Multiple sequence alignment - TraesCS1A01G003900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G003900 chr1A 100.000 3998 0 0 1 3998 2390500 2394497 0.000000e+00 7384.0
1 TraesCS1A01G003900 chr1B 80.660 1334 226 19 985 2303 1953292 1954608 0.000000e+00 1005.0
2 TraesCS1A01G003900 chr1B 83.019 636 95 6 939 1567 1713055 1712426 7.500000e-157 564.0
3 TraesCS1A01G003900 chr1B 82.624 587 89 5 981 1564 2307790 2307214 1.280000e-139 507.0
4 TraesCS1A01G003900 chr1B 84.123 359 55 1 1191 1549 2109967 2109611 2.960000e-91 346.0
5 TraesCS1A01G003900 chr1B 93.651 63 3 1 213 274 565321424 565321486 4.250000e-15 93.5
6 TraesCS1A01G003900 chr3B 77.518 1112 213 25 984 2084 802595428 802596513 5.640000e-178 634.0
7 TraesCS1A01G003900 chr3B 84.601 526 75 5 1022 1544 815476540 815477062 5.920000e-143 518.0
8 TraesCS1A01G003900 chr3B 79.516 620 109 15 2465 3071 801306746 801307360 3.690000e-115 425.0
9 TraesCS1A01G003900 chr3B 82.310 407 62 9 2673 3071 802598588 802598992 1.060000e-90 344.0
10 TraesCS1A01G003900 chr3B 82.571 350 58 3 2596 2943 815477812 815478160 5.020000e-79 305.0
11 TraesCS1A01G003900 chr3B 92.647 68 4 1 208 274 494709454 494709387 3.290000e-16 97.1
12 TraesCS1A01G003900 chr3B 93.443 61 3 1 214 274 10958110 10958051 5.500000e-14 89.8
13 TraesCS1A01G003900 chr3B 89.286 56 3 1 3944 3996 789785813 789785758 2.580000e-07 67.6
14 TraesCS1A01G003900 chr3D 79.254 617 110 15 2468 3071 596669769 596669158 7.990000e-112 414.0
15 TraesCS1A01G003900 chr3D 98.413 63 1 0 97 159 58393026 58392964 1.170000e-20 111.0
16 TraesCS1A01G003900 chr2B 86.643 277 34 3 1278 1554 1395585 1395312 1.810000e-78 303.0
17 TraesCS1A01G003900 chr6A 98.742 159 2 0 1 159 79357681 79357523 2.350000e-72 283.0
18 TraesCS1A01G003900 chr6A 91.176 68 2 3 208 275 617098372 617098309 5.500000e-14 89.8
19 TraesCS1A01G003900 chr6A 90.566 53 2 1 3949 3998 584515488 584515436 2.580000e-07 67.6
20 TraesCS1A01G003900 chr7D 97.531 162 4 0 1 162 470201145 470201306 1.090000e-70 278.0
21 TraesCS1A01G003900 chr7D 92.453 159 4 1 1 159 470202772 470202922 1.870000e-53 220.0
22 TraesCS1A01G003900 chr7D 98.413 63 1 0 97 159 623545623 623545685 1.170000e-20 111.0
23 TraesCS1A01G003900 chr7D 96.825 63 2 0 97 159 511545431 511545493 5.460000e-19 106.0
24 TraesCS1A01G003900 chr7D 96.825 63 2 0 97 159 566218572 566218634 5.460000e-19 106.0
25 TraesCS1A01G003900 chr7D 94.828 58 3 0 213 270 3208611 3208554 1.530000e-14 91.6
26 TraesCS1A01G003900 chr7D 98.000 50 1 0 3949 3998 113730545 113730594 1.980000e-13 87.9
27 TraesCS1A01G003900 chr7D 98.000 50 1 0 3949 3998 602086267 602086316 1.980000e-13 87.9
28 TraesCS1A01G003900 chr7D 89.706 68 4 2 207 274 312976359 312976423 2.560000e-12 84.2
29 TraesCS1A01G003900 chr3A 80.926 367 52 14 2692 3040 737798997 737799363 1.420000e-69 274.0
30 TraesCS1A01G003900 chr3A 92.453 53 1 2 3949 3998 746366378 746366326 5.540000e-09 73.1
31 TraesCS1A01G003900 chr3A 92.157 51 1 2 3949 3996 722178104 722178054 7.170000e-08 69.4
32 TraesCS1A01G003900 chr5D 78.114 297 57 7 1226 1516 526428925 526428631 8.830000e-42 182.0
33 TraesCS1A01G003900 chr5D 92.063 63 4 1 213 274 298277487 298277425 1.980000e-13 87.9
34 TraesCS1A01G003900 chr5D 98.000 50 1 0 3949 3998 502145753 502145704 1.980000e-13 87.9
35 TraesCS1A01G003900 chr7B 73.518 506 118 12 1018 1515 747598811 747598314 1.140000e-40 178.0
36 TraesCS1A01G003900 chr2D 98.413 63 1 0 97 159 181600109 181600047 1.170000e-20 111.0
37 TraesCS1A01G003900 chr2D 98.000 50 1 0 3949 3998 64623236 64623187 1.980000e-13 87.9
38 TraesCS1A01G003900 chr4D 79.355 155 31 1 2728 2881 64362598 64362444 1.520000e-19 108.0
39 TraesCS1A01G003900 chr5B 96.364 55 1 1 214 268 338969828 338969881 5.500000e-14 89.8
40 TraesCS1A01G003900 chr5A 91.935 62 5 0 213 274 44932776 44932715 1.980000e-13 87.9
41 TraesCS1A01G003900 chr5A 90.566 53 2 2 3949 3998 681468559 681468507 2.580000e-07 67.6
42 TraesCS1A01G003900 chr5A 93.023 43 3 0 3449 3491 464198273 464198231 3.340000e-06 63.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G003900 chr1A 2390500 2394497 3997 False 7384.0 7384 100.000 1 3998 1 chr1A.!!$F1 3997
1 TraesCS1A01G003900 chr1B 1953292 1954608 1316 False 1005.0 1005 80.660 985 2303 1 chr1B.!!$F1 1318
2 TraesCS1A01G003900 chr1B 1712426 1713055 629 True 564.0 564 83.019 939 1567 1 chr1B.!!$R1 628
