Multiple sequence alignment - TraesCS1A01G005700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G005700 chr1A 100.000 6624 0 0 807 7430 3377790 3384413 0.000000e+00 12233.0
1 TraesCS1A01G005700 chr1A 100.000 429 0 0 1 429 3376984 3377412 0.000000e+00 793.0
2 TraesCS1A01G005700 chr1A 89.016 610 51 9 2460 3058 216958325 216958929 0.000000e+00 741.0
3 TraesCS1A01G005700 chr1A 96.396 111 4 0 2355 2465 537745562 537745672 4.580000e-42 183.0
4 TraesCS1A01G005700 chr1A 88.811 143 7 4 3266 3399 10549595 10549737 4.610000e-37 167.0
5 TraesCS1A01G005700 chr1A 97.015 67 2 0 2290 2356 216958260 216958326 6.090000e-21 113.0
6 TraesCS1A01G005700 chr1A 97.015 67 2 0 2290 2356 422945551 422945485 6.090000e-21 113.0
7 TraesCS1A01G005700 chr1D 90.916 3831 211 59 3004 6735 570957 574749 0.000000e+00 5020.0
8 TraesCS1A01G005700 chr1D 84.901 1510 147 42 888 2350 568770 570245 0.000000e+00 1450.0
9 TraesCS1A01G005700 chr1D 91.964 112 9 0 24 135 36546883 36546772 2.780000e-34 158.0
10 TraesCS1A01G005700 chr1B 89.676 3458 240 54 3193 6574 4339497 4342913 0.000000e+00 4300.0
11 TraesCS1A01G005700 chr1B 80.156 514 78 12 1822 2329 125863529 125864024 5.480000e-96 363.0
12 TraesCS1A01G005700 chr1B 87.838 222 25 2 4690 4910 24104323 24104103 7.400000e-65 259.0
13 TraesCS1A01G005700 chr1B 84.921 252 30 4 2012 2256 125863928 125864178 1.600000e-61 248.0
14 TraesCS1A01G005700 chr1B 80.000 125 4 8 6579 6682 4342940 4343064 1.030000e-08 73.1
15 TraesCS1A01G005700 chr1B 82.143 84 13 2 7037 7119 240493576 240493494 3.720000e-08 71.3
16 TraesCS1A01G005700 chr5D 90.984 610 41 9 2460 3058 558304130 558304736 0.000000e+00 809.0
17 TraesCS1A01G005700 chr5D 82.955 88 14 1 7033 7119 43906894 43906807 2.220000e-10 78.7
18 TraesCS1A01G005700 chr3D 90.312 609 46 8 2460 3058 56402440 56401835 0.000000e+00 785.0
19 TraesCS1A01G005700 chr3D 97.015 67 2 0 2290 2356 56402505 56402439 6.090000e-21 113.0
20 TraesCS1A01G005700 chr7D 90.164 610 46 9 2460 3058 60104845 60104239 0.000000e+00 782.0
21 TraesCS1A01G005700 chr4A 90.164 610 46 9 2460 3058 298306226 298306832 0.000000e+00 782.0
22 TraesCS1A01G005700 chr4A 84.401 359 41 7 2012 2356 252446563 252446206 9.230000e-89 339.0
23 TraesCS1A01G005700 chr4A 98.148 108 2 0 2354 2461 58915078 58915185 9.840000e-44 189.0
24 TraesCS1A01G005700 chr4A 94.783 115 5 1 2355 2468 175561795 175561681 2.130000e-40 178.0
25 TraesCS1A01G005700 chr4A 88.112 143 8 4 3266 3399 194707403 194707261 2.150000e-35 161.0
26 TraesCS1A01G005700 chr4A 88.112 143 8 4 3266 3399 401978870 401979012 2.150000e-35 161.0
27 TraesCS1A01G005700 chr4A 92.727 110 8 0 24 133 4498005 4497896 7.720000e-35 159.0
28 TraesCS1A01G005700 chr2D 90.164 610 46 9 2460 3058 303083322 303082716 0.000000e+00 782.0
29 TraesCS1A01G005700 chr2D 92.857 112 8 0 24 135 247054866 247054977 5.960000e-36 163.0
30 TraesCS1A01G005700 chr2D 90.000 60 4 2 7054 7112 7125574 7125632 7.990000e-10 76.8
31 TraesCS1A01G005700 chr2B 89.344 610 51 11 2460 3058 127488088 127488694 0.000000e+00 754.0
32 TraesCS1A01G005700 chr2B 88.288 222 24 2 4690 4910 319357288 319357508 1.590000e-66 265.0
33 TraesCS1A01G005700 chr2A 87.383 642 70 8 2460 3092 282530766 282530127 0.000000e+00 726.0
34 TraesCS1A01G005700 chr2A 84.594 357 42 7 2012 2356 282531120 282530765 7.140000e-90 342.0
35 TraesCS1A01G005700 chr2A 86.607 224 26 3 4690 4910 759960417 759960639 2.070000e-60 244.0
36 TraesCS1A01G005700 chr2A 96.396 111 4 0 2351 2461 111501141 111501251 4.580000e-42 183.0
37 TraesCS1A01G005700 chr2A 96.364 110 4 0 2353 2462 763687571 763687462 1.650000e-41 182.0
38 TraesCS1A01G005700 chr2A 88.811 143 7 4 3266 3399 7371603 7371461 4.610000e-37 167.0
39 TraesCS1A01G005700 chr2A 88.811 143 7 4 3266 3399 374010271 374010413 4.610000e-37 167.0
40 TraesCS1A01G005700 chr2A 84.138 145 18 3 2321 2461 763687426 763687569 1.300000e-27 135.0
41 TraesCS1A01G005700 chr6A 87.500 584 59 7 2460 3033 72247703 72247124 0.000000e+00 662.0
42 TraesCS1A01G005700 chr6A 95.798 119 4 1 24 141 597863001 597862883 2.740000e-44 191.0
43 TraesCS1A01G005700 chr6A 91.892 111 9 0 24 134 222490909 222490799 9.980000e-34 156.0
44 TraesCS1A01G005700 chrUn 80.804 547 75 15 1822 2356 96636576 96636048 1.160000e-107 401.0
45 TraesCS1A01G005700 chrUn 86.800 250 27 3 2013 2256 96636176 96635927 2.640000e-69 274.0
46 TraesCS1A01G005700 chr7A 84.314 357 43 7 2012 2356 525237028 525236673 3.320000e-88 337.0
47 TraesCS1A01G005700 chr7A 88.571 140 14 2 2322 2461 691514123 691514260 1.280000e-37 169.0
48 TraesCS1A01G005700 chr7A 88.811 143 7 4 3266 3399 525236002 525235860 4.610000e-37 167.0
49 TraesCS1A01G005700 chr3A 83.754 357 45 7 2012 2356 229385890 229385535 7.190000e-85 326.0
50 TraesCS1A01G005700 chr3A 88.739 222 23 2 4690 4910 549370243 549370023 3.420000e-68 270.0
51 TraesCS1A01G005700 chr3A 96.262 107 4 0 2355 2461 638776784 638776678 7.660000e-40 176.0
52 TraesCS1A01G005700 chr3A 92.500 120 9 0 2352 2471 651627754 651627873 9.910000e-39 172.0
53 TraesCS1A01G005700 chr3A 93.162 117 8 0 2355 2471 657423037 657423153 9.910000e-39 172.0
54 TraesCS1A01G005700 chr3A 88.811 143 7 4 3266 3399 272221507 272221649 4.610000e-37 167.0
55 TraesCS1A01G005700 chr3A 88.811 143 7 4 3266 3399 347187777 347187919 4.610000e-37 167.0
56 TraesCS1A01G005700 chr3A 91.964 112 9 0 24 135 454160996 454160885 2.780000e-34 158.0
57 TraesCS1A01G005700 chr3A 92.683 41 2 1 7068 7107 311982001 311982041 2.900000e-04 58.4
58 TraesCS1A01G005700 chr3A 100.000 29 0 0 7079 7107 311982054 311982082 4.000000e-03 54.7
59 TraesCS1A01G005700 chr3B 85.317 252 29 4 2012 2256 88474323 88474073 3.440000e-63 254.0
60 TraesCS1A01G005700 chr3B 85.375 253 27 5 2012 2256 763366092 763365842 3.440000e-63 254.0
61 TraesCS1A01G005700 chr5B 78.624 407 61 13 1946 2342 61801882 61801492 5.760000e-61 246.0
62 TraesCS1A01G005700 chr6D 93.750 112 7 0 24 135 357742653 357742764 1.280000e-37 169.0
63 TraesCS1A01G005700 chr4D 91.304 115 8 2 24 137 438105409 438105522 9.980000e-34 156.0
64 TraesCS1A01G005700 chr4D 90.678 118 10 1 25 141 493331776 493331659 9.980000e-34 156.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G005700 chr1A 3376984 3384413 7429 False 6513.00 12233 100.0000 1 7430 2 chr1A.!!$F3 7429
1 TraesCS1A01G005700 chr1A 216958260 216958929 669 False 427.00 741 93.0155 2290 3058 2 chr1A.!!$F4 768
2 TraesCS1A01G005700 chr1D 568770 574749 5979 False 3235.00 5020 87.9085 888 6735 2 chr1D.!!$F1 5847
3 TraesCS1A01G005700 chr1B 4339497 4343064 3567 False 2186.55 4300 84.8380 3193 6682 2 chr1B.!!$F1 3489
4 TraesCS1A01G005700 chr1B 125863529 125864178 649 False 305.50 363 82.5385 1822 2329 2 chr1B.!!$F2 507
5 TraesCS1A01G005700 chr5D 558304130 558304736 606 False 809.00 809 90.9840 2460 3058 1 chr5D.!!$F1 598
6 TraesCS1A01G005700 chr3D 56401835 56402505 670 True 449.00 785 93.6635 2290 3058 2 chr3D.!!$R1 768
7 TraesCS1A01G005700 chr7D 60104239 60104845 606 True 782.00 782 90.1640 2460 3058 1 chr7D.!!$R1 598
8 TraesCS1A01G005700 chr4A 298306226 298306832 606 False 782.00 782 90.1640 2460 3058 1 chr4A.!!$F2 598
9 TraesCS1A01G005700 chr2D 303082716 303083322 606 True 782.00 782 90.1640 2460 3058 1 chr2D.!!$R1 598
10 TraesCS1A01G005700 chr2B 127488088 127488694 606 False 754.00 754 89.3440 2460 3058 1 chr2B.!!$F1 598
11 TraesCS1A01G005700 chr2A 282530127 282531120 993 True 534.00 726 85.9885 2012 3092 2 chr2A.!!$R3 1080
12 TraesCS1A01G005700 chr6A 72247124 72247703 579 True 662.00 662 87.5000 2460 3033 1 chr6A.!!$R1 573
13 TraesCS1A01G005700 chrUn 96635927 96636576 649 True 337.50 401 83.8020 1822 2356 2 chrUn.!!$R1 534
14 TraesCS1A01G005700 chr7A 525235860 525237028 1168 True 252.00 337 86.5625 2012 3399 2 chr7A.!!$R1 1387


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
286 287 0.034670 ATCTGAAGCAAGGGCAGTCC 60.035 55.0 0.00 0.00 44.61 3.85 F
859 860 0.035036 GGCCTAGAAATAGGGGCGAC 59.965 60.0 0.00 0.00 44.91 5.19 F
1496 1500 0.035725 CTCCCCTCCCCGTGTTTTAC 60.036 60.0 0.00 0.00 0.00 2.01 F
2131 2390 0.038159 GCTCGGTGCTTGTCTGTAGT 60.038 55.0 0.00 0.00 38.95 2.73 F
2237 2496 0.109597 GGGAGCGTTGTTCAGCATTG 60.110 55.0 0.00 0.00 35.48 2.82 F
2250 2509 0.179156 AGCATTGCTTACATGTGCGC 60.179 50.0 9.11 11.25 40.66 6.09 F
3212 3750 0.183492 GCCTATGCATGTTCCTCCCA 59.817 55.0 10.16 0.00 37.47 4.37 F
4746 5323 0.532862 CTCCTGAAACTGGTGTGCGT 60.533 55.0 0.00 0.00 0.00 5.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2205 2464 0.035439 CGCTCCCAGGTAAACACCAT 60.035 55.000 0.00 0.0 0.00 3.55 R
2218 2477 0.109597 CAATGCTGAACAACGCTCCC 60.110 55.000 0.00 0.0 0.00 4.30 R
3193 3731 0.183492 TGGGAGGAACATGCATAGGC 59.817 55.000 0.00 0.0 41.68 3.93 R
4071 4636 0.178897 TCCCAGGTTTCCCCGACTAA 60.179 55.000 0.00 0.0 38.74 2.24 R
4073 4638 1.462627 TTCCCAGGTTTCCCCGACT 60.463 57.895 0.00 0.0 38.74 4.18 R
4118 4683 1.820519 GCAACATGAGGGAAATGAGCA 59.179 47.619 0.00 0.0 33.20 4.26 R
4807 5384 0.179020 TTGAACCTCTGCACAGGGTG 60.179 55.000 13.08 0.0 37.96 4.61 R
6433 7070 0.243907 CGCTCCTCTTCTTCAACGGA 59.756 55.000 0.00 0.0 0.00 4.69 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 5.168526 TCATTTACACAATCGCATTAGCC 57.831 39.130 0.00 0.00 37.52 3.93
23 24 4.881273 TCATTTACACAATCGCATTAGCCT 59.119 37.500 0.00 0.00 37.52 4.58
24 25 5.356751 TCATTTACACAATCGCATTAGCCTT 59.643 36.000 0.00 0.00 37.52 4.35
25 26 6.540551 TCATTTACACAATCGCATTAGCCTTA 59.459 34.615 0.00 0.00 37.52 2.69
26 27 6.745159 TTTACACAATCGCATTAGCCTTAA 57.255 33.333 0.00 0.00 37.52 1.85
27 28 6.745159 TTACACAATCGCATTAGCCTTAAA 57.255 33.333 0.00 0.00 37.52 1.52
28 29 5.637006 ACACAATCGCATTAGCCTTAAAA 57.363 34.783 0.00 0.00 37.52 1.52
29 30 6.019779 ACACAATCGCATTAGCCTTAAAAA 57.980 33.333 0.00 0.00 37.52 1.94
30 31 6.630071 ACACAATCGCATTAGCCTTAAAAAT 58.370 32.000 0.00 0.00 37.52 1.82
31 32 7.096551 ACACAATCGCATTAGCCTTAAAAATT 58.903 30.769 0.00 0.00 37.52 1.82
32 33 8.247562 ACACAATCGCATTAGCCTTAAAAATTA 58.752 29.630 0.00 0.00 37.52 1.40
33 34 9.081997 CACAATCGCATTAGCCTTAAAAATTAA 57.918 29.630 0.00 0.00 37.52 1.40
34 35 9.816354 ACAATCGCATTAGCCTTAAAAATTAAT 57.184 25.926 0.00 0.00 37.52 1.40
36 37 9.816354 AATCGCATTAGCCTTAAAAATTAATGT 57.184 25.926 0.00 0.00 35.31 2.71
74 75 9.313118 GCCTTAATTGTATGGATTAACAAAAGG 57.687 33.333 11.62 11.62 41.89 3.11
84 85 8.950007 ATGGATTAACAAAAGGAAAGTTAGGA 57.050 30.769 0.00 0.00 0.00 2.94
85 86 8.173542 TGGATTAACAAAAGGAAAGTTAGGAC 57.826 34.615 0.00 0.00 0.00 3.85
86 87 7.780745 TGGATTAACAAAAGGAAAGTTAGGACA 59.219 33.333 0.00 0.00 0.00 4.02
87 88 8.635328 GGATTAACAAAAGGAAAGTTAGGACAA 58.365 33.333 0.00 0.00 0.00 3.18
89 90 9.981114 ATTAACAAAAGGAAAGTTAGGACAATG 57.019 29.630 0.00 0.00 0.00 2.82
90 91 7.418337 AACAAAAGGAAAGTTAGGACAATGT 57.582 32.000 0.00 0.00 0.00 2.71
91 92 8.528044 AACAAAAGGAAAGTTAGGACAATGTA 57.472 30.769 0.00 0.00 0.00 2.29
92 93 8.166422 ACAAAAGGAAAGTTAGGACAATGTAG 57.834 34.615 0.00 0.00 0.00 2.74
93 94 6.819397 AAAGGAAAGTTAGGACAATGTAGC 57.181 37.500 0.00 0.00 0.00 3.58
94 95 5.763876 AGGAAAGTTAGGACAATGTAGCT 57.236 39.130 0.00 0.00 0.00 3.32
95 96 6.128138 AGGAAAGTTAGGACAATGTAGCTT 57.872 37.500 0.00 0.00 0.00 3.74
96 97 6.174049 AGGAAAGTTAGGACAATGTAGCTTC 58.826 40.000 0.00 0.00 0.00 3.86
97 98 5.354513 GGAAAGTTAGGACAATGTAGCTTCC 59.645 44.000 0.00 0.00 0.00 3.46
98 99 4.489306 AGTTAGGACAATGTAGCTTCCC 57.511 45.455 0.00 0.00 0.00 3.97
99 100 4.104831 AGTTAGGACAATGTAGCTTCCCT 58.895 43.478 0.00 0.00 0.00 4.20
100 101 5.278061 AGTTAGGACAATGTAGCTTCCCTA 58.722 41.667 0.00 0.00 0.00 3.53
101 102 5.724854 AGTTAGGACAATGTAGCTTCCCTAA 59.275 40.000 0.00 5.28 33.78 2.69
102 103 4.489306 AGGACAATGTAGCTTCCCTAAC 57.511 45.455 0.00 0.00 0.00 2.34
103 104 3.844211 AGGACAATGTAGCTTCCCTAACA 59.156 43.478 0.00 0.00 0.00 2.41
104 105 4.475016 AGGACAATGTAGCTTCCCTAACAT 59.525 41.667 0.00 0.00 0.00 2.71
105 106 4.816925 GGACAATGTAGCTTCCCTAACATC 59.183 45.833 0.00 0.00 0.00 3.06
106 107 4.781934 ACAATGTAGCTTCCCTAACATCC 58.218 43.478 0.00 0.00 0.00 3.51
107 108 4.137543 CAATGTAGCTTCCCTAACATCCC 58.862 47.826 0.00 0.00 0.00 3.85
108 109 3.130734 TGTAGCTTCCCTAACATCCCT 57.869 47.619 0.00 0.00 0.00 4.20
109 110 3.460825 TGTAGCTTCCCTAACATCCCTT 58.539 45.455 0.00 0.00 0.00 3.95
110 111 3.199946 TGTAGCTTCCCTAACATCCCTTG 59.800 47.826 0.00 0.00 0.00 3.61
111 112 2.279173 AGCTTCCCTAACATCCCTTGT 58.721 47.619 0.00 0.00 41.53 3.16
112 113 2.025887 AGCTTCCCTAACATCCCTTGTG 60.026 50.000 0.00 0.00 38.99 3.33
113 114 2.290960 GCTTCCCTAACATCCCTTGTGT 60.291 50.000 0.00 0.00 38.99 3.72
114 115 3.054655 GCTTCCCTAACATCCCTTGTGTA 60.055 47.826 0.00 0.00 38.99 2.90
115 116 4.385310 GCTTCCCTAACATCCCTTGTGTAT 60.385 45.833 0.00 0.00 38.99 2.29
116 117 4.771114 TCCCTAACATCCCTTGTGTATG 57.229 45.455 0.00 0.00 38.99 2.39
117 118 4.108570 TCCCTAACATCCCTTGTGTATGT 58.891 43.478 0.00 0.00 38.99 2.29
118 119 4.538490 TCCCTAACATCCCTTGTGTATGTT 59.462 41.667 0.00 0.00 44.01 2.71
119 120 5.727279 TCCCTAACATCCCTTGTGTATGTTA 59.273 40.000 0.00 0.00 42.31 2.41
123 124 5.359194 ACATCCCTTGTGTATGTTAGAGG 57.641 43.478 0.00 0.00 37.11 3.69
124 125 5.030147 ACATCCCTTGTGTATGTTAGAGGA 58.970 41.667 0.00 0.00 37.11 3.71
125 126 5.667626 ACATCCCTTGTGTATGTTAGAGGAT 59.332 40.000 0.00 0.00 37.11 3.24
126 127 5.871396 TCCCTTGTGTATGTTAGAGGATC 57.129 43.478 0.00 0.00 0.00 3.36
127 128 4.654262 TCCCTTGTGTATGTTAGAGGATCC 59.346 45.833 2.48 2.48 33.66 3.36
128 129 4.501571 CCCTTGTGTATGTTAGAGGATCCG 60.502 50.000 5.98 0.00 33.66 4.18
129 130 4.501571 CCTTGTGTATGTTAGAGGATCCGG 60.502 50.000 5.98 0.00 33.66 5.14
130 131 3.638860 TGTGTATGTTAGAGGATCCGGT 58.361 45.455 5.98 0.00 33.66 5.28
131 132 4.028131 TGTGTATGTTAGAGGATCCGGTT 58.972 43.478 5.98 0.00 33.66 4.44
132 133 4.098960 TGTGTATGTTAGAGGATCCGGTTC 59.901 45.833 5.98 1.67 33.66 3.62
133 134 3.640029 TGTATGTTAGAGGATCCGGTTCC 59.360 47.826 22.05 22.05 33.66 3.62
134 135 1.492764 TGTTAGAGGATCCGGTTCCC 58.507 55.000 25.10 17.15 36.35 3.97
135 136 0.757512 GTTAGAGGATCCGGTTCCCC 59.242 60.000 25.10 15.83 36.35 4.81
136 137 0.340558 TTAGAGGATCCGGTTCCCCA 59.659 55.000 25.10 10.04 36.35 4.96
137 138 0.340558 TAGAGGATCCGGTTCCCCAA 59.659 55.000 25.10 10.02 36.35 4.12
138 139 0.983378 AGAGGATCCGGTTCCCCAAG 60.983 60.000 25.10 0.00 36.35 3.61
139 140 0.981277 GAGGATCCGGTTCCCCAAGA 60.981 60.000 25.10 0.00 36.35 3.02
140 141 0.327576 AGGATCCGGTTCCCCAAGAT 60.328 55.000 25.10 5.51 36.35 2.40
141 142 0.551396 GGATCCGGTTCCCCAAGATT 59.449 55.000 19.41 0.00 0.00 2.40
142 143 1.680338 GATCCGGTTCCCCAAGATTG 58.320 55.000 0.00 0.00 0.00 2.67
143 144 1.211949 GATCCGGTTCCCCAAGATTGA 59.788 52.381 0.00 0.00 0.00 2.57
144 145 1.295020 TCCGGTTCCCCAAGATTGAT 58.705 50.000 0.00 0.00 0.00 2.57
145 146 1.064758 TCCGGTTCCCCAAGATTGATG 60.065 52.381 0.00 0.00 0.00 3.07
146 147 0.740737 CGGTTCCCCAAGATTGATGC 59.259 55.000 0.00 0.00 0.00 3.91
147 148 1.114627 GGTTCCCCAAGATTGATGCC 58.885 55.000 0.00 0.00 0.00 4.40
148 149 1.342374 GGTTCCCCAAGATTGATGCCT 60.342 52.381 0.00 0.00 0.00 4.75
149 150 1.753073 GTTCCCCAAGATTGATGCCTG 59.247 52.381 0.00 0.00 0.00 4.85
150 151 0.396139 TCCCCAAGATTGATGCCTGC 60.396 55.000 0.00 0.00 0.00 4.85
151 152 1.397390 CCCCAAGATTGATGCCTGCC 61.397 60.000 0.00 0.00 0.00 4.85
152 153 0.685131 CCCAAGATTGATGCCTGCCA 60.685 55.000 0.00 0.00 0.00 4.92
153 154 0.744874 CCAAGATTGATGCCTGCCAG 59.255 55.000 0.00 0.00 0.00 4.85
154 155 1.683938 CCAAGATTGATGCCTGCCAGA 60.684 52.381 0.00 0.00 0.00 3.86
155 156 2.307768 CAAGATTGATGCCTGCCAGAT 58.692 47.619 0.00 0.00 0.00 2.90
156 157 3.483421 CAAGATTGATGCCTGCCAGATA 58.517 45.455 0.00 0.00 0.00 1.98
157 158 3.420300 AGATTGATGCCTGCCAGATAG 57.580 47.619 0.00 0.00 0.00 2.08
158 159 2.977580 AGATTGATGCCTGCCAGATAGA 59.022 45.455 0.00 0.00 0.00 1.98
159 160 3.587951 AGATTGATGCCTGCCAGATAGAT 59.412 43.478 0.00 0.00 0.00 1.98
160 161 3.870538 TTGATGCCTGCCAGATAGATT 57.129 42.857 0.00 0.00 0.00 2.40
161 162 4.980339 TTGATGCCTGCCAGATAGATTA 57.020 40.909 0.00 0.00 0.00 1.75
162 163 4.548451 TGATGCCTGCCAGATAGATTAG 57.452 45.455 0.00 0.00 0.00 1.73
163 164 2.847327 TGCCTGCCAGATAGATTAGC 57.153 50.000 0.00 0.00 0.00 3.09
164 165 1.349026 TGCCTGCCAGATAGATTAGCC 59.651 52.381 0.00 0.00 0.00 3.93
165 166 1.627834 GCCTGCCAGATAGATTAGCCT 59.372 52.381 0.00 0.00 0.00 4.58
166 167 2.614987 GCCTGCCAGATAGATTAGCCTG 60.615 54.545 0.00 0.00 0.00 4.85
167 168 2.636893 CCTGCCAGATAGATTAGCCTGT 59.363 50.000 0.00 0.00 0.00 4.00
168 169 3.306641 CCTGCCAGATAGATTAGCCTGTC 60.307 52.174 0.00 0.00 0.00 3.51
169 170 2.634940 TGCCAGATAGATTAGCCTGTCC 59.365 50.000 0.00 0.00 0.00 4.02
170 171 2.353208 GCCAGATAGATTAGCCTGTCCG 60.353 54.545 0.00 0.00 0.00 4.79
171 172 2.232452 CCAGATAGATTAGCCTGTCCGG 59.768 54.545 0.00 0.00 0.00 5.14
172 173 2.894126 CAGATAGATTAGCCTGTCCGGT 59.106 50.000 0.00 0.00 34.25 5.28
173 174 3.057174 CAGATAGATTAGCCTGTCCGGTC 60.057 52.174 0.00 0.00 34.25 4.79
174 175 2.447408 TAGATTAGCCTGTCCGGTCA 57.553 50.000 0.00 0.00 34.25 4.02
175 176 1.115467 AGATTAGCCTGTCCGGTCAG 58.885 55.000 20.28 20.28 34.25 3.51
176 177 0.530870 GATTAGCCTGTCCGGTCAGC 60.531 60.000 21.58 16.55 34.47 4.26
177 178 0.978146 ATTAGCCTGTCCGGTCAGCT 60.978 55.000 21.58 21.61 34.47 4.24
178 179 1.605058 TTAGCCTGTCCGGTCAGCTC 61.605 60.000 21.58 15.04 34.47 4.09
179 180 2.781431 TAGCCTGTCCGGTCAGCTCA 62.781 60.000 21.58 6.70 34.47 4.26
180 181 2.262915 CCTGTCCGGTCAGCTCAC 59.737 66.667 21.58 1.56 34.47 3.51
181 182 2.574018 CCTGTCCGGTCAGCTCACA 61.574 63.158 21.58 6.46 34.47 3.58
182 183 1.593787 CTGTCCGGTCAGCTCACAT 59.406 57.895 15.77 0.00 0.00 3.21
183 184 0.459237 CTGTCCGGTCAGCTCACATC 60.459 60.000 15.77 0.00 0.00 3.06
184 185 1.153549 GTCCGGTCAGCTCACATCC 60.154 63.158 0.00 0.00 0.00 3.51
185 186 2.187946 CCGGTCAGCTCACATCCC 59.812 66.667 0.00 0.00 0.00 3.85
186 187 2.659063 CCGGTCAGCTCACATCCCA 61.659 63.158 0.00 0.00 0.00 4.37
187 188 1.524002 CGGTCAGCTCACATCCCAT 59.476 57.895 0.00 0.00 0.00 4.00
188 189 0.531532 CGGTCAGCTCACATCCCATC 60.532 60.000 0.00 0.00 0.00 3.51
189 190 0.179034 GGTCAGCTCACATCCCATCC 60.179 60.000 0.00 0.00 0.00 3.51
190 191 0.531532 GTCAGCTCACATCCCATCCG 60.532 60.000 0.00 0.00 0.00 4.18
191 192 0.977627 TCAGCTCACATCCCATCCGT 60.978 55.000 0.00 0.00 0.00 4.69
192 193 0.531532 CAGCTCACATCCCATCCGTC 60.532 60.000 0.00 0.00 0.00 4.79
193 194 1.227674 GCTCACATCCCATCCGTCC 60.228 63.158 0.00 0.00 0.00 4.79
194 195 1.971505 GCTCACATCCCATCCGTCCA 61.972 60.000 0.00 0.00 0.00 4.02
195 196 0.761187 CTCACATCCCATCCGTCCAT 59.239 55.000 0.00 0.00 0.00 3.41
196 197 0.758734 TCACATCCCATCCGTCCATC 59.241 55.000 0.00 0.00 0.00 3.51
197 198 0.469494 CACATCCCATCCGTCCATCA 59.531 55.000 0.00 0.00 0.00 3.07
198 199 0.761187 ACATCCCATCCGTCCATCAG 59.239 55.000 0.00 0.00 0.00 2.90
199 200 1.051008 CATCCCATCCGTCCATCAGA 58.949 55.000 0.00 0.00 0.00 3.27
200 201 1.627329 CATCCCATCCGTCCATCAGAT 59.373 52.381 0.00 0.00 0.00 2.90
201 202 1.342074 TCCCATCCGTCCATCAGATC 58.658 55.000 0.00 0.00 0.00 2.75
202 203 1.051008 CCCATCCGTCCATCAGATCA 58.949 55.000 0.00 0.00 0.00 2.92
203 204 1.001746 CCCATCCGTCCATCAGATCAG 59.998 57.143 0.00 0.00 0.00 2.90
204 205 1.966354 CCATCCGTCCATCAGATCAGA 59.034 52.381 0.00 0.00 0.00 3.27
205 206 2.566279 CCATCCGTCCATCAGATCAGAT 59.434 50.000 0.00 0.00 0.00 2.90
206 207 3.368220 CCATCCGTCCATCAGATCAGATC 60.368 52.174 1.64 1.64 0.00 2.75
207 208 2.949447 TCCGTCCATCAGATCAGATCA 58.051 47.619 13.14 0.00 0.00 2.92
208 209 2.889678 TCCGTCCATCAGATCAGATCAG 59.110 50.000 13.14 4.79 0.00 2.90
209 210 2.889678 CCGTCCATCAGATCAGATCAGA 59.110 50.000 13.14 10.45 0.00 3.27
210 211 3.510753 CCGTCCATCAGATCAGATCAGAT 59.489 47.826 13.14 12.32 36.14 2.90
211 212 4.380761 CCGTCCATCAGATCAGATCAGATC 60.381 50.000 17.88 17.88 43.73 2.75
212 213 4.217983 CGTCCATCAGATCAGATCAGATCA 59.782 45.833 24.89 9.96 45.39 2.92
213 214 5.278858 CGTCCATCAGATCAGATCAGATCAA 60.279 44.000 24.89 15.29 45.39 2.57
214 215 5.927689 GTCCATCAGATCAGATCAGATCAAC 59.072 44.000 24.89 11.44 45.39 3.18
215 216 5.011840 TCCATCAGATCAGATCAGATCAACC 59.988 44.000 24.89 4.09 45.39 3.77
216 217 5.221661 CCATCAGATCAGATCAGATCAACCA 60.222 44.000 24.89 9.75 45.39 3.67
217 218 5.532664 TCAGATCAGATCAGATCAACCAG 57.467 43.478 24.89 12.14 45.39 4.00
218 219 4.059511 CAGATCAGATCAGATCAACCAGC 58.940 47.826 24.89 2.50 45.39 4.85
219 220 3.710165 AGATCAGATCAGATCAACCAGCA 59.290 43.478 24.89 0.00 45.39 4.41
220 221 3.538634 TCAGATCAGATCAACCAGCAG 57.461 47.619 13.14 0.00 0.00 4.24
221 222 2.836372 TCAGATCAGATCAACCAGCAGT 59.164 45.455 13.14 0.00 0.00 4.40
222 223 4.026052 TCAGATCAGATCAACCAGCAGTA 58.974 43.478 13.14 0.00 0.00 2.74
223 224 4.467438 TCAGATCAGATCAACCAGCAGTAA 59.533 41.667 13.14 0.00 0.00 2.24
224 225 5.046376 TCAGATCAGATCAACCAGCAGTAAA 60.046 40.000 13.14 0.00 0.00 2.01
225 226 5.064452 CAGATCAGATCAACCAGCAGTAAAC 59.936 44.000 13.14 0.00 0.00 2.01
226 227 4.350368 TCAGATCAACCAGCAGTAAACA 57.650 40.909 0.00 0.00 0.00 2.83
227 228 4.713553 TCAGATCAACCAGCAGTAAACAA 58.286 39.130 0.00 0.00 0.00 2.83
228 229 5.129634 TCAGATCAACCAGCAGTAAACAAA 58.870 37.500 0.00 0.00 0.00 2.83
229 230 5.592282 TCAGATCAACCAGCAGTAAACAAAA 59.408 36.000 0.00 0.00 0.00 2.44
230 231 6.265196 TCAGATCAACCAGCAGTAAACAAAAT 59.735 34.615 0.00 0.00 0.00 1.82
231 232 6.925165 CAGATCAACCAGCAGTAAACAAAATT 59.075 34.615 0.00 0.00 0.00 1.82
232 233 7.439056 CAGATCAACCAGCAGTAAACAAAATTT 59.561 33.333 0.00 0.00 0.00 1.82
233 234 7.986889 AGATCAACCAGCAGTAAACAAAATTTT 59.013 29.630 0.00 0.00 0.00 1.82
234 235 9.255304 GATCAACCAGCAGTAAACAAAATTTTA 57.745 29.630 2.44 0.00 0.00 1.52
235 236 8.413899 TCAACCAGCAGTAAACAAAATTTTAC 57.586 30.769 2.44 0.00 40.75 2.01
236 237 8.035394 TCAACCAGCAGTAAACAAAATTTTACA 58.965 29.630 2.44 0.00 42.22 2.41
237 238 8.327429 CAACCAGCAGTAAACAAAATTTTACAG 58.673 33.333 2.44 0.00 42.22 2.74
238 239 6.478673 ACCAGCAGTAAACAAAATTTTACAGC 59.521 34.615 2.44 12.59 46.70 4.40
241 242 6.354858 GCAGTAAACAAAATTTTACAGCAGC 58.645 36.000 14.57 0.00 46.11 5.25
242 243 6.571588 CAGTAAACAAAATTTTACAGCAGCG 58.428 36.000 2.44 0.00 42.22 5.18
243 244 6.416455 CAGTAAACAAAATTTTACAGCAGCGA 59.584 34.615 2.44 0.00 42.22 4.93
244 245 5.888412 AAACAAAATTTTACAGCAGCGAG 57.112 34.783 2.44 0.00 0.00 5.03
245 246 4.829064 ACAAAATTTTACAGCAGCGAGA 57.171 36.364 2.44 0.00 0.00 4.04
