36 8.956446 TTCCTATATTGATGACACTATGGAGA 57.044 34.615 0.00 0.00 30.04 3.71
36 37 8.811017 ACTTCCTATATTGATGACACTATGGAG 58.189 37.037 0.00 0.00 30.04 3.86
37 38 8.727100 ACTTCCTATATTGATGACACTATGGA 57.273 34.615 0.00 0.00 0.00 3.41
38 39 7.757173 CGACTTCCTATATTGATGACACTATGG 59.243 40.741 0.00 0.00 0.00 2.74
39 40 8.300286 ACGACTTCCTATATTGATGACACTATG 58.700 37.037 0.00 0.00 0.00 2.23
40 41 8.410673 ACGACTTCCTATATTGATGACACTAT 57.589 34.615 0.00 0.00 0.00 2.12
41 42 7.818997 ACGACTTCCTATATTGATGACACTA 57.181 36.000 0.00 0.00 0.00 2.74
42 43 6.716934 ACGACTTCCTATATTGATGACACT 57.283 37.500 0.00 0.00 0.00 3.55
43 44 6.421202 GGAACGACTTCCTATATTGATGACAC 59.579 42.308 0.00 0.00 42.72 3.67
44 45 6.513180 GGAACGACTTCCTATATTGATGACA 58.487 40.000 0.00 0.00 42.72 3.58
57 58 1.067495 CAGTGAGGAGGAACGACTTCC 60.067 57.143 0.00 0.00 46.03 3.46
58 59 1.670380 GCAGTGAGGAGGAACGACTTC 60.670 57.143 0.00 0.00 0.00 3.01
59 60 0.318762 GCAGTGAGGAGGAACGACTT 59.681 55.000 0.00 0.00 0.00 3.01
60 61 0.540830 AGCAGTGAGGAGGAACGACT 60.541 55.000 0.00 0.00 0.00 4.18
61 62 0.109039 GAGCAGTGAGGAGGAACGAC 60.109 60.000 0.00 0.00 0.00 4.34
62 63 0.251386 AGAGCAGTGAGGAGGAACGA 60.251 55.000 0.00 0.00 0.00 3.85
63 64 0.605589 AAGAGCAGTGAGGAGGAACG 59.394 55.000 0.00 0.00 0.00 3.95
64 65 1.346068 ACAAGAGCAGTGAGGAGGAAC 59.654 52.381 0.00 0.00 0.00 3.62
65 66 1.722034 ACAAGAGCAGTGAGGAGGAA 58.278 50.000 0.00 0.00 0.00 3.36
66 67 1.345741 CAACAAGAGCAGTGAGGAGGA 59.654 52.381 0.00 0.00 0.00 3.71
67 68 1.345741 TCAACAAGAGCAGTGAGGAGG 59.654 52.381 0.00 0.00 0.00 4.30
68 69 2.298446 TCTCAACAAGAGCAGTGAGGAG 59.702 50.000 0.00 0.00 44.35 3.69
69 70 2.319844 TCTCAACAAGAGCAGTGAGGA 58.680 47.619 0.00 0.00 44.35 3.71
70 71 2.827800 TCTCAACAAGAGCAGTGAGG 57.172 50.000 0.00 0.00 44.35 3.86
71 72 3.987547 TCTTCTCAACAAGAGCAGTGAG 58.012 45.455 0.00 0.00 44.35 3.51
72 73 4.313282 CATCTTCTCAACAAGAGCAGTGA 58.687 43.478 0.00 0.00 44.35 3.41
73 74 3.120269 GCATCTTCTCAACAAGAGCAGTG 60.120 47.826 0.00 0.00 44.35 3.66
74 75 3.072944 GCATCTTCTCAACAAGAGCAGT 58.927 45.455 0.00 0.00 44.35 4.40
75 76 3.072211 TGCATCTTCTCAACAAGAGCAG 58.928 45.455 0.00 0.00 44.35 4.24
76 77 3.072211 CTGCATCTTCTCAACAAGAGCA 58.928 45.455 0.00 0.00 44.35 4.26
77 78 2.159544 GCTGCATCTTCTCAACAAGAGC 60.160 50.000 0.00 0.00 44.35 4.09
78 79 3.072211 TGCTGCATCTTCTCAACAAGAG 58.928 45.455 0.00 0.00 46.14 2.85
79 80 3.130280 TGCTGCATCTTCTCAACAAGA 57.870 42.857 0.00 0.00 36.82 3.02
80 81 3.562505 GTTGCTGCATCTTCTCAACAAG 58.437 45.455 1.84 0.00 37.53 3.16
81 82 2.294233 GGTTGCTGCATCTTCTCAACAA 59.706 45.455 1.84 0.00 38.87 2.83
82 83 1.881973 GGTTGCTGCATCTTCTCAACA 59.118 47.619 1.84 0.00 38.87 3.33
83 84 1.881973 TGGTTGCTGCATCTTCTCAAC 59.118 47.619 1.84 0.00 37.04 3.18
84 85 1.881973 GTGGTTGCTGCATCTTCTCAA 59.118 47.619 1.84 0.00 0.00 3.02
85 86 1.072806 AGTGGTTGCTGCATCTTCTCA 59.927 47.619 1.84 0.00 0.00 3.27
86 87 1.736681 GAGTGGTTGCTGCATCTTCTC 59.263 52.381 1.84 10.67 0.00 2.87
87 88 1.612726 GGAGTGGTTGCTGCATCTTCT 60.613 52.381 1.84 5.63 0.00 2.85
88 89 0.807496 GGAGTGGTTGCTGCATCTTC 59.193 55.000 1.84 2.97 0.00 2.87
89 90 0.610232 GGGAGTGGTTGCTGCATCTT 60.610 55.000 1.84 0.00 0.00 2.40
90 91 1.001641 GGGAGTGGTTGCTGCATCT 60.002 57.895 1.84 0.00 0.00 2.90
91 92 2.401766 CGGGAGTGGTTGCTGCATC 61.402 63.158 1.84 1.98 0.00 3.91
92 93 2.360350 CGGGAGTGGTTGCTGCAT 60.360 61.111 1.84 0.00 0.00 3.96
93 94 3.872603 ACGGGAGTGGTTGCTGCA 61.873 61.111 0.00 0.00 44.82 4.41
104 105 1.101635 TCGAGCATACAGGACGGGAG 61.102 60.000 0.00 0.00 0.00 4.30
105 106 0.467474 ATCGAGCATACAGGACGGGA 60.467 55.000 0.00 0.00 0.00 5.14
106 107 0.319040 CATCGAGCATACAGGACGGG 60.319 60.000 0.00 0.00 0.00 5.28
107 108 0.385751 ACATCGAGCATACAGGACGG 59.614 55.000 0.00 0.00 0.00 4.79
108 109 2.209838 AACATCGAGCATACAGGACG 57.790 50.000 0.00 0.00 0.00 4.79
109 110 3.309954 GGAAAACATCGAGCATACAGGAC 59.690 47.826 0.00 0.00 0.00 3.85
110 111 3.055458 TGGAAAACATCGAGCATACAGGA 60.055 43.478 0.00 0.00 0.00 3.86