3 TraesCS1A01G003900 chr1B 2307214 2307790 576 True 507.0 507 82.624 981 1564 1 chr1B.!!$R3 583
4 TraesCS1A01G003900 chr3B 802595428 802598992 3564 False 489.0 634 79.914 984 3071 2 chr3B.!!$F2 2087
5 TraesCS1A01G003900 chr3B 801306746 801307360 614 False 425.0 425 79.516 2465 3071 1 chr3B.!!$F1 606
6 TraesCS1A01G003900 chr3B 815476540 815478160 1620 False 411.5 518 83.586 1022 2943 2 chr3B.!!$F3 1921
7 TraesCS1A01G003900 chr3D 596669158 596669769 611 True 414.0 414 79.254 2468 3071 1 chr3D.!!$R2 603
8 TraesCS1A01G003900 chr7D 470201145 470202922 1777 False 249.0 278 94.992 1 162 2 chr7D.!!$F7 161


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
937 1261 0.039618 GGGAAAAGGGACATCAGGCA 59.960 55.0 0.0 0.0 0.0 4.75 F
956 1280 0.108585 AAAGAAAGCTGCGGGAGTCA 59.891 50.0 0.0 0.0 0.0 3.41 F
2336 4657 0.032952 GCACCGACAACTCTACCACA 59.967 55.0 0.0 0.0 0.0 4.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2317 4638 0.032952 TGTGGTAGAGTTGTCGGTGC 59.967 55.0 0.00 0.0 0.0 5.01 R
2386 4707 0.034756 TGGCGCAACATGACAGTACT 59.965 50.0 10.83 0.0 0.0 2.73 R
3702 6198 0.030235 GGCAACGTTCACACTTTCCC 59.970 55.0 0.00 0.0 0.0 3.97 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
118 119 9.480053 CTAGTACTTGGACTACTACTAGACATC 57.520 40.741 0.00 0.00 40.22 3.06
121 122 6.491383 ACTTGGACTACTACTAGACATCCAA 58.509 40.000 0.00 13.99 41.31 3.53
168 169 6.325993 TGGATTATCCAACAATCTTCTCCA 57.674 37.500 12.08 0.00 45.00 3.86
169 170 6.359804 TGGATTATCCAACAATCTTCTCCAG 58.640 40.000 12.08 0.00 45.00 3.86
171 172 6.709846 GGATTATCCAACAATCTTCTCCAGAG 59.290 42.308 6.34 0.00 36.28 3.35
173 174 4.982241 TCCAACAATCTTCTCCAGAGTT 57.018 40.909 0.00 0.00 33.87 3.01
174 175 5.310409 TCCAACAATCTTCTCCAGAGTTT 57.690 39.130 0.00 0.00 33.87 2.66
175 176 6.433847 TCCAACAATCTTCTCCAGAGTTTA 57.566 37.500 0.00 0.00 33.87 2.01
176 177 7.020827 TCCAACAATCTTCTCCAGAGTTTAT 57.979 36.000 0.00 0.00 33.87 1.40
177 178 7.461749 TCCAACAATCTTCTCCAGAGTTTATT 58.538 34.615 0.00 0.00 33.87 1.40
178 179 7.944554 TCCAACAATCTTCTCCAGAGTTTATTT 59.055 33.333 0.00 0.00 33.87 1.40
179 180 8.025445 CCAACAATCTTCTCCAGAGTTTATTTG 58.975 37.037 0.00 0.00 33.87 2.32
180 181 8.571336 CAACAATCTTCTCCAGAGTTTATTTGT 58.429 33.333 0.00 0.00 33.87 2.83
181 182 8.697507 ACAATCTTCTCCAGAGTTTATTTGTT 57.302 30.769 0.00 0.00 33.87 2.83
182 183 8.787852 ACAATCTTCTCCAGAGTTTATTTGTTC 58.212 33.333 0.00 0.00 33.87 3.18
183 184 9.007901 CAATCTTCTCCAGAGTTTATTTGTTCT 57.992 33.333 0.00 0.00 33.87 3.01
185 186 9.883142 ATCTTCTCCAGAGTTTATTTGTTCTAG 57.117 33.333 0.00 0.00 33.87 2.43
186 187 8.871125 TCTTCTCCAGAGTTTATTTGTTCTAGT 58.129 33.333 0.00 0.00 0.00 2.57
187 188 9.495572 CTTCTCCAGAGTTTATTTGTTCTAGTT 57.504 33.333 0.00 0.00 0.00 2.24
188 189 8.833231 TCTCCAGAGTTTATTTGTTCTAGTTG 57.167 34.615 0.00 0.00 0.00 3.16
189 190 7.387948 TCTCCAGAGTTTATTTGTTCTAGTTGC 59.612 37.037 0.00 0.00 0.00 4.17
190 191 6.430000 TCCAGAGTTTATTTGTTCTAGTTGCC 59.570 38.462 0.00 0.00 0.00 4.52
191 192 6.431234 CCAGAGTTTATTTGTTCTAGTTGCCT 59.569 38.462 0.00 0.00 0.00 4.75
192 193 7.040409 CCAGAGTTTATTTGTTCTAGTTGCCTT 60.040 37.037 0.00 0.00 0.00 4.35
193 194 8.352942 CAGAGTTTATTTGTTCTAGTTGCCTTT 58.647 33.333 0.00 0.00 0.00 3.11
194 195 8.352942 AGAGTTTATTTGTTCTAGTTGCCTTTG 58.647 33.333 0.00 0.00 0.00 2.77
195 196 6.923508 AGTTTATTTGTTCTAGTTGCCTTTGC 59.076 34.615 0.00 0.00 38.26 3.68
207 208 2.170166 TGCCTTTGCAATCACCTTAGG 58.830 47.619 0.00 3.01 46.66 2.69
208 209 2.171003 GCCTTTGCAATCACCTTAGGT 58.829 47.619 11.67 0.00 37.47 3.08
209 210 3.245087 TGCCTTTGCAATCACCTTAGGTA 60.245 43.478 2.52 5.54 46.66 3.08
210 211 3.378427 GCCTTTGCAATCACCTTAGGTAG 59.622 47.826 2.52 0.00 37.47 3.18
211 212 5.699932 GCCTTTGCAATCACCTTAGGTAGG 61.700 50.000 2.52 5.89 43.20 3.18
243 244 3.009714 GGAGGATATCCCCCGGCC 61.010 72.222 18.56 8.54 43.01 6.13
244 245 2.122954 GAGGATATCCCCCGGCCT 59.877 66.667 18.56 0.00 36.42 5.19
245 246 1.990614 GAGGATATCCCCCGGCCTC 60.991 68.421 18.56 6.31 38.45 4.70
246 247 2.122954 GGATATCCCCCGGCCTCT 59.877 66.667 11.02 0.00 0.00 3.69
247 248 2.294078 GGATATCCCCCGGCCTCTG 61.294 68.421 11.02 0.00 0.00 3.35
248 249 2.930562 ATATCCCCCGGCCTCTGC 60.931 66.667 0.00 0.00 0.00 4.26
249 250 3.792325 ATATCCCCCGGCCTCTGCA 62.792 63.158 0.00 0.00 40.13 4.41