246 247 4.787598 ACAAAATTTTACAGCAGCGAGAG 58.212 39.130 2.44 0.00 0.00 3.20
247 248 4.161333 CAAAATTTTACAGCAGCGAGAGG 58.839 43.478 2.44 0.00 0.00 3.69
248 249 2.029838 ATTTTACAGCAGCGAGAGGG 57.970 50.000 0.00 0.00 0.00 4.30
249 250 0.973632 TTTTACAGCAGCGAGAGGGA 59.026 50.000 0.00 0.00 0.00 4.20
250 251 0.532573 TTTACAGCAGCGAGAGGGAG 59.467 55.000 0.00 0.00 0.00 4.30
251 252 0.323451 TTACAGCAGCGAGAGGGAGA 60.323 55.000 0.00 0.00 0.00 3.71
252 253 1.032657 TACAGCAGCGAGAGGGAGAC 61.033 60.000 0.00 0.00 0.00 3.36
265 266 2.887790 GGAGACCAAAGCCCAATCC 58.112 57.895 0.00 0.00 0.00 3.01
266 267 0.039618 GGAGACCAAAGCCCAATCCA 59.960 55.000 0.00 0.00 0.00 3.41
267 268 1.549950 GGAGACCAAAGCCCAATCCAA 60.550 52.381 0.00 0.00 0.00 3.53
268 269 2.460669 GAGACCAAAGCCCAATCCAAT 58.539 47.619 0.00 0.00 0.00 3.16
269 270 2.428530 GAGACCAAAGCCCAATCCAATC 59.571 50.000 0.00 0.00 0.00 2.67
270 271 2.043526 AGACCAAAGCCCAATCCAATCT 59.956 45.455 0.00 0.00 0.00 2.40
271 272 2.167075 GACCAAAGCCCAATCCAATCTG 59.833 50.000 0.00 0.00 0.00 2.90
272 273 2.225343 ACCAAAGCCCAATCCAATCTGA 60.225 45.455 0.00 0.00 0.00 3.27
273 274 2.833338 CCAAAGCCCAATCCAATCTGAA 59.167 45.455 0.00 0.00 0.00 3.02
274 275 3.118884 CCAAAGCCCAATCCAATCTGAAG 60.119 47.826 0.00 0.00 0.00 3.02
275 276 1.772836 AGCCCAATCCAATCTGAAGC 58.227 50.000 0.00 0.00 0.00 3.86
276 277 1.006281 AGCCCAATCCAATCTGAAGCA 59.994 47.619 0.00 0.00 0.00 3.91
277 278 1.826720 GCCCAATCCAATCTGAAGCAA 59.173 47.619 0.00 0.00 0.00 3.91
278 279 2.159142 GCCCAATCCAATCTGAAGCAAG 60.159 50.000 0.00 0.00 0.00 4.01
279 280 2.429610 CCCAATCCAATCTGAAGCAAGG 59.570 50.000 0.00 0.00 0.00 3.61
280 281 2.429610 CCAATCCAATCTGAAGCAAGGG 59.570 50.000 0.00 0.00 0.00 3.95
281 282 1.772836 ATCCAATCTGAAGCAAGGGC 58.227 50.000 0.00 0.00 41.61 5.19
282 283 0.405198 TCCAATCTGAAGCAAGGGCA 59.595 50.000 0.00 0.00 44.61 5.36
283 284 0.815734 CCAATCTGAAGCAAGGGCAG 59.184 55.000 0.00 0.00 44.61 4.85
284 285 1.542492 CAATCTGAAGCAAGGGCAGT 58.458 50.000 0.00 0.00 44.61 4.40
285 286 1.471684 CAATCTGAAGCAAGGGCAGTC 59.528 52.381 0.00 0.00 44.61 3.51
286 287 0.034670 ATCTGAAGCAAGGGCAGTCC 60.035 55.000 0.00 0.00 44.61 3.85
295 296 3.905249 GGGCAGTCCCGTCATTTC 58.095 61.111 0.00 0.00 43.94 2.17
296 297 2.106683 GGGCAGTCCCGTCATTTCG 61.107 63.158 0.00 0.00 43.94 3.46
297 298 2.750888 GGCAGTCCCGTCATTTCGC 61.751 63.158 0.00 0.00 0.00 4.70
298 299 2.750888 GCAGTCCCGTCATTTCGCC 61.751 63.158 0.00 0.00 0.00 5.54
299 300 2.106683 CAGTCCCGTCATTTCGCCC 61.107 63.158 0.00 0.00 0.00 6.13
300 301 2.822701 GTCCCGTCATTTCGCCCC 60.823 66.667 0.00 0.00 0.00 5.80
301 302 4.104183 TCCCGTCATTTCGCCCCC 62.104 66.667 0.00 0.00 0.00 5.40
315 316 3.330720 CCCCCTCCACTTTCGCCT 61.331 66.667 0.00 0.00 0.00 5.52
316 317 2.757077 CCCCTCCACTTTCGCCTT 59.243 61.111 0.00 0.00 0.00 4.35
317 318 1.675641 CCCCTCCACTTTCGCCTTG 60.676 63.158 0.00 0.00 0.00 3.61
318 319 2.335712 CCCTCCACTTTCGCCTTGC 61.336 63.158 0.00 0.00 0.00 4.01
319 320 2.335712 CCTCCACTTTCGCCTTGCC 61.336 63.158 0.00 0.00 0.00 4.52
320 321 2.668212 TCCACTTTCGCCTTGCCG 60.668 61.111 0.00 0.00 0.00 5.69
321 322 4.404654 CCACTTTCGCCTTGCCGC 62.405 66.667 0.00 0.00 0.00 6.53
356 357 4.689549 CCCCCGAAACCCCAACCC 62.690 72.222 0.00 0.00 0.00 4.11
357 358 4.689549 CCCCGAAACCCCAACCCC 62.690 72.222 0.00 0.00 0.00 4.95
358 359 4.689549 CCCGAAACCCCAACCCCC 62.690 72.222 0.00 0.00 0.00 5.40
359 360 3.904617 CCGAAACCCCAACCCCCA 61.905 66.667 0.00 0.00 0.00 4.96
360 361 2.599281 CGAAACCCCAACCCCCAC 60.599 66.667 0.00 0.00 0.00 4.61
361 362 2.203728 GAAACCCCAACCCCCACC 60.204 66.667 0.00 0.00 0.00 4.61
362 363 3.839046 GAAACCCCAACCCCCACCC 62.839 68.421 0.00 0.00 0.00 4.61
850 851 4.157120 ACGCGCGGGCCTAGAAAT 62.157 61.111 35.22 5.42 35.02 2.17
851 852 2.028484 CGCGCGGGCCTAGAAATA 59.972 61.111 24.84 0.00 35.02 1.40
852 853 2.022129 CGCGCGGGCCTAGAAATAG 61.022 63.158 24.84 0.00 35.02 1.73
853 854 1.668151 GCGCGGGCCTAGAAATAGG 60.668 63.158 14.45 0.00 40.20 2.57
854 855 1.004918 CGCGGGCCTAGAAATAGGG 60.005 63.158 0.84 0.00 37.69 3.53
855 856 1.375326 GCGGGCCTAGAAATAGGGG 59.625 63.158 0.84 0.00 37.69 4.79
856 857 1.375326 CGGGCCTAGAAATAGGGGC 59.625 63.158 0.84 0.00 43.68 5.80
857 858 1.375326 GGGCCTAGAAATAGGGGCG 59.625 63.158 0.84 0.00 44.91 6.13
858 859 1.125711 GGGCCTAGAAATAGGGGCGA 61.126 60.000 0.84 0.00 44.91 5.54
859 860 0.035036 GGCCTAGAAATAGGGGCGAC 59.965 60.000 0.00 0.00 44.91 5.19
860 861 0.319641 GCCTAGAAATAGGGGCGACG 60.320 60.000 3.61 0.00 37.69 5.12
861 862 0.317479 CCTAGAAATAGGGGCGACGG 59.683 60.000 0.00 0.00 33.60 4.79
862 863 1.325355 CTAGAAATAGGGGCGACGGA 58.675 55.000 0.00 0.00 0.00 4.69
863 864 1.000496 CTAGAAATAGGGGCGACGGAC 60.000 57.143 0.00 0.00 0.00 4.79
864 865 1.590792 GAAATAGGGGCGACGGACG 60.591 63.158 0.00 0.00 45.66 4.79
865 866 2.966182 GAAATAGGGGCGACGGACGG 62.966 65.000 1.66 0.00 42.83 4.79
866 867 4.511246 ATAGGGGCGACGGACGGA 62.511 66.667 1.66 0.00 42.83 4.69
871 872 3.834799 GGCGACGGACGGAGGAAT 61.835 66.667 1.66 0.00 42.83 3.01
872 873 2.582498 GCGACGGACGGAGGAATG 60.582 66.667 1.66 0.00 42.83 2.67
873 874 2.104331 CGACGGACGGAGGAATGG 59.896 66.667 0.00 0.00 38.46 3.16
874 875 2.412323 CGACGGACGGAGGAATGGA 61.412 63.158 0.00 0.00 38.46 3.41
875 876 1.437986 GACGGACGGAGGAATGGAG 59.562 63.158 0.00 0.00 0.00 3.86
876 877 2.017559 GACGGACGGAGGAATGGAGG 62.018 65.000 0.00 0.00 0.00 4.30
877 878 2.797278 CGGACGGAGGAATGGAGGG 61.797 68.421 0.00 0.00 0.00 4.30
878 879 2.506472 GACGGAGGAATGGAGGGC 59.494 66.667 0.00 0.00 0.00 5.19
879 880 3.447025 GACGGAGGAATGGAGGGCG 62.447 68.421 0.00 0.00 0.00 6.13
880 881 3.154473 CGGAGGAATGGAGGGCGA 61.154 66.667 0.00 0.00 0.00 5.54
881 882 2.506472 GGAGGAATGGAGGGCGAC 59.494 66.667 0.00 0.00 0.00 5.19
969 970 3.131478 CCCCAAAACCCTAGCGCG 61.131 66.667 0.00 0.00 0.00 6.86
970 971 3.810896 CCCAAAACCCTAGCGCGC 61.811 66.667 26.66 26.66 0.00 6.86
971 972 3.810896 CCAAAACCCTAGCGCGCC 61.811 66.667 30.33 10.31 0.00 6.53
972 973 3.810896 CAAAACCCTAGCGCGCCC 61.811 66.667 30.33 0.16 0.00 6.13
1122 1123 4.154347 CACTCGCCCTGCCTCTCC 62.154 72.222 0.00 0.00 0.00 3.71
1123 1124 4.704103 ACTCGCCCTGCCTCTCCA 62.704 66.667 0.00 0.00 0.00 3.86
1124 1125 3.393970 CTCGCCCTGCCTCTCCAA 61.394 66.667 0.00 0.00 0.00 3.53
1125 1126 3.382803 CTCGCCCTGCCTCTCCAAG 62.383 68.421 0.00 0.00 0.00 3.61
1128 1129 4.479993 CCCTGCCTCTCCAAGCCG 62.480 72.222 0.00 0.00 0.00 5.52
1194 1198 4.779733 GAGGACGCCTCCCCCTCA 62.780 72.222 13.12 0.00 44.36 3.86
1305 1309 2.363018 TCCCTCACCGAGCAGGAG 60.363 66.667 5.19 0.00 45.00 3.69
1312 1316 3.393970 CCGAGCAGGAGAAGGCCA 61.394 66.667 5.01 0.00 45.00 5.36
1313 1317 2.665000 CGAGCAGGAGAAGGCCAA 59.335 61.111 5.01 0.00 0.00 4.52
1371 1375 2.722487 GGCGATGACGACGAGGAT 59.278 61.111 0.00 0.00 42.66 3.24
1373 1377 1.355563 GCGATGACGACGAGGATGA 59.644 57.895 0.00 0.00 42.66 2.92
1374 1378 0.658829 GCGATGACGACGAGGATGAG 60.659 60.000 0.00 0.00 42.66 2.90
1377 1381 1.265635 GATGACGACGAGGATGAGGAG 59.734 57.143 0.00 0.00 0.00 3.69
1381 1385 1.791103 CGACGAGGATGAGGAGGAGC 61.791 65.000 0.00 0.00 0.00 4.70
1393 1397 1.679305 GAGGAGCAGGACGAGGACA 60.679 63.158 0.00 0.00 0.00 4.02
1473 1477 2.047274 CCCGTCACCGTGAGCAAT 60.047 61.111 0.08 0.00 0.00 3.56
1488 1492 4.516326 AATCCCCTCCCCTCCCCG 62.516 72.222 0.00 0.00 0.00 5.73
1495 1499 1.202769 CCTCCCCTCCCCGTGTTTTA 61.203 60.000 0.00 0.00 0.00 1.52
1496 1500 0.035725 CTCCCCTCCCCGTGTTTTAC 60.036 60.000 0.00 0.00 0.00 2.01
1497 1501 0.474273 TCCCCTCCCCGTGTTTTACT 60.474 55.000 0.00 0.00 0.00 2.24
1498 1502 0.035725 CCCCTCCCCGTGTTTTACTC 60.036 60.000 0.00 0.00 0.00 2.59
1500 1504 0.390735 CCTCCCCGTGTTTTACTCCG 60.391 60.000 0.00 0.00 0.00 4.63
1512 1521 1.411394 TTACTCCGCGTCAGTTTTCG 58.589 50.000 12.67 0.00 0.00 3.46
1516 1525 2.256174 CTCCGCGTCAGTTTTCGAATA 58.744 47.619 4.92 0.00 0.00 1.75
1531 1540 8.641541 AGTTTTCGAATAAATGCCCATGATTAT 58.358 29.630 0.00 0.00 0.00 1.28
1544 1556 6.058183 GCCCATGATTATATCCACTACCATC 58.942 44.000 0.00 0.00 0.00 3.51
1551 1563 0.180406 ATCCACTACCATCCCGCAAC 59.820 55.000 0.00 0.00 0.00 4.17
1556 1568 3.131396 CACTACCATCCCGCAACTATTC 58.869 50.000 0.00 0.00 0.00 1.75
1562 1574 3.431626 CCATCCCGCAACTATTCACTGTA 60.432 47.826 0.00 0.00 0.00 2.74
1592 1607 2.878429 CGCGGATAGATCTCCCGG 59.122 66.667 27.40 18.03 43.17 5.73
1596 1611 1.979693 GGATAGATCTCCCGGCGCT 60.980 63.158 7.64 0.00 0.00 5.92
1608 1623 2.791256 GGCGCTCGCTGCAAAATA 59.209 55.556 7.64 0.00 43.06 1.40
1610 1625 0.931662 GGCGCTCGCTGCAAAATATG 60.932 55.000 7.64 0.00 43.06 1.78
1616 1631 4.217497 GCTCGCTGCAAAATATGATCTTC 58.783 43.478 0.00 0.00 42.31 2.87
1618 1633 5.663795 TCGCTGCAAAATATGATCTTCTC 57.336 39.130 0.00 0.00 0.00 2.87
1625 1643 1.691127 ATATGATCTTCTCGTGCGCG 58.309 50.000 14.79 14.79 39.92 6.86
1630 1648 3.406361 CTTCTCGTGCGCGCTTGT 61.406 61.111 33.29 0.00 38.14 3.16
1652 1670 5.163602 TGTTGTCATAATGGTTAAATCCCGC 60.164 40.000 0.00 0.00 0.00 6.13
1654 1672 5.136828 TGTCATAATGGTTAAATCCCGCAT 58.863 37.500 0.00 0.00 0.00 4.73
1655 1673 5.240623 TGTCATAATGGTTAAATCCCGCATC 59.759 40.000 0.00 0.00 0.00 3.91
1658 1676 6.493115 TCATAATGGTTAAATCCCGCATCATT 59.507 34.615 0.00 0.00 0.00 2.57
1712 1737 0.471780 TCTTCCTCTGGGTCACTGCA 60.472 55.000 0.00 0.00 0.00 4.41
1721 1746 1.355381 TGGGTCACTGCATCCATTTCT 59.645 47.619 0.00 0.00 0.00 2.52
1737 1762 3.855255 TTTCTCCCCGCATAATCATCA 57.145 42.857 0.00 0.00 0.00 3.07
1739 1764 2.329267 TCTCCCCGCATAATCATCACT 58.671 47.619 0.00 0.00 0.00 3.41
1744 1769 2.669924 CCCGCATAATCATCACTCATCG 59.330 50.000 0.00 0.00 0.00 3.84
1746 1771 3.366121 CCGCATAATCATCACTCATCGTC 59.634 47.826 0.00 0.00 0.00 4.20
1748 1773 4.564041 GCATAATCATCACTCATCGTCCT 58.436 43.478 0.00 0.00 0.00 3.85
1750 1775 5.566429 GCATAATCATCACTCATCGTCCTCT 60.566 44.000 0.00 0.00 0.00 3.69
1761 1786 1.471119 TCGTCCTCTTTATGCCGTCT 58.529 50.000 0.00 0.00 0.00 4.18
1762 1787 1.404391 TCGTCCTCTTTATGCCGTCTC 59.596 52.381 0.00 0.00 0.00 3.36
1763 1788 1.841450 GTCCTCTTTATGCCGTCTCG 58.159 55.000 0.00 0.00 0.00 4.04
1778 1808 1.022735 TCTCGGACGCTCTAACATCC 58.977 55.000 0.00 0.00 0.00 3.51
1790 1820 5.295292 CGCTCTAACATCCATTGATTTCAGT 59.705 40.000 0.00 0.00 0.00 3.41
1792 1822 7.542025 GCTCTAACATCCATTGATTTCAGTTT 58.458 34.615 0.00 0.00 0.00 2.66
1793 1823 7.487189 GCTCTAACATCCATTGATTTCAGTTTG 59.513 37.037 0.00 0.00 0.00 2.93
1794 1824 8.408043 TCTAACATCCATTGATTTCAGTTTGT 57.592 30.769 0.00 0.00 0.00 2.83
1795 1825 8.859090 TCTAACATCCATTGATTTCAGTTTGTT 58.141 29.630 0.00 0.00 0.00 2.83
1796 1826 7.951530 AACATCCATTGATTTCAGTTTGTTC 57.048 32.000 0.00 0.00 0.00 3.18
1797 1827 7.053316 ACATCCATTGATTTCAGTTTGTTCA 57.947 32.000 0.00 0.00 0.00 3.18
1798 1828 7.149973 ACATCCATTGATTTCAGTTTGTTCAG 58.850 34.615 0.00 0.00 0.00 3.02
1800 1830 7.528996 TCCATTGATTTCAGTTTGTTCAGAT 57.471 32.000 0.00 0.00 0.00 2.90
1801 1831 7.372714 TCCATTGATTTCAGTTTGTTCAGATG 58.627 34.615 0.00 0.00 0.00 2.90
1802 1832 7.014518 TCCATTGATTTCAGTTTGTTCAGATGT 59.985 33.333 0.00 0.00 0.00 3.06
1803 1833 7.115805 CCATTGATTTCAGTTTGTTCAGATGTG 59.884 37.037 0.00 0.00 0.00 3.21
1805 1835 5.300034 TGATTTCAGTTTGTTCAGATGTGCT 59.700 36.000 0.00 0.00 0.00 4.40
1806 1836 5.581126 TTTCAGTTTGTTCAGATGTGCTT 57.419 34.783 0.00 0.00 0.00 3.91
1808 1838 5.581126 TCAGTTTGTTCAGATGTGCTTTT 57.419 34.783 0.00 0.00 0.00 2.27
1809 1839 5.342433 TCAGTTTGTTCAGATGTGCTTTTG 58.658 37.500 0.00 0.00 0.00 2.44
1820 1850 3.673599 GCTTTTGCGGCCTTCTCT 58.326 55.556 0.00 0.00 34.86 3.10
1860 1890 9.708222 GTAGCTGTAATGTAATTTCAACATCAG 57.292 33.333 0.00 5.01 37.87 2.90
1903 1938 1.227999 GCGTGTTCTGTGCTTGCCTA 61.228 55.000 0.00 0.00 0.00 3.93
1929 1968 2.228582 CAGATAGGAGCAGAGGATCACG 59.771 54.545 0.00 0.00 37.82 4.35
1985 2024 2.165845 AGACGCACCCACTAGTAATGAC 59.834 50.000 0.00 0.00 0.00 3.06
1993 2032 4.788617 ACCCACTAGTAATGACCCATCTTT 59.211 41.667 0.00 0.00 0.00 2.52
1995 2034 4.576463 CCACTAGTAATGACCCATCTTTGC 59.424 45.833 0.00 0.00 0.00 3.68
2002 2041 1.177401 GACCCATCTTTGCCTTGGTC 58.823 55.000 0.00 0.00 35.91 4.02
2003 2042 0.482446 ACCCATCTTTGCCTTGGTCA 59.518 50.000 0.00 0.00 0.00 4.02
2004 2043 1.077663 ACCCATCTTTGCCTTGGTCAT 59.922 47.619 0.00 0.00 0.00 3.06
2005 2044 2.181975 CCCATCTTTGCCTTGGTCATT 58.818 47.619 0.00 0.00 0.00 2.57
2006 2045 2.093869 CCCATCTTTGCCTTGGTCATTG 60.094 50.000 0.00 0.00 0.00 2.82
2007 2046 2.613691 CATCTTTGCCTTGGTCATTGC 58.386 47.619 0.00 0.00 0.00 3.56
2008 2047 1.999648 TCTTTGCCTTGGTCATTGCT 58.000 45.000 0.00 0.00 0.00 3.91
2009 2048 2.318908 TCTTTGCCTTGGTCATTGCTT 58.681 42.857 0.00 0.00 0.00 3.91
2010 2049 2.297033 TCTTTGCCTTGGTCATTGCTTC 59.703 45.455 0.00 0.00 0.00 3.86
2018 2057 1.820519 TGGTCATTGCTTCCATTGCTC 59.179 47.619 0.00 0.00 0.00 4.26
2109 2368 2.927553 ATTTTCTGATGACGGCTTGC 57.072 45.000 0.00 0.00 0.00 4.01
2110 2369 0.516877 TTTTCTGATGACGGCTTGCG 59.483 50.000 0.00 0.00 0.00 4.85
2114 2373 3.121030 GATGACGGCTTGCGTGCT 61.121 61.111 0.00 0.00 0.00 4.40
2115 2374 3.088500 GATGACGGCTTGCGTGCTC 62.089 63.158 0.00 0.00 0.00 4.26
2122 2381 3.349006 CTTGCGTGCTCGGTGCTT 61.349 61.111 10.52 0.00 43.37 3.91
2123 2382 3.584250 CTTGCGTGCTCGGTGCTTG 62.584 63.158 10.52 0.00 43.37 4.01
2124 2383 4.908687 TGCGTGCTCGGTGCTTGT 62.909 61.111 10.52 0.00 43.37 3.16
2125 2384 4.077188 GCGTGCTCGGTGCTTGTC 62.077 66.667 10.52 0.00 43.37 3.18
2126 2385 2.356313 CGTGCTCGGTGCTTGTCT 60.356 61.111 0.00 0.00 43.37 3.41
2127 2386 2.661566 CGTGCTCGGTGCTTGTCTG 61.662 63.158 0.00 0.00 43.37 3.51
2128 2387 1.595382 GTGCTCGGTGCTTGTCTGT 60.595 57.895 3.53 0.00 43.37 3.41
2129 2388 0.319555 GTGCTCGGTGCTTGTCTGTA 60.320 55.000 3.53 0.00 43.37 2.74
2130 2389 0.038251 TGCTCGGTGCTTGTCTGTAG 60.038 55.000 3.53 0.00 43.37 2.74
2131 2390 0.038159 GCTCGGTGCTTGTCTGTAGT 60.038 55.000 0.00 0.00 38.95 2.73
2132 2391 1.605712 GCTCGGTGCTTGTCTGTAGTT 60.606 52.381 0.00 0.00 38.95 2.24
2133 2392 2.352421 GCTCGGTGCTTGTCTGTAGTTA 60.352 50.000 0.00 0.00 38.95 2.24
2134 2393 3.502920 CTCGGTGCTTGTCTGTAGTTAG 58.497 50.000 0.00 0.00 0.00 2.34
2135 2394 3.151554 TCGGTGCTTGTCTGTAGTTAGA 58.848 45.455 0.00 0.00 0.00 2.10
2136 2395 3.762288 TCGGTGCTTGTCTGTAGTTAGAT 59.238 43.478 0.00 0.00 0.00 1.98
2137 2396 4.945543 TCGGTGCTTGTCTGTAGTTAGATA 59.054 41.667 0.00 0.00 0.00 1.98
2138 2397 5.066117 TCGGTGCTTGTCTGTAGTTAGATAG 59.934 44.000 0.00 0.00 0.00 2.08
2139 2398 5.593010 GGTGCTTGTCTGTAGTTAGATAGG 58.407 45.833 0.00 0.00 0.00 2.57
2140 2399 5.360144 GGTGCTTGTCTGTAGTTAGATAGGA 59.640 44.000 0.00 0.00 0.00 2.94
2141 2400 6.460399 GGTGCTTGTCTGTAGTTAGATAGGAG 60.460 46.154 0.00 0.00 0.00 3.69
2142 2401 6.095720 GTGCTTGTCTGTAGTTAGATAGGAGT 59.904 42.308 0.00 0.00 0.00 3.85
2143 2402 7.282675 GTGCTTGTCTGTAGTTAGATAGGAGTA 59.717 40.741 0.00 0.00 0.00 2.59
2144 2403 7.832685 TGCTTGTCTGTAGTTAGATAGGAGTAA 59.167 37.037 0.00 0.00 0.00 2.24
2145 2404 8.684520 GCTTGTCTGTAGTTAGATAGGAGTAAA 58.315 37.037 0.00 0.00 0.00 2.01
2147 2406 9.750783 TTGTCTGTAGTTAGATAGGAGTAAAGT 57.249 33.333 0.00 0.00 0.00 2.66
2158 2417 8.644374 AGATAGGAGTAAAGTATCATGACCTC 57.356 38.462 0.00 0.00 0.00 3.85
2159 2418 5.776173 AGGAGTAAAGTATCATGACCTCG 57.224 43.478 0.00 0.00 0.00 4.63
2160 2419 5.202004 AGGAGTAAAGTATCATGACCTCGT 58.798 41.667 0.00 0.00 0.00 4.18
2161 2420 5.299782 AGGAGTAAAGTATCATGACCTCGTC 59.700 44.000 0.00 0.00 0.00 4.20
2162 2421 5.299782 GGAGTAAAGTATCATGACCTCGTCT 59.700 44.000 0.00 0.00 33.15 4.18
2163 2422 6.137794 AGTAAAGTATCATGACCTCGTCTG 57.862 41.667 0.00 0.00 33.15 3.51
2164 2423 5.652891 AGTAAAGTATCATGACCTCGTCTGT 59.347 40.000 0.00 0.00 33.15 3.41
2165 2424 5.407407 AAAGTATCATGACCTCGTCTGTT 57.593 39.130 0.00 0.00 33.15 3.16
2166 2425 5.407407 AAGTATCATGACCTCGTCTGTTT 57.593 39.130 0.00 0.00 33.15 2.83
2167 2426 4.748892 AGTATCATGACCTCGTCTGTTTG 58.251 43.478 0.00 0.00 33.15 2.93
2168 2427 3.685139 ATCATGACCTCGTCTGTTTGT 57.315 42.857 0.00 0.00 33.15 2.83
2169 2428 4.801330 ATCATGACCTCGTCTGTTTGTA 57.199 40.909 0.00 0.00 33.15 2.41
2170 2429 4.174411 TCATGACCTCGTCTGTTTGTAG 57.826 45.455 0.00 0.00 33.15 2.74
2171 2430 3.056821 TCATGACCTCGTCTGTTTGTAGG 60.057 47.826 0.00 0.00 33.15 3.18
2172 2431 1.000506 TGACCTCGTCTGTTTGTAGGC 59.999 52.381 0.00 0.00 33.15 3.93
2173 2432 1.272769 GACCTCGTCTGTTTGTAGGCT 59.727 52.381 0.00 0.00 0.00 4.58
2174 2433 1.692519 ACCTCGTCTGTTTGTAGGCTT 59.307 47.619 0.00 0.00 0.00 4.35
2175 2434 2.895404 ACCTCGTCTGTTTGTAGGCTTA 59.105 45.455 0.00 0.00 0.00 3.09
2176 2435 3.322828 ACCTCGTCTGTTTGTAGGCTTAA 59.677 43.478 0.00 0.00 0.00 1.85
2177 2436 4.020485 ACCTCGTCTGTTTGTAGGCTTAAT 60.020 41.667 0.00 0.00 0.00 1.40
2178 2437 4.567159 CCTCGTCTGTTTGTAGGCTTAATC 59.433 45.833 0.00 0.00 0.00 1.75
2179 2438 5.142061 TCGTCTGTTTGTAGGCTTAATCA 57.858 39.130 0.00 0.00 0.00 2.57
2180 2439 4.927425 TCGTCTGTTTGTAGGCTTAATCAC 59.073 41.667 0.00 0.00 0.00 3.06
2181 2440 4.092968 CGTCTGTTTGTAGGCTTAATCACC 59.907 45.833 0.00 0.00 0.00 4.02
2182 2441 5.246307 GTCTGTTTGTAGGCTTAATCACCT 58.754 41.667 0.00 0.00 40.24 4.00
2183 2442 5.122396 GTCTGTTTGTAGGCTTAATCACCTG 59.878 44.000 0.00 0.00 36.77 4.00
2184 2443 4.980573 TGTTTGTAGGCTTAATCACCTGT 58.019 39.130 0.00 0.00 36.77 4.00
2185 2444 4.759693 TGTTTGTAGGCTTAATCACCTGTG 59.240 41.667 0.00 0.00 36.77 3.66
2186 2445 4.634012 TTGTAGGCTTAATCACCTGTGT 57.366 40.909 0.00 0.00 36.77 3.72
2187 2446 5.748670 TTGTAGGCTTAATCACCTGTGTA 57.251 39.130 0.00 0.00 36.77 2.90
2188 2447 5.080969 TGTAGGCTTAATCACCTGTGTAC 57.919 43.478 0.00 0.00 36.77 2.90
2189 2448 4.775780 TGTAGGCTTAATCACCTGTGTACT 59.224 41.667 0.00 0.00 36.77 2.73
2190 2449 4.910458 AGGCTTAATCACCTGTGTACTT 57.090 40.909 0.00 0.00 34.07 2.24
2191 2450 5.242795 AGGCTTAATCACCTGTGTACTTT 57.757 39.130 0.00 0.00 34.07 2.66
2192 2451 5.631119 AGGCTTAATCACCTGTGTACTTTT 58.369 37.500 0.00 0.00 34.07 2.27
2193 2452 6.775708 AGGCTTAATCACCTGTGTACTTTTA 58.224 36.000 0.00 0.00 34.07 1.52
2194 2453 7.402862 AGGCTTAATCACCTGTGTACTTTTAT 58.597 34.615 0.00 0.00 34.07 1.40
2195 2454 8.545472 AGGCTTAATCACCTGTGTACTTTTATA 58.455 33.333 0.00 0.00 34.07 0.98
2196 2455 9.169592 GGCTTAATCACCTGTGTACTTTTATAA 57.830 33.333 0.00 0.00 0.00 0.98
2197 2456 9.983804 GCTTAATCACCTGTGTACTTTTATAAC 57.016 33.333 0.00 0.00 0.00 1.89
2200 2459 7.611213 ATCACCTGTGTACTTTTATAACAGC 57.389 36.000 0.00 0.00 37.51 4.40
2201 2460 6.526526 TCACCTGTGTACTTTTATAACAGCA 58.473 36.000 0.00 0.00 37.51 4.41
2202 2461 7.165485 TCACCTGTGTACTTTTATAACAGCAT 58.835 34.615 0.00 0.00 37.51 3.79
2203 2462 7.119116 TCACCTGTGTACTTTTATAACAGCATG 59.881 37.037 0.00 0.00 46.00 4.06
2204 2463 7.119116 CACCTGTGTACTTTTATAACAGCATGA 59.881 37.037 0.00 0.00 39.69 3.07
2205 2464 7.663905 ACCTGTGTACTTTTATAACAGCATGAA 59.336 33.333 0.00 0.00 39.69 2.57
2206 2465 8.677300 CCTGTGTACTTTTATAACAGCATGAAT 58.323 33.333 0.00 0.00 39.69 2.57
2207 2466 9.494479 CTGTGTACTTTTATAACAGCATGAATG 57.506 33.333 0.00 0.00 39.69 2.67
2208 2467 8.458052 TGTGTACTTTTATAACAGCATGAATGG 58.542 33.333 0.00 0.00 39.69 3.16
2209 2468 8.458843 GTGTACTTTTATAACAGCATGAATGGT 58.541 33.333 0.00 0.00 39.69 3.55
2224 2483 4.296265 GGTGTTTACCTGGGAGCG 57.704 61.111 0.00 0.00 43.97 5.03
2225 2484 1.373812 GGTGTTTACCTGGGAGCGT 59.626 57.895 0.00 0.00 43.97 5.07
2226 2485 0.250597 GGTGTTTACCTGGGAGCGTT 60.251 55.000 0.00 0.00 43.97 4.84
2227 2486 0.872388 GTGTTTACCTGGGAGCGTTG 59.128 55.000 0.00 0.00 0.00 4.10
2228 2487 0.470766 TGTTTACCTGGGAGCGTTGT 59.529 50.000 0.00 0.00 0.00 3.32
2229 2488 1.134037 TGTTTACCTGGGAGCGTTGTT 60.134 47.619 0.00 0.00 0.00 2.83
2230 2489 1.534163 GTTTACCTGGGAGCGTTGTTC 59.466 52.381 0.00 0.00 0.00 3.18
2231 2490 0.759959 TTACCTGGGAGCGTTGTTCA 59.240 50.000 0.00 0.00 0.00 3.18
2232 2491 0.320374 TACCTGGGAGCGTTGTTCAG 59.680 55.000 0.00 0.00 0.00 3.02
2233 2492 2.328099 CCTGGGAGCGTTGTTCAGC 61.328 63.158 0.00 0.00 0.00 4.26
2234 2493 1.597854 CTGGGAGCGTTGTTCAGCA 60.598 57.895 0.00 0.00 35.48 4.41
2235 2494 0.957395 CTGGGAGCGTTGTTCAGCAT 60.957 55.000 0.00 0.00 35.48 3.79
2236 2495 0.537143 TGGGAGCGTTGTTCAGCATT 60.537 50.000 0.00 0.00 35.48 3.56
2237 2496 0.109597 GGGAGCGTTGTTCAGCATTG 60.110 55.000 0.00 0.00 35.48 2.82
2238 2497 0.730494 GGAGCGTTGTTCAGCATTGC 60.730 55.000 0.00 0.00 35.48 3.56
2239 2498 0.239347 GAGCGTTGTTCAGCATTGCT 59.761 50.000 5.03 5.03 40.77 3.91
2240 2499 0.670162 AGCGTTGTTCAGCATTGCTT 59.330 45.000 8.83 0.00 36.40 3.91
2241 2500 1.879380 AGCGTTGTTCAGCATTGCTTA 59.121 42.857 8.83 0.00 36.40 3.09
2242 2501 1.978782 GCGTTGTTCAGCATTGCTTAC 59.021 47.619 8.83 10.70 36.40 2.34
2243 2502 2.604373 GCGTTGTTCAGCATTGCTTACA 60.604 45.455 8.83 13.17 36.40 2.41
2244 2503 3.825308 CGTTGTTCAGCATTGCTTACAT 58.175 40.909 18.80 0.00 36.40 2.29
2245 2504 3.605056 CGTTGTTCAGCATTGCTTACATG 59.395 43.478 18.80 13.02 36.40 3.21
2246 2505 4.549458 GTTGTTCAGCATTGCTTACATGT 58.451 39.130 18.80 2.69 36.40 3.21
2247 2506 4.163458 TGTTCAGCATTGCTTACATGTG 57.837 40.909 8.83 0.00 36.40 3.21
2248 2507 2.919229 GTTCAGCATTGCTTACATGTGC 59.081 45.455 8.83 4.74 36.40 4.57
2249 2508 1.130938 TCAGCATTGCTTACATGTGCG 59.869 47.619 8.83 0.00 40.66 5.34
2250 2509 0.179156 AGCATTGCTTACATGTGCGC 60.179 50.000 9.11 11.25 40.66 6.09
2251 2510 0.456482 GCATTGCTTACATGTGCGCA 60.456 50.000 5.66 5.66 31.04 6.09
2252 2511 1.799917 GCATTGCTTACATGTGCGCAT 60.800 47.619 15.91 7.01 35.32 4.73
2253 2512 2.541383 GCATTGCTTACATGTGCGCATA 60.541 45.455 15.91 12.79 33.30 3.14
2254 2513 3.854414 GCATTGCTTACATGTGCGCATAT 60.854 43.478 15.91 15.11 33.30 1.78
2255 2514 3.337301 TTGCTTACATGTGCGCATATG 57.663 42.857 36.19 36.19 36.22 1.78
2256 2515 2.559440 TGCTTACATGTGCGCATATGA 58.441 42.857 41.80 26.87 34.54 2.15
2257 2516 2.941720 TGCTTACATGTGCGCATATGAA 59.058 40.909 41.80 30.29 34.54 2.57
2258 2517 3.565063 TGCTTACATGTGCGCATATGAAT 59.435 39.130 41.80 27.81 34.54 2.57
2259 2518 4.153986 GCTTACATGTGCGCATATGAATC 58.846 43.478 41.80 25.84 34.54 2.52
2260 2519 4.715896 CTTACATGTGCGCATATGAATCC 58.284 43.478 41.80 17.54 34.54 3.01
2261 2520 2.854963 ACATGTGCGCATATGAATCCT 58.145 42.857 41.80 23.51 34.54 3.24
2262 2521 4.006780 ACATGTGCGCATATGAATCCTA 57.993 40.909 41.80 9.04 34.54 2.94
2263 2522 3.999001 ACATGTGCGCATATGAATCCTAG 59.001 43.478 41.80 20.95 34.54 3.02
2264 2523 2.416747 TGTGCGCATATGAATCCTAGC 58.583 47.619 15.91 0.00 0.00 3.42