111 112 3.270027 TGGAAAACATCGAGCATACAGG 58.730 45.455 0.00 0.00 0.00 4.00
112 113 4.393062 AGTTGGAAAACATCGAGCATACAG 59.607 41.667 0.00 0.00 0.00 2.74
113 114 4.323417 AGTTGGAAAACATCGAGCATACA 58.677 39.130 0.00 0.00 0.00 2.29
114 115 4.946784 AGTTGGAAAACATCGAGCATAC 57.053 40.909 0.00 0.00 0.00 2.39
115 116 5.116180 CCTAGTTGGAAAACATCGAGCATA 58.884 41.667 0.00 0.00 38.35 3.14
116 117 3.941483 CCTAGTTGGAAAACATCGAGCAT 59.059 43.478 0.00 0.00 38.35 3.79
117 118 3.334691 CCTAGTTGGAAAACATCGAGCA 58.665 45.455 0.00 0.00 38.35 4.26
118 119 2.678336 CCCTAGTTGGAAAACATCGAGC 59.322 50.000 0.00 0.00 38.35 5.03
119 120 2.678336 GCCCTAGTTGGAAAACATCGAG 59.322 50.000 0.00 0.00 38.35 4.04
120 121 2.039216 TGCCCTAGTTGGAAAACATCGA 59.961 45.455 0.00 0.00 38.35 3.59
121 122 2.432444 TGCCCTAGTTGGAAAACATCG 58.568 47.619 0.00 0.00 38.35 3.84
122 123 4.706962 AGAATGCCCTAGTTGGAAAACATC 59.293 41.667 0.00 0.00 38.35 3.06
123 124 4.677182 AGAATGCCCTAGTTGGAAAACAT 58.323 39.130 0.00 0.00 38.35 2.71
124 125 4.079253 GAGAATGCCCTAGTTGGAAAACA 58.921 43.478 0.00 0.00 38.35 2.83
125 126 3.444034 GGAGAATGCCCTAGTTGGAAAAC 59.556 47.826 0.00 0.00 38.35 2.43
126 127 3.075283 TGGAGAATGCCCTAGTTGGAAAA 59.925 43.478 0.00 0.00 38.35 2.29
127 128 2.647299 TGGAGAATGCCCTAGTTGGAAA 59.353 45.455 0.00 0.00 38.35 3.13
128 129 2.274542 TGGAGAATGCCCTAGTTGGAA 58.725 47.619 0.00 0.00 38.35 3.53
129 130 1.965414 TGGAGAATGCCCTAGTTGGA 58.035 50.000 0.00 0.00 38.35 3.53
130 131 2.806945 TTGGAGAATGCCCTAGTTGG 57.193 50.000 0.00 0.00 0.00 3.77
140 141 3.247886 CGATGAGTGAGCATTGGAGAATG 59.752 47.826 0.00 0.00 41.82 2.67
141 142 3.464907 CGATGAGTGAGCATTGGAGAAT 58.535 45.455 0.00 0.00 0.00 2.40
142 143 2.897436 CGATGAGTGAGCATTGGAGAA 58.103 47.619 0.00 0.00 0.00 2.87
143 144 1.472201 GCGATGAGTGAGCATTGGAGA 60.472 52.381 0.00 0.00 31.58 3.71
144 145 0.935898 GCGATGAGTGAGCATTGGAG 59.064 55.000 0.00 0.00 31.58 3.86
145 146 0.249955 TGCGATGAGTGAGCATTGGA 59.750 50.000 0.00 0.00 35.81 3.53
146 147 0.376152 GTGCGATGAGTGAGCATTGG 59.624 55.000 0.00 0.00 43.17 3.16
147 148 0.025898 CGTGCGATGAGTGAGCATTG 59.974 55.000 0.00 0.00 43.17 2.82
148 149 1.699656 GCGTGCGATGAGTGAGCATT 61.700 55.000 0.00 0.00 43.17 3.56
149 150 2.169789 GCGTGCGATGAGTGAGCAT 61.170 57.895 0.00 0.00 43.17 3.79
150 151 2.810887 GCGTGCGATGAGTGAGCA 60.811 61.111 0.00 0.00 38.71 4.26
151 152 3.558411 GGCGTGCGATGAGTGAGC 61.558 66.667 0.00 0.00 0.00 4.26
152 153 2.125952 TGGCGTGCGATGAGTGAG 60.126 61.111 0.00 0.00 0.00 3.51
153 154 2.125952 CTGGCGTGCGATGAGTGA 60.126 61.111 0.00 0.00 0.00 3.41
154 155 2.125952 TCTGGCGTGCGATGAGTG 60.126 61.111 0.00 0.00 0.00 3.51
155 156 2.182791 CTCTGGCGTGCGATGAGT 59.817 61.111 0.00 0.00 0.00 3.41
156 157 1.875813 GACTCTGGCGTGCGATGAG 60.876 63.158 0.00 2.11 0.00 2.90
157 158 2.181777 GACTCTGGCGTGCGATGA 59.818 61.111 0.00 0.00 0.00 2.92
158 159 2.842394 AAGGACTCTGGCGTGCGATG 62.842 60.000 0.00 0.00 0.00 3.84
159 160 2.650116 AAGGACTCTGGCGTGCGAT 61.650 57.895 0.00 0.00 0.00 4.58
160 161 3.303135 AAGGACTCTGGCGTGCGA 61.303 61.111 0.00 0.00 0.00 5.10
161 162 3.114616 CAAGGACTCTGGCGTGCG 61.115 66.667 0.00 0.00 0.00 5.34
162 163 2.743928 CCAAGGACTCTGGCGTGC 60.744 66.667 0.00 0.00 0.00 5.34
163 164 2.046892 CCCAAGGACTCTGGCGTG 60.047 66.667 0.00 0.00 0.00 5.34
164 165 4.021925 GCCCAAGGACTCTGGCGT 62.022 66.667 0.00 0.00 33.59 5.68
165 166 4.785453 GGCCCAAGGACTCTGGCG 62.785 72.222 0.00 0.00 44.96 5.69
166 167 2.505364 AATGGCCCAAGGACTCTGGC 62.505 60.000 0.00 4.07 43.26 4.85
167 168 0.682209 CAATGGCCCAAGGACTCTGG 60.682 60.000 0.00 0.00 0.00 3.86
168 169 0.682209 CCAATGGCCCAAGGACTCTG 60.682 60.000 0.00 0.00 0.00 3.35
169 170 0.846427 TCCAATGGCCCAAGGACTCT 60.846 55.000 0.00 0.00 0.00 3.24
170 171 0.681243 GTCCAATGGCCCAAGGACTC 60.681 60.000 24.05 6.10 45.46 3.36
171 172 1.384191 GTCCAATGGCCCAAGGACT 59.616 57.895 24.05 0.00 45.46 3.85
172 173 4.018409 GTCCAATGGCCCAAGGAC 57.982 61.111 19.21 19.21 43.18 3.85