250 251 3.792325 TATCCCCCGGCCTCTGCAT 62.792 63.158 0.00 0.00 40.13 3.96
253 254 4.559063 CCCCGGCCTCTGCATCAG 62.559 72.222 0.00 0.00 40.13 2.90
254 255 4.559063 CCCGGCCTCTGCATCAGG 62.559 72.222 0.00 7.38 40.13 3.86
255 256 3.473647 CCGGCCTCTGCATCAGGA 61.474 66.667 14.75 0.00 40.13 3.86
256 257 2.202987 CGGCCTCTGCATCAGGAC 60.203 66.667 14.75 11.25 40.13 3.85
257 258 2.202987 GGCCTCTGCATCAGGACG 60.203 66.667 14.75 0.00 40.13 4.79
258 259 2.725312 GGCCTCTGCATCAGGACGA 61.725 63.158 14.75 0.00 40.13 4.20
259 260 1.445095 GCCTCTGCATCAGGACGAT 59.555 57.895 14.75 0.00 37.47 3.73
266 267 2.697819 CATCAGGACGATGCATGCA 58.302 52.632 25.04 25.04 44.95 3.96
267 268 0.586802 CATCAGGACGATGCATGCAG 59.413 55.000 26.69 15.79 44.95 4.41
268 269 1.164662 ATCAGGACGATGCATGCAGC 61.165 55.000 25.69 25.69 45.96 5.25
269 270 2.515523 AGGACGATGCATGCAGCC 60.516 61.111 28.76 22.96 44.83 4.85
270 271 2.515523 GGACGATGCATGCAGCCT 60.516 61.111 28.76 18.52 44.83 4.58
271 272 2.117156 GGACGATGCATGCAGCCTT 61.117 57.895 28.76 16.90 44.83 4.35
272 273 0.815213 GGACGATGCATGCAGCCTTA 60.815 55.000 28.76 2.58 44.83 2.69
273 274 1.233019 GACGATGCATGCAGCCTTAT 58.767 50.000 28.76 12.89 44.83 1.73
274 275 1.196354 GACGATGCATGCAGCCTTATC 59.804 52.381 28.76 17.30 44.83 1.75
275 276 1.232119 CGATGCATGCAGCCTTATCA 58.768 50.000 28.76 0.09 44.83 2.15
276 277 1.069432 CGATGCATGCAGCCTTATCAC 60.069 52.381 28.76 8.89 44.83 3.06
277 278 1.268899 GATGCATGCAGCCTTATCACC 59.731 52.381 25.21 0.39 44.83 4.02
278 279 0.256752 TGCATGCAGCCTTATCACCT 59.743 50.000 18.46 0.00 44.83 4.00
279 280 1.341285 TGCATGCAGCCTTATCACCTT 60.341 47.619 18.46 0.00 44.83 3.50
280 281 2.092484 TGCATGCAGCCTTATCACCTTA 60.092 45.455 18.46 0.00 44.83 2.69
281 282 2.551459 GCATGCAGCCTTATCACCTTAG 59.449 50.000 14.21 0.00 37.23 2.18
282 283 3.144506 CATGCAGCCTTATCACCTTAGG 58.855 50.000 0.00 0.00 0.00 2.69
283 284 2.196595 TGCAGCCTTATCACCTTAGGT 58.803 47.619 0.00 0.00 35.62 3.08
284 285 3.380393 TGCAGCCTTATCACCTTAGGTA 58.620 45.455 2.52 0.00 32.11 3.08
285 286 3.388024 TGCAGCCTTATCACCTTAGGTAG 59.612 47.826 2.52 0.00 32.11 3.18
297 298 3.926616 CCTTAGGTAGGTGAACTGTGTG 58.073 50.000 0.00 0.00 39.39 3.82
298 299 3.323979 CCTTAGGTAGGTGAACTGTGTGT 59.676 47.826 0.00 0.00 39.39 3.72
299 300 4.202326 CCTTAGGTAGGTGAACTGTGTGTT 60.202 45.833 0.00 0.00 39.34 3.32
300 301 3.926058 AGGTAGGTGAACTGTGTGTTT 57.074 42.857 0.00 0.00 39.30 2.83
301 302 3.805207 AGGTAGGTGAACTGTGTGTTTC 58.195 45.455 0.00 0.00 39.30 2.78
302 303 3.454812 AGGTAGGTGAACTGTGTGTTTCT 59.545 43.478 0.00 0.00 39.30 2.52
303 304 4.080526 AGGTAGGTGAACTGTGTGTTTCTT 60.081 41.667 0.00 0.00 39.30 2.52
304 305 5.129815 AGGTAGGTGAACTGTGTGTTTCTTA 59.870 40.000 0.00 0.00 39.30 2.10
305 306 5.995897 GGTAGGTGAACTGTGTGTTTCTTAT 59.004 40.000 0.00 0.00 39.30 1.73
306 307 7.015877 AGGTAGGTGAACTGTGTGTTTCTTATA 59.984 37.037 0.00 0.00 39.30 0.98
307 308 7.117379 GGTAGGTGAACTGTGTGTTTCTTATAC 59.883 40.741 0.00 0.00 39.30 1.47
308 309 6.827727 AGGTGAACTGTGTGTTTCTTATACT 58.172 36.000 0.00 0.00 39.30 2.12
309 310 6.706270 AGGTGAACTGTGTGTTTCTTATACTG 59.294 38.462 0.00 0.00 39.30 2.74
310 311 6.704493 GGTGAACTGTGTGTTTCTTATACTGA 59.296 38.462 0.00 0.00 39.30 3.41
311 312 7.387948 GGTGAACTGTGTGTTTCTTATACTGAT 59.612 37.037 0.00 0.00 39.30 2.90
312 313 8.436200 GTGAACTGTGTGTTTCTTATACTGATC 58.564 37.037 0.00 0.00 39.30 2.92
313 314 7.328493 TGAACTGTGTGTTTCTTATACTGATCG 59.672 37.037 0.00 0.00 39.30 3.69
314 315 6.920817 ACTGTGTGTTTCTTATACTGATCGA 58.079 36.000 0.00 0.00 0.00 3.59
315 316 7.375834 ACTGTGTGTTTCTTATACTGATCGAA 58.624 34.615 0.00 0.00 0.00 3.71
316 317 7.870954 ACTGTGTGTTTCTTATACTGATCGAAA 59.129 33.333 0.00 0.00 0.00 3.46
317 318 8.014322 TGTGTGTTTCTTATACTGATCGAAAC 57.986 34.615 11.11 11.11 42.11 2.78
318 319 7.870954 TGTGTGTTTCTTATACTGATCGAAACT 59.129 33.333 16.11 0.00 42.20 2.66
319 320 8.162880 GTGTGTTTCTTATACTGATCGAAACTG 58.837 37.037 16.11 0.00 42.20 3.16
320 321 7.148639 TGTGTTTCTTATACTGATCGAAACTGC 60.149 37.037 16.11 11.51 42.20 4.40
321 322 6.871492 TGTTTCTTATACTGATCGAAACTGCA 59.129 34.615 16.11 0.00 42.20 4.41
322 323 7.386573 TGTTTCTTATACTGATCGAAACTGCAA 59.613 33.333 16.11 0.51 42.20 4.08
323 324 7.525688 TTCTTATACTGATCGAAACTGCAAG 57.474 36.000 0.00 0.00 42.29 4.01