2265 2524 2.037641 TGTGCGCATATGAATCCTAGCT 59.962 45.455 15.91 0.00 0.00 3.32
2266 2525 2.670414 GTGCGCATATGAATCCTAGCTC 59.330 50.000 15.91 0.00 0.00 4.09
2267 2526 2.564504 TGCGCATATGAATCCTAGCTCT 59.435 45.455 5.66 0.00 0.00 4.09
2268 2527 2.928757 GCGCATATGAATCCTAGCTCTG 59.071 50.000 6.97 0.00 0.00 3.35
2269 2528 2.928757 CGCATATGAATCCTAGCTCTGC 59.071 50.000 6.97 0.00 0.00 4.26
2270 2529 3.615834 CGCATATGAATCCTAGCTCTGCA 60.616 47.826 6.97 0.00 0.00 4.41
2271 2530 4.321718 GCATATGAATCCTAGCTCTGCAA 58.678 43.478 6.97 0.00 0.00 4.08
2272 2531 4.153835 GCATATGAATCCTAGCTCTGCAAC 59.846 45.833 6.97 0.00 0.00 4.17
2273 2532 3.920231 ATGAATCCTAGCTCTGCAACA 57.080 42.857 0.00 0.00 0.00 3.33
2274 2533 3.257469 TGAATCCTAGCTCTGCAACAG 57.743 47.619 0.00 0.00 0.00 3.16
2275 2534 1.939255 GAATCCTAGCTCTGCAACAGC 59.061 52.381 8.95 8.95 37.12 4.40
2277 2536 0.248565 TCCTAGCTCTGCAACAGCTG 59.751 55.000 24.02 13.48 46.99 4.24
2312 2571 3.439825 TGTTATTACTGCAGCACCATGTG 59.560 43.478 15.27 0.00 36.51 3.21
2354 2613 4.085357 TGGTGCTTGTCTGTAGTCAAAT 57.915 40.909 0.00 0.00 0.00 2.32
2355 2614 5.222079 TGGTGCTTGTCTGTAGTCAAATA 57.778 39.130 0.00 0.00 0.00 1.40
2356 2615 4.994852 TGGTGCTTGTCTGTAGTCAAATAC 59.005 41.667 0.00 0.00 0.00 1.89
2357 2616 5.221641 TGGTGCTTGTCTGTAGTCAAATACT 60.222 40.000 0.00 0.00 42.62 2.12
2358 2617 5.348997 GGTGCTTGTCTGTAGTCAAATACTC 59.651 44.000 0.00 0.00 39.80 2.59
2359 2618 5.348997 GTGCTTGTCTGTAGTCAAATACTCC 59.651 44.000 0.00 0.00 39.80 3.85
2360 2619 4.870991 GCTTGTCTGTAGTCAAATACTCCC 59.129 45.833 0.00 0.00 39.80 4.30
2361 2620 5.337652 GCTTGTCTGTAGTCAAATACTCCCT 60.338 44.000 0.00 0.00 39.80 4.20
2362 2621 5.916661 TGTCTGTAGTCAAATACTCCCTC 57.083 43.478 0.00 0.00 39.80 4.30
2363 2622 4.710375 TGTCTGTAGTCAAATACTCCCTCC 59.290 45.833 0.00 0.00 39.80 4.30
2364 2623 3.952323 TCTGTAGTCAAATACTCCCTCCG 59.048 47.826 0.00 0.00 39.80 4.63
2365 2624 3.700038 CTGTAGTCAAATACTCCCTCCGT 59.300 47.826 0.00 0.00 39.80 4.69
2366 2625 4.091549 TGTAGTCAAATACTCCCTCCGTT 58.908 43.478 0.00 0.00 39.80 4.44
2367 2626 3.889520 AGTCAAATACTCCCTCCGTTC 57.110 47.619 0.00 0.00 30.33 3.95
2368 2627 3.442076 AGTCAAATACTCCCTCCGTTCT 58.558 45.455 0.00 0.00 30.33 3.01
2369 2628 3.195825 AGTCAAATACTCCCTCCGTTCTG 59.804 47.826 0.00 0.00 30.33 3.02
2370 2629 3.194968 GTCAAATACTCCCTCCGTTCTGA 59.805 47.826 0.00 0.00 0.00 3.27
2371 2630 3.835978 TCAAATACTCCCTCCGTTCTGAA 59.164 43.478 0.00 0.00 0.00 3.02
2372 2631 4.469945 TCAAATACTCCCTCCGTTCTGAAT 59.530 41.667 0.00 0.00 0.00 2.57
2373 2632 5.045869 TCAAATACTCCCTCCGTTCTGAATT 60.046 40.000 0.00 0.00 0.00 2.17
2374 2633 6.155565 TCAAATACTCCCTCCGTTCTGAATTA 59.844 38.462 0.00 0.00 0.00 1.40
2375 2634 3.889520 ACTCCCTCCGTTCTGAATTAC 57.110 47.619 0.00 0.00 0.00 1.89
2376 2635 3.442076 ACTCCCTCCGTTCTGAATTACT 58.558 45.455 0.00 0.00 0.00 2.24
2377 2636 3.447944 ACTCCCTCCGTTCTGAATTACTC 59.552 47.826 0.00 0.00 0.00 2.59
2378 2637 2.426024 TCCCTCCGTTCTGAATTACTCG 59.574 50.000 0.00 0.00 0.00 4.18
2379 2638 2.165845 CCCTCCGTTCTGAATTACTCGT 59.834 50.000 0.00 0.00 0.00 4.18
2380 2639 3.436496 CCTCCGTTCTGAATTACTCGTC 58.564 50.000 0.00 0.00 0.00 4.20
2381 2640 3.099362 CTCCGTTCTGAATTACTCGTCG 58.901 50.000 0.00 0.00 0.00 5.12
2382 2641 1.582502 CCGTTCTGAATTACTCGTCGC 59.417 52.381 0.00 0.00 0.00 5.19
2383 2642 2.247637 CGTTCTGAATTACTCGTCGCA 58.752 47.619 0.00 0.00 0.00 5.10
2384 2643 2.276540 CGTTCTGAATTACTCGTCGCAG 59.723 50.000 0.00 0.00 0.00 5.18
2385 2644 3.499048 GTTCTGAATTACTCGTCGCAGA 58.501 45.455 0.00 0.00 0.00 4.26
2386 2645 3.842732 TCTGAATTACTCGTCGCAGAA 57.157 42.857 0.00 0.00 39.69 3.02
2387 2646 4.168922 TCTGAATTACTCGTCGCAGAAA 57.831 40.909 0.00 0.00 39.69 2.52
2388 2647 4.744570 TCTGAATTACTCGTCGCAGAAAT 58.255 39.130 0.00 0.00 39.69 2.17
2389 2648 4.562789 TCTGAATTACTCGTCGCAGAAATG 59.437 41.667 0.00 0.00 39.69 2.32
2390 2649 3.616821 TGAATTACTCGTCGCAGAAATGG 59.383 43.478 0.00 0.00 39.69 3.16
2391 2650 3.520290 ATTACTCGTCGCAGAAATGGA 57.480 42.857 0.00 0.00 39.69 3.41
2392 2651 3.520290 TTACTCGTCGCAGAAATGGAT 57.480 42.857 0.00 0.00 39.69 3.41
2393 2652 1.645034 ACTCGTCGCAGAAATGGATG 58.355 50.000 0.00 0.00 39.69 3.51
2394 2653 1.066858 ACTCGTCGCAGAAATGGATGT 60.067 47.619 0.00 0.00 39.69 3.06
2395 2654 2.165641 ACTCGTCGCAGAAATGGATGTA 59.834 45.455 0.00 0.00 39.69 2.29
2396 2655 3.181475 ACTCGTCGCAGAAATGGATGTAT 60.181 43.478 0.00 0.00 39.69 2.29
2397 2656 3.381045 TCGTCGCAGAAATGGATGTATC 58.619 45.455 0.00 0.00 39.69 2.24
2398 2657 3.068165 TCGTCGCAGAAATGGATGTATCT 59.932 43.478 0.00 0.00 39.69 1.98
2399 2658 4.277423 TCGTCGCAGAAATGGATGTATCTA 59.723 41.667 0.00 0.00 39.69 1.98
2400 2659 4.618912 CGTCGCAGAAATGGATGTATCTAG 59.381 45.833 0.00 0.00 39.69 2.43
2401 2660 5.562890 CGTCGCAGAAATGGATGTATCTAGA 60.563 44.000 0.00 0.00 39.69 2.43
2402 2661 6.393990 GTCGCAGAAATGGATGTATCTAGAT 58.606 40.000 10.73 10.73 39.69 1.98
2403 2662 6.309980 GTCGCAGAAATGGATGTATCTAGATG 59.690 42.308 15.79 0.00 39.69 2.90
2404 2663 6.015095 TCGCAGAAATGGATGTATCTAGATGT 60.015 38.462 15.79 1.25 0.00 3.06
2405 2664 7.176690 TCGCAGAAATGGATGTATCTAGATGTA 59.823 37.037 15.79 4.44 0.00 2.29
2406 2665 7.978414 CGCAGAAATGGATGTATCTAGATGTAT 59.022 37.037 15.79 9.11 0.00 2.29
2407 2666 9.664332 GCAGAAATGGATGTATCTAGATGTATT 57.336 33.333 15.79 4.32 0.00 1.89
2437 2696 9.347934 GTTCTAGATACATCCATTTCTATGACG 57.652 37.037 0.00 0.00 33.37 4.35
2438 2697 8.863872 TCTAGATACATCCATTTCTATGACGA 57.136 34.615 0.00 0.00 33.37 4.20
2439 2698 8.951243 TCTAGATACATCCATTTCTATGACGAG 58.049 37.037 0.00 0.00 33.37 4.18
2440 2699 7.531857 AGATACATCCATTTCTATGACGAGT 57.468 36.000 0.00 0.00 33.37 4.18
2441 2700 8.637196 AGATACATCCATTTCTATGACGAGTA 57.363 34.615 0.00 0.00 33.37 2.59
2442 2701 9.078990 AGATACATCCATTTCTATGACGAGTAA 57.921 33.333 0.00 0.00 33.37 2.24
2443 2702 9.862371 GATACATCCATTTCTATGACGAGTAAT 57.138 33.333 0.00 0.00 33.37 1.89
2445 2704 8.964476 ACATCCATTTCTATGACGAGTAATTT 57.036 30.769 0.00 0.00 33.37 1.82
2446 2705 8.830580 ACATCCATTTCTATGACGAGTAATTTG 58.169 33.333 0.00 0.00 33.37 2.32
2447 2706 7.786178 TCCATTTCTATGACGAGTAATTTGG 57.214 36.000 0.00 0.00 33.37 3.28
2448 2707 7.561251 TCCATTTCTATGACGAGTAATTTGGA 58.439 34.615 0.00 0.00 33.37 3.53
2449 2708 8.044309 TCCATTTCTATGACGAGTAATTTGGAA 58.956 33.333 0.00 0.00 33.37 3.53
2450 2709 8.122952 CCATTTCTATGACGAGTAATTTGGAAC 58.877 37.037 0.00 0.00 33.37 3.62
2451 2710 6.880822 TTCTATGACGAGTAATTTGGAACG 57.119 37.500 0.00 0.00 0.00 3.95
2452 2711 6.198650 TCTATGACGAGTAATTTGGAACGA 57.801 37.500 0.00 0.00 0.00 3.85
2453 2712 6.623486 TCTATGACGAGTAATTTGGAACGAA 58.377 36.000 0.00 0.00 0.00 3.85
2454 2713 5.779806 ATGACGAGTAATTTGGAACGAAG 57.220 39.130 0.00 0.00 0.00 3.79
2455 2714 3.991773 TGACGAGTAATTTGGAACGAAGG 59.008 43.478 0.00 0.00 0.00 3.46
2456 2715 3.332034 ACGAGTAATTTGGAACGAAGGG 58.668 45.455 0.00 0.00 0.00 3.95
2457 2716 3.007182 ACGAGTAATTTGGAACGAAGGGA 59.993 43.478 0.00 0.00 0.00 4.20
2458 2717 3.617263 CGAGTAATTTGGAACGAAGGGAG 59.383 47.826 0.00 0.00 0.00 4.30
2473 2732 5.661759 ACGAAGGGAGTAGGAGTAAATGATT 59.338 40.000 0.00 0.00 0.00 2.57
2474 2733 5.986135 CGAAGGGAGTAGGAGTAAATGATTG 59.014 44.000 0.00 0.00 0.00 2.67
2493 2977 3.713858 TGCATCTTTGTCTGTTGTTGG 57.286 42.857 0.00 0.00 0.00 3.77
2577 3063 0.258774 AGCTCCTGTGGTGGTGTTTT 59.741 50.000 0.00 0.00 0.00 2.43
2643 3134 2.988010 TACTGTAGATGGCCTTGCTG 57.012 50.000 3.32 0.23 0.00 4.41
2716 3208 0.453390 GTGCCTTGGACTGCTAATGC 59.547 55.000 0.00 0.00 40.20 3.56
2726 3218 3.131709 ACTGCTAATGCACAGTCTGTT 57.868 42.857 1.67 0.00 43.55 3.16
2744 3236 7.327761 CAGTCTGTTGACCAAATGATTTGATTC 59.672 37.037 18.82 14.10 43.91 2.52
2745 3239 7.232127 AGTCTGTTGACCAAATGATTTGATTCT 59.768 33.333 18.82 0.00 43.91 2.40
2750 3244 5.419788 TGACCAAATGATTTGATTCTCCCTG 59.580 40.000 18.82 2.00 43.26 4.45
2767 3261 8.497910 TTCTCCCTGATATTTGCTAGTATCTT 57.502 34.615 10.91 0.00 0.00 2.40
2794 3292 4.993028 TGCCTAGGGTATTTTGTCTGTTT 58.007 39.130 11.72 0.00 0.00 2.83
2796 3294 5.836358 TGCCTAGGGTATTTTGTCTGTTTTT 59.164 36.000 11.72 0.00 0.00 1.94
2823 3321 5.942826 TGTGGCAAAGTGATTACATACATGA 59.057 36.000 0.00 0.00 0.00 3.07
2846 3344 0.896940 ATGCTGCAGTTCAAGGGGTG 60.897 55.000 16.64 0.00 0.00 4.61
2960 3459 5.648092 ACAACTAAAGTGAATGATACCTGGC 59.352 40.000 0.00 0.00 0.00 4.85
2967 3466 2.091720 TGAATGATACCTGGCATTGGCT 60.092 45.455 11.84 0.00 40.87 4.75
2969 3468 2.638480 TGATACCTGGCATTGGCTAC 57.362 50.000 11.84 0.00 40.87 3.58
3033 3571 5.075858 TGTTTCCTTTCATCATGAATGCC 57.924 39.130 0.00 0.00 36.11 4.40
3041 3579 7.039152 TCCTTTCATCATGAATGCCACTTTAAA 60.039 33.333 0.00 0.00 36.11 1.52
3092 3630 1.937546 GCTGGCATACTGTGTTGGGC 61.938 60.000 0.00 0.00 0.00 5.36
3107 3645 1.742308 TGGGCTAAGTCCTTGAACCT 58.258 50.000 0.00 0.00 0.00 3.50
3140 3678 4.048504 GTTTACAACCATGTGTTCCTTGC 58.951 43.478 0.00 0.00 40.84 4.01
3141 3679 1.039856 ACAACCATGTGTTCCTTGCC 58.960 50.000 0.00 0.00 38.69 4.52
3142 3680 1.039068 CAACCATGTGTTCCTTGCCA 58.961 50.000 0.00 0.00 34.00 4.92
3144 3682 2.014010 ACCATGTGTTCCTTGCCATT 57.986 45.000 0.00 0.00 0.00 3.16
3145 3683 1.619827 ACCATGTGTTCCTTGCCATTG 59.380 47.619 0.00 0.00 0.00 2.82
3146 3684 1.673626 CCATGTGTTCCTTGCCATTGC 60.674 52.381 0.00 0.00 38.26 3.56
3167 3705 2.780010 CACCCCTGGAGTCCTGAATATT 59.220 50.000 17.19 0.00 0.00 1.28
3212 3750 0.183492 GCCTATGCATGTTCCTCCCA 59.817 55.000 10.16 0.00 37.47 4.37
3287 3833 2.695666 TGGCTAGCTCTTGATCTGTACC 59.304 50.000 15.72 0.00 0.00 3.34
3362 3921 8.579850 TTGGTTTGTAATCTTAGATTGCTGAT 57.420 30.769 20.34 0.00 0.00 2.90
3391 3950 2.340337 CTGGCATAAAAGGTTGCTTGC 58.660 47.619 0.00 0.00 38.88 4.01
3412 3971 2.877168 CCATAGCCTCTCTTTGACATGC 59.123 50.000 0.00 0.00 0.00 4.06
3480 4042 1.732259 GGCTGTTACTTGTCATGTCCG 59.268 52.381 0.00 0.00 0.00 4.79
3517 4079 8.854614 AGCTGAAAACTATGATTACTTCTGTT 57.145 30.769 0.00 0.00 0.00 3.16
3773 4338 3.319972 GGGTTAACAGTGGAAAAAGGACC 59.680 47.826 8.10 0.00 0.00 4.46
3893 4458 1.915266 TGCTAGTGCAGGTGGCTCT 60.915 57.895 6.00 0.00 45.31 4.09
4043 4608 2.091640 TTGGCCCCATTCCAGCAGAA 62.092 55.000 0.00 0.00 39.32 3.02
4071 4636 0.738389 CAAAAGGCGTCTTGGTGTGT 59.262 50.000 1.40 0.00 32.75 3.72
4073 4638 2.335316 AAAGGCGTCTTGGTGTGTTA 57.665 45.000 1.40 0.00 32.75 2.41
4118 4683 3.958860 GAGTGCAGGCAGTGGGGT 61.959 66.667 6.30 0.00 0.00 4.95
4270 4837 8.202745 GCTAGTTTACTCACTTGCTATCATTT 57.797 34.615 0.79 0.00 40.92 2.32
4277 4844 7.617041 ACTCACTTGCTATCATTTTACTTCC 57.383 36.000 0.00 0.00 0.00 3.46
4293 4860 2.492484 ACTTCCGTGTCTGATCCTACAC 59.508 50.000 14.60 14.60 42.04 2.90
4312 4881 3.494626 ACACGTGAGCACTTATTTCTGTG 59.505 43.478 25.01 0.00 37.26 3.66
4470 5039 3.733727 GGTTGTGCGGTATGTTTTTCTTG 59.266 43.478 0.00 0.00 0.00 3.02
4523 5093 7.358187 GCGTTTGATAAGTCCGTAGTTGATATC 60.358 40.741 0.00 0.00 0.00 1.63
4529 5099 5.916661 AGTCCGTAGTTGATATCACAGTT 57.083 39.130 4.48 0.00 0.00 3.16
4530 5100 7.400599 AAGTCCGTAGTTGATATCACAGTTA 57.599 36.000 4.48 0.00 0.00 2.24
4535 5107 6.691818 CCGTAGTTGATATCACAGTTACACTC 59.308 42.308 4.48 0.00 0.00 3.51
4636 5213 3.327757 AGACCATCCACTGTTCTGCTTAA 59.672 43.478 0.00 0.00 0.00 1.85
4646 5223 8.296713 TCCACTGTTCTGCTTAAATTTGTTATC 58.703 33.333 0.00 0.00 0.00 1.75
4746 5323 0.532862 CTCCTGAAACTGGTGTGCGT 60.533 55.000 0.00 0.00 0.00 5.24
4807 5384 8.027189 GGAAGATTGGTGTTCAGGTAATTTTAC 58.973 37.037 0.00 0.00 29.60 2.01
4809 5386 7.882179 AGATTGGTGTTCAGGTAATTTTACAC 58.118 34.615 3.12 0.00 35.37 2.90
4815 5392 5.533154 TGTTCAGGTAATTTTACACCCTGTG 59.467 40.000 0.00 0.00 39.75 3.66
4822 5399 1.136828 TTTACACCCTGTGCAGAGGT 58.863 50.000 26.87 12.50 36.98 3.85
4825 5402 1.344953 ACACCCTGTGCAGAGGTTCA 61.345 55.000 26.87 0.35 36.98 3.18
4827 5404 0.179018 ACCCTGTGCAGAGGTTCAAC 60.179 55.000 26.87 0.00 30.99 3.18
4828 5405 0.179020 CCCTGTGCAGAGGTTCAACA 60.179 55.000 26.87 0.00 0.00 3.33
4834 5411 2.035066 GTGCAGAGGTTCAACATTGCTT 59.965 45.455 10.34 0.00 33.00 3.91
4835 5412 2.694628 TGCAGAGGTTCAACATTGCTTT 59.305 40.909 10.34 0.00 33.00 3.51
4839 5416 5.218139 CAGAGGTTCAACATTGCTTTTCTC 58.782 41.667 0.00 0.00 0.00 2.87
4842 5419 6.944862 AGAGGTTCAACATTGCTTTTCTCTAT 59.055 34.615 0.00 0.00 0.00 1.98
4843 5420 7.449704 AGAGGTTCAACATTGCTTTTCTCTATT 59.550 33.333 0.00 0.00 0.00 1.73
4917 5494 3.611766 ACATACAAGGTCTGCAGGTAC 57.388 47.619 15.13 5.33 0.00 3.34
4923 5500 2.031495 AGGTCTGCAGGTACCTCTTT 57.969 50.000 18.98 0.45 42.60 2.52
4964 5541 0.038166 GCTCCATGGACCAGGTTTGA 59.962 55.000 11.44 0.00 0.00 2.69
4969 5546 2.297033 CCATGGACCAGGTTTGACAAAG 59.703 50.000 5.56 0.00 0.00 2.77
5011 5589 6.424509 TGGCAATATGCTTTTGTCTTGAAAAG 59.575 34.615 2.00 0.00 44.39 2.27
5121 5699 2.005451 CTGCAAGGTGCTACTGACATC 58.995 52.381 1.43 0.00 45.31 3.06
5128 5706 2.996621 GGTGCTACTGACATCACTGAAC 59.003 50.000 0.00 0.00 0.00 3.18
5200 5778 8.370493 TCTTCTTCTGATGTTTTCACTTACAG 57.630 34.615 0.00 0.00 0.00 2.74
5219 5798 2.876550 CAGGCATACATCATCACCACTG 59.123 50.000 0.00 0.00 0.00 3.66
5220 5799 2.773661 AGGCATACATCATCACCACTGA 59.226 45.455 0.00 0.00 0.00 3.41
5221 5800 3.393609 AGGCATACATCATCACCACTGAT 59.606 43.478 0.00 0.00 37.65 2.90
5222 5801 3.750130 GGCATACATCATCACCACTGATC 59.250 47.826 0.00 0.00 34.65 2.92
5228 5807 4.100653 ACATCATCACCACTGATCGATCTT 59.899 41.667 25.02 10.31 34.65 2.40
5367 5949 5.144692 AGCGTGCTCATATGTCTATGAAT 57.855 39.130 1.90 0.00 42.41 2.57
5390 5972 2.711547 AGAGGCTGTTGAAGGGTTAGTT 59.288 45.455 0.00 0.00 0.00 2.24
5394 5976 5.451354 AGGCTGTTGAAGGGTTAGTTTTTA 58.549 37.500 0.00 0.00 0.00 1.52
5416 5998 2.287308 TGCCGTGTGTTTTGATTGCTAC 60.287 45.455 0.00 0.00 0.00 3.58
5465 6047 7.521871 AATCTATTCCAAGCATTCATTCTCC 57.478 36.000 0.00 0.00 0.00 3.71
5526 6108 2.354403 GGCTGCTCCATTTGCAAGAATT 60.354 45.455 0.00 0.00 40.13 2.17
5546 6128 7.234355 AGAATTTGATGAAGGAACCACTTACT 58.766 34.615 0.00 0.00 0.00 2.24
5597 6179 0.031994 GTTTGACCGCTGCATTTGGT 59.968 50.000 4.49 4.49 39.12 3.67
5687 6269 2.311854 CCCCTCCTGCCCAACTGAT 61.312 63.158 0.00 0.00 0.00 2.90
5716 6298 2.352805 CCTGGAGAACCCACAGGC 59.647 66.667 0.00 0.00 44.55 4.85
5725 6307 3.091545 AGAACCCACAGGCATGTAATTG 58.908 45.455 2.51 0.00 37.65 2.32
5748 6345 3.976793 ACACAAGTCTGTTGAAGCATG 57.023 42.857 0.00 0.00 31.64 4.06
5751 6348 4.158394 ACACAAGTCTGTTGAAGCATGTTT 59.842 37.500 0.00 0.00 31.64 2.83
5779 6377 2.695359 TGTTTACTGATGGACGCCTTC 58.305 47.619 5.27 5.27 0.00 3.46
5889 6490 3.462579 AGGGATCTGCTGAGGAAAATGAT 59.537 43.478 0.00 0.00 0.00 2.45
5895 6496 5.691896 TCTGCTGAGGAAAATGATGATGAT 58.308 37.500 0.00 0.00 0.00 2.45
5925 6526 2.589664 TCTGGAGAAGGAAGAGGAGGAT 59.410 50.000 0.00 0.00 0.00 3.24
6053 6654 4.087892 TCTGAGGCGCAAGGGAGC 62.088 66.667 10.83 0.00 39.33 4.70
6063 6667 1.970352 GCAAGGGAGCTGAGGAGGAG 61.970 65.000 0.00 0.00 0.00 3.69
6098 6702 2.027377 AGAAGATCAAGACCACTGCTGG 60.027 50.000 0.00 0.00 44.26 4.85
6129 6736 2.957680 TGTGGAAAATGCAGCTGAAGAA 59.042 40.909 20.43 0.00 0.00 2.52
6135 6742 1.023513 ATGCAGCTGAAGAAGACGCC 61.024 55.000 20.43 0.00 0.00 5.68
6150 6757 1.128692 GACGCCGAGATGGTTGAAAAG 59.871 52.381 0.00 0.00 41.21 2.27
6151 6758 0.447801 CGCCGAGATGGTTGAAAAGG 59.552 55.000 0.00 0.00 41.21 3.11
6166 6773 5.388599 TGAAAAGGAGGAAGAAGAAGGTT 57.611 39.130 0.00 0.00 0.00 3.50
6176 6783 1.352687 AGAAGAAGGTTCCCAGAAGGC 59.647 52.381 0.00 0.00 34.51 4.35
6432 7069 1.576421 CAAGGCCGACAACTGAAGC 59.424 57.895 0.00 0.00 0.00 3.86
6433 7070 0.886490 CAAGGCCGACAACTGAAGCT 60.886 55.000 0.00 0.00 0.00 3.74
6435 7072 2.035442 GGCCGACAACTGAAGCTCC 61.035 63.158 0.00 0.00 0.00 4.70
6436 7073 2.383527 GCCGACAACTGAAGCTCCG 61.384 63.158 0.00 0.00 0.00 4.63
6437 7074 1.006102 CCGACAACTGAAGCTCCGT 60.006 57.895 0.00 0.00 0.00 4.69
6440 7077 1.865865 GACAACTGAAGCTCCGTTGA 58.134 50.000 21.98 0.00 40.19 3.18
6443 7080 2.158957 ACAACTGAAGCTCCGTTGAAGA 60.159 45.455 21.98 0.00 40.19 2.87
6525 7175 9.674824 GCTGGTCGCGTATTATATATATAGTTT 57.325 33.333 5.77 0.00 0.00 2.66
6558 7209 4.377022 CGGAAGACTGTTTTATCCGTTGTG 60.377 45.833 13.03 0.00 45.96 3.33
6566 7217 4.273969 TGTTTTATCCGTTGTGTCTTGTCC 59.726 41.667 0.00 0.00 0.00 4.02
6567 7218 2.754946 TATCCGTTGTGTCTTGTCCC 57.245 50.000 0.00 0.00 0.00 4.46
6574 7225 1.410004 TGTGTCTTGTCCCGAGACTT 58.590 50.000 11.77 0.00 43.31 3.01
6576 7227 0.679505 TGTCTTGTCCCGAGACTTGG 59.320 55.000 11.77 1.08 43.31 3.61
6577 7228 0.680061 GTCTTGTCCCGAGACTTGGT 59.320 55.000 8.01 0.00 43.91 3.67
6688 7386 9.440773 GGTTATGATGATGATGCTTGAACTATA 57.559 33.333 0.00 0.00 0.00 1.31
6712 7410 9.691362 ATATTTACTGGTGTGATTGTTTGTTTC 57.309 29.630 0.00 0.00 0.00 2.78
6714 7412 5.659440 ACTGGTGTGATTGTTTGTTTCTT 57.341 34.783 0.00 0.00 0.00 2.52
6715 7413 6.036577 ACTGGTGTGATTGTTTGTTTCTTT 57.963 33.333 0.00 0.00 0.00 2.52
6716 7414 6.099341 ACTGGTGTGATTGTTTGTTTCTTTC 58.901 36.000 0.00 0.00 0.00 2.62
6717 7415 6.071391 ACTGGTGTGATTGTTTGTTTCTTTCT 60.071 34.615 0.00 0.00 0.00 2.52
6718 7416 6.696411 TGGTGTGATTGTTTGTTTCTTTCTT 58.304 32.000 0.00 0.00 0.00 2.52
6735 7433 3.701205 TCTTTCTGCTGCATCTGGTTA 57.299 42.857 1.31 0.00 0.00 2.85
6736 7434 3.603532 TCTTTCTGCTGCATCTGGTTAG 58.396 45.455 1.31 0.00 0.00 2.34
6737 7435 3.261643 TCTTTCTGCTGCATCTGGTTAGA 59.738 43.478 1.31 0.00 37.35 2.10
6738 7436 3.920231 TTCTGCTGCATCTGGTTAGAT 57.080 42.857 1.31 0.00 44.45 1.98
6753 7451 8.301252 TCTGGTTAGATGTATAGTTAGTTGCA 57.699 34.615 0.00 0.00 0.00 4.08
6754 7452 8.924303 TCTGGTTAGATGTATAGTTAGTTGCAT 58.076 33.333 0.00 0.00 0.00 3.96
6755 7453 9.197694 CTGGTTAGATGTATAGTTAGTTGCATC 57.802 37.037 0.00 0.00 34.61 3.91
6756 7454 8.924303 TGGTTAGATGTATAGTTAGTTGCATCT 58.076 33.333 2.28 2.28 43.43 2.90
6768 7466 8.220755 AGTTAGTTGCATCTAGTTTTTGTTCA 57.779 30.769 4.74 0.00 0.00 3.18
6769 7467 8.345565 AGTTAGTTGCATCTAGTTTTTGTTCAG 58.654 33.333 4.74 0.00 0.00 3.02
6770 7468 6.942532 AGTTGCATCTAGTTTTTGTTCAGA 57.057 33.333 0.00 0.00 0.00 3.27
6771 7469 7.333528 AGTTGCATCTAGTTTTTGTTCAGAA 57.666 32.000 0.00 0.00 0.00 3.02
6772 7470 7.771183 AGTTGCATCTAGTTTTTGTTCAGAAA 58.229 30.769 0.00 0.00 0.00 2.52
6773 7471 7.702348 AGTTGCATCTAGTTTTTGTTCAGAAAC 59.298 33.333 9.82 9.82 36.31 2.78
6774 7472 6.503524 TGCATCTAGTTTTTGTTCAGAAACC 58.496 36.000 12.93 1.59 36.63 3.27
6775 7473 6.096141 TGCATCTAGTTTTTGTTCAGAAACCA 59.904 34.615 12.93 2.40 36.63 3.67
6776 7474 6.978080 GCATCTAGTTTTTGTTCAGAAACCAA 59.022 34.615 12.93 4.36 36.63 3.67
6777 7475 7.491048 GCATCTAGTTTTTGTTCAGAAACCAAA 59.509 33.333 12.93 0.00 36.63 3.28
6778 7476 8.807581 CATCTAGTTTTTGTTCAGAAACCAAAC 58.192 33.333 12.93 3.36 37.58 2.93
6779 7477 7.317390 TCTAGTTTTTGTTCAGAAACCAAACC 58.683 34.615 12.93 0.75 37.81 3.27
6780 7478 6.109156 AGTTTTTGTTCAGAAACCAAACCT 57.891 33.333 12.93 2.41 37.81 3.50
6781 7479 6.530120 AGTTTTTGTTCAGAAACCAAACCTT 58.470 32.000 12.93 0.00 37.81 3.50
6782 7480 6.426633 AGTTTTTGTTCAGAAACCAAACCTTG 59.573 34.615 12.93 0.00 37.81 3.61
6783 7481 3.518634 TGTTCAGAAACCAAACCTTGC 57.481 42.857 0.00 0.00 34.28 4.01
6784 7482 3.096092 TGTTCAGAAACCAAACCTTGCT 58.904 40.909 0.00 0.00 34.28 3.91
6785 7483 4.274147 TGTTCAGAAACCAAACCTTGCTA 58.726 39.130 0.00 0.00 34.28 3.49
6786 7484 4.707448 TGTTCAGAAACCAAACCTTGCTAA 59.293 37.500 0.00 0.00 34.28 3.09
6787 7485 5.362430 TGTTCAGAAACCAAACCTTGCTAAT 59.638 36.000 0.00 0.00 34.28 1.73
6788 7486 6.127196 TGTTCAGAAACCAAACCTTGCTAATT 60.127 34.615 0.00 0.00 34.28 1.40
6789 7487 6.478512 TCAGAAACCAAACCTTGCTAATTT 57.521 33.333 0.00 0.00 0.00 1.82
6790 7488 6.279882 TCAGAAACCAAACCTTGCTAATTTG 58.720 36.000 0.00 0.00 33.90 2.32
6795 7493 4.599047 CAAACCTTGCTAATTTGGACCA 57.401 40.909 0.00 0.00 31.12 4.02
6796 7494 4.559153 CAAACCTTGCTAATTTGGACCAG 58.441 43.478 0.00 0.00 31.12 4.00
6797 7495 2.807676 ACCTTGCTAATTTGGACCAGG 58.192 47.619 0.00 0.00 0.00 4.45
6798 7496 2.110011 ACCTTGCTAATTTGGACCAGGT 59.890 45.455 0.00 0.00 0.00 4.00
6799 7497 3.165071 CCTTGCTAATTTGGACCAGGTT 58.835 45.455 0.00 0.00 0.00 3.50
6800 7498 3.578282 CCTTGCTAATTTGGACCAGGTTT 59.422 43.478 0.00 0.00 0.00 3.27
6801 7499 4.321974 CCTTGCTAATTTGGACCAGGTTTC 60.322 45.833 0.00 0.00 0.00 2.78
6802 7500 4.112634 TGCTAATTTGGACCAGGTTTCT 57.887 40.909 0.00 0.00 0.00 2.52
6803 7501 4.479158 TGCTAATTTGGACCAGGTTTCTT 58.521 39.130 0.00 0.00 0.00 2.52
6804 7502 4.898861 TGCTAATTTGGACCAGGTTTCTTT 59.101 37.500 0.00 0.00 0.00 2.52
6805 7503 5.365314 TGCTAATTTGGACCAGGTTTCTTTT 59.635 36.000 0.00 0.00 0.00 2.27
6806 7504 6.551601 TGCTAATTTGGACCAGGTTTCTTTTA 59.448 34.615 0.00 0.00 0.00 1.52
6807 7505 7.234577 TGCTAATTTGGACCAGGTTTCTTTTAT 59.765 33.333 0.00 0.00 0.00 1.40
6808 7506 8.745590 GCTAATTTGGACCAGGTTTCTTTTATA 58.254 33.333 0.00 0.00 0.00 0.98
6810 7508 7.718334 ATTTGGACCAGGTTTCTTTTATAGG 57.282 36.000 0.00 0.00 0.00 2.57
6811 7509 5.187621 TGGACCAGGTTTCTTTTATAGGG 57.812 43.478 0.00 0.00 0.00 3.53
6812 7510 4.017867 TGGACCAGGTTTCTTTTATAGGGG 60.018 45.833 0.00 0.00 0.00 4.79
6813 7511 4.228895 GGACCAGGTTTCTTTTATAGGGGA 59.771 45.833 0.00 0.00 0.00 4.81
6814 7512 5.103643 GGACCAGGTTTCTTTTATAGGGGAT 60.104 44.000 0.00 0.00 0.00 3.85
6815 7513 6.102174 GGACCAGGTTTCTTTTATAGGGGATA 59.898 42.308 0.00 0.00 0.00 2.59
6816 7514 7.367095 GGACCAGGTTTCTTTTATAGGGGATAA 60.367 40.741 0.00 0.00 0.00 1.75
6817 7515 7.946381 ACCAGGTTTCTTTTATAGGGGATAAA 58.054 34.615 0.00 0.00 38.07 1.40
6818 7516 8.403474 ACCAGGTTTCTTTTATAGGGGATAAAA 58.597 33.333 0.00 3.26 44.26 1.52
6819 7517 9.434275 CCAGGTTTCTTTTATAGGGGATAAAAT 57.566 33.333 3.62 0.00 44.97 1.82
6865 7563 9.777297 ATAAACTTGGTCATATTTGCAAAGTTT 57.223 25.926 18.19 18.48 41.17 2.66
6866 7564 7.481275 AACTTGGTCATATTTGCAAAGTTTG 57.519 32.000 18.19 11.41 33.28 2.93
6867 7565 5.990996 ACTTGGTCATATTTGCAAAGTTTGG 59.009 36.000 18.19 5.52 0.00 3.28
6868 7566 4.314121 TGGTCATATTTGCAAAGTTTGGC 58.686 39.130 18.19 14.81 0.00 4.52
6869 7567 4.040217 TGGTCATATTTGCAAAGTTTGGCT 59.960 37.500 18.19 1.10 0.00 4.75
6870 7568 4.996758 GGTCATATTTGCAAAGTTTGGCTT 59.003 37.500 18.19 0.33 39.52 4.35
6871 7569 5.106987 GGTCATATTTGCAAAGTTTGGCTTG 60.107 40.000 18.19 6.17 37.52 4.01
6872 7570 4.996122 TCATATTTGCAAAGTTTGGCTTGG 59.004 37.500 18.19 0.00 37.52 3.61
6873 7571 2.035530 TTTGCAAAGTTTGGCTTGGG 57.964 45.000 17.11 0.00 37.52 4.12
6874 7572 1.198713 TTGCAAAGTTTGGCTTGGGA 58.801 45.000 17.11 0.00 37.52 4.37
6875 7573 1.422531 TGCAAAGTTTGGCTTGGGAT 58.577 45.000 17.11 0.00 37.52 3.85