173 174 0.033208 GATGTCCAATGGCCCAAGGA 60.033 55.000 0.00 4.29 0.00 3.36
174 175 0.032813 AGATGTCCAATGGCCCAAGG 60.033 55.000 0.00 0.00 0.00 3.61
175 176 1.108776 CAGATGTCCAATGGCCCAAG 58.891 55.000 0.00 0.00 0.00 3.61
176 177 0.971959 GCAGATGTCCAATGGCCCAA 60.972 55.000 0.00 0.00 0.00 4.12
177 178 1.380246 GCAGATGTCCAATGGCCCA 60.380 57.895 0.00 0.00 0.00 5.36
178 179 0.971959 TTGCAGATGTCCAATGGCCC 60.972 55.000 0.00 0.00 0.00 5.80
179 180 0.896923 TTTGCAGATGTCCAATGGCC 59.103 50.000 0.00 0.00 0.00 5.36
180 181 2.747396 TTTTGCAGATGTCCAATGGC 57.253 45.000 0.00 0.00 0.00 4.40
181 182 3.991773 CACTTTTTGCAGATGTCCAATGG 59.008 43.478 0.00 0.00 0.00 3.16
182 183 4.682860 GTCACTTTTTGCAGATGTCCAATG 59.317 41.667 0.00 0.00 0.00 2.82
183 184 4.341806 TGTCACTTTTTGCAGATGTCCAAT 59.658 37.500 0.00 0.00 0.00 3.16
184 185 3.698539 TGTCACTTTTTGCAGATGTCCAA 59.301 39.130 0.00 0.00 0.00 3.53
185 186 3.286353 TGTCACTTTTTGCAGATGTCCA 58.714 40.909 0.00 0.00 0.00 4.02
186 187 3.565482 TCTGTCACTTTTTGCAGATGTCC 59.435 43.478 0.00 0.00 35.04 4.02
187 188 4.818534 TCTGTCACTTTTTGCAGATGTC 57.181 40.909 0.00 0.00 35.04 3.06
188 189 5.581126 TTTCTGTCACTTTTTGCAGATGT 57.419 34.783 0.00 0.00 37.85 3.06
189 190 6.890663 TTTTTCTGTCACTTTTTGCAGATG 57.109 33.333 0.00 0.00 37.85 2.90
190 191 8.196771 TGTATTTTTCTGTCACTTTTTGCAGAT 58.803 29.630 0.00 0.00 37.85 2.90
191 192 7.542890 TGTATTTTTCTGTCACTTTTTGCAGA 58.457 30.769 0.00 0.00 36.90 4.26
192 193 7.754069 TGTATTTTTCTGTCACTTTTTGCAG 57.246 32.000 0.00 0.00 33.22 4.41
193 194 7.816995 AGTTGTATTTTTCTGTCACTTTTTGCA 59.183 29.630 0.00 0.00 0.00 4.08
194 195 8.185003 AGTTGTATTTTTCTGTCACTTTTTGC 57.815 30.769 0.00 0.00 0.00 3.68
195 196 9.956797 CAAGTTGTATTTTTCTGTCACTTTTTG 57.043 29.630 0.00 0.00 0.00 2.44
196 197 9.150348 CCAAGTTGTATTTTTCTGTCACTTTTT 57.850 29.630 1.45 0.00 0.00 1.94
197 198 7.277760 GCCAAGTTGTATTTTTCTGTCACTTTT 59.722 33.333 1.45 0.00 0.00 2.27
198 199 6.756542 GCCAAGTTGTATTTTTCTGTCACTTT 59.243 34.615 1.45 0.00 0.00 2.66
199 200 6.127479 TGCCAAGTTGTATTTTTCTGTCACTT 60.127 34.615 1.45 0.00 0.00 3.16
200 201 5.359576 TGCCAAGTTGTATTTTTCTGTCACT 59.640 36.000 1.45 0.00 0.00 3.41
201 202 5.587289 TGCCAAGTTGTATTTTTCTGTCAC 58.413 37.500 1.45 0.00 0.00 3.67
202 203 5.843673 TGCCAAGTTGTATTTTTCTGTCA 57.156 34.783 1.45 0.00 0.00 3.58
203 204 7.816640 TCTATGCCAAGTTGTATTTTTCTGTC 58.183 34.615 1.45 0.00 0.00 3.51
204 205 7.759489 TCTATGCCAAGTTGTATTTTTCTGT 57.241 32.000 1.45 0.00 0.00 3.41
205 206 7.703621 CCATCTATGCCAAGTTGTATTTTTCTG 59.296 37.037 1.45 0.00 0.00 3.02
206 207 7.397192 ACCATCTATGCCAAGTTGTATTTTTCT 59.603 33.333 1.45 0.00 0.00 2.52
207 208 7.547227 ACCATCTATGCCAAGTTGTATTTTTC 58.453 34.615 1.45 0.00 0.00 2.29
208 209 7.480760 ACCATCTATGCCAAGTTGTATTTTT 57.519 32.000 1.45 0.00 0.00 1.94
209 210 8.632679 CATACCATCTATGCCAAGTTGTATTTT 58.367 33.333 1.45 0.00 0.00 1.82
210 211 7.255590 GCATACCATCTATGCCAAGTTGTATTT 60.256 37.037 1.45 0.00 43.18 1.40
211 212 6.207417 GCATACCATCTATGCCAAGTTGTATT 59.793 38.462 1.45 0.00 43.18 1.89
212 213 5.707298 GCATACCATCTATGCCAAGTTGTAT 59.293 40.000 1.45 0.00 43.18 2.29
213 214 5.063204 GCATACCATCTATGCCAAGTTGTA 58.937 41.667 1.45 0.00 43.18 2.41
214 215 3.885297 GCATACCATCTATGCCAAGTTGT 59.115 43.478 1.45 0.00 43.18 3.32
215 216 4.494350 GCATACCATCTATGCCAAGTTG 57.506 45.455 0.00 0.00 43.18 3.16
245 246 3.615709 GCACCGGGCTGCCTTTTT 61.616 61.111 19.68 0.00 40.25 1.94
246 247 4.912395 TGCACCGGGCTGCCTTTT 62.912 61.111 19.68 0.00 45.15 2.27
250 251 4.794648 TATGTGCACCGGGCTGCC 62.795 66.667 15.69 11.05 45.15 4.85
251 252 2.516930 ATATGTGCACCGGGCTGC 60.517 61.111 15.69 8.50 45.15 5.25
252 253 0.882042 GAGATATGTGCACCGGGCTG 60.882 60.000 15.69 0.00 45.15 4.85
253 254 1.447643 GAGATATGTGCACCGGGCT 59.552 57.895 15.69 6.74 45.15 5.19
254 255 1.598130 GGAGATATGTGCACCGGGC 60.598 63.158 15.69 7.25 45.13 6.13
255 256 0.250038 CTGGAGATATGTGCACCGGG 60.250 60.000 15.69 0.00 0.00 5.73