324 325 5.520288 TCTTATACTGATCGAAACTGCAAGC 59.480 40.000 0.00 0.00 37.60 4.01
325 326 1.882912 ACTGATCGAAACTGCAAGCA 58.117 45.000 0.00 0.00 37.60 3.91
327 328 2.071540 CTGATCGAAACTGCAAGCAGA 58.928 47.619 27.17 6.24 46.30 4.26
328 329 1.800586 TGATCGAAACTGCAAGCAGAC 59.199 47.619 27.17 15.98 46.30 3.51
329 330 0.792640 ATCGAAACTGCAAGCAGACG 59.207 50.000 27.17 24.44 46.30 4.18
330 331 1.205064 CGAAACTGCAAGCAGACGG 59.795 57.895 27.17 10.18 46.30 4.79
331 332 1.221466 CGAAACTGCAAGCAGACGGA 61.221 55.000 27.17 0.00 46.30 4.69
332 333 0.514691 GAAACTGCAAGCAGACGGAG 59.485 55.000 27.17 2.14 46.30 4.63
333 334 0.886490 AAACTGCAAGCAGACGGAGG 60.886 55.000 27.17 1.40 46.30 4.30
334 335 1.758440 AACTGCAAGCAGACGGAGGA 61.758 55.000 27.17 0.00 46.30 3.71
335 336 1.447489 CTGCAAGCAGACGGAGGAG 60.447 63.158 16.75 0.00 46.30 3.69
336 337 2.125350 GCAAGCAGACGGAGGAGG 60.125 66.667 0.00 0.00 0.00 4.30
337 338 2.125350 CAAGCAGACGGAGGAGGC 60.125 66.667 0.00 0.00 0.00 4.70
338 339 3.764466 AAGCAGACGGAGGAGGCG 61.764 66.667 0.00 0.00 0.00 5.52
342 343 1.433879 CAGACGGAGGAGGCGTAAG 59.566 63.158 0.00 0.00 43.44 2.34
357 358 4.157289 AGGCGTAAGATTCGACTACTTGAA 59.843 41.667 7.79 0.00 45.23 2.69
359 360 6.039047 AGGCGTAAGATTCGACTACTTGAATA 59.961 38.462 7.79 0.00 45.23 1.75
360 361 6.142002 GGCGTAAGATTCGACTACTTGAATAC 59.858 42.308 7.79 0.00 43.02 1.89
361 362 6.690098 GCGTAAGATTCGACTACTTGAATACA 59.310 38.462 7.79 0.00 43.02 2.29
362 363 7.096966 GCGTAAGATTCGACTACTTGAATACAG 60.097 40.741 7.79 0.00 43.02 2.74
364 365 9.953697 GTAAGATTCGACTACTTGAATACAGAT 57.046 33.333 7.79 0.00 35.06 2.90
366 367 8.864069 AGATTCGACTACTTGAATACAGATTG 57.136 34.615 0.00 0.00 35.06 2.67
367 368 7.923344 AGATTCGACTACTTGAATACAGATTGG 59.077 37.037 0.00 0.00 35.06 3.16
368 369 6.769134 TCGACTACTTGAATACAGATTGGA 57.231 37.500 0.00 0.00 0.00 3.53
371 486 7.068226 TCGACTACTTGAATACAGATTGGATGA 59.932 37.037 0.00 0.00 0.00 2.92
374 489 5.440610 ACTTGAATACAGATTGGATGACCC 58.559 41.667 0.00 0.00 34.81 4.46
376 491 5.715439 TGAATACAGATTGGATGACCCTT 57.285 39.130 0.00 0.00 35.38 3.95
377 492 6.078456 TGAATACAGATTGGATGACCCTTT 57.922 37.500 0.00 0.00 35.38 3.11
384 499 5.713861 CAGATTGGATGACCCTTTTCTTCTT 59.286 40.000 0.00 0.00 35.38 2.52
389 504 0.881796 GACCCTTTTCTTCTTGCCGG 59.118 55.000 0.00 0.00 0.00 6.13
390 505 0.476771 ACCCTTTTCTTCTTGCCGGA 59.523 50.000 5.05 0.00 0.00 5.14
391 506 1.168714 CCCTTTTCTTCTTGCCGGAG 58.831 55.000 5.05 0.00 0.00 4.63
406 521 1.490574 CGGAGGAGATTTGAGGACCT 58.509 55.000 0.00 0.00 0.00 3.85
407 522 2.667470 CGGAGGAGATTTGAGGACCTA 58.333 52.381 0.00 0.00 0.00 3.08
408 523 2.362717 CGGAGGAGATTTGAGGACCTAC 59.637 54.545 0.00 0.00 0.00 3.18
409 524 3.375699 GGAGGAGATTTGAGGACCTACA 58.624 50.000 0.00 0.00 32.36 2.74
410 525 3.386402 GGAGGAGATTTGAGGACCTACAG 59.614 52.174 0.00 0.00 32.36 2.74
411 526 4.282496 GAGGAGATTTGAGGACCTACAGA 58.718 47.826 0.00 0.00 0.00 3.41
412 527 4.689062 AGGAGATTTGAGGACCTACAGAA 58.311 43.478 0.00 0.00 0.00 3.02
413 528 4.468153 AGGAGATTTGAGGACCTACAGAAC 59.532 45.833 0.00 0.00 0.00 3.01
414 529 4.223032 GGAGATTTGAGGACCTACAGAACA 59.777 45.833 0.00 0.00 0.00 3.18
415 530 5.153950 AGATTTGAGGACCTACAGAACAC 57.846 43.478 0.00 0.00 0.00 3.32
416 531 4.593206 AGATTTGAGGACCTACAGAACACA 59.407 41.667 0.00 0.00 0.00 3.72
417 532 4.974645 TTTGAGGACCTACAGAACACAT 57.025 40.909 0.00 0.00 0.00 3.21
418 533 3.961480 TGAGGACCTACAGAACACATG 57.039 47.619 0.00 0.00 0.00 3.21
419 534 3.506398 TGAGGACCTACAGAACACATGA 58.494 45.455 0.00 0.00 0.00 3.07
420 535 3.511540 TGAGGACCTACAGAACACATGAG 59.488 47.826 0.00 0.00 0.00 2.90
421 536 3.764434 GAGGACCTACAGAACACATGAGA 59.236 47.826 0.00 0.00 0.00 3.27
422 537 3.766591 AGGACCTACAGAACACATGAGAG 59.233 47.826 0.00 0.00 0.00 3.20
423 538 3.764434 GGACCTACAGAACACATGAGAGA 59.236 47.826 0.00 0.00 0.00 3.10
424 539 4.220821 GGACCTACAGAACACATGAGAGAA 59.779 45.833 0.00 0.00 0.00 2.87
425 540 5.398603 ACCTACAGAACACATGAGAGAAG 57.601 43.478 0.00 0.00 0.00 2.85
426 541 4.180057 CCTACAGAACACATGAGAGAAGC 58.820 47.826 0.00 0.00 0.00 3.86
427 542 3.758755 ACAGAACACATGAGAGAAGCA 57.241 42.857 0.00 0.00 0.00 3.91
428 543 3.661944 ACAGAACACATGAGAGAAGCAG 58.338 45.455 0.00 0.00 0.00 4.24
429 544 2.415857 CAGAACACATGAGAGAAGCAGC 59.584 50.000 0.00 0.00 0.00 5.25
430 545 2.302445 AGAACACATGAGAGAAGCAGCT 59.698 45.455 0.00 0.00 0.00 4.24