6876 7574 1.767681 TGCAAAGTTTGGCTTGGGATT 59.232 42.857 17.11 0.00 37.52 3.01
6877 7575 2.145536 GCAAAGTTTGGCTTGGGATTG 58.854 47.619 17.11 0.00 37.52 2.67
6878 7576 2.145536 CAAAGTTTGGCTTGGGATTGC 58.854 47.619 7.78 0.00 37.52 3.56
6879 7577 0.318120 AAGTTTGGCTTGGGATTGCG 59.682 50.000 0.00 0.00 35.80 4.85
6880 7578 0.827507 AGTTTGGCTTGGGATTGCGT 60.828 50.000 0.00 0.00 0.00 5.24
6881 7579 0.667184 GTTTGGCTTGGGATTGCGTG 60.667 55.000 0.00 0.00 0.00 5.34
6882 7580 1.814772 TTTGGCTTGGGATTGCGTGG 61.815 55.000 0.00 0.00 0.00 4.94
6883 7581 2.676471 GGCTTGGGATTGCGTGGT 60.676 61.111 0.00 0.00 0.00 4.16
6884 7582 2.275380 GGCTTGGGATTGCGTGGTT 61.275 57.895 0.00 0.00 0.00 3.67
6885 7583 1.212751 GCTTGGGATTGCGTGGTTC 59.787 57.895 0.00 0.00 0.00 3.62
6886 7584 1.244019 GCTTGGGATTGCGTGGTTCT 61.244 55.000 0.00 0.00 0.00 3.01
6887 7585 0.523072 CTTGGGATTGCGTGGTTCTG 59.477 55.000 0.00 0.00 0.00 3.02
6888 7586 0.109532 TTGGGATTGCGTGGTTCTGA 59.890 50.000 0.00 0.00 0.00 3.27
6889 7587 0.321564 TGGGATTGCGTGGTTCTGAG 60.322 55.000 0.00 0.00 0.00 3.35
6890 7588 0.321653 GGGATTGCGTGGTTCTGAGT 60.322 55.000 0.00 0.00 0.00 3.41
6891 7589 1.066430 GGGATTGCGTGGTTCTGAGTA 60.066 52.381 0.00 0.00 0.00 2.59
6892 7590 2.000447 GGATTGCGTGGTTCTGAGTAC 59.000 52.381 0.00 0.00 0.00 2.73
6893 7591 2.611971 GGATTGCGTGGTTCTGAGTACA 60.612 50.000 0.00 0.00 0.00 2.90
6894 7592 1.860676 TTGCGTGGTTCTGAGTACAC 58.139 50.000 0.00 0.00 0.00 2.90
6895 7593 1.037493 TGCGTGGTTCTGAGTACACT 58.963 50.000 0.00 0.00 0.00 3.55
6896 7594 2.232399 TGCGTGGTTCTGAGTACACTA 58.768 47.619 0.00 0.00 0.00 2.74
6897 7595 2.228103 TGCGTGGTTCTGAGTACACTAG 59.772 50.000 0.00 0.00 0.00 2.57
6898 7596 2.228343 GCGTGGTTCTGAGTACACTAGT 59.772 50.000 0.00 0.00 0.00 2.57
6899 7597 3.305199 GCGTGGTTCTGAGTACACTAGTT 60.305 47.826 0.00 0.00 0.00 2.24
6900 7598 4.795308 GCGTGGTTCTGAGTACACTAGTTT 60.795 45.833 0.00 0.00 0.00 2.66
6901 7599 5.287226 CGTGGTTCTGAGTACACTAGTTTT 58.713 41.667 0.00 0.00 0.00 2.43
6902 7600 6.441274 CGTGGTTCTGAGTACACTAGTTTTA 58.559 40.000 0.00 0.00 0.00 1.52
6903 7601 6.361748 CGTGGTTCTGAGTACACTAGTTTTAC 59.638 42.308 0.00 0.00 0.00 2.01
6904 7602 7.205297 GTGGTTCTGAGTACACTAGTTTTACA 58.795 38.462 12.09 1.79 0.00 2.41
6905 7603 7.707893 GTGGTTCTGAGTACACTAGTTTTACAA 59.292 37.037 12.09 2.23 0.00 2.41
6906 7604 8.259411 TGGTTCTGAGTACACTAGTTTTACAAA 58.741 33.333 12.09 1.97 0.00 2.83
6907 7605 8.762426 GGTTCTGAGTACACTAGTTTTACAAAG 58.238 37.037 12.09 9.22 0.00 2.77
6908 7606 7.941795 TCTGAGTACACTAGTTTTACAAAGC 57.058 36.000 12.09 2.45 0.00 3.51
6909 7607 7.723324 TCTGAGTACACTAGTTTTACAAAGCT 58.277 34.615 12.09 0.00 33.85 3.74
6910 7608 7.866393 TCTGAGTACACTAGTTTTACAAAGCTC 59.134 37.037 12.09 3.71 31.69 4.09
6911 7609 6.927381 TGAGTACACTAGTTTTACAAAGCTCC 59.073 38.462 12.09 0.00 31.69 4.70
6912 7610 6.823497 AGTACACTAGTTTTACAAAGCTCCA 58.177 36.000 12.09 0.00 31.69 3.86
6913 7611 7.277396 AGTACACTAGTTTTACAAAGCTCCAA 58.723 34.615 12.09 0.00 31.69 3.53
6914 7612 7.771826 AGTACACTAGTTTTACAAAGCTCCAAA 59.228 33.333 12.09 0.00 31.69 3.28
6915 7613 7.399245 ACACTAGTTTTACAAAGCTCCAAAA 57.601 32.000 0.00 0.00 31.69 2.44
6916 7614 7.832769 ACACTAGTTTTACAAAGCTCCAAAAA 58.167 30.769 0.00 0.00 31.69 1.94
6917 7615 7.758076 ACACTAGTTTTACAAAGCTCCAAAAAC 59.242 33.333 14.16 14.16 39.28 2.43
6918 7616 7.222031 CACTAGTTTTACAAAGCTCCAAAAACC 59.778 37.037 16.61 5.96 39.63 3.27
6919 7617 6.043854 AGTTTTACAAAGCTCCAAAAACCA 57.956 33.333 16.61 0.00 39.63 3.67
6920 7618 6.468543 AGTTTTACAAAGCTCCAAAAACCAA 58.531 32.000 16.61 0.00 39.63 3.67
6921 7619 6.937465 AGTTTTACAAAGCTCCAAAAACCAAA 59.063 30.769 16.61 0.00 39.63 3.28
6922 7620 7.445707 AGTTTTACAAAGCTCCAAAAACCAAAA 59.554 29.630 16.61 2.02 39.63 2.44
6923 7621 6.729391 TTACAAAGCTCCAAAAACCAAAAC 57.271 33.333 0.00 0.00 0.00 2.43
6924 7622 4.905429 ACAAAGCTCCAAAAACCAAAACT 58.095 34.783 0.00 0.00 0.00 2.66
6925 7623 5.312895 ACAAAGCTCCAAAAACCAAAACTT 58.687 33.333 0.00 0.00 0.00 2.66
6926 7624 5.411361 ACAAAGCTCCAAAAACCAAAACTTC 59.589 36.000 0.00 0.00 0.00 3.01
6927 7625 3.780902 AGCTCCAAAAACCAAAACTTCG 58.219 40.909 0.00 0.00 0.00 3.79
6928 7626 3.445805 AGCTCCAAAAACCAAAACTTCGA 59.554 39.130 0.00 0.00 0.00 3.71
6929 7627 4.081917 AGCTCCAAAAACCAAAACTTCGAA 60.082 37.500 0.00 0.00 0.00 3.71
6930 7628 4.627900 GCTCCAAAAACCAAAACTTCGAAA 59.372 37.500 0.00 0.00 0.00 3.46
6931 7629 5.120986 GCTCCAAAAACCAAAACTTCGAAAA 59.879 36.000 0.00 0.00 0.00 2.29
6932 7630 6.183360 GCTCCAAAAACCAAAACTTCGAAAAT 60.183 34.615 0.00 0.00 0.00 1.82
6933 7631 7.010645 GCTCCAAAAACCAAAACTTCGAAAATA 59.989 33.333 0.00 0.00 0.00 1.40
6934 7632 8.187354 TCCAAAAACCAAAACTTCGAAAATAC 57.813 30.769 0.00 0.00 0.00 1.89
6935 7633 7.278203 TCCAAAAACCAAAACTTCGAAAATACC 59.722 33.333 0.00 0.00 0.00 2.73
6936 7634 7.279090 CCAAAAACCAAAACTTCGAAAATACCT 59.721 33.333 0.00 0.00 0.00 3.08
6937 7635 8.661257 CAAAAACCAAAACTTCGAAAATACCTT 58.339 29.630 0.00 0.00 0.00 3.50
6938 7636 7.997107 AAACCAAAACTTCGAAAATACCTTC 57.003 32.000 0.00 0.00 0.00 3.46
6939 7637 6.080648 ACCAAAACTTCGAAAATACCTTCC 57.919 37.500 0.00 0.00 0.00 3.46
6940 7638 5.595133 ACCAAAACTTCGAAAATACCTTCCA 59.405 36.000 0.00 0.00 0.00 3.53
6941 7639 6.266786 ACCAAAACTTCGAAAATACCTTCCAT 59.733 34.615 0.00 0.00 0.00 3.41
6942 7640 6.806739 CCAAAACTTCGAAAATACCTTCCATC 59.193 38.462 0.00 0.00 0.00 3.51
6943 7641 7.309194 CCAAAACTTCGAAAATACCTTCCATCT 60.309 37.037 0.00 0.00 0.00 2.90
6944 7642 6.743575 AACTTCGAAAATACCTTCCATCTG 57.256 37.500 0.00 0.00 0.00 2.90
6945 7643 5.186198 ACTTCGAAAATACCTTCCATCTGG 58.814 41.667 0.00 0.00 0.00 3.86
6946 7644 4.837093 TCGAAAATACCTTCCATCTGGT 57.163 40.909 0.00 0.00 40.12 4.00
6947 7645 5.174037 TCGAAAATACCTTCCATCTGGTT 57.826 39.130 0.00 0.00 37.74 3.67
6948 7646 5.566469 TCGAAAATACCTTCCATCTGGTTT 58.434 37.500 0.00 0.00 37.74 3.27
6949 7647 5.646360 TCGAAAATACCTTCCATCTGGTTTC 59.354 40.000 0.00 0.00 37.74 2.78
6950 7648 5.414454 CGAAAATACCTTCCATCTGGTTTCA 59.586 40.000 0.00 0.00 37.74 2.69
6951 7649 6.590234 AAAATACCTTCCATCTGGTTTCAC 57.410 37.500 0.00 0.00 37.74 3.18
6952 7650 2.185004 ACCTTCCATCTGGTTTCACG 57.815 50.000 0.00 0.00 36.34 4.35
6953 7651 1.271379 ACCTTCCATCTGGTTTCACGG 60.271 52.381 0.00 0.00 36.34 4.94
6954 7652 1.271379 CCTTCCATCTGGTTTCACGGT 60.271 52.381 0.00 0.00 36.34 4.83
6955 7653 2.504367 CTTCCATCTGGTTTCACGGTT 58.496 47.619 0.00 0.00 36.34 4.44
6956 7654 2.178912 TCCATCTGGTTTCACGGTTC 57.821 50.000 0.00 0.00 36.34 3.62
6957 7655 1.697432 TCCATCTGGTTTCACGGTTCT 59.303 47.619 0.00 0.00 36.34 3.01
6958 7656 1.806542 CCATCTGGTTTCACGGTTCTG 59.193 52.381 0.00 0.00 0.00 3.02
6959 7657 2.549992 CCATCTGGTTTCACGGTTCTGA 60.550 50.000 0.00 0.00 0.00 3.27
6960 7658 2.526304 TCTGGTTTCACGGTTCTGAG 57.474 50.000 0.00 0.00 0.00 3.35
6961 7659 1.760613 TCTGGTTTCACGGTTCTGAGT 59.239 47.619 0.00 0.00 0.00 3.41
6962 7660 2.960384 TCTGGTTTCACGGTTCTGAGTA 59.040 45.455 0.00 0.00 0.00 2.59
6963 7661 3.057734 CTGGTTTCACGGTTCTGAGTAC 58.942 50.000 0.00 0.00 0.00 2.73
6964 7662 2.431419 TGGTTTCACGGTTCTGAGTACA 59.569 45.455 0.00 0.00 0.00 2.90
6965 7663 3.057734 GGTTTCACGGTTCTGAGTACAG 58.942 50.000 0.00 0.00 44.66 2.74
6966 7664 3.492137 GGTTTCACGGTTCTGAGTACAGT 60.492 47.826 0.00 0.00 43.81 3.55
6967 7665 4.117685 GTTTCACGGTTCTGAGTACAGTT 58.882 43.478 0.00 0.00 43.81 3.16
6968 7666 4.395959 TTCACGGTTCTGAGTACAGTTT 57.604 40.909 0.00 0.00 43.81 2.66
6969 7667 4.395959 TCACGGTTCTGAGTACAGTTTT 57.604 40.909 0.00 0.00 43.81 2.43
6970 7668 4.761975 TCACGGTTCTGAGTACAGTTTTT 58.238 39.130 0.00 0.00 43.81 1.94
6992 7690 6.715344 TTTTGTAGAAGTAGGTATTGCGTG 57.285 37.500 0.00 0.00 0.00 5.34
6993 7691 4.380841 TGTAGAAGTAGGTATTGCGTGG 57.619 45.455 0.00 0.00 0.00 4.94
6994 7692 2.311124 AGAAGTAGGTATTGCGTGGC 57.689 50.000 0.00 0.00 0.00 5.01
6995 7693 1.553248 AGAAGTAGGTATTGCGTGGCA 59.447 47.619 0.00 0.00 36.47 4.92
7004 7702 3.863681 TTGCGTGGCAAAGTGAATC 57.136 47.368 0.00 0.00 45.96 2.52
7005 7703 1.028130 TTGCGTGGCAAAGTGAATCA 58.972 45.000 0.00 0.00 45.96 2.57
7006 7704 1.028130 TGCGTGGCAAAGTGAATCAA 58.972 45.000 0.00 0.00 34.76 2.57
7007 7705 1.406898 TGCGTGGCAAAGTGAATCAAA 59.593 42.857 0.00 0.00 34.76 2.69
7008 7706 2.053627 GCGTGGCAAAGTGAATCAAAG 58.946 47.619 0.00 0.00 0.00 2.77
7009 7707 2.543653 GCGTGGCAAAGTGAATCAAAGT 60.544 45.455 0.00 0.00 0.00 2.66
7010 7708 3.705604 CGTGGCAAAGTGAATCAAAGTT 58.294 40.909 0.00 0.00 0.00 2.66
7011 7709 4.791411 GCGTGGCAAAGTGAATCAAAGTTA 60.791 41.667 0.00 0.00 0.00 2.24
7012 7710 5.277825 CGTGGCAAAGTGAATCAAAGTTAA 58.722 37.500 0.00 0.00 0.00 2.01
7013 7711 5.399301 CGTGGCAAAGTGAATCAAAGTTAAG 59.601 40.000 0.00 0.00 0.00 1.85
7014 7712 5.175673 GTGGCAAAGTGAATCAAAGTTAAGC 59.824 40.000 0.00 0.00 0.00 3.09
7015 7713 4.686091 GGCAAAGTGAATCAAAGTTAAGCC 59.314 41.667 0.00 0.00 0.00 4.35
7016 7714 5.288804 GCAAAGTGAATCAAAGTTAAGCCA 58.711 37.500 0.00 0.00 0.00 4.75
7017 7715 5.752955 GCAAAGTGAATCAAAGTTAAGCCAA 59.247 36.000 0.00 0.00 0.00 4.52
7018 7716 6.074142 GCAAAGTGAATCAAAGTTAAGCCAAG 60.074 38.462 0.00 0.00 0.00 3.61
7019 7717 5.712152 AGTGAATCAAAGTTAAGCCAAGG 57.288 39.130 0.00 0.00 0.00 3.61
7020 7718 5.385198 AGTGAATCAAAGTTAAGCCAAGGA 58.615 37.500 0.00 0.00 0.00 3.36
7021 7719 5.833131 AGTGAATCAAAGTTAAGCCAAGGAA 59.167 36.000 0.00 0.00 0.00 3.36
7022 7720 6.494835 AGTGAATCAAAGTTAAGCCAAGGAAT 59.505 34.615 0.00 0.00 0.00 3.01
7023 7721 7.015584 AGTGAATCAAAGTTAAGCCAAGGAATT 59.984 33.333 0.00 0.00 0.00 2.17
7024 7722 8.303876 GTGAATCAAAGTTAAGCCAAGGAATTA 58.696 33.333 0.00 0.00 0.00 1.40
7025 7723 8.522830 TGAATCAAAGTTAAGCCAAGGAATTAG 58.477 33.333 0.00 0.00 0.00 1.73
7026 7724 6.834168 TCAAAGTTAAGCCAAGGAATTAGG 57.166 37.500 0.00 0.00 0.00 2.69
7027 7725 6.548321 TCAAAGTTAAGCCAAGGAATTAGGA 58.452 36.000 0.00 0.00 0.00 2.94
7028 7726 6.433093 TCAAAGTTAAGCCAAGGAATTAGGAC 59.567 38.462 0.00 0.00 0.00 3.85
7029 7727 4.856509 AGTTAAGCCAAGGAATTAGGACC 58.143 43.478 0.00 0.00 0.00 4.46
7030 7728 4.540502 AGTTAAGCCAAGGAATTAGGACCT 59.459 41.667 0.00 0.00 38.23 3.85
7031 7729 5.729718 AGTTAAGCCAAGGAATTAGGACCTA 59.270 40.000 0.00 0.00 35.25 3.08
7032 7730 6.390165 AGTTAAGCCAAGGAATTAGGACCTAT 59.610 38.462 0.94 0.00 35.25 2.57
7033 7731 5.734031 AAGCCAAGGAATTAGGACCTATT 57.266 39.130 0.94 0.00 35.25 1.73
7034 7732 5.734031 AGCCAAGGAATTAGGACCTATTT 57.266 39.130 0.94 5.17 35.25 1.40
7035 7733 5.449553 AGCCAAGGAATTAGGACCTATTTG 58.550 41.667 12.37 7.84 35.25 2.32
7036 7734 5.044105 AGCCAAGGAATTAGGACCTATTTGT 60.044 40.000 12.37 0.00 35.25 2.83
7037 7735 5.656859 GCCAAGGAATTAGGACCTATTTGTT 59.343 40.000 12.37 4.60 35.25 2.83
7038 7736 6.154534 GCCAAGGAATTAGGACCTATTTGTTT 59.845 38.462 12.37 5.15 35.25 2.83
7039 7737 7.630728 GCCAAGGAATTAGGACCTATTTGTTTC 60.631 40.741 12.37 6.71 35.25 2.78
7040 7738 7.615757 CCAAGGAATTAGGACCTATTTGTTTCT 59.384 37.037 12.37 3.30 35.25 2.52
7041 7739 8.462016 CAAGGAATTAGGACCTATTTGTTTCTG 58.538 37.037 12.37 1.59 35.25 3.02
7042 7740 7.928873 AGGAATTAGGACCTATTTGTTTCTGA 58.071 34.615 12.37 0.00 34.47 3.27
7043 7741 8.560903 AGGAATTAGGACCTATTTGTTTCTGAT 58.439 33.333 12.37 0.00 34.47 2.90
7044 7742 9.190317 GGAATTAGGACCTATTTGTTTCTGATT 57.810 33.333 12.37 1.26 0.00 2.57
7048 7746 7.839680 AGGACCTATTTGTTTCTGATTTTGT 57.160 32.000 0.00 0.00 0.00 2.83
7049 7747 8.934023 AGGACCTATTTGTTTCTGATTTTGTA 57.066 30.769 0.00 0.00 0.00 2.41
7050 7748 9.014297 AGGACCTATTTGTTTCTGATTTTGTAG 57.986 33.333 0.00 0.00 0.00 2.74
7051 7749 7.755373 GGACCTATTTGTTTCTGATTTTGTAGC 59.245 37.037 0.00 0.00 0.00 3.58
7052 7750 7.602753 ACCTATTTGTTTCTGATTTTGTAGCC 58.397 34.615 0.00 0.00 0.00 3.93
7053 7751 7.451566 ACCTATTTGTTTCTGATTTTGTAGCCT 59.548 33.333 0.00 0.00 0.00 4.58
7054 7752 8.306761 CCTATTTGTTTCTGATTTTGTAGCCTT 58.693 33.333 0.00 0.00 0.00 4.35
7055 7753 9.346725 CTATTTGTTTCTGATTTTGTAGCCTTC 57.653 33.333 0.00 0.00 0.00 3.46
7056 7754 6.959639 TTGTTTCTGATTTTGTAGCCTTCT 57.040 33.333 0.00 0.00 0.00 2.85
7057 7755 6.560253 TGTTTCTGATTTTGTAGCCTTCTC 57.440 37.500 0.00 0.00 0.00 2.87
7058 7756 6.061441 TGTTTCTGATTTTGTAGCCTTCTCA 58.939 36.000 0.00 0.00 0.00 3.27
7059 7757 6.716628 TGTTTCTGATTTTGTAGCCTTCTCAT 59.283 34.615 0.00 0.00 0.00 2.90
7060 7758 7.231317 TGTTTCTGATTTTGTAGCCTTCTCATT 59.769 33.333 0.00 0.00 0.00 2.57
7061 7759 7.765695 TTCTGATTTTGTAGCCTTCTCATTT 57.234 32.000 0.00 0.00 0.00 2.32
7062 7760 7.765695 TCTGATTTTGTAGCCTTCTCATTTT 57.234 32.000 0.00 0.00 0.00 1.82
7063 7761 7.596494 TCTGATTTTGTAGCCTTCTCATTTTG 58.404 34.615 0.00 0.00 0.00 2.44
7064 7762 6.690530 TGATTTTGTAGCCTTCTCATTTTGG 58.309 36.000 0.00 0.00 0.00 3.28
7065 7763 6.267471 TGATTTTGTAGCCTTCTCATTTTGGT 59.733 34.615 0.00 0.00 0.00 3.67
7066 7764 5.705609 TTTGTAGCCTTCTCATTTTGGTC 57.294 39.130 0.00 0.00 0.00 4.02
7067 7765 4.365514 TGTAGCCTTCTCATTTTGGTCA 57.634 40.909 0.00 0.00 0.00 4.02
7068 7766 4.724399 TGTAGCCTTCTCATTTTGGTCAA 58.276 39.130 0.00 0.00 0.00 3.18
7069 7767 5.136828 TGTAGCCTTCTCATTTTGGTCAAA 58.863 37.500 0.00 0.00 0.00 2.69
7070 7768 5.596361 TGTAGCCTTCTCATTTTGGTCAAAA 59.404 36.000 10.72 10.72 43.48 2.44
7083 7781 7.945033 TTTTGGTCAAAATGTCATAAAGCTC 57.055 32.000 4.92 0.00 35.57 4.09
7084 7782 6.899393 TTGGTCAAAATGTCATAAAGCTCT 57.101 33.333 0.00 0.00 0.00 4.09
7085 7783 6.899393 TGGTCAAAATGTCATAAAGCTCTT 57.101 33.333 0.00 0.00 0.00 2.85
7086 7784 7.994425 TGGTCAAAATGTCATAAAGCTCTTA 57.006 32.000 0.00 0.00 0.00 2.10
7087 7785 8.402798 TGGTCAAAATGTCATAAAGCTCTTAA 57.597 30.769 0.00 0.00 0.00 1.85
7088 7786 8.855110 TGGTCAAAATGTCATAAAGCTCTTAAA 58.145 29.630 0.00 0.00 0.00 1.52
7089 7787 9.860898 GGTCAAAATGTCATAAAGCTCTTAAAT 57.139 29.630 0.00 0.00 0.00 1.40
7095 7793 7.553881 TGTCATAAAGCTCTTAAATAGGTGC 57.446 36.000 0.00 0.00 0.00 5.01
7096 7794 7.338710 TGTCATAAAGCTCTTAAATAGGTGCT 58.661 34.615 0.00 0.00 36.26 4.40
7097 7795 7.829211 TGTCATAAAGCTCTTAAATAGGTGCTT 59.171 33.333 6.17 6.17 41.92 3.91
7098 7796 8.678199 GTCATAAAGCTCTTAAATAGGTGCTTT 58.322 33.333 20.66 20.66 45.96 3.51
7099 7797 9.243105 TCATAAAGCTCTTAAATAGGTGCTTTT 57.757 29.630 21.50 11.88 44.02 2.27
7100 7798 9.294030 CATAAAGCTCTTAAATAGGTGCTTTTG 57.706 33.333 21.50 16.75 44.02 2.44
7101 7799 5.904362 AGCTCTTAAATAGGTGCTTTTGG 57.096 39.130 0.00 0.00 32.80 3.28
7102 7800 5.570320 AGCTCTTAAATAGGTGCTTTTGGA 58.430 37.500 0.00 0.00 32.80 3.53
7103 7801 5.649831 AGCTCTTAAATAGGTGCTTTTGGAG 59.350 40.000 0.00 0.00 32.80 3.86
7115 7813 3.575965 CTTTTGGAGCTTTTATGCCGT 57.424 42.857 0.00 0.00 0.00 5.68
7116 7814 3.913089 CTTTTGGAGCTTTTATGCCGTT 58.087 40.909 0.00 0.00 0.00 4.44
7117 7815 4.306600 CTTTTGGAGCTTTTATGCCGTTT 58.693 39.130 0.00 0.00 0.00 3.60
7118 7816 3.296322 TTGGAGCTTTTATGCCGTTTG 57.704 42.857 0.00 0.00 0.00 2.93
7119 7817 2.509569 TGGAGCTTTTATGCCGTTTGA 58.490 42.857 0.00 0.00 0.00 2.69
7120 7818 3.088532 TGGAGCTTTTATGCCGTTTGAT 58.911 40.909 0.00 0.00 0.00 2.57
7121 7819 3.119531 TGGAGCTTTTATGCCGTTTGATG 60.120 43.478 0.00 0.00 0.00 3.07
7122 7820 3.128589 GGAGCTTTTATGCCGTTTGATGA 59.871 43.478 0.00 0.00 0.00 2.92
7123 7821 4.380444 GGAGCTTTTATGCCGTTTGATGAA 60.380 41.667 0.00 0.00 0.00 2.57
7124 7822 4.737054 AGCTTTTATGCCGTTTGATGAAG 58.263 39.130 0.00 0.00 0.00 3.02
7125 7823 3.859386 GCTTTTATGCCGTTTGATGAAGG 59.141 43.478 0.00 0.00 0.00 3.46
7126 7824 4.380444 GCTTTTATGCCGTTTGATGAAGGA 60.380 41.667 0.00 0.00 0.00 3.36
7127 7825 4.963276 TTTATGCCGTTTGATGAAGGAG 57.037 40.909 0.00 0.00 0.00 3.69
7128 7826 2.787473 ATGCCGTTTGATGAAGGAGA 57.213 45.000 0.00 0.00 0.00 3.71
7129 7827 2.787473 TGCCGTTTGATGAAGGAGAT 57.213 45.000 0.00 0.00 0.00 2.75
7130 7828 2.358957 TGCCGTTTGATGAAGGAGATG 58.641 47.619 0.00 0.00 0.00 2.90
7131 7829 2.290260 TGCCGTTTGATGAAGGAGATGT 60.290 45.455 0.00 0.00 0.00 3.06
7132 7830 2.096496 GCCGTTTGATGAAGGAGATGTG 59.904 50.000 0.00 0.00 0.00 3.21
7133 7831 2.096496 CCGTTTGATGAAGGAGATGTGC 59.904 50.000 0.00 0.00 0.00 4.57
7134 7832 2.096496 CGTTTGATGAAGGAGATGTGCC 59.904 50.000 0.00 0.00 0.00 5.01
7135 7833 3.350833 GTTTGATGAAGGAGATGTGCCT 58.649 45.455 0.00 0.00 37.35 4.75
7136 7834 2.704464 TGATGAAGGAGATGTGCCTG 57.296 50.000 0.00 0.00 35.50 4.85
7137 7835 1.911357 TGATGAAGGAGATGTGCCTGT 59.089 47.619 0.00 0.00 35.50 4.00
7138 7836 2.306805 TGATGAAGGAGATGTGCCTGTT 59.693 45.455 0.00 0.00 35.50 3.16
7139 7837 2.957402 TGAAGGAGATGTGCCTGTTT 57.043 45.000 0.00 0.00 35.50 2.83
7140 7838 2.507484 TGAAGGAGATGTGCCTGTTTG 58.493 47.619 0.00 0.00 35.50 2.93
7141 7839 1.200948 GAAGGAGATGTGCCTGTTTGC 59.799 52.381 0.00 0.00 35.50 3.68
7142 7840 0.957395 AGGAGATGTGCCTGTTTGCG 60.957 55.000 0.00 0.00 33.59 4.85
7143 7841 0.955428 GGAGATGTGCCTGTTTGCGA 60.955 55.000 0.00 0.00 0.00 5.10
7144 7842 0.445436 GAGATGTGCCTGTTTGCGAG 59.555 55.000 0.00 0.00 0.00 5.03
7145 7843 0.250467 AGATGTGCCTGTTTGCGAGT 60.250 50.000 0.00 0.00 0.00 4.18
7146 7844 0.593128 GATGTGCCTGTTTGCGAGTT 59.407 50.000 0.00 0.00 0.00 3.01
7147 7845 1.804151 GATGTGCCTGTTTGCGAGTTA 59.196 47.619 0.00 0.00 0.00 2.24
7148 7846 1.890876 TGTGCCTGTTTGCGAGTTAT 58.109 45.000 0.00 0.00 0.00 1.89
7149 7847 1.804151 TGTGCCTGTTTGCGAGTTATC 59.196 47.619 0.00 0.00 0.00 1.75
7150 7848 2.076863 GTGCCTGTTTGCGAGTTATCT 58.923 47.619 0.00 0.00 0.00 1.98
7151 7849 2.094417 GTGCCTGTTTGCGAGTTATCTC 59.906 50.000 0.00 0.00 37.35 2.75
7152 7850 2.028112 TGCCTGTTTGCGAGTTATCTCT 60.028 45.455 0.00 0.00 38.45 3.10
7153 7851 2.605366 GCCTGTTTGCGAGTTATCTCTC 59.395 50.000 0.00 0.00 38.45 3.20
7154 7852 3.190874 CCTGTTTGCGAGTTATCTCTCC 58.809 50.000 0.00 0.00 38.45 3.71
7155 7853 3.118956 CCTGTTTGCGAGTTATCTCTCCT 60.119 47.826 0.00 0.00 38.45 3.69
7156 7854 4.098044 CCTGTTTGCGAGTTATCTCTCCTA 59.902 45.833 0.00 0.00 38.45 2.94
7157 7855 5.394224 CCTGTTTGCGAGTTATCTCTCCTAA 60.394 44.000 0.00 0.00 38.45 2.69
7158 7856 6.032956 TGTTTGCGAGTTATCTCTCCTAAA 57.967 37.500 0.00 0.00 38.45 1.85
7159 7857 5.867716 TGTTTGCGAGTTATCTCTCCTAAAC 59.132 40.000 0.00 0.00 38.45 2.01
7160 7858 5.654603 TTGCGAGTTATCTCTCCTAAACA 57.345 39.130 0.00 0.00 38.45 2.83
7161 7859 5.654603 TGCGAGTTATCTCTCCTAAACAA 57.345 39.130 0.00 0.00 38.45 2.83
7162 7860 6.222038 TGCGAGTTATCTCTCCTAAACAAT 57.778 37.500 0.00 0.00 38.45 2.71
7163 7861 6.640518 TGCGAGTTATCTCTCCTAAACAATT 58.359 36.000 0.00 0.00 38.45 2.32
7164 7862 6.535150 TGCGAGTTATCTCTCCTAAACAATTG 59.465 38.462 3.24 3.24 38.45 2.32
7165 7863 6.535508 GCGAGTTATCTCTCCTAAACAATTGT 59.464 38.462 4.92 4.92 38.45 2.71
7166 7864 7.254151 GCGAGTTATCTCTCCTAAACAATTGTC 60.254 40.741 12.39 0.00 38.45 3.18
7167 7865 7.976734 CGAGTTATCTCTCCTAAACAATTGTCT 59.023 37.037 12.39 0.00 38.45 3.41
7168 7866 9.308318 GAGTTATCTCTCCTAAACAATTGTCTC 57.692 37.037 12.39 5.10 37.68 3.36
7169 7867 9.041354 AGTTATCTCTCCTAAACAATTGTCTCT 57.959 33.333 12.39 2.36 0.00 3.10
7170 7868 9.660180 GTTATCTCTCCTAAACAATTGTCTCTT 57.340 33.333 12.39 5.38 0.00 2.85
7171 7869 9.658799 TTATCTCTCCTAAACAATTGTCTCTTG 57.341 33.333 12.39 0.38 0.00 3.02
7172 7870 7.067496 TCTCTCCTAAACAATTGTCTCTTGT 57.933 36.000 12.39 0.00 38.44 3.16
7173 7871 7.155328 TCTCTCCTAAACAATTGTCTCTTGTC 58.845 38.462 12.39 0.00 35.84 3.18
7174 7872 7.015682 TCTCTCCTAAACAATTGTCTCTTGTCT 59.984 37.037 12.39 0.00 35.84 3.41
7175 7873 7.509546 TCTCCTAAACAATTGTCTCTTGTCTT 58.490 34.615 12.39 2.35 35.84 3.01
7176 7874 7.993183 TCTCCTAAACAATTGTCTCTTGTCTTT 59.007 33.333 12.39 1.61 35.84 2.52
7177 7875 8.519799 TCCTAAACAATTGTCTCTTGTCTTTT 57.480 30.769 12.39 0.86 35.84 2.27
7178 7876 8.966868 TCCTAAACAATTGTCTCTTGTCTTTTT 58.033 29.630 12.39 0.33 35.84 1.94
7204 7902 8.713708 TTTTTCTAATGAGTGAAATAACCCCA 57.286 30.769 0.00 0.00 33.04 4.96
7205 7903 8.893563 TTTTCTAATGAGTGAAATAACCCCAT 57.106 30.769 0.00 0.00 33.04 4.00
7206 7904 8.893563 TTTCTAATGAGTGAAATAACCCCATT 57.106 30.769 0.00 0.00 32.27 3.16
7207 7905 7.880160 TCTAATGAGTGAAATAACCCCATTG 57.120 36.000 0.00 0.00 30.95 2.82
7208 7906 5.343307 AATGAGTGAAATAACCCCATTGC 57.657 39.130 0.00 0.00 0.00 3.56
7209 7907 3.772387 TGAGTGAAATAACCCCATTGCA 58.228 40.909 0.00 0.00 0.00 4.08
7210 7908 4.155709 TGAGTGAAATAACCCCATTGCAA 58.844 39.130 0.00 0.00 0.00 4.08
7211 7909 4.590647 TGAGTGAAATAACCCCATTGCAAA 59.409 37.500 1.71 0.00 0.00 3.68
7212 7910 5.248020 TGAGTGAAATAACCCCATTGCAAAT 59.752 36.000 1.71 0.00 0.00 2.32
7213 7911 6.125589 AGTGAAATAACCCCATTGCAAATT 57.874 33.333 1.71 0.00 0.00 1.82
7214 7912 6.541907 AGTGAAATAACCCCATTGCAAATTT 58.458 32.000 1.71 2.73 0.00 1.82
7215 7913 6.430616 AGTGAAATAACCCCATTGCAAATTTG 59.569 34.615 14.03 14.03 0.00 2.32
7216 7914 6.206438 GTGAAATAACCCCATTGCAAATTTGT 59.794 34.615 19.03 0.00 0.00 2.83
7217 7915 7.389053 GTGAAATAACCCCATTGCAAATTTGTA 59.611 33.333 19.03 12.46 0.00 2.41
7218 7916 7.605691 TGAAATAACCCCATTGCAAATTTGTAG 59.394 33.333 19.03 5.60 0.00 2.74
7219 7917 3.979101 ACCCCATTGCAAATTTGTAGG 57.021 42.857 19.03 13.89 0.00 3.18
7220 7918 3.515562 ACCCCATTGCAAATTTGTAGGA 58.484 40.909 19.03 1.66 0.00 2.94
7221 7919 3.260632 ACCCCATTGCAAATTTGTAGGAC 59.739 43.478 19.03 3.17 0.00 3.85
7222 7920 3.515104 CCCCATTGCAAATTTGTAGGACT 59.485 43.478 19.03 0.00 0.00 3.85
7223 7921 4.381932 CCCCATTGCAAATTTGTAGGACTC 60.382 45.833 19.03 1.78 0.00 3.36
7224 7922 4.381932 CCCATTGCAAATTTGTAGGACTCC 60.382 45.833 19.03 1.08 0.00 3.85
7225 7923 4.220382 CCATTGCAAATTTGTAGGACTCCA 59.780 41.667 19.03 3.68 0.00 3.86
7226 7924 5.279406 CCATTGCAAATTTGTAGGACTCCAA 60.279 40.000 19.03 11.88 0.00 3.53
7227 7925 5.860941 TTGCAAATTTGTAGGACTCCAAA 57.139 34.783 19.03 0.00 35.25 3.28
7228 7926 5.452078 TGCAAATTTGTAGGACTCCAAAG 57.548 39.130 19.03 0.00 34.35 2.77
7229 7927 4.892934 TGCAAATTTGTAGGACTCCAAAGT 59.107 37.500 19.03 0.00 38.88 2.66
7230 7928 6.065374 TGCAAATTTGTAGGACTCCAAAGTA 58.935 36.000 19.03 0.00 35.28 2.24
7231 7929 6.719370 TGCAAATTTGTAGGACTCCAAAGTAT 59.281 34.615 19.03 0.00 35.28 2.12
7232 7930 7.885922 TGCAAATTTGTAGGACTCCAAAGTATA 59.114 33.333 19.03 0.00 35.28 1.47
7233 7931 8.903820 GCAAATTTGTAGGACTCCAAAGTATAT 58.096 33.333 19.03 0.00 35.28 0.86
7239 7937 9.613428 TTGTAGGACTCCAAAGTATATTCATTG 57.387 33.333 0.00 0.00 35.28 2.82
7240 7938 8.988060 TGTAGGACTCCAAAGTATATTCATTGA 58.012 33.333 0.00 0.00 35.28 2.57
7241 7939 9.832445 GTAGGACTCCAAAGTATATTCATTGAA 57.168 33.333 0.75 0.75 35.28 2.69
7242 7940 8.970859 AGGACTCCAAAGTATATTCATTGAAG 57.029 34.615 5.21 0.00 35.28 3.02