256 257 0.882042 GCTGGAGATATGTGCACCGG 60.882 60.000 15.69 0.00 0.00 5.28
257 258 0.105593 AGCTGGAGATATGTGCACCG 59.894 55.000 15.69 0.00 0.00 4.94
258 259 1.945394 CAAGCTGGAGATATGTGCACC 59.055 52.381 15.69 0.00 0.00 5.01
259 260 1.332997 GCAAGCTGGAGATATGTGCAC 59.667 52.381 10.75 10.75 0.00 4.57
260 261 1.671979 GCAAGCTGGAGATATGTGCA 58.328 50.000 0.00 0.00 0.00 4.57
261 262 0.585357 CGCAAGCTGGAGATATGTGC 59.415 55.000 0.00 0.00 0.00 4.57
262 263 1.945387 ACGCAAGCTGGAGATATGTG 58.055 50.000 0.00 0.00 45.62 3.21
263 264 2.036475 CCTACGCAAGCTGGAGATATGT 59.964 50.000 0.00 0.00 45.62 2.29
264 265 2.611473 CCCTACGCAAGCTGGAGATATG 60.611 54.545 0.00 0.00 45.62 1.78
265 266 1.620819 CCCTACGCAAGCTGGAGATAT 59.379 52.381 0.00 0.00 45.62 1.63
266 267 1.040646 CCCTACGCAAGCTGGAGATA 58.959 55.000 0.00 0.00 45.62 1.98
267 268 0.978146 ACCCTACGCAAGCTGGAGAT 60.978 55.000 0.00 0.00 45.62 2.75
268 269 0.323999 TACCCTACGCAAGCTGGAGA 60.324 55.000 0.00 0.00 45.62 3.71
269 270 0.179108 GTACCCTACGCAAGCTGGAG 60.179 60.000 0.00 0.00 45.62 3.86
270 271 0.613853 AGTACCCTACGCAAGCTGGA 60.614 55.000 0.00 0.00 45.62 3.86
271 272 1.067212 CTAGTACCCTACGCAAGCTGG 59.933 57.143 0.00 0.00 45.62 4.85
272 273 1.067212 CCTAGTACCCTACGCAAGCTG 59.933 57.143 0.00 0.00 45.62 4.24
273 274 1.400737 CCTAGTACCCTACGCAAGCT 58.599 55.000 0.00 0.00 45.62 3.74
274 275 0.388294 CCCTAGTACCCTACGCAAGC 59.612 60.000 0.00 0.00 45.62 4.01
276 277 2.234414 CAAACCCTAGTACCCTACGCAA 59.766 50.000 0.00 0.00 0.00 4.85
277 278 1.826720 CAAACCCTAGTACCCTACGCA 59.173 52.381 0.00 0.00 0.00 5.24
278 279 1.137675 CCAAACCCTAGTACCCTACGC 59.862 57.143 0.00 0.00 0.00 4.42
279 280 1.758862 CCCAAACCCTAGTACCCTACG 59.241 57.143 0.00 0.00 0.00 3.51
280 281 3.120468 TCCCAAACCCTAGTACCCTAC 57.880 52.381 0.00 0.00 0.00 3.18
281 282 3.870439 TTCCCAAACCCTAGTACCCTA 57.130 47.619 0.00 0.00 0.00 3.53
282 283 2.747083 TTCCCAAACCCTAGTACCCT 57.253 50.000 0.00 0.00 0.00 4.34
283 284 2.025605 CCTTTCCCAAACCCTAGTACCC 60.026 54.545 0.00 0.00 0.00 3.69
284 285 2.914941 TCCTTTCCCAAACCCTAGTACC 59.085 50.000 0.00 0.00 0.00 3.34
285 286 4.857130 ATCCTTTCCCAAACCCTAGTAC 57.143 45.455 0.00 0.00 0.00 2.73
286 287 4.080751 CGAATCCTTTCCCAAACCCTAGTA 60.081 45.833 0.00 0.00 0.00 1.82
287 288 3.308188 CGAATCCTTTCCCAAACCCTAGT 60.308 47.826 0.00 0.00 0.00 2.57
288 289 3.279434 CGAATCCTTTCCCAAACCCTAG 58.721 50.000 0.00 0.00 0.00 3.02
289 290 2.025699 CCGAATCCTTTCCCAAACCCTA 60.026 50.000 0.00 0.00 0.00 3.53
290 291 1.272480 CCGAATCCTTTCCCAAACCCT 60.272 52.381 0.00 0.00 0.00 4.34
291 292 1.182667 CCGAATCCTTTCCCAAACCC 58.817 55.000 0.00 0.00 0.00 4.11
292 293 0.530744 GCCGAATCCTTTCCCAAACC 59.469 55.000 0.00 0.00 0.00 3.27
293 294 0.530744 GGCCGAATCCTTTCCCAAAC 59.469 55.000 0.00 0.00 0.00 2.93
294 295 0.113385 TGGCCGAATCCTTTCCCAAA 59.887 50.000 0.00 0.00 0.00 3.28
295 296 0.610785 GTGGCCGAATCCTTTCCCAA 60.611 55.000 0.00 0.00 28.70 4.12
296 297 1.001393 GTGGCCGAATCCTTTCCCA 60.001 57.895 0.00 0.00 0.00 4.37
297 298 0.323451 AAGTGGCCGAATCCTTTCCC 60.323 55.000 0.00 0.00 0.00 3.97
298 299 1.545841 AAAGTGGCCGAATCCTTTCC 58.454 50.000 0.00 0.00 0.00 3.13
299 300 2.352715 CCAAAAGTGGCCGAATCCTTTC 60.353 50.000 0.00 0.00 38.35 2.62
300 301 1.618343 CCAAAAGTGGCCGAATCCTTT 59.382 47.619 0.00 0.00 38.35 3.11
301 302 1.256812 CCAAAAGTGGCCGAATCCTT 58.743 50.000 0.00 0.00 38.35 3.36
302 303 2.961424 CCAAAAGTGGCCGAATCCT 58.039 52.632 0.00 0.00 38.35 3.24
322 323 3.140325 TGGAAAGACTGCCTACAAAGG 57.860 47.619 0.00 0.00 46.76 3.11
323 324 3.119708 GCATGGAAAGACTGCCTACAAAG 60.120 47.826 0.00 0.00 0.00 2.77
324 325 2.819608 GCATGGAAAGACTGCCTACAAA 59.180 45.455 0.00 0.00 0.00 2.83
325 326 2.224744 TGCATGGAAAGACTGCCTACAA 60.225 45.455 0.00 0.00 35.02 2.41
326 327 1.350684 TGCATGGAAAGACTGCCTACA 59.649 47.619 0.00 0.00 35.02 2.74
327 328 2.113860 TGCATGGAAAGACTGCCTAC 57.886 50.000 0.00 0.00 35.02 3.18