431 546 3.513119 AGAACACATGAGAGAAGCAGCTA 59.487 43.478 0.00 0.00 0.00 3.32
432 547 3.244033 ACACATGAGAGAAGCAGCTAC 57.756 47.619 0.00 0.00 0.00 3.58
433 548 2.830923 ACACATGAGAGAAGCAGCTACT 59.169 45.455 0.00 0.00 0.00 2.57
434 549 4.019858 ACACATGAGAGAAGCAGCTACTA 58.980 43.478 0.00 0.00 0.00 1.82
435 550 4.648762 ACACATGAGAGAAGCAGCTACTAT 59.351 41.667 0.00 0.00 0.00 2.12
436 551 4.983538 CACATGAGAGAAGCAGCTACTATG 59.016 45.833 0.00 0.00 0.00 2.23
437 552 3.724508 TGAGAGAAGCAGCTACTATGC 57.275 47.619 0.00 0.00 44.18 3.14
453 568 3.760673 GCTGTCAAGCTCGTCGAG 58.239 61.111 18.08 18.08 46.60 4.04
454 569 1.081108 GCTGTCAAGCTCGTCGAGT 60.081 57.895 22.61 7.70 46.60 4.18
455 570 0.168348 GCTGTCAAGCTCGTCGAGTA 59.832 55.000 22.61 4.61 46.60 2.59
456 571 1.401148 GCTGTCAAGCTCGTCGAGTAA 60.401 52.381 22.61 4.29 46.60 2.24
457 572 2.921069 GCTGTCAAGCTCGTCGAGTAAA 60.921 50.000 22.61 4.62 46.60 2.01
458 573 2.657372 CTGTCAAGCTCGTCGAGTAAAC 59.343 50.000 22.61 15.49 31.39 2.01
459 574 1.984297 GTCAAGCTCGTCGAGTAAACC 59.016 52.381 22.61 6.42 31.39 3.27
460 575 0.982673 CAAGCTCGTCGAGTAAACCG 59.017 55.000 22.61 3.47 31.39 4.44
461 576 0.877071 AAGCTCGTCGAGTAAACCGA 59.123 50.000 22.61 0.00 31.39 4.69
462 577 0.877071 AGCTCGTCGAGTAAACCGAA 59.123 50.000 22.61 0.00 37.81 4.30
463 578 1.471684 AGCTCGTCGAGTAAACCGAAT 59.528 47.619 22.61 0.00 37.81 3.34
464 579 1.844962 GCTCGTCGAGTAAACCGAATC 59.155 52.381 22.61 0.00 37.81 2.52
465 580 2.448219 CTCGTCGAGTAAACCGAATCC 58.552 52.381 14.27 0.00 37.81 3.01
466 581 1.811965 TCGTCGAGTAAACCGAATCCA 59.188 47.619 0.00 0.00 37.81 3.41
467 582 2.228582 TCGTCGAGTAAACCGAATCCAA 59.771 45.455 0.00 0.00 37.81 3.53
468 583 2.597305 CGTCGAGTAAACCGAATCCAAG 59.403 50.000 0.00 0.00 37.81 3.61
469 584 3.582780 GTCGAGTAAACCGAATCCAAGT 58.417 45.455 0.00 0.00 37.81 3.16
470 585 3.992427 GTCGAGTAAACCGAATCCAAGTT 59.008 43.478 0.00 0.00 37.81 2.66
471 586 4.091075 GTCGAGTAAACCGAATCCAAGTTC 59.909 45.833 0.00 0.00 37.81 3.01
472 587 3.991773 CGAGTAAACCGAATCCAAGTTCA 59.008 43.478 0.00 0.00 0.00 3.18
473 588 4.091509 CGAGTAAACCGAATCCAAGTTCAG 59.908 45.833 0.00 0.00 0.00 3.02
474 589 4.969484 AGTAAACCGAATCCAAGTTCAGT 58.031 39.130 0.00 0.00 0.00 3.41
475 590 4.995487 AGTAAACCGAATCCAAGTTCAGTC 59.005 41.667 0.00 0.00 0.00 3.51
476 591 2.474410 ACCGAATCCAAGTTCAGTCC 57.526 50.000 0.00 0.00 0.00 3.85
477 592 1.697432 ACCGAATCCAAGTTCAGTCCA 59.303 47.619 0.00 0.00 0.00 4.02
478 593 2.305927 ACCGAATCCAAGTTCAGTCCAT 59.694 45.455 0.00 0.00 0.00 3.41
479 594 3.244911 ACCGAATCCAAGTTCAGTCCATT 60.245 43.478 0.00 0.00 0.00 3.16
480 595 3.758554 CCGAATCCAAGTTCAGTCCATTT 59.241 43.478 0.00 0.00 0.00 2.32
481 596 4.218417 CCGAATCCAAGTTCAGTCCATTTT 59.782 41.667 0.00 0.00 0.00 1.82
482 597 5.156355 CGAATCCAAGTTCAGTCCATTTTG 58.844 41.667 0.00 0.00 0.00 2.44
483 598 5.278463 CGAATCCAAGTTCAGTCCATTTTGT 60.278 40.000 0.00 0.00 0.00 2.83
484 599 6.484364 AATCCAAGTTCAGTCCATTTTGTT 57.516 33.333 0.00 0.00 0.00 2.83
485 600 5.514274 TCCAAGTTCAGTCCATTTTGTTC 57.486 39.130 0.00 0.00 0.00 3.18
486 601 4.952957 TCCAAGTTCAGTCCATTTTGTTCA 59.047 37.500 0.00 0.00 0.00 3.18
487 602 5.043248 CCAAGTTCAGTCCATTTTGTTCAC 58.957 41.667 0.00 0.00 0.00 3.18
488 603 4.552166 AGTTCAGTCCATTTTGTTCACG 57.448 40.909 0.00 0.00 0.00 4.35
489 604 3.945285 AGTTCAGTCCATTTTGTTCACGT 59.055 39.130 0.00 0.00 0.00 4.49
490 605 3.961477 TCAGTCCATTTTGTTCACGTG 57.039 42.857 9.94 9.94 0.00 4.49
491 606 3.536570 TCAGTCCATTTTGTTCACGTGA 58.463 40.909 15.76 15.76 0.00 4.35
492 607 3.311322 TCAGTCCATTTTGTTCACGTGAC 59.689 43.478 19.90 13.95 0.00 3.67
493 608 3.064682 CAGTCCATTTTGTTCACGTGACA 59.935 43.478 19.90 16.43 0.00 3.58
494 609 3.692101 AGTCCATTTTGTTCACGTGACAA 59.308 39.130 19.90 21.02 0.00 3.18
495 610 4.156922 AGTCCATTTTGTTCACGTGACAAA 59.843 37.500 27.37 27.37 0.00 2.83
496 611 4.859798 GTCCATTTTGTTCACGTGACAAAA 59.140 37.500 34.44 34.44 44.15 2.44
498 613 5.746245 TCCATTTTGTTCACGTGACAAAATC 59.254 36.000 36.29 20.68 46.12 2.17
499 614 5.051106 CCATTTTGTTCACGTGACAAAATCC 60.051 40.000 36.29 18.33 46.12 3.01
500 615 4.703645 TTTGTTCACGTGACAAAATCCA 57.296 36.364 28.21 15.52 31.44 3.41
501 616 4.703645 TTGTTCACGTGACAAAATCCAA 57.296 36.364 19.90 9.44 0.00 3.53
502 617 4.285807 TGTTCACGTGACAAAATCCAAG 57.714 40.909 19.90 0.00 0.00 3.61