7243 7941 8.772250 AGGACTCCAAAGTATATTCATTGAAGA 58.228 33.333 5.21 0.26 35.28 2.87
7244 7942 9.396022 GGACTCCAAAGTATATTCATTGAAGAA 57.604 33.333 5.21 0.00 35.28 2.52
7246 7944 9.965902 ACTCCAAAGTATATTCATTGAAGAACT 57.034 29.630 5.21 5.46 32.59 3.01
7278 7976 8.885494 TTTGACAAAAGGATTGATTTTACTGG 57.115 30.769 0.00 0.00 0.00 4.00
7279 7977 6.454795 TGACAAAAGGATTGATTTTACTGGC 58.545 36.000 0.00 0.00 0.00 4.85
7280 7978 6.267471 TGACAAAAGGATTGATTTTACTGGCT 59.733 34.615 0.00 0.00 0.00 4.75
7281 7979 6.691508 ACAAAAGGATTGATTTTACTGGCTC 58.308 36.000 0.00 0.00 0.00 4.70
7282 7980 6.267471 ACAAAAGGATTGATTTTACTGGCTCA 59.733 34.615 0.00 0.00 0.00 4.26
7283 7981 6.916360 AAAGGATTGATTTTACTGGCTCAA 57.084 33.333 0.00 0.00 32.63 3.02
7284 7982 6.916360 AAGGATTGATTTTACTGGCTCAAA 57.084 33.333 0.00 0.00 31.92 2.69
7285 7983 6.916360 AGGATTGATTTTACTGGCTCAAAA 57.084 33.333 0.00 0.00 31.92 2.44
7286 7984 7.486407 AGGATTGATTTTACTGGCTCAAAAT 57.514 32.000 4.65 4.65 37.12 1.82
7287 7985 8.593945 AGGATTGATTTTACTGGCTCAAAATA 57.406 30.769 4.89 0.00 35.14 1.40
7288 7986 9.034800 AGGATTGATTTTACTGGCTCAAAATAA 57.965 29.630 4.89 0.00 35.14 1.40
7289 7987 9.651913 GGATTGATTTTACTGGCTCAAAATAAA 57.348 29.630 4.89 4.90 35.14 1.40
7291 7989 8.532977 TTGATTTTACTGGCTCAAAATAAAGC 57.467 30.769 4.89 0.00 35.14 3.51
7292 7990 7.665690 TGATTTTACTGGCTCAAAATAAAGCA 58.334 30.769 0.00 0.00 40.36 3.91
7293 7991 8.313292 TGATTTTACTGGCTCAAAATAAAGCAT 58.687 29.630 0.00 0.00 40.36 3.79
7294 7992 9.154847 GATTTTACTGGCTCAAAATAAAGCATT 57.845 29.630 0.00 0.00 40.36 3.56
7295 7993 7.887996 TTTACTGGCTCAAAATAAAGCATTG 57.112 32.000 0.00 0.00 40.36 2.82
7296 7994 5.726980 ACTGGCTCAAAATAAAGCATTGA 57.273 34.783 0.00 0.00 40.36 2.57
7297 7995 6.100404 ACTGGCTCAAAATAAAGCATTGAA 57.900 33.333 0.00 0.00 40.36 2.69
7298 7996 6.523840 ACTGGCTCAAAATAAAGCATTGAAA 58.476 32.000 0.00 0.00 40.36 2.69
7299 7997 7.163441 ACTGGCTCAAAATAAAGCATTGAAAT 58.837 30.769 0.00 0.00 40.36 2.17
7300 7998 7.118680 ACTGGCTCAAAATAAAGCATTGAAATG 59.881 33.333 0.00 0.00 40.36 2.32
7301 7999 7.160049 TGGCTCAAAATAAAGCATTGAAATGA 58.840 30.769 7.21 0.00 40.36 2.57
7302 8000 7.825270 TGGCTCAAAATAAAGCATTGAAATGAT 59.175 29.630 7.21 0.00 40.36 2.45
7303 8001 9.316730 GGCTCAAAATAAAGCATTGAAATGATA 57.683 29.630 7.21 0.00 40.36 2.15
7306 8004 8.806634 TCAAAATAAAGCATTGAAATGATACGC 58.193 29.630 7.21 0.00 38.70 4.42
7307 8005 8.593842 CAAAATAAAGCATTGAAATGATACGCA 58.406 29.630 7.21 0.00 38.70 5.24
7308 8006 8.876275 AAATAAAGCATTGAAATGATACGCAT 57.124 26.923 7.21 0.00 38.70 4.73
7309 8007 9.964303 AAATAAAGCATTGAAATGATACGCATA 57.036 25.926 7.21 0.00 38.70 3.14
7310 8008 9.616634 AATAAAGCATTGAAATGATACGCATAG 57.383 29.630 7.21 0.00 38.70 2.23
7311 8009 5.618056 AGCATTGAAATGATACGCATAGG 57.382 39.130 7.21 0.00 38.70 2.57
7312 8010 5.065914 AGCATTGAAATGATACGCATAGGT 58.934 37.500 7.21 0.00 38.70 3.08
7313 8011 6.230472 AGCATTGAAATGATACGCATAGGTA 58.770 36.000 7.21 0.00 38.70 3.08
7314 8012 6.710295 AGCATTGAAATGATACGCATAGGTAA 59.290 34.615 7.21 0.00 38.70 2.85
7315 8013 7.017645 GCATTGAAATGATACGCATAGGTAAG 58.982 38.462 7.21 0.00 38.70 2.34
7316 8014 6.539649 TTGAAATGATACGCATAGGTAAGC 57.460 37.500 0.00 0.00 35.78 3.09
7317 8015 5.606505 TGAAATGATACGCATAGGTAAGCA 58.393 37.500 0.00 0.00 35.78 3.91
7318 8016 5.465390 TGAAATGATACGCATAGGTAAGCAC 59.535 40.000 0.00 0.00 35.78 4.40
7319 8017 4.600692 ATGATACGCATAGGTAAGCACA 57.399 40.909 0.00 0.00 34.82 4.57
7320 8018 3.713288 TGATACGCATAGGTAAGCACAC 58.287 45.455 0.00 0.00 0.00 3.82
7321 8019 3.131400 TGATACGCATAGGTAAGCACACA 59.869 43.478 0.00 0.00 0.00 3.72
7322 8020 1.722011 ACGCATAGGTAAGCACACAC 58.278 50.000 0.00 0.00 0.00 3.82
7323 8021 1.006832 CGCATAGGTAAGCACACACC 58.993 55.000 0.00 0.00 34.86 4.16
7324 8022 1.405526 CGCATAGGTAAGCACACACCT 60.406 52.381 0.00 0.00 46.88 4.00
7325 8023 2.009774 GCATAGGTAAGCACACACCTG 58.990 52.381 3.53 0.00 44.93 4.00
7326 8024 2.632377 CATAGGTAAGCACACACCTGG 58.368 52.381 3.53 0.00 44.93 4.45
7327 8025 0.323629 TAGGTAAGCACACACCTGGC 59.676 55.000 3.53 0.00 44.93 4.85
7328 8026 1.073199 GGTAAGCACACACCTGGCT 59.927 57.895 0.00 0.00 40.14 4.75
7329 8027 3.619841 TAGGTAAGCACACACCTGGCTT 61.620 50.000 3.53 0.00 44.93 4.35
7330 8028 0.875059 GTAAGCACACACCTGGCTTC 59.125 55.000 0.90 0.00 43.97 3.86
7331 8029 0.472044 TAAGCACACACCTGGCTTCA 59.528 50.000 0.90 0.00 43.97 3.02
7332 8030 0.820891 AAGCACACACCTGGCTTCAG 60.821 55.000 0.00 0.00 43.97 3.02
7333 8031 2.912624 GCACACACCTGGCTTCAGC 61.913 63.158 0.00 0.00 37.19 4.26
7334 8032 1.526686 CACACACCTGGCTTCAGCA 60.527 57.895 0.30 0.00 44.36 4.41
7335 8033 0.892358 CACACACCTGGCTTCAGCAT 60.892 55.000 0.30 0.00 44.36 3.79
7336 8034 0.692476 ACACACCTGGCTTCAGCATA 59.308 50.000 0.30 0.00 44.36 3.14
7337 8035 1.339438 ACACACCTGGCTTCAGCATAG 60.339 52.381 0.30 0.00 44.36 2.23
7338 8036 0.987294 ACACCTGGCTTCAGCATAGT 59.013 50.000 0.30 0.00 44.36 2.12
7339 8037 2.093500 CACACCTGGCTTCAGCATAGTA 60.093 50.000 0.30 0.00 44.36 1.82
7340 8038 2.571653 ACACCTGGCTTCAGCATAGTAA 59.428 45.455 0.30 0.00 44.36 2.24
7341 8039 3.201290 CACCTGGCTTCAGCATAGTAAG 58.799 50.000 0.30 0.00 44.36 2.34
7342 8040 2.171448 ACCTGGCTTCAGCATAGTAAGG 59.829 50.000 0.30 0.66 44.36 2.69
7343 8041 2.435805 CCTGGCTTCAGCATAGTAAGGA 59.564 50.000 0.30 0.00 44.36 3.36
7344 8042 3.072184 CCTGGCTTCAGCATAGTAAGGAT 59.928 47.826 0.30 0.00 44.36 3.24
7345 8043 4.063689 CTGGCTTCAGCATAGTAAGGATG 58.936 47.826 0.30 0.00 44.36 3.51
7355 8053 5.878332 CATAGTAAGGATGCACACAAACA 57.122 39.130 0.00 0.00 0.00 2.83
7356 8054 6.441093 CATAGTAAGGATGCACACAAACAT 57.559 37.500 0.00 0.00 0.00 2.71
7357 8055 6.489675 CATAGTAAGGATGCACACAAACATC 58.510 40.000 0.00 0.00 41.60 3.06
7358 8056 4.397420 AGTAAGGATGCACACAAACATCA 58.603 39.130 5.46 0.00 43.64 3.07
7359 8057 4.826733 AGTAAGGATGCACACAAACATCAA 59.173 37.500 5.46 0.00 43.64 2.57
7360 8058 4.877378 AAGGATGCACACAAACATCAAT 57.123 36.364 5.46 0.00 43.64 2.57
7361 8059 5.981088 AAGGATGCACACAAACATCAATA 57.019 34.783 5.46 0.00 43.64 1.90
7362 8060 5.314923 AGGATGCACACAAACATCAATAC 57.685 39.130 5.46 0.00 43.64 1.89
7363 8061 4.766373 AGGATGCACACAAACATCAATACA 59.234 37.500 5.46 0.00 43.64 2.29
7364 8062 4.858692 GGATGCACACAAACATCAATACAC 59.141 41.667 5.46 0.00 43.64 2.90
7365 8063 4.907879 TGCACACAAACATCAATACACA 57.092 36.364 0.00 0.00 0.00 3.72
7366 8064 4.857799 TGCACACAAACATCAATACACAG 58.142 39.130 0.00 0.00 0.00 3.66
7367 8065 4.578105 TGCACACAAACATCAATACACAGA 59.422 37.500 0.00 0.00 0.00 3.41
7368 8066 4.911610 GCACACAAACATCAATACACAGAC 59.088 41.667 0.00 0.00 0.00 3.51
7369 8067 5.505489 GCACACAAACATCAATACACAGACA 60.505 40.000 0.00 0.00 0.00 3.41
7370 8068 6.493978 CACACAAACATCAATACACAGACAA 58.506 36.000 0.00 0.00 0.00 3.18
7371 8069 6.971756 CACACAAACATCAATACACAGACAAA 59.028 34.615 0.00 0.00 0.00 2.83
7372 8070 7.487509 CACACAAACATCAATACACAGACAAAA 59.512 33.333 0.00 0.00 0.00 2.44
7373 8071 8.031864 ACACAAACATCAATACACAGACAAAAA 58.968 29.630 0.00 0.00 0.00 1.94
7374 8072 8.320295 CACAAACATCAATACACAGACAAAAAC 58.680 33.333 0.00 0.00 0.00 2.43
7375 8073 8.031864 ACAAACATCAATACACAGACAAAAACA 58.968 29.630 0.00 0.00 0.00 2.83
7376 8074 8.867935 CAAACATCAATACACAGACAAAAACAA 58.132 29.630 0.00 0.00 0.00 2.83
7377 8075 8.633075 AACATCAATACACAGACAAAAACAAG 57.367 30.769 0.00 0.00 0.00 3.16
7378 8076 6.697019 ACATCAATACACAGACAAAAACAAGC 59.303 34.615 0.00 0.00 0.00 4.01
7379 8077 5.587289 TCAATACACAGACAAAAACAAGCC 58.413 37.500 0.00 0.00 0.00 4.35
7380 8078 2.559998 ACACAGACAAAAACAAGCCG 57.440 45.000 0.00 0.00 0.00 5.52
7381 8079 2.088423 ACACAGACAAAAACAAGCCGA 58.912 42.857 0.00 0.00 0.00 5.54
7382 8080 2.159435 ACACAGACAAAAACAAGCCGAC 60.159 45.455 0.00 0.00 0.00 4.79
7383 8081 1.404035 ACAGACAAAAACAAGCCGACC 59.596 47.619 0.00 0.00 0.00 4.79
7384 8082 1.403679 CAGACAAAAACAAGCCGACCA 59.596 47.619 0.00 0.00 0.00 4.02
7385 8083 2.096248 AGACAAAAACAAGCCGACCAA 58.904 42.857 0.00 0.00 0.00 3.67
7386 8084 2.693074 AGACAAAAACAAGCCGACCAAT 59.307 40.909 0.00 0.00 0.00 3.16
7387 8085 2.794350 GACAAAAACAAGCCGACCAATG 59.206 45.455 0.00 0.00 0.00 2.82
7388 8086 2.134346 CAAAAACAAGCCGACCAATGG 58.866 47.619 0.00 0.00 0.00 3.16
7404 8102 3.942351 TGGCACAGTCATGGAAGAG 57.058 52.632 0.00 0.00 0.00 2.85
7405 8103 0.321919 TGGCACAGTCATGGAAGAGC 60.322 55.000 0.00 0.00 0.00 4.09
7406 8104 0.035630 GGCACAGTCATGGAAGAGCT 60.036 55.000 0.00 0.00 0.00 4.09
7407 8105 1.367659 GCACAGTCATGGAAGAGCTC 58.632 55.000 5.27 5.27 0.00 4.09
7408 8106 1.066286 GCACAGTCATGGAAGAGCTCT 60.066 52.381 11.45 11.45 0.00 4.09
7409 8107 2.614987 GCACAGTCATGGAAGAGCTCTT 60.615 50.000 28.83 28.83 39.23 2.85
7420 8118 2.399916 AGAGCTCTTCAATGACAGGC 57.600 50.000 11.45 0.00 0.00 4.85
7421 8119 1.005340 GAGCTCTTCAATGACAGGCG 58.995 55.000 6.43 0.00 0.00 5.52
7422 8120 1.023513 AGCTCTTCAATGACAGGCGC 61.024 55.000 0.00 0.00 0.00 6.53
7423 8121 1.023513 GCTCTTCAATGACAGGCGCT 61.024 55.000 7.64 0.00 0.00 5.92
7424 8122 1.446907 CTCTTCAATGACAGGCGCTT 58.553 50.000 7.64 0.00 0.00 4.68
7425 8123 1.129998 CTCTTCAATGACAGGCGCTTG 59.870 52.381 19.01 19.01 0.00 4.01
7426 8124 1.159285 CTTCAATGACAGGCGCTTGA 58.841 50.000 27.58 14.85 0.00 3.02
7427 8125 1.536766 CTTCAATGACAGGCGCTTGAA 59.463 47.619 27.58 20.93 36.48 2.69
7428 8126 1.159285 TCAATGACAGGCGCTTGAAG 58.841 50.000 27.58 10.34 0.00 3.02
7429 8127 1.159285 CAATGACAGGCGCTTGAAGA 58.841 50.000 27.58 9.34 0.00 2.87
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
6 7 5.637006 TTTTAAGGCTAATGCGATTGTGT 57.363 34.783 0.00 0.00 40.82 3.72
8 9 9.816354 ATTAATTTTTAAGGCTAATGCGATTGT 57.184 25.926 0.00 0.00 40.82 2.71
10 11 9.816354 ACATTAATTTTTAAGGCTAATGCGATT 57.184 25.926 3.03 0.00 40.82 3.34
48 49 9.313118 CCTTTTGTTAATCCATACAATTAAGGC 57.687 33.333 0.00 0.00 36.36 4.35
59 60 8.803235 GTCCTAACTTTCCTTTTGTTAATCCAT 58.197 33.333 0.00 0.00 0.00 3.41
60 61 7.780745 TGTCCTAACTTTCCTTTTGTTAATCCA 59.219 33.333 0.00 0.00 0.00 3.41
61 62 8.173542 TGTCCTAACTTTCCTTTTGTTAATCC 57.826 34.615 0.00 0.00 0.00 3.01
63 64 9.981114 CATTGTCCTAACTTTCCTTTTGTTAAT 57.019 29.630 0.00 0.00 0.00 1.40
64 65 8.973182 ACATTGTCCTAACTTTCCTTTTGTTAA 58.027 29.630 0.00 0.00 0.00 2.01
65 66 8.528044 ACATTGTCCTAACTTTCCTTTTGTTA 57.472 30.769 0.00 0.00 0.00 2.41
66 67 7.418337 ACATTGTCCTAACTTTCCTTTTGTT 57.582 32.000 0.00 0.00 0.00 2.83
67 68 7.255486 GCTACATTGTCCTAACTTTCCTTTTGT 60.255 37.037 0.00 0.00 0.00 2.83
68 69 7.040409 AGCTACATTGTCCTAACTTTCCTTTTG 60.040 37.037 0.00 0.00 0.00 2.44
69 70 7.004691 AGCTACATTGTCCTAACTTTCCTTTT 58.995 34.615 0.00 0.00 0.00 2.27
70 71 6.543735 AGCTACATTGTCCTAACTTTCCTTT 58.456 36.000 0.00 0.00 0.00 3.11
71 72 6.128138 AGCTACATTGTCCTAACTTTCCTT 57.872 37.500 0.00 0.00 0.00 3.36
72 73 5.763876 AGCTACATTGTCCTAACTTTCCT 57.236 39.130 0.00 0.00 0.00 3.36
73 74 5.354513 GGAAGCTACATTGTCCTAACTTTCC 59.645 44.000 0.00 0.00 0.00 3.13
74 75 5.354513 GGGAAGCTACATTGTCCTAACTTTC 59.645 44.000 0.00 0.00 0.00 2.62
75 76 5.014228 AGGGAAGCTACATTGTCCTAACTTT 59.986 40.000 0.00 0.00 0.00 2.66
76 77 4.536489 AGGGAAGCTACATTGTCCTAACTT 59.464 41.667 0.00 0.00 0.00 2.66
77 78 4.104831 AGGGAAGCTACATTGTCCTAACT 58.895 43.478 0.00 0.00 0.00 2.24
78 79 4.489306 AGGGAAGCTACATTGTCCTAAC 57.511 45.455 0.00 0.00 0.00 2.34
79 80 5.486063 TGTTAGGGAAGCTACATTGTCCTAA 59.514 40.000 7.85 7.85 34.28 2.69
80 81 5.027460 TGTTAGGGAAGCTACATTGTCCTA 58.973 41.667 0.00 0.00 0.00 2.94
81 82 3.844211 TGTTAGGGAAGCTACATTGTCCT 59.156 43.478 0.00 0.00 0.00 3.85
82 83 4.216411 TGTTAGGGAAGCTACATTGTCC 57.784 45.455 0.00 0.00 0.00 4.02
83 84 4.816925 GGATGTTAGGGAAGCTACATTGTC 59.183 45.833 0.00 0.00 31.76 3.18
84 85 4.385310 GGGATGTTAGGGAAGCTACATTGT 60.385 45.833 0.00 0.00 31.76 2.71
85 86 4.137543 GGGATGTTAGGGAAGCTACATTG 58.862 47.826 0.00 0.00 31.76 2.82
86 87 4.047883 AGGGATGTTAGGGAAGCTACATT 58.952 43.478 0.00 0.00 31.76 2.71
87 88 3.669949 AGGGATGTTAGGGAAGCTACAT 58.330 45.455 0.00 0.00 34.14 2.29
88 89 3.130734 AGGGATGTTAGGGAAGCTACA 57.869 47.619 0.00 0.00 0.00 2.74
89 90 3.200165 ACAAGGGATGTTAGGGAAGCTAC 59.800 47.826 0.00 0.00 40.06 3.58
90 91 3.199946 CACAAGGGATGTTAGGGAAGCTA 59.800 47.826 0.00 0.00 41.46 3.32
91 92 2.025887 CACAAGGGATGTTAGGGAAGCT 60.026 50.000 0.00 0.00 41.46 3.74
92 93 2.290960 ACACAAGGGATGTTAGGGAAGC 60.291 50.000 0.00 0.00 41.46 3.86
93 94 3.721087 ACACAAGGGATGTTAGGGAAG 57.279 47.619 0.00 0.00 41.46 3.46
94 95 4.538490 ACATACACAAGGGATGTTAGGGAA 59.462 41.667 0.00 0.00 41.46 3.97
95 96 4.108570 ACATACACAAGGGATGTTAGGGA 58.891 43.478 0.00 0.00 41.46 4.20
96 97 4.503714 ACATACACAAGGGATGTTAGGG 57.496 45.455 0.00 0.00 41.46 3.53
99 100 6.670464 TCCTCTAACATACACAAGGGATGTTA 59.330 38.462 10.70 10.70 42.35 2.41
100 101 5.487488 TCCTCTAACATACACAAGGGATGTT 59.513 40.000 9.61 9.61 44.07 2.71
101 102 5.030147 TCCTCTAACATACACAAGGGATGT 58.970 41.667 0.00 0.00 45.34 3.06
102 103 5.614324 TCCTCTAACATACACAAGGGATG 57.386 43.478 0.00 0.00 0.00 3.51
103 104 5.308237 GGATCCTCTAACATACACAAGGGAT 59.692 44.000 3.84 0.00 34.29 3.85
104 105 4.654262 GGATCCTCTAACATACACAAGGGA 59.346 45.833 3.84 0.00 0.00 4.20
105 106 4.501571 CGGATCCTCTAACATACACAAGGG 60.502 50.000 10.75 0.00 0.00 3.95
106 107 4.501571 CCGGATCCTCTAACATACACAAGG 60.502 50.000 10.75 0.00 0.00 3.61
107 108 4.099573 ACCGGATCCTCTAACATACACAAG 59.900 45.833 9.46 0.00 0.00 3.16
108 109 4.028131 ACCGGATCCTCTAACATACACAA 58.972 43.478 9.46 0.00 0.00 3.33
109 110 3.638860 ACCGGATCCTCTAACATACACA 58.361 45.455 9.46 0.00 0.00 3.72
110 111 4.501058 GGAACCGGATCCTCTAACATACAC 60.501 50.000 22.87 0.00 36.50 2.90
111 112 3.640029 GGAACCGGATCCTCTAACATACA 59.360 47.826 22.87 0.00 36.50 2.29
112 113 3.006644 GGGAACCGGATCCTCTAACATAC 59.993 52.174 27.91 6.43 40.86 2.39
113 114 3.236896 GGGAACCGGATCCTCTAACATA 58.763 50.000 27.91 0.00 40.86 2.29
114 115 2.047830 GGGAACCGGATCCTCTAACAT 58.952 52.381 27.91 0.00 40.86 2.71
115 116 1.492764 GGGAACCGGATCCTCTAACA 58.507 55.000 27.91 0.00 40.86 2.41
129 130 1.753073 CAGGCATCAATCTTGGGGAAC 59.247 52.381 0.00 0.00 0.00 3.62
130 131 1.961435 GCAGGCATCAATCTTGGGGAA 60.961 52.381 0.00 0.00 0.00 3.97
131 132 0.396139 GCAGGCATCAATCTTGGGGA 60.396 55.000 0.00 0.00 0.00 4.81
132 133 1.397390 GGCAGGCATCAATCTTGGGG 61.397 60.000 0.00 0.00 0.00 4.96
133 134 0.685131 TGGCAGGCATCAATCTTGGG 60.685 55.000 0.00 0.00 0.00 4.12
134 135 0.744874 CTGGCAGGCATCAATCTTGG 59.255 55.000 6.61 0.00 0.00 3.61
135 136 1.758936 TCTGGCAGGCATCAATCTTG 58.241 50.000 15.73 0.00 0.00 3.02
136 137 2.750141 ATCTGGCAGGCATCAATCTT 57.250 45.000 15.73 0.00 0.00 2.40
137 138 2.977580 TCTATCTGGCAGGCATCAATCT 59.022 45.455 15.73 0.00 0.00 2.40
138 139 3.413846 TCTATCTGGCAGGCATCAATC 57.586 47.619 15.73 0.00 0.00 2.67
139 140 4.383931 AATCTATCTGGCAGGCATCAAT 57.616 40.909 15.73 1.79 0.00 2.57
140 141 3.870538 AATCTATCTGGCAGGCATCAA 57.129 42.857 15.73 0.00 0.00 2.57
141 142 3.307269 GCTAATCTATCTGGCAGGCATCA 60.307 47.826 15.73 0.00 0.00 3.07
142 143 3.269178 GCTAATCTATCTGGCAGGCATC 58.731 50.000 15.73 0.00 0.00 3.91
143 144 2.026449 GGCTAATCTATCTGGCAGGCAT 60.026 50.000 15.73 4.17 0.00 4.40
144 145 1.349026 GGCTAATCTATCTGGCAGGCA 59.651 52.381 15.73 0.00 0.00 4.75
145 146 1.627834 AGGCTAATCTATCTGGCAGGC 59.372 52.381 15.73 7.11 0.00 4.85
146 147 2.636893 ACAGGCTAATCTATCTGGCAGG 59.363 50.000 15.73 0.00 0.00 4.85
147 148 3.306641 GGACAGGCTAATCTATCTGGCAG 60.307 52.174 8.58 8.58 37.01 4.85
148 149 2.634940 GGACAGGCTAATCTATCTGGCA 59.365 50.000 0.00 0.00 37.01 4.92
149 150 2.353208 CGGACAGGCTAATCTATCTGGC 60.353 54.545 0.00 0.00 34.68 4.85
150 151 2.232452 CCGGACAGGCTAATCTATCTGG 59.768 54.545 0.00 0.00 0.00 3.86
151 152 2.894126 ACCGGACAGGCTAATCTATCTG 59.106 50.000 9.46 0.00 46.52 2.90
152 153 3.158676 GACCGGACAGGCTAATCTATCT 58.841 50.000 9.46 0.00 46.52 1.98
153 154 2.891580 TGACCGGACAGGCTAATCTATC 59.108 50.000 9.46 0.00 46.52 2.08
154 155 2.894126 CTGACCGGACAGGCTAATCTAT 59.106 50.000 23.99 0.00 46.52 1.98
155 156 2.307768 CTGACCGGACAGGCTAATCTA 58.692 52.381 23.99 0.00 46.52 1.98
156 157 1.115467 CTGACCGGACAGGCTAATCT 58.885 55.000 23.99 0.00 46.52 2.40
157 158 0.530870 GCTGACCGGACAGGCTAATC 60.531 60.000 30.43 12.57 46.52 1.75
158 159 0.978146 AGCTGACCGGACAGGCTAAT 60.978 55.000 30.43 8.81 46.52 1.73
159 160 1.605058 GAGCTGACCGGACAGGCTAA 61.605 60.000 30.43 0.00 46.52 3.09
160 161 2.037367 AGCTGACCGGACAGGCTA 59.963 61.111 30.43 0.00 46.52 3.93
161 162 3.386237 GAGCTGACCGGACAGGCT 61.386 66.667 30.43 26.25 46.52 4.58
162 163 3.695606 TGAGCTGACCGGACAGGC 61.696 66.667 30.43 22.77 46.52 4.85
164 165 0.459237 GATGTGAGCTGACCGGACAG 60.459 60.000 26.72 26.72 40.43 3.51
165 166 1.591703 GATGTGAGCTGACCGGACA 59.408 57.895 9.46 7.70 0.00 4.02
166 167 1.153549 GGATGTGAGCTGACCGGAC 60.154 63.158 9.46 1.07 0.00 4.79
167 168 2.359169 GGGATGTGAGCTGACCGGA 61.359 63.158 9.46 0.00 0.00 5.14
168 169 1.976132 ATGGGATGTGAGCTGACCGG 61.976 60.000 0.00 0.00 0.00 5.28
169 170 0.531532 GATGGGATGTGAGCTGACCG 60.532 60.000 0.00 0.00 0.00 4.79
170 171 0.179034 GGATGGGATGTGAGCTGACC 60.179 60.000 0.00 0.00 0.00 4.02
171 172 0.531532 CGGATGGGATGTGAGCTGAC 60.532 60.000 0.00 0.00 0.00 3.51
172 173 0.977627 ACGGATGGGATGTGAGCTGA 60.978 55.000 0.00 0.00 0.00 4.26
173 174 0.531532 GACGGATGGGATGTGAGCTG 60.532 60.000 0.00 0.00 0.00 4.24
174 175 1.690219 GGACGGATGGGATGTGAGCT 61.690 60.000 0.00 0.00 0.00 4.09
175 176 1.227674 GGACGGATGGGATGTGAGC 60.228 63.158 0.00 0.00 0.00 4.26
176 177 0.761187 ATGGACGGATGGGATGTGAG 59.239 55.000 0.00 0.00 0.00 3.51
177 178 0.758734 GATGGACGGATGGGATGTGA 59.241 55.000 0.00 0.00 0.00 3.58
178 179 0.469494 TGATGGACGGATGGGATGTG 59.531 55.000 0.00 0.00 0.00 3.21
179 180 0.761187 CTGATGGACGGATGGGATGT 59.239 55.000 0.00 0.00 0.00 3.06
180 181 1.051008 TCTGATGGACGGATGGGATG 58.949 55.000 0.00 0.00 0.00 3.51
181 182 1.905215 GATCTGATGGACGGATGGGAT 59.095 52.381 0.00 0.00 43.77 3.85
182 183 1.342074 GATCTGATGGACGGATGGGA 58.658 55.000 0.00 0.00 43.77 4.37
183 184 1.001746 CTGATCTGATGGACGGATGGG 59.998 57.143 0.00 0.00 43.77 4.00
184 185 1.966354 TCTGATCTGATGGACGGATGG 59.034 52.381 0.00 0.00 43.77 3.51
185 186 3.257624 TGATCTGATCTGATGGACGGATG 59.742 47.826 18.72 0.00 43.77 3.51
186 187 3.504375 TGATCTGATCTGATGGACGGAT 58.496 45.455 18.72 0.00 46.08 4.18
187 188 2.889678 CTGATCTGATCTGATGGACGGA 59.110 50.000 18.72 0.00 38.35 4.69
188 189 2.889678 TCTGATCTGATCTGATGGACGG 59.110 50.000 18.72 10.16 33.13 4.79
189 190 4.217983 TGATCTGATCTGATCTGATGGACG 59.782 45.833 31.85 5.54 44.64 4.79
190 191 5.725325 TGATCTGATCTGATCTGATGGAC 57.275 43.478 31.85 22.09 44.64 4.02
191 192 5.011840 GGTTGATCTGATCTGATCTGATGGA 59.988 44.000 31.85 21.31 44.64 3.41
192 193 5.221661 TGGTTGATCTGATCTGATCTGATGG 60.222 44.000 31.85 11.44 44.64 3.51
193 194 5.855045 TGGTTGATCTGATCTGATCTGATG 58.145 41.667 31.85 15.45 44.64 3.07
194 195 5.511716 GCTGGTTGATCTGATCTGATCTGAT 60.512 44.000 30.92 28.98 46.44 2.90
195 196 4.202233 GCTGGTTGATCTGATCTGATCTGA 60.202 45.833 30.92 23.67 42.30 3.27
196 197 4.059511 GCTGGTTGATCTGATCTGATCTG 58.940 47.826 30.92 16.82 42.30 2.90
197 198 3.710165 TGCTGGTTGATCTGATCTGATCT 59.290 43.478 30.92 9.26 42.30 2.75
198 199 4.059511 CTGCTGGTTGATCTGATCTGATC 58.940 47.826 27.10 27.10 42.19 2.92
199 200 3.455177 ACTGCTGGTTGATCTGATCTGAT 59.545 43.478 17.82 14.33 0.00 2.90
200 201 2.836372 ACTGCTGGTTGATCTGATCTGA 59.164 45.455 17.82 4.63 0.00 3.27
201 202 3.263489 ACTGCTGGTTGATCTGATCTG 57.737 47.619 17.82 0.00 0.00 2.90
202 203 5.181748 GTTTACTGCTGGTTGATCTGATCT 58.818 41.667 17.82 0.00 0.00 2.75
203 204 4.937620 TGTTTACTGCTGGTTGATCTGATC 59.062 41.667 10.72 10.72 0.00 2.92
204 205 4.910195 TGTTTACTGCTGGTTGATCTGAT 58.090 39.130 0.00 0.00 0.00 2.90
205 206 4.350368 TGTTTACTGCTGGTTGATCTGA 57.650 40.909 0.00 0.00 0.00 3.27
206 207 5.437289 TTTGTTTACTGCTGGTTGATCTG 57.563 39.130 0.00 0.00 0.00 2.90
207 208 6.655078 ATTTTGTTTACTGCTGGTTGATCT 57.345 33.333 0.00 0.00 0.00 2.75
208 209 7.713764 AAATTTTGTTTACTGCTGGTTGATC 57.286 32.000 0.00 0.00 0.00 2.92
209 210 9.040939 GTAAAATTTTGTTTACTGCTGGTTGAT 57.959 29.630 13.76 0.00 39.72 2.57
210 211 8.035394 TGTAAAATTTTGTTTACTGCTGGTTGA 58.965 29.630 13.76 0.00 42.17 3.18
211 212 8.190888 TGTAAAATTTTGTTTACTGCTGGTTG 57.809 30.769 13.76 0.00 42.17 3.77
212 213 8.419076 CTGTAAAATTTTGTTTACTGCTGGTT 57.581 30.769 13.76 0.00 42.17 3.67
218 219 6.416455 TCGCTGCTGTAAAATTTTGTTTACTG 59.584 34.615 13.76 8.50 42.17 2.74
219 220 6.500041 TCGCTGCTGTAAAATTTTGTTTACT 58.500 32.000 13.76 0.00 42.17 2.24
220 221 6.635239 TCTCGCTGCTGTAAAATTTTGTTTAC 59.365 34.615 13.76 4.29 42.07 2.01
221 222 6.730175 TCTCGCTGCTGTAAAATTTTGTTTA 58.270 32.000 13.76 0.00 0.00 2.01
222 223 5.587289 TCTCGCTGCTGTAAAATTTTGTTT 58.413 33.333 13.76 0.00 0.00 2.83
223 224 5.181690 TCTCGCTGCTGTAAAATTTTGTT 57.818 34.783 13.76 0.00 0.00 2.83
224 225 4.320494 CCTCTCGCTGCTGTAAAATTTTGT 60.320 41.667 13.76 0.00 0.00 2.83
225 226 4.161333 CCTCTCGCTGCTGTAAAATTTTG 58.839 43.478 13.76 0.00 0.00 2.44
226 227 3.191371 CCCTCTCGCTGCTGTAAAATTTT 59.809 43.478 8.75 8.75 0.00 1.82
227 228 2.749621 CCCTCTCGCTGCTGTAAAATTT 59.250 45.455 0.00 0.00 0.00 1.82
228 229 2.027192 TCCCTCTCGCTGCTGTAAAATT 60.027 45.455 0.00 0.00 0.00 1.82
229 230 1.555075 TCCCTCTCGCTGCTGTAAAAT 59.445 47.619 0.00 0.00 0.00 1.82
230 231 0.973632 TCCCTCTCGCTGCTGTAAAA 59.026 50.000 0.00 0.00 0.00 1.52
231 232 0.532573 CTCCCTCTCGCTGCTGTAAA 59.467 55.000 0.00 0.00 0.00 2.01
232 233 0.323451 TCTCCCTCTCGCTGCTGTAA 60.323 55.000 0.00 0.00 0.00 2.41
233 234 1.032657 GTCTCCCTCTCGCTGCTGTA 61.033 60.000 0.00 0.00 0.00 2.74
234 235 2.036414 TCTCCCTCTCGCTGCTGT 59.964 61.111 0.00 0.00 0.00 4.40
235 236 2.493973 GTCTCCCTCTCGCTGCTG 59.506 66.667 0.00 0.00 0.00 4.41
236 237 2.757917 GGTCTCCCTCTCGCTGCT 60.758 66.667 0.00 0.00 0.00 4.24
237 238 2.172483 TTTGGTCTCCCTCTCGCTGC 62.172 60.000 0.00 0.00 0.00 5.25
238 239 0.108424 CTTTGGTCTCCCTCTCGCTG 60.108 60.000 0.00 0.00 0.00 5.18
239 240 1.893919 GCTTTGGTCTCCCTCTCGCT 61.894 60.000 0.00 0.00 0.00 4.93
240 241 1.448717 GCTTTGGTCTCCCTCTCGC 60.449 63.158 0.00 0.00 0.00 5.03
241 242 1.219393 GGCTTTGGTCTCCCTCTCG 59.781 63.158 0.00 0.00 0.00 4.04
242 243 1.201429 TGGGCTTTGGTCTCCCTCTC 61.201 60.000 0.00 0.00 40.69 3.20
243 244 0.772124 TTGGGCTTTGGTCTCCCTCT 60.772 55.000 0.00 0.00 40.69 3.69