328 329 3.370840 AATGCATGGAAAGACTGCCTA 57.629 42.857 0.00 0.00 35.02 3.93
329 330 2.226962 AATGCATGGAAAGACTGCCT 57.773 45.000 0.00 0.00 35.02 4.75
330 331 2.231964 TGAAATGCATGGAAAGACTGCC 59.768 45.455 0.00 0.00 35.02 4.85
331 332 3.581024 TGAAATGCATGGAAAGACTGC 57.419 42.857 0.00 0.00 36.45 4.40
361 362 7.809806 GCTACTGAGCTGAAACATTTTGTTTAT 59.190 33.333 5.66 0.00 46.39 1.40
362 363 7.138736 GCTACTGAGCTGAAACATTTTGTTTA 58.861 34.615 5.66 0.00 46.39 2.01
364 365 5.523369 GCTACTGAGCTGAAACATTTTGTT 58.477 37.500 0.00 0.00 45.98 2.83
365 366 5.113502 GCTACTGAGCTGAAACATTTTGT 57.886 39.130 0.00 0.00 45.98 2.83
379 380 2.370281 TTCTTTCCGCAGCTACTGAG 57.630 50.000 0.00 0.00 32.44 3.35
380 381 2.831685 TTTCTTTCCGCAGCTACTGA 57.168 45.000 0.00 0.00 32.44 3.41
381 382 4.034510 CCTTATTTCTTTCCGCAGCTACTG 59.965 45.833 0.00 0.00 34.12 2.74
382 383 4.081087 TCCTTATTTCTTTCCGCAGCTACT 60.081 41.667 0.00 0.00 0.00 2.57
383 384 4.189231 TCCTTATTTCTTTCCGCAGCTAC 58.811 43.478 0.00 0.00 0.00 3.58
384 385 4.481368 TCCTTATTTCTTTCCGCAGCTA 57.519 40.909 0.00 0.00 0.00 3.32
385 386 3.350219 TCCTTATTTCTTTCCGCAGCT 57.650 42.857 0.00 0.00 0.00 4.24
386 387 3.727970 CGTTCCTTATTTCTTTCCGCAGC 60.728 47.826 0.00 0.00 0.00 5.25
387 388 3.682858 TCGTTCCTTATTTCTTTCCGCAG 59.317 43.478 0.00 0.00 0.00 5.18
388 389 3.434299 GTCGTTCCTTATTTCTTTCCGCA 59.566 43.478 0.00 0.00 0.00 5.69
389 390 3.434299 TGTCGTTCCTTATTTCTTTCCGC 59.566 43.478 0.00 0.00 0.00 5.54
390 391 5.600908 TTGTCGTTCCTTATTTCTTTCCG 57.399 39.130 0.00 0.00 0.00 4.30
391 392 6.731164 TGTTTGTCGTTCCTTATTTCTTTCC 58.269 36.000 0.00 0.00 0.00 3.13
392 393 8.623310 TTTGTTTGTCGTTCCTTATTTCTTTC 57.377 30.769 0.00 0.00 0.00 2.62
393 394 8.248253 ACTTTGTTTGTCGTTCCTTATTTCTTT 58.752 29.630 0.00 0.00 0.00 2.52
394 395 7.700656 CACTTTGTTTGTCGTTCCTTATTTCTT 59.299 33.333 0.00 0.00 0.00 2.52
395 396 7.066525 TCACTTTGTTTGTCGTTCCTTATTTCT 59.933 33.333 0.00 0.00 0.00 2.52
396 397 7.165318 GTCACTTTGTTTGTCGTTCCTTATTTC 59.835 37.037 0.00 0.00 0.00 2.17
397 398 6.970613 GTCACTTTGTTTGTCGTTCCTTATTT 59.029 34.615 0.00 0.00 0.00 1.40
398 399 6.094325 TGTCACTTTGTTTGTCGTTCCTTATT 59.906 34.615 0.00 0.00 0.00 1.40
399 400 5.587043 TGTCACTTTGTTTGTCGTTCCTTAT 59.413 36.000 0.00 0.00 0.00 1.73
400 401 4.936411 TGTCACTTTGTTTGTCGTTCCTTA 59.064 37.500 0.00 0.00 0.00 2.69
401 402 3.754323 TGTCACTTTGTTTGTCGTTCCTT 59.246 39.130 0.00 0.00 0.00 3.36
402 403 3.340034 TGTCACTTTGTTTGTCGTTCCT 58.660 40.909 0.00 0.00 0.00 3.36
403 404 3.750639 TGTCACTTTGTTTGTCGTTCC 57.249 42.857 0.00 0.00 0.00 3.62
404 405 5.060446 CCTTTTGTCACTTTGTTTGTCGTTC 59.940 40.000 0.00 0.00 0.00 3.95
405 406 4.920927 CCTTTTGTCACTTTGTTTGTCGTT 59.079 37.500 0.00 0.00 0.00 3.85
406 407 4.481463 CCTTTTGTCACTTTGTTTGTCGT 58.519 39.130 0.00 0.00 0.00 4.34
407 408 3.303229 GCCTTTTGTCACTTTGTTTGTCG 59.697 43.478 0.00 0.00 0.00 4.35
408 409 3.616821 GGCCTTTTGTCACTTTGTTTGTC 59.383 43.478 0.00 0.00 0.00 3.18
409 410 3.595173 GGCCTTTTGTCACTTTGTTTGT 58.405 40.909 0.00 0.00 0.00 2.83
410 411 2.602660 CGGCCTTTTGTCACTTTGTTTG 59.397 45.455 0.00 0.00 0.00 2.93
411 412 2.418060 CCGGCCTTTTGTCACTTTGTTT 60.418 45.455 0.00 0.00 0.00 2.83
412 413 1.136110 CCGGCCTTTTGTCACTTTGTT 59.864 47.619 0.00 0.00 0.00 2.83
413 414 0.744281 CCGGCCTTTTGTCACTTTGT 59.256 50.000 0.00 0.00 0.00 2.83
414 415 0.597377 GCCGGCCTTTTGTCACTTTG 60.597 55.000 18.11 0.00 0.00 2.77
415 416 0.755327 AGCCGGCCTTTTGTCACTTT 60.755 50.000 26.15 0.00 0.00 2.66
416 417 1.152756 AGCCGGCCTTTTGTCACTT 60.153 52.632 26.15 0.00 0.00 3.16
417 418 1.898574 CAGCCGGCCTTTTGTCACT 60.899 57.895 26.15 0.00 0.00 3.41
418 419 2.644992 CAGCCGGCCTTTTGTCAC 59.355 61.111 26.15 0.00 0.00 3.67
419 420 2.597217 CCAGCCGGCCTTTTGTCA 60.597 61.111 26.15 0.00 0.00 3.58
431 432 3.752339 CAAAGAAGCCGGCCAGCC 61.752 66.667 26.15 10.00 0.00 4.85
432 433 2.048603 ATCAAAGAAGCCGGCCAGC 61.049 57.895 26.15 13.20 0.00 4.85
433 434 0.962356 ACATCAAAGAAGCCGGCCAG 60.962 55.000 26.15 6.94 0.00 4.85