503 618 3.692101 TGTTCACGTGACAAAATCCAAGT 59.308 39.130 19.90 0.00 0.00 3.16
504 619 4.156922 TGTTCACGTGACAAAATCCAAGTT 59.843 37.500 19.90 0.00 0.00 2.66
505 620 4.285807 TCACGTGACAAAATCCAAGTTG 57.714 40.909 15.76 0.00 0.00 3.16
506 621 3.942115 TCACGTGACAAAATCCAAGTTGA 59.058 39.130 15.76 0.00 0.00 3.18
507 622 4.396478 TCACGTGACAAAATCCAAGTTGAA 59.604 37.500 15.76 0.00 0.00 2.69
508 623 5.098893 CACGTGACAAAATCCAAGTTGAAA 58.901 37.500 10.90 0.00 0.00 2.69
509 624 5.229887 CACGTGACAAAATCCAAGTTGAAAG 59.770 40.000 10.90 0.00 0.00 2.62
510 625 5.105917 ACGTGACAAAATCCAAGTTGAAAGT 60.106 36.000 3.87 0.00 0.00 2.66
511 626 5.804979 CGTGACAAAATCCAAGTTGAAAGTT 59.195 36.000 3.87 0.00 0.00 2.66
512 627 6.237542 CGTGACAAAATCCAAGTTGAAAGTTG 60.238 38.462 3.87 6.16 38.71 3.16
513 628 5.580297 TGACAAAATCCAAGTTGAAAGTTGC 59.420 36.000 3.87 1.94 37.88 4.17
514 629 5.733676 ACAAAATCCAAGTTGAAAGTTGCT 58.266 33.333 3.87 0.00 37.88 3.91
515 630 6.172630 ACAAAATCCAAGTTGAAAGTTGCTT 58.827 32.000 3.87 0.00 37.88 3.91
516 631 6.654582 ACAAAATCCAAGTTGAAAGTTGCTTT 59.345 30.769 3.87 4.95 37.88 3.51
517 632 7.174772 ACAAAATCCAAGTTGAAAGTTGCTTTT 59.825 29.630 3.87 9.40 37.88 2.27
518 633 6.908870 AATCCAAGTTGAAAGTTGCTTTTC 57.091 33.333 3.87 0.00 37.88 2.29
519 634 5.659440 TCCAAGTTGAAAGTTGCTTTTCT 57.341 34.783 3.87 0.00 37.88 2.52
520 635 6.036577 TCCAAGTTGAAAGTTGCTTTTCTT 57.963 33.333 3.87 0.58 37.88 2.52
521 636 6.099341 TCCAAGTTGAAAGTTGCTTTTCTTC 58.901 36.000 3.87 0.00 37.88 2.87
522 637 5.291858 CCAAGTTGAAAGTTGCTTTTCTTCC 59.708 40.000 3.87 0.80 37.88 3.46
523 638 5.921962 AGTTGAAAGTTGCTTTTCTTCCT 57.078 34.783 9.28 2.42 37.81 3.36
524 639 6.286240 AGTTGAAAGTTGCTTTTCTTCCTT 57.714 33.333 9.28 0.00 37.81 3.36
525 640 6.333416 AGTTGAAAGTTGCTTTTCTTCCTTC 58.667 36.000 9.28 0.00 37.81 3.46
526 641 6.153510 AGTTGAAAGTTGCTTTTCTTCCTTCT 59.846 34.615 9.28 0.00 37.81 2.85
527 642 7.339466 AGTTGAAAGTTGCTTTTCTTCCTTCTA 59.661 33.333 9.28 0.00 37.81 2.10
528 643 7.264373 TGAAAGTTGCTTTTCTTCCTTCTAG 57.736 36.000 9.28 0.00 37.81 2.43
529 644 6.263168 TGAAAGTTGCTTTTCTTCCTTCTAGG 59.737 38.462 9.28 0.00 37.81 3.02
530 645 5.568620 AGTTGCTTTTCTTCCTTCTAGGA 57.431 39.130 0.00 0.00 44.10 2.94
531 646 6.133253 AGTTGCTTTTCTTCCTTCTAGGAT 57.867 37.500 0.00 0.00 45.34 3.24
532 647 6.176896 AGTTGCTTTTCTTCCTTCTAGGATC 58.823 40.000 0.00 0.00 45.34 3.36
533 648 5.762179 TGCTTTTCTTCCTTCTAGGATCA 57.238 39.130 0.00 0.00 45.34 2.92
534 649 5.738909 TGCTTTTCTTCCTTCTAGGATCAG 58.261 41.667 0.00 0.00 45.34 2.90
535 650 5.485353 TGCTTTTCTTCCTTCTAGGATCAGA 59.515 40.000 0.00 0.00 45.34 3.27
536 651 6.157645 TGCTTTTCTTCCTTCTAGGATCAGAT 59.842 38.462 0.00 0.00 45.34 2.90
537 652 7.053498 GCTTTTCTTCCTTCTAGGATCAGATT 58.947 38.462 0.00 0.00 45.34 2.40
538 653 7.226523 GCTTTTCTTCCTTCTAGGATCAGATTC 59.773 40.741 0.00 0.00 45.34 2.52
539 654 7.739995 TTTCTTCCTTCTAGGATCAGATTCA 57.260 36.000 0.00 0.00 45.34 2.57
540 655 6.975196 TCTTCCTTCTAGGATCAGATTCAG 57.025 41.667 0.00 0.00 45.34 3.02
541 656 6.677552 TCTTCCTTCTAGGATCAGATTCAGA 58.322 40.000 0.00 0.00 45.34 3.27
542 657 6.777091 TCTTCCTTCTAGGATCAGATTCAGAG 59.223 42.308 0.00 0.00 45.34 3.35
543 658 6.272953 TCCTTCTAGGATCAGATTCAGAGA 57.727 41.667 0.00 0.00 40.06 3.10
544 659 6.862225 TCCTTCTAGGATCAGATTCAGAGAT 58.138 40.000 0.00 0.00 40.06 2.75
545 660 6.947733 TCCTTCTAGGATCAGATTCAGAGATC 59.052 42.308 0.00 0.00 40.06 2.75
546 661 6.950041 CCTTCTAGGATCAGATTCAGAGATCT 59.050 42.308 0.00 0.00 37.67 2.75
547 662 7.452501 CCTTCTAGGATCAGATTCAGAGATCTT 59.547 40.741 0.00 7.96 37.67 2.40
548 663 7.764141 TCTAGGATCAGATTCAGAGATCTTG 57.236 40.000 0.00 0.00 38.51 3.02
549 664 5.217978 AGGATCAGATTCAGAGATCTTGC 57.782 43.478 0.00 0.00 38.51 4.01
550 665 4.040706 AGGATCAGATTCAGAGATCTTGCC 59.959 45.833 0.00 0.00 38.51 4.52
551 666 4.202336 GGATCAGATTCAGAGATCTTGCCA 60.202 45.833 0.00 0.00 38.51 4.92
552 667 5.513441 GGATCAGATTCAGAGATCTTGCCAT 60.513 44.000 0.00 0.00 38.51 4.40
553 668 4.704965 TCAGATTCAGAGATCTTGCCATG 58.295 43.478 0.00 0.00 34.20 3.66
554 669 3.815962 CAGATTCAGAGATCTTGCCATGG 59.184 47.826 7.63 7.63 34.20 3.66
555 670 3.458857 AGATTCAGAGATCTTGCCATGGT 59.541 43.478 14.67 0.00 32.54 3.55
556 671 2.996249 TCAGAGATCTTGCCATGGTC 57.004 50.000 14.67 6.41 0.00 4.02
557 672 2.190538 TCAGAGATCTTGCCATGGTCA 58.809 47.619 14.67 9.23 0.00 4.02