244 245 0.332972 ATTGGGCTTTGGTCTCCCTC 59.667 55.000 0.00 0.00 40.69 4.30
245 246 0.332972 GATTGGGCTTTGGTCTCCCT 59.667 55.000 0.00 0.00 40.69 4.20
246 247 0.684479 GGATTGGGCTTTGGTCTCCC 60.684 60.000 0.00 0.00 40.47 4.30
247 248 0.039618 TGGATTGGGCTTTGGTCTCC 59.960 55.000 0.00 0.00 0.00 3.71
248 249 1.923356 TTGGATTGGGCTTTGGTCTC 58.077 50.000 0.00 0.00 0.00 3.36
249 250 2.043526 AGATTGGATTGGGCTTTGGTCT 59.956 45.455 0.00 0.00 0.00 3.85
250 251 2.167075 CAGATTGGATTGGGCTTTGGTC 59.833 50.000 0.00 0.00 0.00 4.02
251 252 2.181975 CAGATTGGATTGGGCTTTGGT 58.818 47.619 0.00 0.00 0.00 3.67
252 253 2.459644 TCAGATTGGATTGGGCTTTGG 58.540 47.619 0.00 0.00 0.00 3.28
253 254 3.677976 GCTTCAGATTGGATTGGGCTTTG 60.678 47.826 0.00 0.00 0.00 2.77
254 255 2.498885 GCTTCAGATTGGATTGGGCTTT 59.501 45.455 0.00 0.00 0.00 3.51
255 256 2.105766 GCTTCAGATTGGATTGGGCTT 58.894 47.619 0.00 0.00 0.00 4.35
256 257 1.006281 TGCTTCAGATTGGATTGGGCT 59.994 47.619 0.00 0.00 0.00 5.19
257 258 1.477553 TGCTTCAGATTGGATTGGGC 58.522 50.000 0.00 0.00 0.00 5.36
258 259 2.429610 CCTTGCTTCAGATTGGATTGGG 59.570 50.000 0.00 0.00 0.00 4.12
259 260 2.429610 CCCTTGCTTCAGATTGGATTGG 59.570 50.000 0.00 0.00 0.00 3.16
260 261 2.159142 GCCCTTGCTTCAGATTGGATTG 60.159 50.000 0.00 0.00 33.53 2.67
261 262 2.105766 GCCCTTGCTTCAGATTGGATT 58.894 47.619 0.00 0.00 33.53 3.01
262 263 1.006281 TGCCCTTGCTTCAGATTGGAT 59.994 47.619 0.00 0.00 38.71 3.41
263 264 0.405198 TGCCCTTGCTTCAGATTGGA 59.595 50.000 0.00 0.00 38.71 3.53
264 265 0.815734 CTGCCCTTGCTTCAGATTGG 59.184 55.000 0.00 0.00 38.71 3.16
265 266 1.471684 GACTGCCCTTGCTTCAGATTG 59.528 52.381 0.00 0.00 38.71 2.67
266 267 1.615384 GGACTGCCCTTGCTTCAGATT 60.615 52.381 0.00 0.00 38.71 2.40
267 268 0.034670 GGACTGCCCTTGCTTCAGAT 60.035 55.000 0.00 0.00 38.71 2.90
268 269 1.376466 GGACTGCCCTTGCTTCAGA 59.624 57.895 0.00 0.00 38.71 3.27
269 270 3.993535 GGACTGCCCTTGCTTCAG 58.006 61.111 0.00 0.00 38.71 3.02
279 280 2.750888 GCGAAATGACGGGACTGCC 61.751 63.158 0.00 0.00 0.00 4.85
280 281 2.750888 GGCGAAATGACGGGACTGC 61.751 63.158 0.00 0.00 0.00 4.40
281 282 2.106683 GGGCGAAATGACGGGACTG 61.107 63.158 0.00 0.00 0.00 3.51
282 283 2.267961 GGGCGAAATGACGGGACT 59.732 61.111 0.00 0.00 0.00 3.85
283 284 2.822701 GGGGCGAAATGACGGGAC 60.823 66.667 0.00 0.00 0.00 4.46
284 285 4.104183 GGGGGCGAAATGACGGGA 62.104 66.667 0.00 0.00 0.00 5.14
298 299 2.907179 AAGGCGAAAGTGGAGGGGG 61.907 63.158 0.00 0.00 0.00 5.40
299 300 1.675641 CAAGGCGAAAGTGGAGGGG 60.676 63.158 0.00 0.00 0.00 4.79
300 301 2.335712 GCAAGGCGAAAGTGGAGGG 61.336 63.158 0.00 0.00 0.00 4.30
301 302 2.335712 GGCAAGGCGAAAGTGGAGG 61.336 63.158 0.00 0.00 0.00 4.30
302 303 2.680913 CGGCAAGGCGAAAGTGGAG 61.681 63.158 10.75 0.00 0.00 3.86
303 304 2.668212 CGGCAAGGCGAAAGTGGA 60.668 61.111 10.75 0.00 0.00 4.02
304 305 4.404654 GCGGCAAGGCGAAAGTGG 62.405 66.667 20.47 0.00 0.00 4.00
339 340 4.689549 GGGTTGGGGTTTCGGGGG 62.690 72.222 0.00 0.00 0.00 5.40
340 341 4.689549 GGGGTTGGGGTTTCGGGG 62.690 72.222 0.00 0.00 0.00 5.73
341 342 4.689549 GGGGGTTGGGGTTTCGGG 62.690 72.222 0.00 0.00 0.00 5.14
342 343 3.904617 TGGGGGTTGGGGTTTCGG 61.905 66.667 0.00 0.00 0.00 4.30
343 344 2.599281 GTGGGGGTTGGGGTTTCG 60.599 66.667 0.00 0.00 0.00 3.46
344 345 2.203728 GGTGGGGGTTGGGGTTTC 60.204 66.667 0.00 0.00 0.00 2.78
345 346 3.852421 GGGTGGGGGTTGGGGTTT 61.852 66.667 0.00 0.00 0.00 3.27
832 833 2.964438 TATTTCTAGGCCCGCGCGTG 62.964 60.000 29.95 20.15 34.31 5.34
833 834 2.694829 CTATTTCTAGGCCCGCGCGT 62.695 60.000 29.95 12.94 36.89 6.01
834 835 2.022129 CTATTTCTAGGCCCGCGCG 61.022 63.158 25.67 25.67 35.02 6.86
835 836 1.668151 CCTATTTCTAGGCCCGCGC 60.668 63.158 0.00 0.00 38.29 6.86
836 837 1.004918 CCCTATTTCTAGGCCCGCG 60.005 63.158 0.00 0.00 42.95 6.46
837 838 1.375326 CCCCTATTTCTAGGCCCGC 59.625 63.158 0.00 0.00 42.95 6.13
838 839 1.375326 GCCCCTATTTCTAGGCCCG 59.625 63.158 0.00 0.00 42.95 6.13
839 840 1.125711 TCGCCCCTATTTCTAGGCCC 61.126 60.000 0.00 0.00 42.95 5.80
840 841 0.035036 GTCGCCCCTATTTCTAGGCC 59.965 60.000 0.00 0.00 42.95 5.19
841 842 0.319641 CGTCGCCCCTATTTCTAGGC 60.320 60.000 0.00 0.00 42.95 3.93
842 843 0.317479 CCGTCGCCCCTATTTCTAGG 59.683 60.000 0.00 0.00 43.78 3.02
843 844 1.000496 GTCCGTCGCCCCTATTTCTAG 60.000 57.143 0.00 0.00 0.00 2.43
844 845 1.035139 GTCCGTCGCCCCTATTTCTA 58.965 55.000 0.00 0.00 0.00 2.10
845 846 1.821258 GTCCGTCGCCCCTATTTCT 59.179 57.895 0.00 0.00 0.00 2.52
846 847 1.590792 CGTCCGTCGCCCCTATTTC 60.591 63.158 0.00 0.00 0.00 2.17
847 848 2.497770 CGTCCGTCGCCCCTATTT 59.502 61.111 0.00 0.00 0.00 1.40
848 849 3.534056 CCGTCCGTCGCCCCTATT 61.534 66.667 0.00 0.00 38.35 1.73
849 850 4.511246 TCCGTCCGTCGCCCCTAT 62.511 66.667 0.00 0.00 38.35 2.57
854 855 3.834799 ATTCCTCCGTCCGTCGCC 61.835 66.667 0.00 0.00 38.35 5.54
855 856 2.582498 CATTCCTCCGTCCGTCGC 60.582 66.667 0.00 0.00 38.35 5.19
856 857 2.104331 CCATTCCTCCGTCCGTCG 59.896 66.667 0.00 0.00 39.52 5.12
857 858 1.437986 CTCCATTCCTCCGTCCGTC 59.562 63.158 0.00 0.00 0.00 4.79
858 859 2.058595 CCTCCATTCCTCCGTCCGT 61.059 63.158 0.00 0.00 0.00 4.69
859 860 2.797278 CCCTCCATTCCTCCGTCCG 61.797 68.421 0.00 0.00 0.00 4.79
860 861 3.108288 GCCCTCCATTCCTCCGTCC 62.108 68.421 0.00 0.00 0.00 4.79
861 862 2.506472 GCCCTCCATTCCTCCGTC 59.494 66.667 0.00 0.00 0.00 4.79
862 863 3.470888 CGCCCTCCATTCCTCCGT 61.471 66.667 0.00 0.00 0.00 4.69
863 864 3.154473 TCGCCCTCCATTCCTCCG 61.154 66.667 0.00 0.00 0.00 4.63
864 865 2.506472 GTCGCCCTCCATTCCTCC 59.494 66.667 0.00 0.00 0.00 4.30
865 866 2.506472 GGTCGCCCTCCATTCCTC 59.494 66.667 0.00 0.00 0.00 3.71
866 867 3.470888 CGGTCGCCCTCCATTCCT 61.471 66.667 0.00 0.00 0.00 3.36
867 868 3.735037 GACGGTCGCCCTCCATTCC 62.735 68.421 0.00 0.00 0.00 3.01
868 869 2.202892 GACGGTCGCCCTCCATTC 60.203 66.667 0.00 0.00 0.00 2.67
869 870 2.683933 AGACGGTCGCCCTCCATT 60.684 61.111 1.89 0.00 0.00 3.16
870 871 3.148279 GAGACGGTCGCCCTCCAT 61.148 66.667 1.89 0.00 0.00 3.41
895 896 0.251430 TTTGATTTGGGGACGGGGAC 60.251 55.000 0.00 0.00 0.00 4.46
896 897 0.483328 TTTTGATTTGGGGACGGGGA 59.517 50.000 0.00 0.00 0.00 4.81
897 898 1.567357 ATTTTGATTTGGGGACGGGG 58.433 50.000 0.00 0.00 0.00 5.73
898 899 3.007398 TGAAATTTTGATTTGGGGACGGG 59.993 43.478 0.00 0.00 0.00 5.28
899 900 4.264460 TGAAATTTTGATTTGGGGACGG 57.736 40.909 0.00 0.00 0.00 4.79
900 901 5.757808 AGTTTGAAATTTTGATTTGGGGACG 59.242 36.000 0.00 0.00 0.00 4.79
901 902 7.566760 AAGTTTGAAATTTTGATTTGGGGAC 57.433 32.000 0.00 0.00 0.00 4.46
902 903 7.284261 GGAAAGTTTGAAATTTTGATTTGGGGA 59.716 33.333 3.06 0.00 0.00 4.81
985 986 2.801631 GCATCCTCACTCTCCCCGG 61.802 68.421 0.00 0.00 0.00 5.73
986 987 2.801631 GGCATCCTCACTCTCCCCG 61.802 68.421 0.00 0.00 0.00 5.73
988 989 2.801631 CCGGCATCCTCACTCTCCC 61.802 68.421 0.00 0.00 0.00 4.30
993 994 2.039624 AGGTCCGGCATCCTCACT 59.960 61.111 0.00 0.00 0.00 3.41
994 995 2.187946 CAGGTCCGGCATCCTCAC 59.812 66.667 0.00 0.00 30.91 3.51
995 996 3.785859 GCAGGTCCGGCATCCTCA 61.786 66.667 9.36 0.00 30.91 3.86
996 997 4.554036 GGCAGGTCCGGCATCCTC 62.554 72.222 16.26 0.00 30.91 3.71
1288 1292 2.363018 CTCCTGCTCGGTGAGGGA 60.363 66.667 0.00 0.00 0.00 4.20
1355 1359 0.658829 CTCATCCTCGTCGTCATCGC 60.659 60.000 0.00 0.00 36.96 4.58
1358 1362 1.313772 CTCCTCATCCTCGTCGTCAT 58.686 55.000 0.00 0.00 0.00 3.06
1359 1363 0.748367 CCTCCTCATCCTCGTCGTCA 60.748 60.000 0.00 0.00 0.00 4.35
1361 1365 0.464735 CTCCTCCTCATCCTCGTCGT 60.465 60.000 0.00 0.00 0.00 4.34
1367 1371 0.398381 GTCCTGCTCCTCCTCATCCT 60.398 60.000 0.00 0.00 0.00 3.24
1368 1372 1.743321 CGTCCTGCTCCTCCTCATCC 61.743 65.000 0.00 0.00 0.00 3.51
1371 1375 1.379176 CTCGTCCTGCTCCTCCTCA 60.379 63.158 0.00 0.00 0.00 3.86
1373 1377 2.043450 CCTCGTCCTGCTCCTCCT 60.043 66.667 0.00 0.00 0.00 3.69
1374 1378 2.043852 TCCTCGTCCTGCTCCTCC 60.044 66.667 0.00 0.00 0.00 4.30
1377 1381 1.079750 GTTGTCCTCGTCCTGCTCC 60.080 63.158 0.00 0.00 0.00 4.70
1381 1385 2.805353 CGCGTTGTCCTCGTCCTG 60.805 66.667 0.00 0.00 0.00 3.86
1393 1397 2.277373 GACGATCTCGAGCGCGTT 60.277 61.111 25.51 0.00 45.05 4.84
1488 1492 1.494824 ACTGACGCGGAGTAAAACAC 58.505 50.000 12.47 0.00 0.00 3.32
1489 1493 2.228138 AACTGACGCGGAGTAAAACA 57.772 45.000 12.47 0.00 0.00 2.83
1490 1494 3.538780 GAAAACTGACGCGGAGTAAAAC 58.461 45.455 12.47 1.76 0.00 2.43
1491 1495 2.219216 CGAAAACTGACGCGGAGTAAAA 59.781 45.455 12.47 0.00 0.00 1.52
1495 1499 0.249155 TTCGAAAACTGACGCGGAGT 60.249 50.000 12.47 9.39 0.00 3.85
1496 1500 1.068474 ATTCGAAAACTGACGCGGAG 58.932 50.000 12.47 8.63 0.00 4.63
1497 1501 2.350899 TATTCGAAAACTGACGCGGA 57.649 45.000 12.47 0.00 0.00 5.54
1498 1502 3.443054 TTTATTCGAAAACTGACGCGG 57.557 42.857 12.47 0.00 0.00 6.46
1500 1504 3.542310 GGCATTTATTCGAAAACTGACGC 59.458 43.478 0.00 0.00 0.00 5.19
1512 1521 9.193806 AGTGGATATAATCATGGGCATTTATTC 57.806 33.333 0.00 0.00 0.00 1.75
1516 1525 6.891908 GGTAGTGGATATAATCATGGGCATTT 59.108 38.462 0.00 0.00 0.00 2.32
1531 1540 1.414919 GTTGCGGGATGGTAGTGGATA 59.585 52.381 0.00 0.00 0.00 2.59
1544 1556 7.277981 GGATATTATACAGTGAATAGTTGCGGG 59.722 40.741 0.00 0.00 0.00 6.13
1551 1563 5.459107 GCCGCGGATATTATACAGTGAATAG 59.541 44.000 33.48 0.00 0.00 1.73
1556 1568 1.917955 CGCCGCGGATATTATACAGTG 59.082 52.381 33.48 0.00 0.00 3.66
1578 1593 1.939769 GAGCGCCGGGAGATCTATCC 61.940 65.000 8.86 0.00 38.76 2.59
1596 1611 4.209911 CGAGAAGATCATATTTTGCAGCGA 59.790 41.667 0.00 0.00 0.00 4.93
1600 1615 4.260334 CGCACGAGAAGATCATATTTTGCA 60.260 41.667 0.00 0.00 0.00 4.08
1608 1623 2.233654 GCGCGCACGAGAAGATCAT 61.234 57.895 29.10 0.00 43.93 2.45
1610 1625 2.161486 AAGCGCGCACGAGAAGATC 61.161 57.895 35.10 0.00 43.93 2.75
1616 1631 3.893914 GACAACAAGCGCGCACGAG 62.894 63.158 35.10 21.07 43.93 4.18
1618 1633 2.221704 TATGACAACAAGCGCGCACG 62.222 55.000 35.10 25.31 44.07 5.34
1625 1643 6.756542 GGGATTTAACCATTATGACAACAAGC 59.243 38.462 0.00 0.00 0.00 4.01
1630 1648 4.950475 TGCGGGATTTAACCATTATGACAA 59.050 37.500 0.00 0.00 0.00 3.18
1654 1672 4.462394 GCAGGGCGCATCTAATGA 57.538 55.556 10.83 0.00 41.79 2.57
1677 1698 6.874664 CAGAGGAAGATGATGGATCATTACTG 59.125 42.308 3.65 4.72 46.84 2.74
1712 1737 3.074390 TGATTATGCGGGGAGAAATGGAT 59.926 43.478 0.00 0.00 0.00 3.41
1721 1746 2.046292 TGAGTGATGATTATGCGGGGA 58.954 47.619 0.00 0.00 0.00 4.81
1737 1762 2.223829 CGGCATAAAGAGGACGATGAGT 60.224 50.000 0.00 0.00 0.00 3.41
1739 1764 1.754803 ACGGCATAAAGAGGACGATGA 59.245 47.619 0.00 0.00 0.00 2.92
1744 1769 1.536284 CCGAGACGGCATAAAGAGGAC 60.536 57.143 0.00 0.00 41.17 3.85
1746 1771 3.274393 CCGAGACGGCATAAAGAGG 57.726 57.895 0.00 0.00 41.17 3.69
1761 1786 1.399714 ATGGATGTTAGAGCGTCCGA 58.600 50.000 0.83 0.00 45.21 4.55
1762 1787 1.860950 CAATGGATGTTAGAGCGTCCG 59.139 52.381 0.83 0.00 45.21 4.79
1763 1788 3.179443 TCAATGGATGTTAGAGCGTCC 57.821 47.619 0.00 0.00 43.17 4.79
1764 1789 5.294306 TGAAATCAATGGATGTTAGAGCGTC 59.706 40.000 0.00 0.00 32.92 5.19
1765 1790 5.185454 TGAAATCAATGGATGTTAGAGCGT 58.815 37.500 0.00 0.00 32.92 5.07
1766 1791 5.295292 ACTGAAATCAATGGATGTTAGAGCG 59.705 40.000 0.00 0.00 30.75 5.03
1775 1805 7.528996 TCTGAACAAACTGAAATCAATGGAT 57.471 32.000 0.00 0.00 34.43 3.41
1776 1806 6.957920 TCTGAACAAACTGAAATCAATGGA 57.042 33.333 0.00 0.00 0.00 3.41
1778 1808 7.358931 GCACATCTGAACAAACTGAAATCAATG 60.359 37.037 0.00 0.00 0.00 2.82
1790 1820 3.114809 CGCAAAAGCACATCTGAACAAA 58.885 40.909 0.00 0.00 0.00 2.83
1792 1822 1.001487 CCGCAAAAGCACATCTGAACA 60.001 47.619 0.00 0.00 0.00 3.18
1793 1823 1.689959 CCGCAAAAGCACATCTGAAC 58.310 50.000 0.00 0.00 0.00 3.18
1794 1824 0.039256 GCCGCAAAAGCACATCTGAA 60.039 50.000 0.00 0.00 0.00 3.02
1795 1825 1.580942 GCCGCAAAAGCACATCTGA 59.419 52.632 0.00 0.00 0.00 3.27
1796 1826 1.444895 GGCCGCAAAAGCACATCTG 60.445 57.895 0.00 0.00 0.00 2.90
1797 1827 1.181098 AAGGCCGCAAAAGCACATCT 61.181 50.000 0.00 0.00 0.00 2.90
1798 1828 0.733909 GAAGGCCGCAAAAGCACATC 60.734 55.000 0.00 0.00 0.00 3.06
1800 1830 1.795170 GAGAAGGCCGCAAAAGCACA 61.795 55.000 0.00 0.00 0.00 4.57
1801 1831 1.081175 GAGAAGGCCGCAAAAGCAC 60.081 57.895 0.00 0.00 0.00 4.40
1802 1832 0.823356 AAGAGAAGGCCGCAAAAGCA 60.823 50.000 0.00 0.00 0.00 3.91
1803 1833 0.315251 AAAGAGAAGGCCGCAAAAGC 59.685 50.000 0.00 0.00 0.00 3.51
1826 1856 9.503427 GAAATTACATTACAGCTACATCAAACC 57.497 33.333 0.00 0.00 0.00 3.27
1877 1912 4.496341 GCAAGCACAGAACACGCATATATT 60.496 41.667 0.00 0.00 0.00 1.28
1878 1913 3.002656 GCAAGCACAGAACACGCATATAT 59.997 43.478 0.00 0.00 0.00 0.86
1879 1914 2.351418 GCAAGCACAGAACACGCATATA 59.649 45.455 0.00 0.00 0.00 0.86
1903 1938 5.015072 TGATCCTCTGCTCCTATCTGACTAT 59.985 44.000 0.00 0.00 0.00 2.12
1929 1968 4.106925 CTGACAGCAGGGGAGGCC 62.107 72.222 0.00 0.00 38.51 5.19
1944 1983 6.758886 GCGTCTAATTATCAGGGGATTATCTG 59.241 42.308 0.00 0.00 34.89 2.90
1985 2024 1.856629 ATGACCAAGGCAAAGATGGG 58.143 50.000 0.00 0.00 38.58 4.00
1993 2032 0.178967 TGGAAGCAATGACCAAGGCA 60.179 50.000 0.00 0.00 0.00 4.75
1995 2034 2.675889 GCAATGGAAGCAATGACCAAGG 60.676 50.000 0.00 0.00 37.24 3.61
2002 2041 3.130516 AGATGTGAGCAATGGAAGCAATG 59.869 43.478 0.00 0.00 0.00 2.82
2003 2042 3.130516 CAGATGTGAGCAATGGAAGCAAT 59.869 43.478 0.00 0.00 0.00 3.56
2004 2043 2.490509 CAGATGTGAGCAATGGAAGCAA 59.509 45.455 0.00 0.00 0.00 3.91
2005 2044 2.089201 CAGATGTGAGCAATGGAAGCA 58.911 47.619 0.00 0.00 0.00 3.91
2006 2045 1.202268 GCAGATGTGAGCAATGGAAGC 60.202 52.381 0.00 0.00 0.00 3.86
2007 2046 2.089201 TGCAGATGTGAGCAATGGAAG 58.911 47.619 0.00 0.00 37.90 3.46
2008 2047 1.814394 GTGCAGATGTGAGCAATGGAA 59.186 47.619 0.00 0.00 43.20 3.53
2009 2048 1.271488 TGTGCAGATGTGAGCAATGGA 60.271 47.619 0.00 0.00 43.20 3.41
2010 2049 1.170442 TGTGCAGATGTGAGCAATGG 58.830 50.000 0.00 0.00 43.20 3.16
2018 2057 6.596497 TGCTATGGATTATATGTGCAGATGTG 59.404 38.462 6.60 0.00 0.00 3.21
2114 2373 3.151554 TCTAACTACAGACAAGCACCGA 58.848 45.455 0.00 0.00 0.00 4.69
2115 2374 3.570926 TCTAACTACAGACAAGCACCG 57.429 47.619 0.00 0.00 0.00 4.94
2116 2375 5.360144 TCCTATCTAACTACAGACAAGCACC 59.640 44.000 0.00 0.00 0.00 5.01
2117 2376 6.095720 ACTCCTATCTAACTACAGACAAGCAC 59.904 42.308 0.00 0.00 0.00 4.40
2118 2377 6.188407 ACTCCTATCTAACTACAGACAAGCA 58.812 40.000 0.00 0.00 0.00 3.91
2119 2378 6.702716 ACTCCTATCTAACTACAGACAAGC 57.297 41.667 0.00 0.00 0.00 4.01
2121 2380 9.750783 ACTTTACTCCTATCTAACTACAGACAA 57.249 33.333 0.00 0.00 0.00 3.18
2132 2391 9.742144 GAGGTCATGATACTTTACTCCTATCTA 57.258 37.037 0.00 0.00 0.00 1.98
2133 2392 7.392113 CGAGGTCATGATACTTTACTCCTATCT 59.608 40.741 0.00 0.00 0.00 1.98
2134 2393 7.175293 ACGAGGTCATGATACTTTACTCCTATC 59.825 40.741 0.00 0.00 0.00 2.08
2135 2394 7.005296 ACGAGGTCATGATACTTTACTCCTAT 58.995 38.462 0.00 0.00 0.00 2.57
2136 2395 6.363065 ACGAGGTCATGATACTTTACTCCTA 58.637 40.000 0.00 0.00 0.00 2.94
2137 2396 5.202004 ACGAGGTCATGATACTTTACTCCT 58.798 41.667 0.00 0.00 0.00 3.69
2138 2397 5.299782 AGACGAGGTCATGATACTTTACTCC 59.700 44.000 0.00 0.00 34.60 3.85
2139 2398 6.183360 ACAGACGAGGTCATGATACTTTACTC 60.183 42.308 0.00 0.00 34.60 2.59
2140 2399 5.652891 ACAGACGAGGTCATGATACTTTACT 59.347 40.000 0.00 0.00 34.60 2.24
2141 2400 5.892568 ACAGACGAGGTCATGATACTTTAC 58.107 41.667 0.00 0.00 34.60 2.01
2142 2401 6.525578 AACAGACGAGGTCATGATACTTTA 57.474 37.500 0.00 0.00 34.60 1.85
2143 2402 5.407407 AACAGACGAGGTCATGATACTTT 57.593 39.130 0.00 0.00 34.60 2.66
2144 2403 5.171476 CAAACAGACGAGGTCATGATACTT 58.829 41.667 0.00 0.00 34.60 2.24
2145 2404 4.220821 ACAAACAGACGAGGTCATGATACT 59.779 41.667 0.00 0.00 34.60 2.12
2146 2405 4.495422 ACAAACAGACGAGGTCATGATAC 58.505 43.478 0.00 0.00 34.60 2.24
2147 2406 4.801330 ACAAACAGACGAGGTCATGATA 57.199 40.909 0.00 0.00 34.60 2.15
2148 2407 3.685139 ACAAACAGACGAGGTCATGAT 57.315 42.857 0.00 0.00 34.60 2.45
2149 2408 3.056821 CCTACAAACAGACGAGGTCATGA 60.057 47.826 0.00 0.00 34.60 3.07
2150 2409 3.254060 CCTACAAACAGACGAGGTCATG 58.746 50.000 0.00 0.00 34.60 3.07
2151 2410 2.353803 GCCTACAAACAGACGAGGTCAT 60.354 50.000 0.00 0.00 34.60 3.06
2152 2411 1.000506 GCCTACAAACAGACGAGGTCA 59.999 52.381 0.00 0.00 34.60 4.02
2153 2412 1.272769 AGCCTACAAACAGACGAGGTC 59.727 52.381 0.00 0.00 0.00 3.85
2154 2413 1.339097 AGCCTACAAACAGACGAGGT 58.661 50.000 0.00 0.00 0.00 3.85
2155 2414 2.457366 AAGCCTACAAACAGACGAGG 57.543 50.000 0.00 0.00 0.00 4.63
2156 2415 5.062308 GTGATTAAGCCTACAAACAGACGAG 59.938 44.000 0.00 0.00 0.00 4.18
2157 2416 4.927425 GTGATTAAGCCTACAAACAGACGA 59.073 41.667 0.00 0.00 0.00 4.20
2158 2417 4.092968 GGTGATTAAGCCTACAAACAGACG 59.907 45.833 0.00 0.00 0.00 4.18
2159 2418 5.122396 CAGGTGATTAAGCCTACAAACAGAC 59.878 44.000 0.00 0.00 33.07 3.51
2160 2419 5.221843 ACAGGTGATTAAGCCTACAAACAGA 60.222 40.000 0.00 0.00 33.07 3.41
2161 2420 5.003804 ACAGGTGATTAAGCCTACAAACAG 58.996 41.667 0.00 0.00 33.07 3.16
2162 2421 4.759693 CACAGGTGATTAAGCCTACAAACA 59.240 41.667 0.00 0.00 33.07 2.83
2163 2422 4.760204 ACACAGGTGATTAAGCCTACAAAC 59.240 41.667 6.40 0.00 33.07 2.93
2164 2423 4.980573 ACACAGGTGATTAAGCCTACAAA 58.019 39.130 6.40 0.00 33.07 2.83
2165 2424 4.634012 ACACAGGTGATTAAGCCTACAA 57.366 40.909 6.40 0.00 33.07 2.41
2166 2425 4.775780 AGTACACAGGTGATTAAGCCTACA 59.224 41.667 6.40 0.00 33.07 2.74
2167 2426 5.340439 AGTACACAGGTGATTAAGCCTAC 57.660 43.478 6.40 0.00 33.07 3.18
2168 2427 6.368779 AAAGTACACAGGTGATTAAGCCTA 57.631 37.500 6.40 0.00 33.07 3.93
2169 2428 4.910458 AAGTACACAGGTGATTAAGCCT 57.090 40.909 6.40 0.00 35.04 4.58
2170 2429 5.959618 AAAAGTACACAGGTGATTAAGCC 57.040 39.130 6.40 0.00 0.00 4.35
2171 2430 9.983804 GTTATAAAAGTACACAGGTGATTAAGC 57.016 33.333 6.40 0.00 0.00 3.09
2174 2433 9.158233 GCTGTTATAAAAGTACACAGGTGATTA 57.842 33.333 6.40 0.00 36.22 1.75
2175 2434 7.663905 TGCTGTTATAAAAGTACACAGGTGATT 59.336 33.333 6.40 0.00 36.22 2.57
2176 2435 7.165485 TGCTGTTATAAAAGTACACAGGTGAT 58.835 34.615 6.40 0.00 36.22 3.06
2177 2436 6.526526 TGCTGTTATAAAAGTACACAGGTGA 58.473 36.000 6.40 0.00 36.22 4.02
2178 2437 6.795098 TGCTGTTATAAAAGTACACAGGTG 57.205 37.500 4.57 0.00 36.22 4.00
2179 2438 7.165485 TCATGCTGTTATAAAAGTACACAGGT 58.835 34.615 4.57 0.00 36.22 4.00
2180 2439 7.609760 TCATGCTGTTATAAAAGTACACAGG 57.390 36.000 4.57 0.00 36.22 4.00
2181 2440 9.494479 CATTCATGCTGTTATAAAAGTACACAG 57.506 33.333 4.57 0.00 38.32 3.66
2182 2441 8.458052 CCATTCATGCTGTTATAAAAGTACACA 58.542 33.333 4.57 0.00 0.00 3.72
2183 2442 8.458843 ACCATTCATGCTGTTATAAAAGTACAC 58.541 33.333 4.57 0.00 0.00 2.90
2184 2443 8.458052 CACCATTCATGCTGTTATAAAAGTACA 58.542 33.333 4.57 0.00 0.00 2.90
2185 2444 8.458843 ACACCATTCATGCTGTTATAAAAGTAC 58.541 33.333 4.57 0.00 0.00 2.73
2186 2445 8.574251 ACACCATTCATGCTGTTATAAAAGTA 57.426 30.769 4.57 0.03 0.00 2.24
2187 2446 7.466746 ACACCATTCATGCTGTTATAAAAGT 57.533 32.000 4.57 0.00 0.00 2.66
2188 2447 8.761575 AAACACCATTCATGCTGTTATAAAAG 57.238 30.769 0.00 0.00 36.01 2.27
2189 2448 9.632807 GTAAACACCATTCATGCTGTTATAAAA 57.367 29.630 1.72 0.00 36.01 1.52
2190 2449 8.247562 GGTAAACACCATTCATGCTGTTATAAA 58.752 33.333 1.72 0.00 36.01 1.40
2191 2450 7.613801 AGGTAAACACCATTCATGCTGTTATAA 59.386 33.333 1.72 0.00 36.01 0.98
2192 2451 7.066887 CAGGTAAACACCATTCATGCTGTTATA 59.933 37.037 1.72 0.00 36.01 0.98
2193 2452 5.951747 AGGTAAACACCATTCATGCTGTTAT 59.048 36.000 1.72 0.00 36.01 1.89
2194 2453 5.182950 CAGGTAAACACCATTCATGCTGTTA 59.817 40.000 1.72 0.00 36.01 2.41
2195 2454 4.022068 CAGGTAAACACCATTCATGCTGTT 60.022 41.667 0.00 0.00 37.99 3.16
2196 2455 3.507233 CAGGTAAACACCATTCATGCTGT 59.493 43.478 0.00 0.00 0.00 4.40
2197 2456 3.119388 CCAGGTAAACACCATTCATGCTG 60.119 47.826 0.00 0.00 0.00 4.41
2198 2457 3.091545 CCAGGTAAACACCATTCATGCT 58.908 45.455 0.00 0.00 0.00 3.79
2199 2458 2.166254 CCCAGGTAAACACCATTCATGC 59.834 50.000 0.00 0.00 0.00 4.06
2200 2459 3.696045 TCCCAGGTAAACACCATTCATG 58.304 45.455 0.00 0.00 0.00 3.07
2201 2460 3.877735 GCTCCCAGGTAAACACCATTCAT 60.878 47.826 0.00 0.00 0.00 2.57
2202 2461 2.554344 GCTCCCAGGTAAACACCATTCA 60.554 50.000 0.00 0.00 0.00 2.57
2203 2462 2.092323 GCTCCCAGGTAAACACCATTC 58.908 52.381 0.00 0.00 0.00 2.67
2204 2463 1.613255 CGCTCCCAGGTAAACACCATT 60.613 52.381 0.00 0.00 0.00 3.16
2205 2464 0.035439 CGCTCCCAGGTAAACACCAT 60.035 55.000 0.00 0.00 0.00 3.55
2206 2465 1.373435 CGCTCCCAGGTAAACACCA 59.627 57.895 0.00 0.00 0.00 4.17
2207 2466 0.250597 AACGCTCCCAGGTAAACACC 60.251 55.000 0.00 0.00 0.00 4.16
2208 2467 0.872388 CAACGCTCCCAGGTAAACAC 59.128 55.000 0.00 0.00 0.00 3.32
2209 2468 0.470766 ACAACGCTCCCAGGTAAACA 59.529 50.000 0.00 0.00 0.00 2.83
2210 2469 1.534163 GAACAACGCTCCCAGGTAAAC 59.466 52.381 0.00 0.00 0.00 2.01
2211 2470 1.141254 TGAACAACGCTCCCAGGTAAA 59.859 47.619 0.00 0.00 0.00 2.01
2212 2471 0.759959 TGAACAACGCTCCCAGGTAA 59.240 50.000 0.00 0.00 0.00 2.85
2213 2472 0.320374 CTGAACAACGCTCCCAGGTA 59.680 55.000 0.00 0.00 0.00 3.08
2214 2473 1.071471 CTGAACAACGCTCCCAGGT 59.929 57.895 0.00 0.00 0.00 4.00
2215 2474 2.328099 GCTGAACAACGCTCCCAGG 61.328 63.158 0.00 0.00 0.00 4.45
2216 2475 0.957395 ATGCTGAACAACGCTCCCAG 60.957 55.000 0.00 0.00 0.00 4.45
2217 2476 0.537143 AATGCTGAACAACGCTCCCA 60.537 50.000 0.00 0.00 0.00 4.37
2218 2477 0.109597 CAATGCTGAACAACGCTCCC 60.110 55.000 0.00 0.00 0.00 4.30
2219 2478 0.730494 GCAATGCTGAACAACGCTCC 60.730 55.000 0.00 0.00 0.00 4.70
2220 2479 0.239347 AGCAATGCTGAACAACGCTC 59.761 50.000 7.07 0.00 37.57 5.03
2221 2480 0.670162 AAGCAATGCTGAACAACGCT 59.330 45.000 9.14 0.00 39.62 5.07
2222 2481 1.978782 GTAAGCAATGCTGAACAACGC 59.021 47.619 9.14 0.00 39.62 4.84
2223 2482 3.266541 TGTAAGCAATGCTGAACAACG 57.733 42.857 17.78 0.00 39.62 4.10
2224 2483 4.383649 CACATGTAAGCAATGCTGAACAAC 59.616 41.667 22.03 11.24 39.62 3.32
2225 2484 4.548494 CACATGTAAGCAATGCTGAACAA 58.452 39.130 22.03 10.17 39.62 2.83
2226 2485 3.612241 GCACATGTAAGCAATGCTGAACA 60.612 43.478 20.94 20.94 39.62 3.18
2227 2486 2.919229 GCACATGTAAGCAATGCTGAAC 59.081 45.455 9.14 11.21 39.62 3.18
2228 2487 2.414426 CGCACATGTAAGCAATGCTGAA 60.414 45.455 9.14 0.00 39.62 3.02
2229 2488 1.130938 CGCACATGTAAGCAATGCTGA 59.869 47.619 9.14 0.00 39.62 4.26
2230 2489 1.541475 CGCACATGTAAGCAATGCTG 58.459 50.000 9.14 0.00 39.62 4.41
2231 2490 0.179156 GCGCACATGTAAGCAATGCT 60.179 50.000 16.81 0.00 42.56 3.79
2232 2491 0.456482 TGCGCACATGTAAGCAATGC 60.456 50.000 20.64 10.91 36.60 3.56
2233 2492 2.197792 ATGCGCACATGTAAGCAATG 57.802 45.000 24.76 2.58 43.19 2.82