434 435 0.326595 TACATCAAAGAAGCCGGCCA 59.673 50.000 26.15 0.00 0.00 5.36
435 436 1.680338 ATACATCAAAGAAGCCGGCC 58.320 50.000 26.15 9.10 0.00 6.13
436 437 5.438761 AAATATACATCAAAGAAGCCGGC 57.561 39.130 21.89 21.89 0.00 6.13
473 474 9.639563 TGCCAAATCCATCTATCTTTAATTACA 57.360 29.630 0.00 0.00 0.00 2.41
475 476 9.300681 CCTGCCAAATCCATCTATCTTTAATTA 57.699 33.333 0.00 0.00 0.00 1.40
476 477 7.256083 GCCTGCCAAATCCATCTATCTTTAATT 60.256 37.037 0.00 0.00 0.00 1.40
477 478 6.210185 GCCTGCCAAATCCATCTATCTTTAAT 59.790 38.462 0.00 0.00 0.00 1.40
478 479 5.536161 GCCTGCCAAATCCATCTATCTTTAA 59.464 40.000 0.00 0.00 0.00 1.52
479 480 5.072741 GCCTGCCAAATCCATCTATCTTTA 58.927 41.667 0.00 0.00 0.00 1.85
480 481 3.893813 GCCTGCCAAATCCATCTATCTTT 59.106 43.478 0.00 0.00 0.00 2.52
481 482 3.117398 TGCCTGCCAAATCCATCTATCTT 60.117 43.478 0.00 0.00 0.00 2.40
482 483 2.444388 TGCCTGCCAAATCCATCTATCT 59.556 45.455 0.00 0.00 0.00 1.98
483 484 2.867624 TGCCTGCCAAATCCATCTATC 58.132 47.619 0.00 0.00 0.00 2.08
484 485 3.317455 TTGCCTGCCAAATCCATCTAT 57.683 42.857 0.00 0.00 0.00 1.98
485 486 2.824689 TTGCCTGCCAAATCCATCTA 57.175 45.000 0.00 0.00 0.00 1.98
486 487 1.829222 CTTTGCCTGCCAAATCCATCT 59.171 47.619 0.00 0.00 42.22 2.90
487 488 1.134610 CCTTTGCCTGCCAAATCCATC 60.135 52.381 0.00 0.00 42.22 3.51
488 489 0.906775 CCTTTGCCTGCCAAATCCAT 59.093 50.000 0.00 0.00 42.22 3.41
489 490 1.829523 GCCTTTGCCTGCCAAATCCA 61.830 55.000 0.00 0.00 42.22 3.41
490 491 1.078918 GCCTTTGCCTGCCAAATCC 60.079 57.895 0.00 0.00 42.22 3.01
491 492 0.251073 ATGCCTTTGCCTGCCAAATC 59.749 50.000 0.00 0.00 42.22 2.17
492 493 0.251073 GATGCCTTTGCCTGCCAAAT 59.749 50.000 0.00 0.00 42.22 2.32
493 494 1.120184 TGATGCCTTTGCCTGCCAAA 61.120 50.000 0.00 0.00 40.97 3.28
494 495 1.533513 TGATGCCTTTGCCTGCCAA 60.534 52.632 0.00 0.00 36.33 4.52
495 496 2.117858 TGATGCCTTTGCCTGCCA 59.882 55.556 0.00 0.00 36.33 4.92
496 497 2.575461 GTGATGCCTTTGCCTGCC 59.425 61.111 0.00 0.00 36.33 4.85
497 498 2.180017 CGTGATGCCTTTGCCTGC 59.820 61.111 0.00 0.00 36.33 4.85
498 499 2.180017 GCGTGATGCCTTTGCCTG 59.820 61.111 0.00 0.00 37.76 4.85
499 500 3.434319 CGCGTGATGCCTTTGCCT 61.434 61.111 0.00 0.00 42.08 4.75
501 502 3.615536 AAGCGCGTGATGCCTTTGC 62.616 57.895 8.43 0.00 42.08 3.68
502 503 1.067199 GAAAGCGCGTGATGCCTTTG 61.067 55.000 8.43 0.00 41.27 2.77
503 504 1.210155 GAAAGCGCGTGATGCCTTT 59.790 52.632 8.43 7.46 42.77 3.11
504 505 1.639298 GAGAAAGCGCGTGATGCCTT 61.639 55.000 8.43 0.00 42.08 4.35
505 506 2.046892 AGAAAGCGCGTGATGCCT 60.047 55.556 8.43 0.00 42.08 4.75
506 507 2.390599 TGAGAAAGCGCGTGATGCC 61.391 57.895 8.43 0.00 42.08 4.40
507 508 1.225854 GTGAGAAAGCGCGTGATGC 60.226 57.895 8.43 0.00 41.47 3.91
508 509 1.291184 TGGTGAGAAAGCGCGTGATG 61.291 55.000 8.43 0.00 0.00 3.07
509 510 0.391661 ATGGTGAGAAAGCGCGTGAT 60.392 50.000 8.43 0.00 0.00 3.06
510 511 1.005037 ATGGTGAGAAAGCGCGTGA 60.005 52.632 8.43 0.00 0.00 4.35
511 512 1.133253 CATGGTGAGAAAGCGCGTG 59.867 57.895 8.43 0.00 0.00 5.34
512 513 2.034879 CCATGGTGAGAAAGCGCGT 61.035 57.895 8.43 0.00 0.00 6.01
513 514 2.787249 CCATGGTGAGAAAGCGCG 59.213 61.111 2.57 0.00 0.00 6.86
514 515 1.986575 GAGCCATGGTGAGAAAGCGC 61.987 60.000 14.67 0.00 0.00 5.92
515 516 0.392193 AGAGCCATGGTGAGAAAGCG 60.392 55.000 14.67 0.00 0.00 4.68
516 517 1.471684 CAAGAGCCATGGTGAGAAAGC 59.528 52.381 14.67 0.00 0.00 3.51
517 518 1.471684 GCAAGAGCCATGGTGAGAAAG 59.528 52.381 14.67 0.00 33.58 2.62
518 519 1.074405 AGCAAGAGCCATGGTGAGAAA 59.926 47.619 14.67 0.00 43.56 2.52
519 520 0.694771 AGCAAGAGCCATGGTGAGAA 59.305 50.000 14.67 0.00 43.56 2.87
520 521 1.571955 TAGCAAGAGCCATGGTGAGA 58.428 50.000 14.67 0.00 43.56 3.27
521 522 2.104451 AGATAGCAAGAGCCATGGTGAG 59.896 50.000 14.67 0.54 43.56 3.51
522 523 2.103771 GAGATAGCAAGAGCCATGGTGA 59.896 50.000 14.67 0.00 43.56 4.02
523 524 2.492012 GAGATAGCAAGAGCCATGGTG 58.508 52.381 14.67 4.51 43.56 4.17
524 525 1.419387 GGAGATAGCAAGAGCCATGGT 59.581 52.381 14.67 0.00 43.56 3.55