558 673 2.573009 TCAGAGATCTTGCCATGGTCAA 59.427 45.455 14.67 16.21 0.00 3.18
559 674 3.009363 TCAGAGATCTTGCCATGGTCAAA 59.991 43.478 14.67 5.09 0.00 2.69
560 675 3.377485 CAGAGATCTTGCCATGGTCAAAG 59.623 47.826 14.67 14.50 0.00 2.77
561 676 3.265221 AGAGATCTTGCCATGGTCAAAGA 59.735 43.478 21.41 21.41 0.00 2.52
562 677 4.079901 AGAGATCTTGCCATGGTCAAAGAT 60.080 41.667 26.35 26.35 0.00 2.40
563 678 5.131642 AGAGATCTTGCCATGGTCAAAGATA 59.868 40.000 26.21 13.23 0.00 1.98
564 679 5.950023 AGATCTTGCCATGGTCAAAGATAT 58.050 37.500 26.21 22.97 0.00 1.63
565 680 6.371278 AGATCTTGCCATGGTCAAAGATATT 58.629 36.000 26.21 19.05 0.00 1.28
566 681 5.840243 TCTTGCCATGGTCAAAGATATTG 57.160 39.130 14.67 4.96 0.00 1.90
567 682 4.098349 TCTTGCCATGGTCAAAGATATTGC 59.902 41.667 14.67 0.00 0.00 3.56
568 683 3.363627 TGCCATGGTCAAAGATATTGCA 58.636 40.909 14.67 0.00 0.00 4.08
569 684 3.768215 TGCCATGGTCAAAGATATTGCAA 59.232 39.130 14.67 0.00 0.00 4.08
570 685 4.222366 TGCCATGGTCAAAGATATTGCAAA 59.778 37.500 14.67 0.00 0.00 3.68
571 686 5.104859 TGCCATGGTCAAAGATATTGCAAAT 60.105 36.000 14.67 0.00 0.00 2.32
572 687 5.464389 GCCATGGTCAAAGATATTGCAAATC 59.536 40.000 14.67 8.26 0.00 2.17
573 688 6.575267 CCATGGTCAAAGATATTGCAAATCA 58.425 36.000 1.71 0.00 0.00 2.57
574 689 6.700081 CCATGGTCAAAGATATTGCAAATCAG 59.300 38.462 1.71 3.49 0.00 2.90
575 690 7.417003 CCATGGTCAAAGATATTGCAAATCAGA 60.417 37.037 1.71 5.54 0.00 3.27
576 691 7.465353 TGGTCAAAGATATTGCAAATCAGAA 57.535 32.000 1.71 0.00 0.00 3.02
577 692 7.894708 TGGTCAAAGATATTGCAAATCAGAAA 58.105 30.769 1.71 0.00 0.00 2.52
578 693 8.030692 TGGTCAAAGATATTGCAAATCAGAAAG 58.969 33.333 1.71 0.00 0.00 2.62
579 694 7.009907 GGTCAAAGATATTGCAAATCAGAAAGC 59.990 37.037 1.71 2.89 0.00 3.51
580 695 7.758528 GTCAAAGATATTGCAAATCAGAAAGCT 59.241 33.333 1.71 0.00 0.00 3.74
581 696 8.959548 TCAAAGATATTGCAAATCAGAAAGCTA 58.040 29.630 1.71 0.00 0.00 3.32
582 697 9.234384 CAAAGATATTGCAAATCAGAAAGCTAG 57.766 33.333 1.71 0.00 0.00 3.42
583 698 6.968250 AGATATTGCAAATCAGAAAGCTAGC 58.032 36.000 6.62 6.62 0.00 3.42
584 699 6.544931 AGATATTGCAAATCAGAAAGCTAGCA 59.455 34.615 18.83 0.00 0.00 3.49
585 700 3.837213 TGCAAATCAGAAAGCTAGCAC 57.163 42.857 18.83 7.96 0.00 4.40
586 701 3.415212 TGCAAATCAGAAAGCTAGCACT 58.585 40.909 18.83 10.23 0.00 4.40
587 702 3.189910 TGCAAATCAGAAAGCTAGCACTG 59.810 43.478 18.83 20.80 0.00 3.66
588 703 3.190118 GCAAATCAGAAAGCTAGCACTGT 59.810 43.478 24.68 15.30 0.00 3.55
589 704 4.671250 GCAAATCAGAAAGCTAGCACTGTC 60.671 45.833 24.68 14.32 0.00 3.51
590 705 4.550076 AATCAGAAAGCTAGCACTGTCT 57.450 40.909 24.68 15.87 34.38 3.41
591 706 4.550076 ATCAGAAAGCTAGCACTGTCTT 57.450 40.909 24.68 14.52 31.52 3.01
592 707 4.342862 TCAGAAAGCTAGCACTGTCTTT 57.657 40.909 24.68 14.13 31.52 2.52
593 708 4.310769 TCAGAAAGCTAGCACTGTCTTTC 58.689 43.478 24.68 19.83 42.66 2.62
594 709 4.060900 CAGAAAGCTAGCACTGTCTTTCA 58.939 43.478 18.83 0.00 43.96 2.69
608 723 4.498241 TGTCTTTCAGTCATGAATCCTCG 58.502 43.478 0.00 0.00 44.75 4.63
609 724 4.021104 TGTCTTTCAGTCATGAATCCTCGT 60.021 41.667 0.00 0.00 44.75 4.18
610 725 4.932200 GTCTTTCAGTCATGAATCCTCGTT 59.068 41.667 0.00 0.00 44.75 3.85
611 726 5.062809 GTCTTTCAGTCATGAATCCTCGTTC 59.937 44.000 0.00 0.00 44.75 3.95
612 727 3.150848 TCAGTCATGAATCCTCGTTCG 57.849 47.619 0.00 0.00 30.61 3.95
613 728 2.752903 TCAGTCATGAATCCTCGTTCGA 59.247 45.455 0.00 0.00 30.61 3.71
614 729 3.111838 CAGTCATGAATCCTCGTTCGAG 58.888 50.000 14.26 14.26 0.00 4.04
615 730 2.755655 AGTCATGAATCCTCGTTCGAGT 59.244 45.455 18.59 2.96 0.00 4.18
616 731 3.193691 AGTCATGAATCCTCGTTCGAGTT 59.806 43.478 18.59 9.09 0.00 3.01
617 732 4.398358 AGTCATGAATCCTCGTTCGAGTTA 59.602 41.667 18.59 8.71 0.00 2.24
618 733 5.067936 AGTCATGAATCCTCGTTCGAGTTAT 59.932 40.000 18.59 10.35 0.00 1.89
619 734 5.749109 GTCATGAATCCTCGTTCGAGTTATT 59.251 40.000 18.59 16.57 0.00 1.40
620 735 6.255887 GTCATGAATCCTCGTTCGAGTTATTT 59.744 38.462 18.59 8.16 0.00 1.40
621 736 6.816640 TCATGAATCCTCGTTCGAGTTATTTT 59.183 34.615 18.59 6.72 0.00 1.82
622 737 7.333423 TCATGAATCCTCGTTCGAGTTATTTTT 59.667 33.333 18.59 8.45 0.00 1.94
675 790 7.765307 ACATACAGGAATGCTATTGTTTTCTG 58.235 34.615 0.00 0.00 0.00 3.02
676 791 7.394359 ACATACAGGAATGCTATTGTTTTCTGT 59.606 33.333 9.53 9.53 0.00 3.41