2234 2493 3.565063 TCATATGCGCACATGTAAGCAAT 59.435 39.130 26.56 17.67 43.19 3.56
2235 2494 2.941720 TCATATGCGCACATGTAAGCAA 59.058 40.909 26.56 16.60 43.19 3.91
2236 2495 2.559440 TCATATGCGCACATGTAAGCA 58.441 42.857 26.56 23.69 44.13 3.91
2237 2496 3.607422 TTCATATGCGCACATGTAAGC 57.393 42.857 26.56 15.36 37.04 3.09
2238 2497 4.453478 AGGATTCATATGCGCACATGTAAG 59.547 41.667 26.56 6.60 37.04 2.34
2239 2498 4.388485 AGGATTCATATGCGCACATGTAA 58.612 39.130 26.56 19.15 37.04 2.41
2240 2499 4.006780 AGGATTCATATGCGCACATGTA 57.993 40.909 26.56 18.93 37.04 2.29
2241 2500 2.854963 AGGATTCATATGCGCACATGT 58.145 42.857 26.56 10.05 37.04 3.21
2242 2501 3.181513 GCTAGGATTCATATGCGCACATG 60.182 47.826 22.50 22.50 37.04 3.21
2243 2502 3.005554 GCTAGGATTCATATGCGCACAT 58.994 45.455 14.90 2.34 40.49 3.21
2244 2503 2.037641 AGCTAGGATTCATATGCGCACA 59.962 45.455 14.90 0.00 0.00 4.57
2245 2504 2.670414 GAGCTAGGATTCATATGCGCAC 59.330 50.000 14.90 0.00 0.00 5.34
2246 2505 2.564504 AGAGCTAGGATTCATATGCGCA 59.435 45.455 14.96 14.96 0.00 6.09
2247 2506 2.928757 CAGAGCTAGGATTCATATGCGC 59.071 50.000 0.00 0.00 0.00 6.09
2248 2507 2.928757 GCAGAGCTAGGATTCATATGCG 59.071 50.000 0.00 0.00 0.00 4.73
2249 2508 3.935315 TGCAGAGCTAGGATTCATATGC 58.065 45.455 0.00 0.00 0.00 3.14
2250 2509 5.303165 TGTTGCAGAGCTAGGATTCATATG 58.697 41.667 0.00 0.00 0.00 1.78
2251 2510 5.549347 CTGTTGCAGAGCTAGGATTCATAT 58.451 41.667 0.00 0.00 32.44 1.78
2252 2511 4.741837 GCTGTTGCAGAGCTAGGATTCATA 60.742 45.833 11.55 0.00 39.41 2.15
2253 2512 3.806380 CTGTTGCAGAGCTAGGATTCAT 58.194 45.455 0.00 0.00 32.44 2.57
2254 2513 2.679059 GCTGTTGCAGAGCTAGGATTCA 60.679 50.000 11.55 0.00 39.41 2.57
2255 2514 1.939255 GCTGTTGCAGAGCTAGGATTC 59.061 52.381 11.55 0.00 39.41 2.52
2256 2515 1.558756 AGCTGTTGCAGAGCTAGGATT 59.441 47.619 18.14 0.00 45.17 3.01
2257 2516 1.134461 CAGCTGTTGCAGAGCTAGGAT 60.134 52.381 18.92 0.00 45.24 3.24
2258 2517 0.248565 CAGCTGTTGCAGAGCTAGGA 59.751 55.000 18.92 0.00 45.24 2.94
2259 2518 2.764944 CAGCTGTTGCAGAGCTAGG 58.235 57.895 18.92 7.21 45.24 3.02
2269 2528 3.155093 ACAAAAAGACTGCAGCTGTTG 57.845 42.857 15.27 19.06 0.00 3.33
2270 2529 3.056607 ACAACAAAAAGACTGCAGCTGTT 60.057 39.130 15.27 10.53 0.00 3.16
2271 2530 2.493278 ACAACAAAAAGACTGCAGCTGT 59.507 40.909 15.27 4.29 0.00 4.40
2272 2531 3.155093 ACAACAAAAAGACTGCAGCTG 57.845 42.857 15.27 10.11 0.00 4.24
2273 2532 3.874392 AACAACAAAAAGACTGCAGCT 57.126 38.095 15.27 9.34 0.00 4.24
2274 2533 6.918022 AGTAATAACAACAAAAAGACTGCAGC 59.082 34.615 15.27 6.85 0.00 5.25
2275 2534 8.273643 CAGTAATAACAACAAAAAGACTGCAG 57.726 34.615 13.48 13.48 0.00 4.41
2278 2537 7.096477 GCTGCAGTAATAACAACAAAAAGACTG 60.096 37.037 16.64 0.00 35.88 3.51
2279 2538 6.918022 GCTGCAGTAATAACAACAAAAAGACT 59.082 34.615 16.64 0.00 0.00 3.24
2280 2539 6.695278 TGCTGCAGTAATAACAACAAAAAGAC 59.305 34.615 16.64 0.00 0.00 3.01
2281 2540 6.695278 GTGCTGCAGTAATAACAACAAAAAGA 59.305 34.615 16.64 0.00 0.00 2.52
2282 2541 6.074356 GGTGCTGCAGTAATAACAACAAAAAG 60.074 38.462 16.64 0.00 0.00 2.27
2283 2542 5.751028 GGTGCTGCAGTAATAACAACAAAAA 59.249 36.000 16.64 0.00 0.00 1.94
2284 2543 5.163509 TGGTGCTGCAGTAATAACAACAAAA 60.164 36.000 16.64 0.00 0.00 2.44
2285 2544 4.339530 TGGTGCTGCAGTAATAACAACAAA 59.660 37.500 16.64 0.00 0.00 2.83
2286 2545 3.885901 TGGTGCTGCAGTAATAACAACAA 59.114 39.130 16.64 0.00 0.00 2.83
2287 2546 3.481453 TGGTGCTGCAGTAATAACAACA 58.519 40.909 16.64 9.49 0.00 3.33
2288 2547 4.082787 ACATGGTGCTGCAGTAATAACAAC 60.083 41.667 16.64 6.72 0.00 3.32
2312 2571 4.687483 CCAAACTGCCATCATCAGAAAAAC 59.313 41.667 0.00 0.00 35.61 2.43
2354 2613 4.607239 AGTAATTCAGAACGGAGGGAGTA 58.393 43.478 0.00 0.00 0.00 2.59
2355 2614 3.442076 AGTAATTCAGAACGGAGGGAGT 58.558 45.455 0.00 0.00 0.00 3.85
2356 2615 3.489398 CGAGTAATTCAGAACGGAGGGAG 60.489 52.174 0.00 0.00 0.00 4.30
2357 2616 2.426024 CGAGTAATTCAGAACGGAGGGA 59.574 50.000 0.00 0.00 0.00 4.20
2358 2617 2.165845 ACGAGTAATTCAGAACGGAGGG 59.834 50.000 0.00 0.00 0.00 4.30
2359 2618 3.436496 GACGAGTAATTCAGAACGGAGG 58.564 50.000 0.00 0.00 0.00 4.30
2360 2619 3.099362 CGACGAGTAATTCAGAACGGAG 58.901 50.000 0.00 0.00 0.00 4.63
2361 2620 2.730090 GCGACGAGTAATTCAGAACGGA 60.730 50.000 0.00 0.00 0.00 4.69
2362 2621 1.582502 GCGACGAGTAATTCAGAACGG 59.417 52.381 0.00 0.00 0.00 4.44
2363 2622 2.247637 TGCGACGAGTAATTCAGAACG 58.752 47.619 0.00 0.00 0.00 3.95
2364 2623 3.499048 TCTGCGACGAGTAATTCAGAAC 58.501 45.455 0.00 0.00 0.00 3.01
2365 2624 3.842732 TCTGCGACGAGTAATTCAGAA 57.157 42.857 0.00 0.00 0.00 3.02
2366 2625 3.842732 TTCTGCGACGAGTAATTCAGA 57.157 42.857 0.00 0.00 0.00 3.27
2367 2626 4.259970 CCATTTCTGCGACGAGTAATTCAG 60.260 45.833 0.00 0.00 0.00 3.02
2368 2627 3.616821 CCATTTCTGCGACGAGTAATTCA 59.383 43.478 0.00 0.00 0.00 2.57
2369 2628 3.863424 TCCATTTCTGCGACGAGTAATTC 59.137 43.478 0.00 0.00 0.00 2.17
2370 2629 3.857052 TCCATTTCTGCGACGAGTAATT 58.143 40.909 0.00 0.00 0.00 1.40
2371 2630 3.520290 TCCATTTCTGCGACGAGTAAT 57.480 42.857 0.00 0.00 0.00 1.89
2372 2631 3.186909 CATCCATTTCTGCGACGAGTAA 58.813 45.455 0.00 0.00 0.00 2.24
2373 2632 2.165641 ACATCCATTTCTGCGACGAGTA 59.834 45.455 0.00 0.00 0.00 2.59
2374 2633 1.066858 ACATCCATTTCTGCGACGAGT 60.067 47.619 0.00 0.00 0.00 4.18
2375 2634 1.645034 ACATCCATTTCTGCGACGAG 58.355 50.000 0.00 0.00 0.00 4.18
2376 2635 2.951457 TACATCCATTTCTGCGACGA 57.049 45.000 0.00 0.00 0.00 4.20
2377 2636 3.384668 AGATACATCCATTTCTGCGACG 58.615 45.455 0.00 0.00 0.00 5.12
2378 2637 5.773575 TCTAGATACATCCATTTCTGCGAC 58.226 41.667 0.00 0.00 0.00 5.19
2379 2638 6.015095 ACATCTAGATACATCCATTTCTGCGA 60.015 38.462 4.54 0.00 0.00 5.10
2380 2639 6.162079 ACATCTAGATACATCCATTTCTGCG 58.838 40.000 4.54 0.00 0.00 5.18
2381 2640 9.664332 AATACATCTAGATACATCCATTTCTGC 57.336 33.333 4.54 0.00 0.00 4.26
2411 2670 9.347934 CGTCATAGAAATGGATGTATCTAGAAC 57.652 37.037 0.00 0.00 33.61 3.01
2412 2671 9.297037 TCGTCATAGAAATGGATGTATCTAGAA 57.703 33.333 0.00 0.00 33.61 2.10
2413 2672 8.863872 TCGTCATAGAAATGGATGTATCTAGA 57.136 34.615 0.00 0.00 33.61 2.43
2414 2673 8.735315 ACTCGTCATAGAAATGGATGTATCTAG 58.265 37.037 0.00 0.00 33.61 2.43
2415 2674 8.637196 ACTCGTCATAGAAATGGATGTATCTA 57.363 34.615 0.00 0.00 33.61 1.98
2416 2675 7.531857 ACTCGTCATAGAAATGGATGTATCT 57.468 36.000 0.00 0.00 33.61 1.98
2417 2676 9.862371 ATTACTCGTCATAGAAATGGATGTATC 57.138 33.333 0.00 0.00 33.61 2.24
2420 2679 8.830580 CAAATTACTCGTCATAGAAATGGATGT 58.169 33.333 0.00 0.00 33.61 3.06
2421 2680 8.285394 CCAAATTACTCGTCATAGAAATGGATG 58.715 37.037 0.00 0.00 33.61 3.51
2422 2681 8.210946 TCCAAATTACTCGTCATAGAAATGGAT 58.789 33.333 0.00 0.00 33.61 3.41
2423 2682 7.561251 TCCAAATTACTCGTCATAGAAATGGA 58.439 34.615 0.00 0.00 33.61 3.41
2424 2683 7.786178 TCCAAATTACTCGTCATAGAAATGG 57.214 36.000 0.00 0.00 33.61 3.16
2425 2684 7.846107 CGTTCCAAATTACTCGTCATAGAAATG 59.154 37.037 0.00 0.00 0.00 2.32
2426 2685 7.762615 TCGTTCCAAATTACTCGTCATAGAAAT 59.237 33.333 0.00 0.00 0.00 2.17
2427 2686 7.092079 TCGTTCCAAATTACTCGTCATAGAAA 58.908 34.615 0.00 0.00 0.00 2.52
2428 2687 6.623486 TCGTTCCAAATTACTCGTCATAGAA 58.377 36.000 0.00 0.00 0.00 2.10
2429 2688 6.198650 TCGTTCCAAATTACTCGTCATAGA 57.801 37.500 0.00 0.00 0.00 1.98
2430 2689 6.019801 CCTTCGTTCCAAATTACTCGTCATAG 60.020 42.308 0.00 0.00 0.00 2.23
2431 2690 5.808540 CCTTCGTTCCAAATTACTCGTCATA 59.191 40.000 0.00 0.00 0.00 2.15
2432 2691 4.630069 CCTTCGTTCCAAATTACTCGTCAT 59.370 41.667 0.00 0.00 0.00 3.06
2433 2692 3.991773 CCTTCGTTCCAAATTACTCGTCA 59.008 43.478 0.00 0.00 0.00 4.35
2434 2693 3.370061 CCCTTCGTTCCAAATTACTCGTC 59.630 47.826 0.00 0.00 0.00 4.20
2435 2694 3.007182 TCCCTTCGTTCCAAATTACTCGT 59.993 43.478 0.00 0.00 0.00 4.18
2436 2695 3.592059 TCCCTTCGTTCCAAATTACTCG 58.408 45.455 0.00 0.00 0.00 4.18
2437 2696 4.576879 ACTCCCTTCGTTCCAAATTACTC 58.423 43.478 0.00 0.00 0.00 2.59
2438 2697 4.635699 ACTCCCTTCGTTCCAAATTACT 57.364 40.909 0.00 0.00 0.00 2.24
2439 2698 4.874396 CCTACTCCCTTCGTTCCAAATTAC 59.126 45.833 0.00 0.00 0.00 1.89
2440 2699 4.778958 TCCTACTCCCTTCGTTCCAAATTA 59.221 41.667 0.00 0.00 0.00 1.40
2441 2700 3.585732 TCCTACTCCCTTCGTTCCAAATT 59.414 43.478 0.00 0.00 0.00 1.82
2442 2701 3.178865 TCCTACTCCCTTCGTTCCAAAT 58.821 45.455 0.00 0.00 0.00 2.32
2443 2702 2.565834 CTCCTACTCCCTTCGTTCCAAA 59.434 50.000 0.00 0.00 0.00 3.28
2444 2703 2.176889 CTCCTACTCCCTTCGTTCCAA 58.823 52.381 0.00 0.00 0.00 3.53
2445 2704 1.076677 ACTCCTACTCCCTTCGTTCCA 59.923 52.381 0.00 0.00 0.00 3.53
2446 2705 1.849977 ACTCCTACTCCCTTCGTTCC 58.150 55.000 0.00 0.00 0.00 3.62
2447 2706 5.126707 TCATTTACTCCTACTCCCTTCGTTC 59.873 44.000 0.00 0.00 0.00 3.95
2448 2707 5.021458 TCATTTACTCCTACTCCCTTCGTT 58.979 41.667 0.00 0.00 0.00 3.85
2449 2708 4.607239 TCATTTACTCCTACTCCCTTCGT 58.393 43.478 0.00 0.00 0.00 3.85
2450 2709 5.793030 ATCATTTACTCCTACTCCCTTCG 57.207 43.478 0.00 0.00 0.00 3.79
2451 2710 5.760743 GCAATCATTTACTCCTACTCCCTTC 59.239 44.000 0.00 0.00 0.00 3.46
2452 2711 5.191722 TGCAATCATTTACTCCTACTCCCTT 59.808 40.000 0.00 0.00 0.00 3.95
2453 2712 4.721776 TGCAATCATTTACTCCTACTCCCT 59.278 41.667 0.00 0.00 0.00 4.20
2454 2713 5.036117 TGCAATCATTTACTCCTACTCCC 57.964 43.478 0.00 0.00 0.00 4.30
2455 2714 6.793492 GATGCAATCATTTACTCCTACTCC 57.207 41.667 0.00 0.00 44.70 3.85
2473 2732 2.361757 CCCAACAACAGACAAAGATGCA 59.638 45.455 0.00 0.00 0.00 3.96
2474 2733 2.362077 ACCCAACAACAGACAAAGATGC 59.638 45.455 0.00 0.00 0.00 3.91
2493 2977 6.653740 ACTGTTAAAGCTTACAGGTGATTACC 59.346 38.462 25.78 0.00 44.68 2.85
2577 3063 8.956446 TGACCAGACTATCCAGATATCATTTA 57.044 34.615 5.32 0.00 0.00 1.40
2595 3081 5.048782 GCAAATGACATTACACTTGACCAGA 60.049 40.000 0.00 0.00 30.11 3.86
2643 3134 0.538287 ACCAGCAAAAGGAGCAGGAC 60.538 55.000 3.56 0.00 40.72 3.85
2687 3178 0.257328 TCCAAGGCACAGACAAACCA 59.743 50.000 0.00 0.00 0.00 3.67
2695 3187 1.741706 CATTAGCAGTCCAAGGCACAG 59.258 52.381 0.00 0.00 0.00 3.66
2716 3208 5.443185 AATCATTTGGTCAACAGACTGTG 57.557 39.130 9.33 3.88 32.81 3.66
2717 3209 5.593909 TCAAATCATTTGGTCAACAGACTGT 59.406 36.000 10.30 1.07 40.98 3.55
2726 3218 5.419788 CAGGGAGAATCAAATCATTTGGTCA 59.580 40.000 10.30 0.00 40.98 4.02
2744 3236 7.675062 ACAAGATACTAGCAAATATCAGGGAG 58.325 38.462 0.00 0.00 31.34 4.30
2745 3239 7.618019 ACAAGATACTAGCAAATATCAGGGA 57.382 36.000 0.00 0.00 31.34 4.20
2750 3244 8.091449 AGGCAGTACAAGATACTAGCAAATATC 58.909 37.037 0.00 0.00 0.00 1.63
2767 3261 4.781087 AGACAAAATACCCTAGGCAGTACA 59.219 41.667 2.05 0.00 0.00 2.90
2796 3294 5.532779 TGTATGTAATCACTTTGCCACACAA 59.467 36.000 0.00 0.00 36.13 3.33
2798 3296 5.621197 TGTATGTAATCACTTTGCCACAC 57.379 39.130 0.00 0.00 0.00 3.82
2815 3313 5.699458 TGAACTGCAGCATAGATCATGTATG 59.301 40.000 15.27 0.00 36.95 2.39
2823 3321 2.422519 CCCCTTGAACTGCAGCATAGAT 60.423 50.000 15.27 0.00 0.00 1.98
2956 3455 1.747355 CCAAAGAGTAGCCAATGCCAG 59.253 52.381 0.00 0.00 38.69 4.85
2960 3459 5.712152 AAGAAACCAAAGAGTAGCCAATG 57.288 39.130 0.00 0.00 0.00 2.82
2967 3466 8.458843 CAAACTCTCAAAAGAAACCAAAGAGTA 58.541 33.333 2.84 0.00 40.67 2.59
2969 3468 6.254373 GCAAACTCTCAAAAGAAACCAAAGAG 59.746 38.462 0.00 0.00 35.90 2.85
3033 3571 7.875971 AGCTAAACCTGACTCAATTTAAAGTG 58.124 34.615 9.33 9.33 0.00 3.16
3041 3579 8.256356 AGATATGTAGCTAAACCTGACTCAAT 57.744 34.615 0.00 0.00 0.00 2.57
3092 3630 4.407296 AGCCATCTAGGTTCAAGGACTTAG 59.593 45.833 0.00 0.00 40.61 2.18
3121 3659 2.235016 GGCAAGGAACACATGGTTGTA 58.765 47.619 0.00 0.00 40.63 2.41
3139 3677 2.757099 CTCCAGGGGTGCAATGGC 60.757 66.667 0.00 0.00 41.68 4.40
3140 3678 1.379044 GACTCCAGGGGTGCAATGG 60.379 63.158 0.00 0.00 35.30 3.16
3141 3679 1.379044 GGACTCCAGGGGTGCAATG 60.379 63.158 5.99 0.00 0.00 2.82
3142 3680 1.542375 AGGACTCCAGGGGTGCAAT 60.542 57.895 14.50 0.00 0.00 3.56
3144 3682 2.930019 CAGGACTCCAGGGGTGCA 60.930 66.667 14.50 0.00 0.00 4.57
3145 3683 1.566298 ATTCAGGACTCCAGGGGTGC 61.566 60.000 1.71 1.71 0.00 5.01
3146 3684 1.879575 TATTCAGGACTCCAGGGGTG 58.120 55.000 0.00 0.00 0.00 4.61
3147 3685 2.897823 ATATTCAGGACTCCAGGGGT 57.102 50.000 0.00 0.00 0.00 4.95
3149 3687 7.290061 TCAAATAAATATTCAGGACTCCAGGG 58.710 38.462 0.00 0.00 0.00 4.45
3151 3689 8.970859 ACTCAAATAAATATTCAGGACTCCAG 57.029 34.615 0.00 0.00 0.00 3.86
3152 3690 9.396022 GAACTCAAATAAATATTCAGGACTCCA 57.604 33.333 0.00 0.00 0.00 3.86
3153 3691 9.396022 TGAACTCAAATAAATATTCAGGACTCC 57.604 33.333 0.00 0.00 0.00 3.85
3193 3731 0.183492 TGGGAGGAACATGCATAGGC 59.817 55.000 0.00 0.00 41.68 3.93
3212 3750 8.587608 ACAACATATTGACTGGAATCACAAATT 58.412 29.630 0.00 0.00 39.30 1.82
3287 3833 2.621526 GTCCAACCAACCAAAGTAGGTG 59.378 50.000 0.00 0.00 42.25 4.00
3362 3921 2.092429 CCTTTTATGCCAGCAGAGGGTA 60.092 50.000 0.00 0.00 0.00 3.69
3391 3950 2.877168 GCATGTCAAAGAGAGGCTATGG 59.123 50.000 0.00 0.00 0.00 2.74
3412 3971 1.945394 GGCTATGCATGTGTCCAGAAG 59.055 52.381 10.16 0.00 0.00 2.85
3480 4042 7.647715 TCATAGTTTTCAGCTTAAAAAGTGTGC 59.352 33.333 20.12 6.14 37.72 4.57
3587 4149 9.131791 AGAAAAAGAACATACAAGGAAAGCTTA 57.868 29.630 0.00 0.00 0.00 3.09
3640 4202 9.562226 ACCAAATATATAGTAGGCAGGAGTATT 57.438 33.333 0.00 0.00 0.00 1.89
3773 4338 1.304052 TCCCCGGCATTTTCCACAG 60.304 57.895 0.00 0.00 0.00 3.66
3878 4443 0.835971 TTCCAGAGCCACCTGCACTA 60.836 55.000 0.00 0.00 44.83 2.74
3881 4446 0.322816 GATTTCCAGAGCCACCTGCA 60.323 55.000 0.00 0.00 44.83 4.41
3893 4458 9.527157 TTTCTTATGTAATGAACAGGATTTCCA 57.473 29.630 0.00 0.00 42.70 3.53
3977 4542 2.877097 TCTGGCCACTTGAAGCATTA 57.123 45.000 0.00 0.00 0.00 1.90
4043 4608 3.439008 CGCCTTTTGGGGTCGTTT 58.561 55.556 0.00 0.00 46.26 3.60
4071 4636 0.178897 TCCCAGGTTTCCCCGACTAA 60.179 55.000 0.00 0.00 38.74 2.24
4073 4638 1.462627 TTCCCAGGTTTCCCCGACT 60.463 57.895 0.00 0.00 38.74 4.18
4118 4683 1.820519 GCAACATGAGGGAAATGAGCA 59.179 47.619 0.00 0.00 33.20 4.26
4244 4809 6.531503 TGATAGCAAGTGAGTAAACTAGCT 57.468 37.500 0.00 0.00 35.06 3.32
4293 4860 4.990543 TTCACAGAAATAAGTGCTCACG 57.009 40.909 0.00 0.00 35.76 4.35
4312 4881 6.653320 TCCACCACTGTCAGTACAAATTATTC 59.347 38.462 4.85 0.00 34.49 1.75
4499 5069 8.753175 GTGATATCAACTACGGACTTATCAAAC 58.247 37.037 7.07 0.00 0.00 2.93
4510 5080 6.807708 GTGTAACTGTGATATCAACTACGG 57.192 41.667 7.07 2.68 0.00 4.02
4530 5100 2.002505 ACACTGTCAGGCTAGAGTGT 57.997 50.000 15.81 15.81 46.00 3.55
4567 5142 9.020731 ACAACATAAAACTATTCAAGGTAAGGG 57.979 33.333 0.00 0.00 0.00 3.95
4579 5154 7.754924 GCAGCACATGTAACAACATAAAACTAT 59.245 33.333 0.00 0.00 0.00 2.12
4581 5156 5.920273 GCAGCACATGTAACAACATAAAACT 59.080 36.000 0.00 0.00 0.00 2.66
4587 5162 5.840243 ATATGCAGCACATGTAACAACAT 57.160 34.783 0.00 4.78 40.06 2.71
4588 5163 6.238703 CCATATATGCAGCACATGTAACAACA 60.239 38.462 7.24 0.00 40.06 3.33
4589 5164 6.017192 TCCATATATGCAGCACATGTAACAAC 60.017 38.462 7.24 0.00 40.06 3.32
4689 5266 6.709018 TTCTCTTTGTGGGACCTTTTTAAG 57.291 37.500 0.00 0.00 0.00 1.85
4746 5323 7.069344 TCTCAATCCTGTAGACTCCATCATAA 58.931 38.462 0.00 0.00 0.00 1.90
4807 5384 0.179020 TTGAACCTCTGCACAGGGTG 60.179 55.000 13.08 0.00 37.96 4.61
4809 5386 0.179020 TGTTGAACCTCTGCACAGGG 60.179 55.000 13.08 3.25 37.96 4.45
4815 5392 3.375782 AAAGCAATGTTGAACCTCTGC 57.624 42.857 5.55 5.55 0.00 4.26
4822 5399 9.033481 CACAAAATAGAGAAAAGCAATGTTGAA 57.967 29.630 0.00 0.00 0.00 2.69
4825 5402 6.424812 GGCACAAAATAGAGAAAAGCAATGTT 59.575 34.615 0.00 0.00 0.00 2.71
4827 5404 5.927689 TGGCACAAAATAGAGAAAAGCAATG 59.072 36.000 0.00 0.00 31.92 2.82
4828 5405 5.928264 GTGGCACAAAATAGAGAAAAGCAAT 59.072 36.000 13.86 0.00 44.16 3.56
4834 5411 6.294675 CCATTCAGTGGCACAAAATAGAGAAA 60.295 38.462 21.41 0.00 44.16 2.52
4835 5412 5.183713 CCATTCAGTGGCACAAAATAGAGAA 59.816 40.000 21.41 10.11 44.16 2.87
4870 5447 8.112183 ACCCTGAGACAGAAATCAAAAGAATAT 58.888 33.333 0.00 0.00 32.44 1.28
4917 5494 1.990799 TGTCGCATCGTACAAAGAGG 58.009 50.000 0.00 0.00 0.00 3.69
4923 5500 1.996898 GGTTCATTGTCGCATCGTACA 59.003 47.619 0.00 0.00 0.00 2.90
4964 5541 7.497249 TGCCAAAACAAAATGTAATAGCTTTGT 59.503 29.630 0.00 0.00 42.30 2.83
4969 5546 9.919348 CATATTGCCAAAACAAAATGTAATAGC 57.081 29.630 0.00 0.00 32.27 2.97
5011 5589 5.643777 ACATCAGTGTAAGTAATGCCACTTC 59.356 40.000 0.00 0.00 39.45 3.01
5014 5592 5.181245 ACAACATCAGTGTAAGTAATGCCAC 59.819 40.000 0.00 0.00 37.67 5.01
5121 5699 1.450312 GGATCCTGCCCGTTCAGTG 60.450 63.158 3.84 0.00 32.32 3.66
5167 5745 5.947228 AACATCAGAAGAAGAAAATCGCA 57.053 34.783 0.00 0.00 0.00 5.10
5200 5778 3.198409 TCAGTGGTGATGATGTATGCC 57.802 47.619 0.00 0.00 0.00 4.40
5367 5949 1.140312 AACCCTTCAACAGCCTCTCA 58.860 50.000 0.00 0.00 0.00 3.27
5390 5972 4.210120 GCAATCAAAACACACGGCATAAAA 59.790 37.500 0.00 0.00 0.00 1.52
5394 5976 1.340889 AGCAATCAAAACACACGGCAT 59.659 42.857 0.00 0.00 0.00 4.40
5416 5998 3.685058 GCTATTTAAGCCAAACAGAGCG 58.315 45.455 0.00 0.00 46.25 5.03
5440 6022 7.783596 AGGAGAATGAATGCTTGGAATAGATTT 59.216 33.333 0.00 0.00 0.00 2.17
5465 6047 2.998772 ACAAACACAAGCACGCATTAG 58.001 42.857 0.00 0.00 0.00 1.73
5510 6092 6.312918 CCTTCATCAAATTCTTGCAAATGGAG 59.687 38.462 0.00 3.52 32.14 3.86
5526 6108 6.295688 GGAGTAGTAAGTGGTTCCTTCATCAA 60.296 42.308 0.00 0.00 0.00 2.57
5546 6128 4.466370 CAGAAGTTATGACCACAGGGAGTA 59.534 45.833 0.00 0.00 38.05 2.59
5597 6179 1.286849 TCCCTCATAGAACCCTCGTCA 59.713 52.381 0.00 0.00 0.00 4.35
5687 6269 3.596214 GTTCTCCAGGAAGTCGCAAATA 58.404 45.455 0.00 0.00 34.23 1.40
5716 6298 7.914871 TCAACAGACTTGTGTTTCAATTACATG 59.085 33.333 0.00 0.00 38.65 3.21
5725 6307 4.355543 TGCTTCAACAGACTTGTGTTTC 57.644 40.909 0.00 0.00 38.65 2.78
5748 6345 9.537848 CGTCCATCAGTAAACATACTTTAAAAC 57.462 33.333 0.00 0.00 0.00 2.43
5751 6348 6.314400 GGCGTCCATCAGTAAACATACTTTAA 59.686 38.462 0.00 0.00 0.00 1.52
5764 6362 0.687354 AACAGAAGGCGTCCATCAGT 59.313 50.000 0.00 0.11 0.00 3.41
5773 6371 2.979813 GCAACACAAATAACAGAAGGCG 59.020 45.455 0.00 0.00 0.00 5.52
5779 6377 8.746922 ATGTTAATCTGCAACACAAATAACAG 57.253 30.769 0.00 0.00 38.63 3.16
5889 6490 2.633481 CTCCAGAGCATCCTCATCATCA 59.367 50.000 0.00 0.00 40.68 3.07
5895 6496 1.007600 TCCTTCTCCAGAGCATCCTCA 59.992 52.381 0.00 0.00 40.68 3.86
5925 6526 1.005748 CTCGTTCAGGCTGCTGTCA 60.006 57.895 10.34 0.00 0.00 3.58
6053 6654 1.134159 CATCTTTGGCCTCCTCCTCAG 60.134 57.143 3.32 0.00 0.00 3.35
6063 6667 4.521146 TGATCTTCTTCTCATCTTTGGCC 58.479 43.478 0.00 0.00 0.00 5.36
6098 6702 2.416431 GCATTTTCCACATCAGGAGCAC 60.416 50.000 0.00 0.00 39.25 4.40
6103 6710 1.822990 AGCTGCATTTTCCACATCAGG 59.177 47.619 1.02 0.00 0.00 3.86
6129 6736 0.320374 TTTCAACCATCTCGGCGTCT 59.680 50.000 6.85 0.00 39.03 4.18
6135 6742 3.334583 TCCTCCTTTTCAACCATCTCG 57.665 47.619 0.00 0.00 0.00 4.04
6166 6773 1.905215 CTTCTTCTGAGCCTTCTGGGA 59.095 52.381 0.00 0.00 37.23 4.37
6176 6783 1.023513 CCCCTTGCGCTTCTTCTGAG 61.024 60.000 9.73 0.00 0.00 3.35
6249 6874 2.046892 GCGGCCTTCTCTTCAGCA 60.047 61.111 0.00 0.00 0.00 4.41
6252 6877 4.760047 GCGGCGGCCTTCTCTTCA 62.760 66.667 18.34 0.00 0.00 3.02
6366 7003 4.202574 CCACCAGCCACCACCACA 62.203 66.667 0.00 0.00 0.00 4.17
6432 7069 1.734047 CGCTCCTCTTCTTCAACGGAG 60.734 57.143 0.00 0.00 43.18 4.63
6433 7070 0.243907 CGCTCCTCTTCTTCAACGGA 59.756 55.000 0.00 0.00 0.00 4.69
6435 7072 1.355066 GCCGCTCCTCTTCTTCAACG 61.355 60.000 0.00 0.00 0.00 4.10
6436 7073 1.355066 CGCCGCTCCTCTTCTTCAAC 61.355 60.000 0.00 0.00 0.00 3.18
6437 7074 1.079819 CGCCGCTCCTCTTCTTCAA 60.080 57.895 0.00 0.00 0.00 2.69
6440 7077 4.459089 GGCGCCGCTCCTCTTCTT 62.459 66.667 12.58 0.00 0.00 2.52
6526 7176 9.503399 GGATAAAACAGTCTTCCGGATAAATAT 57.497 33.333 4.15 0.00 0.00 1.28
6530 7180 5.353938 CGGATAAAACAGTCTTCCGGATAA 58.646 41.667 4.15 0.00 44.24 1.75
6537 7187 5.465724 AGACACAACGGATAAAACAGTCTTC 59.534 40.000 0.00 0.00 30.32 2.87
6545 7195 3.816523 GGGACAAGACACAACGGATAAAA 59.183 43.478 0.00 0.00 0.00 1.52
6553 7203 1.068741 AGTCTCGGGACAAGACACAAC 59.931 52.381 19.57 0.00 44.36 3.32
6558 7209 0.680061 ACCAAGTCTCGGGACAAGAC 59.320 55.000 19.57 5.59 44.36 3.01
6566 7217 1.302033 AGCAGCAACCAAGTCTCGG 60.302 57.895 0.00 0.00 0.00 4.63
6567 7218 1.864862 CAGCAGCAACCAAGTCTCG 59.135 57.895 0.00 0.00 0.00 4.04
6674 7372 8.338259 CACACCAGTAAATATAGTTCAAGCATC 58.662 37.037 0.00 0.00 0.00 3.91
6688 7386 7.781056 AGAAACAAACAATCACACCAGTAAAT 58.219 30.769 0.00 0.00 0.00 1.40
6689 7387 7.164230 AGAAACAAACAATCACACCAGTAAA 57.836 32.000 0.00 0.00 0.00 2.01
6694 7392 6.279513 AGAAAGAAACAAACAATCACACCA 57.720 33.333 0.00 0.00 0.00 4.17
6707 7405 4.581824 AGATGCAGCAGAAAGAAAGAAACA 59.418 37.500 4.07 0.00 0.00 2.83
6712 7410 2.818432 ACCAGATGCAGCAGAAAGAAAG 59.182 45.455 4.07 0.00 0.00 2.62
6714 7412 2.574006 ACCAGATGCAGCAGAAAGAA 57.426 45.000 4.07 0.00 0.00 2.52
6715 7413 2.574006 AACCAGATGCAGCAGAAAGA 57.426 45.000 4.07 0.00 0.00 2.52
6716 7414 3.603532 TCTAACCAGATGCAGCAGAAAG 58.396 45.455 4.07 0.00 0.00 2.62
6717 7415 3.701205 TCTAACCAGATGCAGCAGAAA 57.299 42.857 4.07 0.00 0.00 2.52
6718 7416 3.920231 ATCTAACCAGATGCAGCAGAA 57.080 42.857 4.07 0.00 40.15 3.02
6742 7440 9.332502 TGAACAAAAACTAGATGCAACTAACTA 57.667 29.630 5.14 0.00 0.00 2.24
6743 7441 8.220755 TGAACAAAAACTAGATGCAACTAACT 57.779 30.769 5.14 0.00 0.00 2.24
6744 7442 8.342634 TCTGAACAAAAACTAGATGCAACTAAC 58.657 33.333 5.14 0.00 0.00 2.34
6745 7443 8.445275 TCTGAACAAAAACTAGATGCAACTAA 57.555 30.769 5.14 0.00 0.00 2.24
6746 7444 8.445275 TTCTGAACAAAAACTAGATGCAACTA 57.555 30.769 3.46 3.46 0.00 2.24
6747 7445 6.942532 TCTGAACAAAAACTAGATGCAACT 57.057 33.333 0.86 0.86 0.00 3.16
6748 7446 7.043391 GGTTTCTGAACAAAAACTAGATGCAAC 60.043 37.037 0.00 0.00 37.51 4.17
6749 7447 6.978080 GGTTTCTGAACAAAAACTAGATGCAA 59.022 34.615 0.00 0.00 37.51 4.08
6750 7448 6.096141 TGGTTTCTGAACAAAAACTAGATGCA 59.904 34.615 0.00 0.00 37.51 3.96
6751 7449 6.503524 TGGTTTCTGAACAAAAACTAGATGC 58.496 36.000 0.00 0.00 37.51 3.91
6752 7450 8.807581 GTTTGGTTTCTGAACAAAAACTAGATG 58.192 33.333 0.00 0.00 39.68 2.90
6753 7451 7.979537 GGTTTGGTTTCTGAACAAAAACTAGAT 59.020 33.333 15.08 0.00 41.30 1.98
6754 7452 7.317390 GGTTTGGTTTCTGAACAAAAACTAGA 58.683 34.615 15.08 0.00 41.30 2.43
6755 7453 7.520119 GGTTTGGTTTCTGAACAAAAACTAG 57.480 36.000 15.08 0.00 41.30 2.57
6757 7455 6.109156 AGGTTTGGTTTCTGAACAAAAACT 57.891 33.333 15.08 4.31 46.89 2.66
6758 7456 6.598525 CAAGGTTTGGTTTCTGAACAAAAAC 58.401 36.000 7.49 9.05 43.69 2.43