525 526 1.607509 CGGAGATAGCAAGAGCCATGG 60.608 57.143 7.63 7.63 43.56 3.66
526 527 1.793258 CGGAGATAGCAAGAGCCATG 58.207 55.000 0.00 0.00 43.56 3.66
527 528 0.034616 GCGGAGATAGCAAGAGCCAT 59.965 55.000 0.00 0.00 43.56 4.40
528 529 1.329913 TGCGGAGATAGCAAGAGCCA 61.330 55.000 0.00 0.00 42.18 4.75
529 530 0.599728 CTGCGGAGATAGCAAGAGCC 60.600 60.000 0.00 0.00 44.67 4.70
530 531 1.220817 GCTGCGGAGATAGCAAGAGC 61.221 60.000 8.65 0.00 44.67 4.09
531 532 0.103755 TGCTGCGGAGATAGCAAGAG 59.896 55.000 8.65 0.00 43.93 2.85
532 533 2.201927 TGCTGCGGAGATAGCAAGA 58.798 52.632 8.65 0.00 43.93 3.02
533 534 4.842292 TGCTGCGGAGATAGCAAG 57.158 55.556 8.65 0.00 43.93 4.01
535 536 2.104928 CGTGCTGCGGAGATAGCA 59.895 61.111 8.65 0.00 44.49 3.49
536 537 1.946650 GACGTGCTGCGGAGATAGC 60.947 63.158 8.65 0.00 46.52 2.97
537 538 1.299468 GGACGTGCTGCGGAGATAG 60.299 63.158 8.65 0.00 46.52 2.08
538 539 2.805546 GGACGTGCTGCGGAGATA 59.194 61.111 8.65 0.00 46.52 1.98
539 540 4.498520 CGGACGTGCTGCGGAGAT 62.499 66.667 8.65 0.00 46.52 2.75
545 546 1.847890 TTTAAAGCCGGACGTGCTGC 61.848 55.000 15.43 15.43 39.48 5.25
546 547 0.110373 GTTTAAAGCCGGACGTGCTG 60.110 55.000 5.05 0.00 39.48 4.41
547 548 1.232621 GGTTTAAAGCCGGACGTGCT 61.233 55.000 5.05 0.00 41.89 4.40
548 549 1.208358 GGTTTAAAGCCGGACGTGC 59.792 57.895 5.05 0.00 0.00 5.34
549 550 0.236449 GTGGTTTAAAGCCGGACGTG 59.764 55.000 5.05 0.00 0.00 4.49
550 551 0.886043 GGTGGTTTAAAGCCGGACGT 60.886 55.000 5.05 0.00 0.00 4.34
551 552 0.885596 TGGTGGTTTAAAGCCGGACG 60.886 55.000 5.05 0.00 0.00 4.79
552 553 0.594602 GTGGTGGTTTAAAGCCGGAC 59.405 55.000 5.05 6.40 0.00 4.79
553 554 0.885596 CGTGGTGGTTTAAAGCCGGA 60.886 55.000 5.05 0.00 0.00 5.14
554 555 1.577421 CGTGGTGGTTTAAAGCCGG 59.423 57.895 14.49 0.00 0.00 6.13
555 556 1.081708 GCGTGGTGGTTTAAAGCCG 60.082 57.895 14.49 11.28 0.00 5.52
556 557 1.081708 CGCGTGGTGGTTTAAAGCC 60.082 57.895 14.49 7.30 0.00 4.35
557 558 1.081708 CCGCGTGGTGGTTTAAAGC 60.082 57.895 6.91 10.47 0.00 3.51
568 569 2.434359 GGGAGAGAAACCGCGTGG 60.434 66.667 14.93 14.93 42.84 4.94
569 570 2.027625 GTGGGAGAGAAACCGCGTG 61.028 63.158 4.92 0.00 0.00 5.34
570 571 2.342648 GTGGGAGAGAAACCGCGT 59.657 61.111 4.92 0.00 0.00 6.01
572 573 3.119096 GCGTGGGAGAGAAACCGC 61.119 66.667 0.00 0.00 0.00 5.68
573 574 2.434359 GGCGTGGGAGAGAAACCG 60.434 66.667 0.00 0.00 0.00 4.44
574 575 1.376037 CAGGCGTGGGAGAGAAACC 60.376 63.158 0.00 0.00 0.00 3.27
575 576 0.390472 CTCAGGCGTGGGAGAGAAAC 60.390 60.000 0.00 0.00 32.87 2.78
576 577 0.541998 TCTCAGGCGTGGGAGAGAAA 60.542 55.000 4.49 0.00 35.34 2.52
577 578 0.541998 TTCTCAGGCGTGGGAGAGAA 60.542 55.000 9.25 6.62 42.85 2.87
578 579 1.076727 TTCTCAGGCGTGGGAGAGA 59.923 57.895 9.25 0.20 40.91 3.10
579 580 1.216710 GTTCTCAGGCGTGGGAGAG 59.783 63.158 9.25 0.00 40.91 3.20
580 581 2.283529 GGTTCTCAGGCGTGGGAGA 61.284 63.158 9.25 1.33 33.50 3.71
581 582 2.266055 GGTTCTCAGGCGTGGGAG 59.734 66.667 9.25 0.00 33.50 4.30
582 583 3.319198 GGGTTCTCAGGCGTGGGA 61.319 66.667 4.49 4.49 0.00 4.37
583 584 4.410400 GGGGTTCTCAGGCGTGGG 62.410 72.222 6.56 2.56 0.00 4.61
584 585 3.636231 TGGGGTTCTCAGGCGTGG 61.636 66.667 6.56 0.00 0.00 4.94
585 586 2.358737 GTGGGGTTCTCAGGCGTG 60.359 66.667 0.00 0.00 0.00 5.34
586 587 2.847234 TGTGGGGTTCTCAGGCGT 60.847 61.111 0.00 0.00 0.00 5.68
587 588 2.358737 GTGTGGGGTTCTCAGGCG 60.359 66.667 0.00 0.00 0.00 5.52
588 589 1.302832 CAGTGTGGGGTTCTCAGGC 60.303 63.158 0.00 0.00 0.00 4.85
589 590 1.302832 GCAGTGTGGGGTTCTCAGG 60.303 63.158 0.00 0.00 0.00 3.86
590 591 0.321122 GAGCAGTGTGGGGTTCTCAG 60.321 60.000 0.00 0.00 0.00 3.35
591 592 1.754745 GAGCAGTGTGGGGTTCTCA 59.245 57.895 0.00 0.00 0.00 3.27
592 593 1.003233 GGAGCAGTGTGGGGTTCTC 60.003 63.158 0.00 0.00 0.00 2.87
593 594 2.529744 GGGAGCAGTGTGGGGTTCT 61.530 63.158 0.00 0.00 0.00 3.01
594 595 2.034221 GGGAGCAGTGTGGGGTTC 59.966 66.667 0.00 0.00 0.00 3.62
595 596 3.953775 CGGGAGCAGTGTGGGGTT 61.954 66.667 0.00 0.00 0.00 4.11
596 597 4.954118 TCGGGAGCAGTGTGGGGT 62.954 66.667 0.00 0.00 0.00 4.95
597 598 4.087892 CTCGGGAGCAGTGTGGGG 62.088 72.222 0.00 0.00 0.00 4.96
598 599 4.087892 CCTCGGGAGCAGTGTGGG 62.088 72.222 0.00 0.00 0.00 4.61
599 600 2.997315 TCCTCGGGAGCAGTGTGG 60.997 66.667 0.00 0.00 0.00 4.17
600 601 2.262915 GTCCTCGGGAGCAGTGTG 59.737 66.667 0.00 0.00 29.39 3.82
601 602 3.374402 CGTCCTCGGGAGCAGTGT 61.374 66.667 0.00 0.00 29.39 3.55
602 603 4.803426 GCGTCCTCGGGAGCAGTG 62.803 72.222 0.00 0.00 37.56 3.66
607 608 4.148825 CAAGGGCGTCCTCGGGAG 62.149 72.222 10.20 0.00 44.07 4.30
641 642 4.470170 TCGATGTCGCACCGTCCG 62.470 66.667 0.00 0.00 39.60 4.79
642 643 2.879462 GTCGATGTCGCACCGTCC 60.879 66.667 0.00 0.00 39.60 4.79
643 644 3.238241 CGTCGATGTCGCACCGTC 61.238 66.667 0.00 0.00 39.60 4.79
644 645 2.736343 TTTCGTCGATGTCGCACCGT 62.736 55.000 4.21 0.00 39.60 4.83
645 646 1.998550 CTTTCGTCGATGTCGCACCG 61.999 60.000 4.21 0.73 39.60 4.94
646 647 1.702299 CTTTCGTCGATGTCGCACC 59.298 57.895 4.21 0.00 39.60 5.01
647 648 1.057361 GCTTTCGTCGATGTCGCAC 59.943 57.895 4.21 0.00 39.60 5.34
648 649 0.666274 AAGCTTTCGTCGATGTCGCA 60.666 50.000 4.21 0.00 39.60 5.10
649 650 0.438830 AAAGCTTTCGTCGATGTCGC 59.561 50.000 5.69 6.05 39.60 5.19
650 651 2.096909 ACAAAAGCTTTCGTCGATGTCG 60.097 45.455 13.10 0.00 41.45 4.35
651 652 3.521524 ACAAAAGCTTTCGTCGATGTC 57.478 42.857 13.10 0.00 0.00 3.06
652 653 3.560068 AGAACAAAAGCTTTCGTCGATGT 59.440 39.130 13.10 9.11 0.00 3.06
653 654 4.133856 AGAACAAAAGCTTTCGTCGATG 57.866 40.909 13.10 8.43 0.00 3.84
654 655 3.186613 GGAGAACAAAAGCTTTCGTCGAT 59.813 43.478 13.10 0.00 0.00 3.59
655 656 2.542595 GGAGAACAAAAGCTTTCGTCGA 59.457 45.455 13.10 0.00 0.00 4.20
656 657 2.544267 AGGAGAACAAAAGCTTTCGTCG 59.456 45.455 13.10 4.36 0.00 5.12
657 658 3.560068 TGAGGAGAACAAAAGCTTTCGTC 59.440 43.478 13.10 10.33 0.00 4.20
658 659 3.541632 TGAGGAGAACAAAAGCTTTCGT 58.458 40.909 13.10 4.12 0.00 3.85
659 660 4.201910 TGTTGAGGAGAACAAAAGCTTTCG 60.202 41.667 13.10 3.31 32.84 3.46
660 661 5.248870 TGTTGAGGAGAACAAAAGCTTTC 57.751 39.130 13.10 0.00 32.84 2.62
661 662 5.654497 CTTGTTGAGGAGAACAAAAGCTTT 58.346 37.500 5.69 5.69 43.48 3.51
662 663 5.254339 CTTGTTGAGGAGAACAAAAGCTT 57.746 39.130 0.00 0.00 43.48 3.74
663 664 4.907879 CTTGTTGAGGAGAACAAAAGCT 57.092 40.909 0.00 0.00 43.48 3.74
676 677 6.483307 TGTTGATCTTGAGTAACCTTGTTGAG 59.517 38.462 0.00 0.00 0.00 3.02
677 678 6.353323 TGTTGATCTTGAGTAACCTTGTTGA 58.647 36.000 0.00 0.00 0.00 3.18
678 679 6.618287 TGTTGATCTTGAGTAACCTTGTTG 57.382 37.500 0.00 0.00 0.00 3.33
679 680 6.772716 ACATGTTGATCTTGAGTAACCTTGTT 59.227 34.615 0.00 0.00 0.00 2.83
680 681 6.299141 ACATGTTGATCTTGAGTAACCTTGT 58.701 36.000 0.00 0.00 0.00 3.16
681 682 6.652481 AGACATGTTGATCTTGAGTAACCTTG 59.348 38.462 0.00 0.00 0.00 3.61
682 683 6.773638 AGACATGTTGATCTTGAGTAACCTT 58.226 36.000 0.00 0.00 0.00 3.50
683 684 6.365970 AGACATGTTGATCTTGAGTAACCT 57.634 37.500 0.00 0.00 0.00 3.50
684 685 6.092807 GGAAGACATGTTGATCTTGAGTAACC 59.907 42.308 0.00 0.00 35.29 2.85
685 686 6.092807 GGGAAGACATGTTGATCTTGAGTAAC 59.907 42.308 0.00 0.00 35.29 2.50
686 687 6.173339 GGGAAGACATGTTGATCTTGAGTAA 58.827 40.000 0.00 0.00 35.29 2.24
687 688 5.624509 CGGGAAGACATGTTGATCTTGAGTA 60.625 44.000 0.00 0.00 35.29 2.59
688 689 4.583871 GGGAAGACATGTTGATCTTGAGT 58.416 43.478 0.00 0.00 35.29 3.41
689 690 3.620374 CGGGAAGACATGTTGATCTTGAG 59.380 47.826 0.00 0.00 35.29 3.02
690 691 3.260632 TCGGGAAGACATGTTGATCTTGA 59.739 43.478 0.00 0.00 35.29 3.02
691 692 3.599343 TCGGGAAGACATGTTGATCTTG 58.401 45.455 0.00 0.00 35.29 3.02
692 693 3.981071 TCGGGAAGACATGTTGATCTT 57.019 42.857 0.00 0.00 37.88 2.40
693 694 3.261897 AGTTCGGGAAGACATGTTGATCT 59.738 43.478 0.00 0.00 0.00 2.75
694 695 3.372206 CAGTTCGGGAAGACATGTTGATC 59.628 47.826 0.00 0.00 0.00 2.92
695 696 3.338249 CAGTTCGGGAAGACATGTTGAT 58.662 45.455 0.00 0.00 0.00 2.57
696 697 2.766313 CAGTTCGGGAAGACATGTTGA 58.234 47.619