6759 7457 5.180304 GCAAGGTTTGGTTTCTGAACAAAAA 59.820 36.000 7.49 0.00 39.68 1.94
6760 7458 4.693095 GCAAGGTTTGGTTTCTGAACAAAA 59.307 37.500 7.49 0.03 36.55 2.44
6761 7459 4.020662 AGCAAGGTTTGGTTTCTGAACAAA 60.021 37.500 3.00 3.00 38.40 2.83
6762 7460 3.513515 AGCAAGGTTTGGTTTCTGAACAA 59.486 39.130 0.00 0.00 38.40 2.83
6763 7461 3.096092 AGCAAGGTTTGGTTTCTGAACA 58.904 40.909 0.00 0.00 38.40 3.18
6764 7462 3.801114 AGCAAGGTTTGGTTTCTGAAC 57.199 42.857 0.00 0.00 38.40 3.18
6765 7463 6.478512 AATTAGCAAGGTTTGGTTTCTGAA 57.521 33.333 0.00 0.00 42.20 3.02
6766 7464 6.279882 CAAATTAGCAAGGTTTGGTTTCTGA 58.720 36.000 0.00 0.00 42.20 3.27
6767 7465 5.466393 CCAAATTAGCAAGGTTTGGTTTCTG 59.534 40.000 12.17 0.00 44.23 3.02
6768 7466 5.610398 CCAAATTAGCAAGGTTTGGTTTCT 58.390 37.500 12.17 0.00 44.23 2.52
6769 7467 5.922739 CCAAATTAGCAAGGTTTGGTTTC 57.077 39.130 12.17 0.00 44.23 2.78
6774 7472 4.559153 CTGGTCCAAATTAGCAAGGTTTG 58.441 43.478 0.00 0.00 33.72 2.93
6775 7473 3.578282 CCTGGTCCAAATTAGCAAGGTTT 59.422 43.478 0.00 0.00 0.00 3.27
6776 7474 3.165071 CCTGGTCCAAATTAGCAAGGTT 58.835 45.455 0.00 0.00 0.00 3.50
6777 7475 2.110011 ACCTGGTCCAAATTAGCAAGGT 59.890 45.455 0.00 0.00 0.00 3.50
6778 7476 2.807676 ACCTGGTCCAAATTAGCAAGG 58.192 47.619 0.00 0.00 0.00 3.61
6779 7477 4.524328 AGAAACCTGGTCCAAATTAGCAAG 59.476 41.667 0.00 0.00 0.00 4.01
6780 7478 4.479158 AGAAACCTGGTCCAAATTAGCAA 58.521 39.130 0.00 0.00 0.00 3.91
6781 7479 4.112634 AGAAACCTGGTCCAAATTAGCA 57.887 40.909 0.00 0.00 0.00 3.49
6782 7480 5.468540 AAAGAAACCTGGTCCAAATTAGC 57.531 39.130 0.00 0.00 0.00 3.09
6784 7482 9.250246 CCTATAAAAGAAACCTGGTCCAAATTA 57.750 33.333 0.00 0.00 0.00 1.40
6785 7483 7.180229 CCCTATAAAAGAAACCTGGTCCAAATT 59.820 37.037 0.00 0.00 0.00 1.82
6786 7484 6.667848 CCCTATAAAAGAAACCTGGTCCAAAT 59.332 38.462 0.00 0.00 0.00 2.32
6787 7485 6.014012 CCCTATAAAAGAAACCTGGTCCAAA 58.986 40.000 0.00 0.00 0.00 3.28
6788 7486 5.517655 CCCCTATAAAAGAAACCTGGTCCAA 60.518 44.000 0.00 0.00 0.00 3.53
6789 7487 4.017867 CCCCTATAAAAGAAACCTGGTCCA 60.018 45.833 0.00 0.00 0.00 4.02
6790 7488 4.228895 TCCCCTATAAAAGAAACCTGGTCC 59.771 45.833 0.00 0.00 0.00 4.46
6791 7489 5.446260 TCCCCTATAAAAGAAACCTGGTC 57.554 43.478 0.00 0.00 0.00 4.02
6792 7490 7.533923 TTATCCCCTATAAAAGAAACCTGGT 57.466 36.000 0.00 0.00 0.00 4.00
6793 7491 8.832458 TTTTATCCCCTATAAAAGAAACCTGG 57.168 34.615 0.00 0.00 42.46 4.45
6839 7537 9.777297 AAACTTTGCAAATATGACCAAGTTTAT 57.223 25.926 13.23 0.00 37.11 1.40
6840 7538 9.039870 CAAACTTTGCAAATATGACCAAGTTTA 57.960 29.630 13.23 0.00 36.96 2.01
6841 7539 7.012232 CCAAACTTTGCAAATATGACCAAGTTT 59.988 33.333 13.23 12.57 38.07 2.66
6842 7540 6.482973 CCAAACTTTGCAAATATGACCAAGTT 59.517 34.615 13.23 6.93 33.87 2.66
6843 7541 5.990996 CCAAACTTTGCAAATATGACCAAGT 59.009 36.000 13.23 0.12 0.00 3.16
6844 7542 5.106987 GCCAAACTTTGCAAATATGACCAAG 60.107 40.000 13.23 0.00 0.00 3.61
6845 7543 4.754114 GCCAAACTTTGCAAATATGACCAA 59.246 37.500 13.23 0.00 0.00 3.67
6846 7544 4.040217 AGCCAAACTTTGCAAATATGACCA 59.960 37.500 13.23 0.00 0.00 4.02
6847 7545 4.568956 AGCCAAACTTTGCAAATATGACC 58.431 39.130 13.23 6.85 0.00 4.02
6848 7546 5.106987 CCAAGCCAAACTTTGCAAATATGAC 60.107 40.000 13.23 4.91 36.04 3.06
6849 7547 4.996122 CCAAGCCAAACTTTGCAAATATGA 59.004 37.500 13.23 0.00 36.04 2.15
6850 7548 4.154556 CCCAAGCCAAACTTTGCAAATATG 59.845 41.667 13.23 11.49 36.04 1.78
6851 7549 4.041444 TCCCAAGCCAAACTTTGCAAATAT 59.959 37.500 13.23 0.90 36.04 1.28
6852 7550 3.389329 TCCCAAGCCAAACTTTGCAAATA 59.611 39.130 13.23 0.00 36.04 1.40
6853 7551 2.172293 TCCCAAGCCAAACTTTGCAAAT 59.828 40.909 13.23 0.00 36.04 2.32
6854 7552 1.556911 TCCCAAGCCAAACTTTGCAAA 59.443 42.857 12.14 12.14 36.04 3.68
6855 7553 1.198713 TCCCAAGCCAAACTTTGCAA 58.801 45.000 0.00 0.00 36.04 4.08
6856 7554 1.422531 ATCCCAAGCCAAACTTTGCA 58.577 45.000 0.00 0.00 36.04 4.08
6857 7555 2.145536 CAATCCCAAGCCAAACTTTGC 58.854 47.619 0.00 0.00 36.04 3.68
6858 7556 2.145536 GCAATCCCAAGCCAAACTTTG 58.854 47.619 0.00 0.00 36.04 2.77
6859 7557 1.270252 CGCAATCCCAAGCCAAACTTT 60.270 47.619 0.00 0.00 36.04 2.66
6860 7558 0.318120 CGCAATCCCAAGCCAAACTT 59.682 50.000 0.00 0.00 40.05 2.66
6861 7559 0.827507 ACGCAATCCCAAGCCAAACT 60.828 50.000 0.00 0.00 0.00 2.66
6862 7560 0.667184 CACGCAATCCCAAGCCAAAC 60.667 55.000 0.00 0.00 0.00 2.93
6863 7561 1.664873 CACGCAATCCCAAGCCAAA 59.335 52.632 0.00 0.00 0.00 3.28
6864 7562 2.274645 CCACGCAATCCCAAGCCAA 61.275 57.895 0.00 0.00 0.00 4.52
6865 7563 2.676121 CCACGCAATCCCAAGCCA 60.676 61.111 0.00 0.00 0.00 4.75
6866 7564 2.212900 GAACCACGCAATCCCAAGCC 62.213 60.000 0.00 0.00 0.00 4.35
6867 7565 1.212751 GAACCACGCAATCCCAAGC 59.787 57.895 0.00 0.00 0.00 4.01
6868 7566 0.523072 CAGAACCACGCAATCCCAAG 59.477 55.000 0.00 0.00 0.00 3.61
6869 7567 0.109532 TCAGAACCACGCAATCCCAA 59.890 50.000 0.00 0.00 0.00 4.12
6870 7568 0.321564 CTCAGAACCACGCAATCCCA 60.322 55.000 0.00 0.00 0.00 4.37
6871 7569 0.321653 ACTCAGAACCACGCAATCCC 60.322 55.000 0.00 0.00 0.00 3.85
6872 7570 2.000447 GTACTCAGAACCACGCAATCC 59.000 52.381 0.00 0.00 0.00 3.01
6873 7571 2.412089 GTGTACTCAGAACCACGCAATC 59.588 50.000 0.00 0.00 0.00 2.67
6874 7572 2.037251 AGTGTACTCAGAACCACGCAAT 59.963 45.455 0.00 0.00 33.14 3.56
6875 7573 1.411246 AGTGTACTCAGAACCACGCAA 59.589 47.619 0.00 0.00 33.14 4.85
6876 7574 1.037493 AGTGTACTCAGAACCACGCA 58.963 50.000 0.00 0.00 33.14 5.24
6877 7575 2.228343 ACTAGTGTACTCAGAACCACGC 59.772 50.000 0.00 0.00 33.14 5.34
6878 7576 4.500603 AACTAGTGTACTCAGAACCACG 57.499 45.455 0.00 0.00 33.14 4.94
6879 7577 7.205297 TGTAAAACTAGTGTACTCAGAACCAC 58.795 38.462 14.77 0.00 0.00 4.16
6880 7578 7.350744 TGTAAAACTAGTGTACTCAGAACCA 57.649 36.000 14.77 0.00 0.00 3.67
6881 7579 8.652810 TTTGTAAAACTAGTGTACTCAGAACC 57.347 34.615 14.77 0.00 0.00 3.62
6882 7580 8.274248 GCTTTGTAAAACTAGTGTACTCAGAAC 58.726 37.037 14.77 0.00 0.00 3.01
6883 7581 8.202137 AGCTTTGTAAAACTAGTGTACTCAGAA 58.798 33.333 14.77 2.65 0.00 3.02
6884 7582 7.723324 AGCTTTGTAAAACTAGTGTACTCAGA 58.277 34.615 14.77 0.00 0.00 3.27
6885 7583 7.116519 GGAGCTTTGTAAAACTAGTGTACTCAG 59.883 40.741 14.77 11.84 0.00 3.35
6886 7584 6.927381 GGAGCTTTGTAAAACTAGTGTACTCA 59.073 38.462 14.77 1.15 0.00 3.41
6887 7585 6.927381 TGGAGCTTTGTAAAACTAGTGTACTC 59.073 38.462 14.77 6.59 0.00 2.59
6888 7586 6.823497 TGGAGCTTTGTAAAACTAGTGTACT 58.177 36.000 14.77 0.00 0.00 2.73
6889 7587 7.486802 TTGGAGCTTTGTAAAACTAGTGTAC 57.513 36.000 0.00 3.05 0.00 2.90
6890 7588 8.508883 TTTTGGAGCTTTGTAAAACTAGTGTA 57.491 30.769 0.00 0.00 0.00 2.90
6891 7589 7.399245 TTTTGGAGCTTTGTAAAACTAGTGT 57.601 32.000 0.00 0.00 0.00 3.55
6892 7590 7.222031 GGTTTTTGGAGCTTTGTAAAACTAGTG 59.778 37.037 18.40 0.00 38.25 2.74
6893 7591 7.093684 TGGTTTTTGGAGCTTTGTAAAACTAGT 60.094 33.333 18.40 0.00 38.25 2.57
6894 7592 7.262048 TGGTTTTTGGAGCTTTGTAAAACTAG 58.738 34.615 18.40 0.00 38.25 2.57
6895 7593 7.171630 TGGTTTTTGGAGCTTTGTAAAACTA 57.828 32.000 18.40 13.67 38.25 2.24
6896 7594 6.043854 TGGTTTTTGGAGCTTTGTAAAACT 57.956 33.333 18.40 0.00 38.25 2.66
6897 7595 6.729391 TTGGTTTTTGGAGCTTTGTAAAAC 57.271 33.333 14.11 14.11 37.75 2.43
6898 7596 7.445707 AGTTTTGGTTTTTGGAGCTTTGTAAAA 59.554 29.630 0.00 0.00 0.00 1.52
6899 7597 6.937465 AGTTTTGGTTTTTGGAGCTTTGTAAA 59.063 30.769 0.00 0.00 0.00 2.01
6900 7598 6.468543 AGTTTTGGTTTTTGGAGCTTTGTAA 58.531 32.000 0.00 0.00 0.00 2.41
6901 7599 6.043854 AGTTTTGGTTTTTGGAGCTTTGTA 57.956 33.333 0.00 0.00 0.00 2.41
6902 7600 4.905429 AGTTTTGGTTTTTGGAGCTTTGT 58.095 34.783 0.00 0.00 0.00 2.83
6903 7601 5.445806 CGAAGTTTTGGTTTTTGGAGCTTTG 60.446 40.000 0.00 0.00 0.00 2.77
6904 7602 4.629634 CGAAGTTTTGGTTTTTGGAGCTTT 59.370 37.500 0.00 0.00 0.00 3.51
6905 7603 4.081917 TCGAAGTTTTGGTTTTTGGAGCTT 60.082 37.500 0.00 0.00 0.00 3.74
6906 7604 3.445805 TCGAAGTTTTGGTTTTTGGAGCT 59.554 39.130 0.00 0.00 0.00 4.09
6907 7605 3.776340 TCGAAGTTTTGGTTTTTGGAGC 58.224 40.909 0.00 0.00 0.00 4.70
6908 7606 6.713792 TTTTCGAAGTTTTGGTTTTTGGAG 57.286 33.333 0.00 0.00 0.00 3.86
6909 7607 7.278203 GGTATTTTCGAAGTTTTGGTTTTTGGA 59.722 33.333 0.00 0.00 0.00 3.53
6910 7608 7.279090 AGGTATTTTCGAAGTTTTGGTTTTTGG 59.721 33.333 0.00 0.00 0.00 3.28
6911 7609 8.192068 AGGTATTTTCGAAGTTTTGGTTTTTG 57.808 30.769 0.00 0.00 0.00 2.44
6912 7610 8.780846 AAGGTATTTTCGAAGTTTTGGTTTTT 57.219 26.923 0.00 0.00 0.00 1.94
6913 7611 7.493320 GGAAGGTATTTTCGAAGTTTTGGTTTT 59.507 33.333 0.00 0.00 0.00 2.43
6914 7612 6.982141 GGAAGGTATTTTCGAAGTTTTGGTTT 59.018 34.615 0.00 0.00 0.00 3.27
6915 7613 6.097129 TGGAAGGTATTTTCGAAGTTTTGGTT 59.903 34.615 0.00 0.00 0.00 3.67
6916 7614 5.595133 TGGAAGGTATTTTCGAAGTTTTGGT 59.405 36.000 0.00 0.00 0.00 3.67
6917 7615 6.079424 TGGAAGGTATTTTCGAAGTTTTGG 57.921 37.500 0.00 0.00 0.00 3.28
6918 7616 7.538678 CAGATGGAAGGTATTTTCGAAGTTTTG 59.461 37.037 0.00 0.00 0.00 2.44
6919 7617 7.309194 CCAGATGGAAGGTATTTTCGAAGTTTT 60.309 37.037 0.00 0.00 37.39 2.43
6920 7618 6.151144 CCAGATGGAAGGTATTTTCGAAGTTT 59.849 38.462 0.00 0.00 37.39 2.66
6921 7619 5.648092 CCAGATGGAAGGTATTTTCGAAGTT 59.352 40.000 0.00 0.00 37.39 2.66
6922 7620 5.186198 CCAGATGGAAGGTATTTTCGAAGT 58.814 41.667 0.00 0.00 37.39 3.01
6923 7621 5.186198 ACCAGATGGAAGGTATTTTCGAAG 58.814 41.667 5.72 0.00 36.07 3.79
6924 7622 5.174037 ACCAGATGGAAGGTATTTTCGAA 57.826 39.130 5.72 0.00 36.07 3.71
6925 7623 4.837093 ACCAGATGGAAGGTATTTTCGA 57.163 40.909 5.72 0.00 36.07 3.71
6926 7624 5.414454 TGAAACCAGATGGAAGGTATTTTCG 59.586 40.000 5.72 0.00 37.07 3.46
6927 7625 6.621613 GTGAAACCAGATGGAAGGTATTTTC 58.378 40.000 5.72 4.17 37.07 2.29
6928 7626 5.183140 CGTGAAACCAGATGGAAGGTATTTT 59.817 40.000 5.72 0.00 37.07 1.82
6929 7627 4.700213 CGTGAAACCAGATGGAAGGTATTT 59.300 41.667 5.72 0.00 37.07 1.40
6930 7628 4.261801 CGTGAAACCAGATGGAAGGTATT 58.738 43.478 5.72 0.00 37.07 1.89
6931 7629 3.370527 CCGTGAAACCAGATGGAAGGTAT 60.371 47.826 5.72 0.00 37.07 2.73
6932 7630 2.027561 CCGTGAAACCAGATGGAAGGTA 60.028 50.000 5.72 0.00 37.07 3.08
6933 7631 1.271379 CCGTGAAACCAGATGGAAGGT 60.271 52.381 5.72 0.00 40.61 3.50
6934 7632 1.271379 ACCGTGAAACCAGATGGAAGG 60.271 52.381 5.72 0.00 38.94 3.46
6935 7633 2.185004 ACCGTGAAACCAGATGGAAG 57.815 50.000 5.72 0.00 38.94 3.46
6936 7634 2.105821 AGAACCGTGAAACCAGATGGAA 59.894 45.455 5.72 0.00 38.94 3.53
6937 7635 1.697432 AGAACCGTGAAACCAGATGGA 59.303 47.619 5.72 0.00 38.94 3.41
6938 7636 1.806542 CAGAACCGTGAAACCAGATGG 59.193 52.381 0.00 0.00 42.17 3.51
6939 7637 2.738846 CTCAGAACCGTGAAACCAGATG 59.261 50.000 0.00 0.00 0.00 2.90
6940 7638 2.368875 ACTCAGAACCGTGAAACCAGAT 59.631 45.455 0.00 0.00 0.00 2.90
6941 7639 1.760613 ACTCAGAACCGTGAAACCAGA 59.239 47.619 0.00 0.00 0.00 3.86
6942 7640 2.240493 ACTCAGAACCGTGAAACCAG 57.760 50.000 0.00 0.00 0.00 4.00
6943 7641 2.431419 TGTACTCAGAACCGTGAAACCA 59.569 45.455 0.00 0.00 0.00 3.67
6944 7642 3.057734 CTGTACTCAGAACCGTGAAACC 58.942 50.000 0.00 0.00 43.76 3.27
6945 7643 3.714391 ACTGTACTCAGAACCGTGAAAC 58.286 45.455 2.17 0.00 43.76 2.78
6946 7644 4.395959 AACTGTACTCAGAACCGTGAAA 57.604 40.909 2.17 0.00 43.76 2.69
6947 7645 4.395959 AAACTGTACTCAGAACCGTGAA 57.604 40.909 2.17 0.00 43.76 3.18
6948 7646 4.395959 AAAACTGTACTCAGAACCGTGA 57.604 40.909 2.17 0.00 43.76 4.35
6968 7666 6.148150 CCACGCAATACCTACTTCTACAAAAA 59.852 38.462 0.00 0.00 0.00 1.94
6969 7667 5.640357 CCACGCAATACCTACTTCTACAAAA 59.360 40.000 0.00 0.00 0.00 2.44
6970 7668 5.172934 CCACGCAATACCTACTTCTACAAA 58.827 41.667 0.00 0.00 0.00 2.83
6971 7669 4.751060 CCACGCAATACCTACTTCTACAA 58.249 43.478 0.00 0.00 0.00 2.41
6972 7670 3.429822 GCCACGCAATACCTACTTCTACA 60.430 47.826 0.00 0.00 0.00 2.74
6973 7671 3.121544 GCCACGCAATACCTACTTCTAC 58.878 50.000 0.00 0.00 0.00 2.59
6974 7672 2.761767 TGCCACGCAATACCTACTTCTA 59.238 45.455 0.00 0.00 34.76 2.10
6975 7673 1.553248 TGCCACGCAATACCTACTTCT 59.447 47.619 0.00 0.00 34.76 2.85
6976 7674 2.018542 TGCCACGCAATACCTACTTC 57.981 50.000 0.00 0.00 34.76 3.01
6977 7675 2.483014 TTGCCACGCAATACCTACTT 57.517 45.000 0.00 0.00 43.99 2.24
6987 7685 1.028130 TTGATTCACTTTGCCACGCA 58.972 45.000 0.00 0.00 36.47 5.24
6988 7686 2.053627 CTTTGATTCACTTTGCCACGC 58.946 47.619 0.00 0.00 0.00 5.34
6989 7687 3.354089 ACTTTGATTCACTTTGCCACG 57.646 42.857 0.00 0.00 0.00 4.94
6990 7688 5.175673 GCTTAACTTTGATTCACTTTGCCAC 59.824 40.000 0.00 0.00 0.00 5.01
6991 7689 5.288804 GCTTAACTTTGATTCACTTTGCCA 58.711 37.500 0.00 0.00 0.00 4.92
6992 7690 4.686091 GGCTTAACTTTGATTCACTTTGCC 59.314 41.667 0.00 0.00 0.00 4.52
6993 7691 5.288804 TGGCTTAACTTTGATTCACTTTGC 58.711 37.500 0.00 0.00 0.00 3.68
6994 7692 6.421801 CCTTGGCTTAACTTTGATTCACTTTG 59.578 38.462 0.00 0.00 0.00 2.77
6995 7693 6.323739 TCCTTGGCTTAACTTTGATTCACTTT 59.676 34.615 0.00 0.00 0.00 2.66
6996 7694 5.833131 TCCTTGGCTTAACTTTGATTCACTT 59.167 36.000 0.00 0.00 0.00 3.16
6997 7695 5.385198 TCCTTGGCTTAACTTTGATTCACT 58.615 37.500 0.00 0.00 0.00 3.41
6998 7696 5.705609 TCCTTGGCTTAACTTTGATTCAC 57.294 39.130 0.00 0.00 0.00 3.18
6999 7697 6.916360 ATTCCTTGGCTTAACTTTGATTCA 57.084 33.333 0.00 0.00 0.00 2.57
7000 7698 7.976175 CCTAATTCCTTGGCTTAACTTTGATTC 59.024 37.037 0.00 0.00 0.00 2.52
7001 7699 7.673926 TCCTAATTCCTTGGCTTAACTTTGATT 59.326 33.333 0.00 0.00 0.00 2.57
7002 7700 7.122799 GTCCTAATTCCTTGGCTTAACTTTGAT 59.877 37.037 0.00 0.00 0.00 2.57
7003 7701 6.433093 GTCCTAATTCCTTGGCTTAACTTTGA 59.567 38.462 0.00 0.00 0.00 2.69
7004 7702 6.350194 GGTCCTAATTCCTTGGCTTAACTTTG 60.350 42.308 0.00 0.00 0.00 2.77
7005 7703 5.715279 GGTCCTAATTCCTTGGCTTAACTTT 59.285 40.000 0.00 0.00 0.00 2.66
7006 7704 5.015284 AGGTCCTAATTCCTTGGCTTAACTT 59.985 40.000 0.00 0.00 0.00 2.66
7007 7705 4.540502 AGGTCCTAATTCCTTGGCTTAACT 59.459 41.667 0.00 0.00 0.00 2.24
7008 7706 4.856509 AGGTCCTAATTCCTTGGCTTAAC 58.143 43.478 0.00 0.00 0.00 2.01
7009 7707 6.841781 ATAGGTCCTAATTCCTTGGCTTAA 57.158 37.500 1.78 0.00 35.51 1.85
7010 7708 6.841781 AATAGGTCCTAATTCCTTGGCTTA 57.158 37.500 1.78 0.00 35.51 3.09
7011 7709 5.734031 AATAGGTCCTAATTCCTTGGCTT 57.266 39.130 1.78 0.00 35.51 4.35
7012 7710 5.044105 ACAAATAGGTCCTAATTCCTTGGCT 60.044 40.000 1.78 0.00 35.51 4.75
7013 7711 5.201243 ACAAATAGGTCCTAATTCCTTGGC 58.799 41.667 1.78 0.00 35.51 4.52
7014 7712 7.615757 AGAAACAAATAGGTCCTAATTCCTTGG 59.384 37.037 1.78 0.00 35.51 3.61
7015 7713 8.462016 CAGAAACAAATAGGTCCTAATTCCTTG 58.538 37.037 1.78 4.93 35.51 3.61
7016 7714 8.390921 TCAGAAACAAATAGGTCCTAATTCCTT 58.609 33.333 1.78 0.00 35.51 3.36
7017 7715 7.928873 TCAGAAACAAATAGGTCCTAATTCCT 58.071 34.615 1.78 0.00 37.80 3.36
7018 7716 8.753497 ATCAGAAACAAATAGGTCCTAATTCC 57.247 34.615 1.78 0.00 0.00 3.01
7022 7720 9.362151 ACAAAATCAGAAACAAATAGGTCCTAA 57.638 29.630 1.78 0.00 0.00 2.69
7023 7721 8.934023 ACAAAATCAGAAACAAATAGGTCCTA 57.066 30.769 0.00 0.00 0.00 2.94
7024 7722 7.839680 ACAAAATCAGAAACAAATAGGTCCT 57.160 32.000 0.00 0.00 0.00 3.85
7025 7723 7.755373 GCTACAAAATCAGAAACAAATAGGTCC 59.245 37.037 0.00 0.00 0.00 4.46
7026 7724 7.755373 GGCTACAAAATCAGAAACAAATAGGTC 59.245 37.037 0.00 0.00 0.00 3.85
7027 7725 7.451566 AGGCTACAAAATCAGAAACAAATAGGT 59.548 33.333 0.00 0.00 0.00 3.08
7028 7726 7.830739 AGGCTACAAAATCAGAAACAAATAGG 58.169 34.615 0.00 0.00 0.00 2.57
7029 7727 9.346725 GAAGGCTACAAAATCAGAAACAAATAG 57.653 33.333 0.00 0.00 0.00 1.73
7030 7728 9.077885 AGAAGGCTACAAAATCAGAAACAAATA 57.922 29.630 0.00 0.00 0.00 1.40
7031 7729 7.955918 AGAAGGCTACAAAATCAGAAACAAAT 58.044 30.769 0.00 0.00 0.00 2.32
7032 7730 7.068103 TGAGAAGGCTACAAAATCAGAAACAAA 59.932 33.333 0.00 0.00 0.00 2.83
7033 7731 6.545666 TGAGAAGGCTACAAAATCAGAAACAA 59.454 34.615 0.00 0.00 0.00 2.83
7034 7732 6.061441 TGAGAAGGCTACAAAATCAGAAACA 58.939 36.000 0.00 0.00 0.00 2.83
7035 7733 6.560253 TGAGAAGGCTACAAAATCAGAAAC 57.440 37.500 0.00 0.00 0.00 2.78
7036 7734 7.765695 AATGAGAAGGCTACAAAATCAGAAA 57.234 32.000 0.00 0.00 0.00 2.52
7037 7735 7.765695 AAATGAGAAGGCTACAAAATCAGAA 57.234 32.000 0.00 0.00 0.00 3.02
7038 7736 7.309377 CCAAAATGAGAAGGCTACAAAATCAGA 60.309 37.037 0.00 0.00 0.00 3.27
7039 7737 6.810182 CCAAAATGAGAAGGCTACAAAATCAG 59.190 38.462 0.00 0.00 0.00 2.90
7040 7738 6.267471 ACCAAAATGAGAAGGCTACAAAATCA 59.733 34.615 0.00 0.00 0.00 2.57
7041 7739 6.691508 ACCAAAATGAGAAGGCTACAAAATC 58.308 36.000 0.00 0.00 0.00 2.17
7042 7740 6.267471 TGACCAAAATGAGAAGGCTACAAAAT 59.733 34.615 0.00 0.00 0.00 1.82
7043 7741 5.596361 TGACCAAAATGAGAAGGCTACAAAA 59.404 36.000 0.00 0.00 0.00 2.44
7044 7742 5.136828 TGACCAAAATGAGAAGGCTACAAA 58.863 37.500 0.00 0.00 0.00 2.83
7045 7743 4.724399 TGACCAAAATGAGAAGGCTACAA 58.276 39.130 0.00 0.00 0.00 2.41
7046 7744 4.365514 TGACCAAAATGAGAAGGCTACA 57.634 40.909 0.00 0.00 0.00 2.74
7047 7745 5.705609 TTTGACCAAAATGAGAAGGCTAC 57.294 39.130 0.00 0.00 0.00 3.58
7048 7746 6.916360 ATTTTGACCAAAATGAGAAGGCTA 57.084 33.333 17.04 0.00 45.99 3.93
7049 7747 5.813513 ATTTTGACCAAAATGAGAAGGCT 57.186 34.783 17.04 0.00 45.99 4.58
7059 7757 7.725251 AGAGCTTTATGACATTTTGACCAAAA 58.275 30.769 9.94 9.94 43.48 2.44
7060 7758 7.288810 AGAGCTTTATGACATTTTGACCAAA 57.711 32.000 0.00 0.00 0.00 3.28
7061 7759 6.899393 AGAGCTTTATGACATTTTGACCAA 57.101 33.333 0.00 0.00 0.00 3.67
7062 7760 6.899393 AAGAGCTTTATGACATTTTGACCA 57.101 33.333 0.00 0.00 0.00 4.02
7063 7761 9.860898 ATTTAAGAGCTTTATGACATTTTGACC 57.139 29.630 0.00 0.00 0.00 4.02
7069 7767 8.624776 GCACCTATTTAAGAGCTTTATGACATT 58.375 33.333 0.00 0.00 0.00 2.71
7070 7768 7.995488 AGCACCTATTTAAGAGCTTTATGACAT 59.005 33.333 0.00 0.00 34.09 3.06
7071 7769 7.338710 AGCACCTATTTAAGAGCTTTATGACA 58.661 34.615 0.00 0.00 34.09 3.58
7072 7770 7.793927 AGCACCTATTTAAGAGCTTTATGAC 57.206 36.000 0.00 0.00 34.09 3.06
7073 7771 8.807948 AAAGCACCTATTTAAGAGCTTTATGA 57.192 30.769 8.27 0.00 45.91 2.15
7074 7772 9.294030 CAAAAGCACCTATTTAAGAGCTTTATG 57.706 33.333 10.16 7.65 46.47 1.90
7075 7773 8.470002 CCAAAAGCACCTATTTAAGAGCTTTAT 58.530 33.333 10.16 0.24 46.47 1.40
7076 7774 7.668052 TCCAAAAGCACCTATTTAAGAGCTTTA 59.332 33.333 10.16 0.00 46.47 1.85
7078 7776 6.010219 TCCAAAAGCACCTATTTAAGAGCTT 58.990 36.000 0.00 0.00 43.66 3.74
7079 7777 5.570320 TCCAAAAGCACCTATTTAAGAGCT 58.430 37.500 0.00 0.00 37.80 4.09
7080 7778 5.884771 CTCCAAAAGCACCTATTTAAGAGC 58.115 41.667 0.00 0.00 0.00 4.09
7095 7793 3.575965 ACGGCATAAAAGCTCCAAAAG 57.424 42.857 0.00 0.00 34.17 2.27
7096 7794 4.054671 CAAACGGCATAAAAGCTCCAAAA 58.945 39.130 0.00 0.00 34.17 2.44
7097 7795 3.319405 TCAAACGGCATAAAAGCTCCAAA 59.681 39.130 0.00 0.00 34.17 3.28
7098 7796 2.887783 TCAAACGGCATAAAAGCTCCAA 59.112 40.909 0.00 0.00 34.17 3.53
7099 7797 2.509569 TCAAACGGCATAAAAGCTCCA 58.490 42.857 0.00 0.00 34.17 3.86
7100 7798 3.128589 TCATCAAACGGCATAAAAGCTCC 59.871 43.478 0.00 0.00 34.17 4.70
7101 7799 4.355543 TCATCAAACGGCATAAAAGCTC 57.644 40.909 0.00 0.00 34.17 4.09
7102 7800 4.380867 CCTTCATCAAACGGCATAAAAGCT 60.381 41.667 0.00 0.00 34.17 3.74
7103 7801 3.859386 CCTTCATCAAACGGCATAAAAGC 59.141 43.478 0.00 0.00 0.00 3.51
7104 7802 5.123820 TCTCCTTCATCAAACGGCATAAAAG 59.876 40.000 0.00 0.00 0.00 2.27
7105 7803 5.007034 TCTCCTTCATCAAACGGCATAAAA 58.993 37.500 0.00 0.00 0.00 1.52
7106 7804 4.584874 TCTCCTTCATCAAACGGCATAAA 58.415 39.130 0.00 0.00 0.00 1.40
7107 7805 4.214986 TCTCCTTCATCAAACGGCATAA 57.785 40.909 0.00 0.00 0.00 1.90
7108 7806 3.904800 TCTCCTTCATCAAACGGCATA 57.095 42.857 0.00 0.00 0.00 3.14
7109 7807 2.787473 TCTCCTTCATCAAACGGCAT 57.213 45.000 0.00 0.00 0.00 4.40
7110 7808 2.290260 ACATCTCCTTCATCAAACGGCA 60.290 45.455 0.00 0.00 0.00 5.69
7111 7809 2.096496 CACATCTCCTTCATCAAACGGC 59.904 50.000 0.00 0.00 0.00 5.68
7112 7810 2.096496 GCACATCTCCTTCATCAAACGG 59.904 50.000 0.00 0.00 0.00 4.44
7113 7811 2.096496 GGCACATCTCCTTCATCAAACG 59.904 50.000 0.00 0.00 0.00 3.60
7114 7812 3.128242 CAGGCACATCTCCTTCATCAAAC 59.872 47.826 0.00 0.00 0.00 2.93
7115 7813 3.245016 ACAGGCACATCTCCTTCATCAAA 60.245 43.478 0.00 0.00 0.00 2.69
7116 7814 2.306805 ACAGGCACATCTCCTTCATCAA 59.693 45.455 0.00 0.00 0.00 2.57
7117 7815 1.911357 ACAGGCACATCTCCTTCATCA 59.089 47.619 0.00 0.00 0.00 3.07
7118 7816 2.706339 ACAGGCACATCTCCTTCATC 57.294 50.000 0.00 0.00 0.00 2.92
7119 7817 3.087031 CAAACAGGCACATCTCCTTCAT 58.913 45.455 0.00 0.00 0.00 2.57
7120 7818 2.507484 CAAACAGGCACATCTCCTTCA 58.493 47.619 0.00 0.00 0.00 3.02
7121 7819 1.200948 GCAAACAGGCACATCTCCTTC 59.799 52.381 0.00 0.00 0.00 3.46
7122 7820 1.251251 GCAAACAGGCACATCTCCTT 58.749 50.000 0.00 0.00 0.00 3.36
7123 7821 0.957395 CGCAAACAGGCACATCTCCT 60.957 55.000 0.00 0.00 0.00 3.69
7124 7822 0.955428 TCGCAAACAGGCACATCTCC 60.955 55.000 0.00 0.00 0.00 3.71
7125 7823 0.445436 CTCGCAAACAGGCACATCTC 59.555 55.000 0.00 0.00 0.00 2.75
7126 7824 0.250467 ACTCGCAAACAGGCACATCT 60.250 50.000 0.00 0.00 0.00 2.90
7127 7825 0.593128 AACTCGCAAACAGGCACATC 59.407 50.000 0.00 0.00 0.00 3.06
7128 7826 1.890876 TAACTCGCAAACAGGCACAT 58.109 45.000 0.00 0.00 0.00 3.21
7129 7827 1.804151 GATAACTCGCAAACAGGCACA 59.196 47.619 0.00 0.00 0.00 4.57
7130 7828 2.076863 AGATAACTCGCAAACAGGCAC 58.923 47.619 0.00 0.00 0.00 5.01
7131 7829 2.028112 AGAGATAACTCGCAAACAGGCA 60.028 45.455 0.00 0.00 46.64 4.75
7132 7830 2.605366 GAGAGATAACTCGCAAACAGGC 59.395 50.000 0.00 0.00 46.64 4.85
7133 7831 3.118956 AGGAGAGATAACTCGCAAACAGG 60.119 47.826 6.12 0.00 46.64 4.00
7134 7832 4.116747 AGGAGAGATAACTCGCAAACAG 57.883 45.455 6.12 0.00 46.64 3.16
7135 7833 5.654603 TTAGGAGAGATAACTCGCAAACA 57.345 39.130 6.12 0.00 46.64 2.83
7136 7834 5.867716 TGTTTAGGAGAGATAACTCGCAAAC 59.132 40.000 6.12 8.72 46.64 2.93
7137 7835 6.032956 TGTTTAGGAGAGATAACTCGCAAA 57.967 37.500 6.12 0.00 46.64 3.68
7138 7836 5.654603 TGTTTAGGAGAGATAACTCGCAA 57.345 39.130 6.12 0.00 46.64 4.85
7139 7837 5.654603 TTGTTTAGGAGAGATAACTCGCA 57.345 39.130 6.12 0.00 46.64 5.10
7140 7838 6.535508 ACAATTGTTTAGGAGAGATAACTCGC 59.464 38.462 4.92 0.00 46.64 5.03
7141 7839 7.976734 AGACAATTGTTTAGGAGAGATAACTCG 59.023 37.037 13.36 0.00 46.64 4.18
7142 7840 9.308318 GAGACAATTGTTTAGGAGAGATAACTC 57.692 37.037 13.36 5.57 42.90 3.01
7143 7841 9.041354 AGAGACAATTGTTTAGGAGAGATAACT 57.959 33.333 13.36 0.00 0.00 2.24
7144 7842 9.660180 AAGAGACAATTGTTTAGGAGAGATAAC 57.340 33.333 13.36 0.00 0.00 1.89
7145 7843 9.658799 CAAGAGACAATTGTTTAGGAGAGATAA 57.341 33.333 13.36 0.00 0.00 1.75
7146 7844 8.816894 ACAAGAGACAATTGTTTAGGAGAGATA 58.183 33.333 13.36 0.00