677 792 6.259550 ACAGGAATGCTATTGTTTTCTGTC 57.740 37.500 0.00 0.00 0.00 3.51
679 794 6.265196 ACAGGAATGCTATTGTTTTCTGTCAA 59.735 34.615 0.00 0.00 0.00 3.18
680 795 6.805271 CAGGAATGCTATTGTTTTCTGTCAAG 59.195 38.462 0.00 0.00 0.00 3.02
681 796 6.491403 AGGAATGCTATTGTTTTCTGTCAAGT 59.509 34.615 0.00 0.00 0.00 3.16
686 1010 5.979517 GCTATTGTTTTCTGTCAAGTTGCTT 59.020 36.000 0.00 0.00 0.00 3.91
694 1018 7.624360 TTTCTGTCAAGTTGCTTTTCTTCTA 57.376 32.000 0.00 0.00 0.00 2.10
695 1019 7.624360 TTCTGTCAAGTTGCTTTTCTTCTAA 57.376 32.000 0.00 0.00 0.00 2.10
699 1023 6.597672 TGTCAAGTTGCTTTTCTTCTAAGTCA 59.402 34.615 0.00 0.00 0.00 3.41
700 1024 7.128976 GTCAAGTTGCTTTTCTTCTAAGTCAG 58.871 38.462 0.00 0.00 0.00 3.51
701 1025 7.011482 GTCAAGTTGCTTTTCTTCTAAGTCAGA 59.989 37.037 0.00 0.00 0.00 3.27
702 1026 7.552687 TCAAGTTGCTTTTCTTCTAAGTCAGAA 59.447 33.333 0.00 0.00 41.10 3.02
710 1034 3.988976 TTCTAAGTCAGAAGCTGGCAT 57.011 42.857 1.62 0.00 38.73 4.40
711 1035 3.988976 TCTAAGTCAGAAGCTGGCATT 57.011 42.857 1.62 0.00 38.73 3.56
712 1036 5.420725 TTCTAAGTCAGAAGCTGGCATTA 57.579 39.130 1.62 0.00 38.73 1.90
713 1037 5.620738 TCTAAGTCAGAAGCTGGCATTAT 57.379 39.130 1.62 0.00 38.73 1.28
714 1038 5.363101 TCTAAGTCAGAAGCTGGCATTATG 58.637 41.667 1.62 0.00 38.73 1.90
715 1039 2.295885 AGTCAGAAGCTGGCATTATGC 58.704 47.619 8.93 8.93 38.73 3.14
729 1053 5.459110 GCATTATGCCAATTTGTCAGTTG 57.541 39.130 5.80 0.00 37.42 3.16
730 1054 5.170021 GCATTATGCCAATTTGTCAGTTGA 58.830 37.500 5.80 0.00 37.42 3.18
731 1055 5.290158 GCATTATGCCAATTTGTCAGTTGAG 59.710 40.000 5.80 0.00 37.42 3.02
732 1056 6.392354 CATTATGCCAATTTGTCAGTTGAGT 58.608 36.000 0.00 0.00 0.00 3.41
733 1057 4.942761 ATGCCAATTTGTCAGTTGAGTT 57.057 36.364 0.00 0.00 0.00 3.01
734 1058 4.734398 TGCCAATTTGTCAGTTGAGTTT 57.266 36.364 0.00 0.00 0.00 2.66
735 1059 5.843673 TGCCAATTTGTCAGTTGAGTTTA 57.156 34.783 0.00 0.00 0.00 2.01
736 1060 5.830912 TGCCAATTTGTCAGTTGAGTTTAG 58.169 37.500 0.00 0.00 0.00 1.85
737 1061 5.359576 TGCCAATTTGTCAGTTGAGTTTAGT 59.640 36.000 0.00 0.00 0.00 2.24
738 1062 5.915196 GCCAATTTGTCAGTTGAGTTTAGTC 59.085 40.000 0.00 0.00 0.00 2.59
739 1063 6.459573 GCCAATTTGTCAGTTGAGTTTAGTCA 60.460 38.462 0.00 0.00 0.00 3.41
740 1064 7.479980 CCAATTTGTCAGTTGAGTTTAGTCAA 58.520 34.615 0.00 0.00 33.95 3.18
741 1065 7.973388 CCAATTTGTCAGTTGAGTTTAGTCAAA 59.027 33.333 1.75 0.00 38.17 2.69
742 1066 9.352784 CAATTTGTCAGTTGAGTTTAGTCAAAA 57.647 29.630 1.75 0.00 38.17 2.44
745 1069 9.921637 TTTGTCAGTTGAGTTTAGTCAAAATTT 57.078 25.926 1.75 0.00 38.17 1.82
746 1070 8.909708 TGTCAGTTGAGTTTAGTCAAAATTTG 57.090 30.769 0.00 0.00 38.17 2.32
747 1071 7.973388 TGTCAGTTGAGTTTAGTCAAAATTTGG 59.027 33.333 5.83 0.00 38.17 3.28
748 1072 6.978080 TCAGTTGAGTTTAGTCAAAATTTGGC 59.022 34.615 1.48 1.48 38.17 4.52
749 1073 6.756074 CAGTTGAGTTTAGTCAAAATTTGGCA 59.244 34.615 13.11 0.00 38.17 4.92
750 1074 6.756542 AGTTGAGTTTAGTCAAAATTTGGCAC 59.243 34.615 13.11 2.31 38.17 5.01
751 1075 6.214191 TGAGTTTAGTCAAAATTTGGCACA 57.786 33.333 13.11 0.00 37.85 4.57
752 1076 7.064016 GTTGAGTTTAGTCAAAATTTGGCACAA 59.936 33.333 13.11 3.42 40.21 3.33
753 1077 7.604164 TTGAGTTTAGTCAAAATTTGGCACAAA 59.396 29.630 13.11 9.12 37.17 2.83
764 1088 1.745232 TGGCACAAACTTCGTTGAGT 58.255 45.000 0.00 0.00 31.92 3.41
765 1089 2.088423 TGGCACAAACTTCGTTGAGTT 58.912 42.857 0.00 0.00 41.44 3.01
767 1091 3.690139 TGGCACAAACTTCGTTGAGTTTA 59.310 39.130 11.76 0.00 45.44 2.01
768 1092 4.201871 TGGCACAAACTTCGTTGAGTTTAG 60.202 41.667 11.76 9.65 45.44 1.85
769 1093 4.201881 GGCACAAACTTCGTTGAGTTTAGT 60.202 41.667 11.76 10.18 45.44 2.24
770 1094 5.329493 GCACAAACTTCGTTGAGTTTAGTT 58.671 37.500 11.76 0.00 45.44 2.24
771 1095 6.457257 GGCACAAACTTCGTTGAGTTTAGTTA 60.457 38.462 11.76 0.00 45.44 2.24
772 1096 6.627671 GCACAAACTTCGTTGAGTTTAGTTAG 59.372 38.462 11.76 5.09 45.44 2.34
773 1097 7.675637 GCACAAACTTCGTTGAGTTTAGTTAGT 60.676 37.037 11.76 5.53 45.44 2.24
774 1098 8.173130 CACAAACTTCGTTGAGTTTAGTTAGTT 58.827 33.333 11.76 0.00 45.44 2.24
775 1099 8.385858 ACAAACTTCGTTGAGTTTAGTTAGTTC 58.614 33.333 11.76 0.00 45.44 3.01
776 1100 8.385111 CAAACTTCGTTGAGTTTAGTTAGTTCA 58.615 33.333 11.76 0.00 45.44 3.18
777 1101 8.658499 AACTTCGTTGAGTTTAGTTAGTTCAT 57.342 30.769 0.00 0.00 36.49 2.57
778 1102 8.658499 ACTTCGTTGAGTTTAGTTAGTTCATT 57.342 30.769 0.00 0.00 0.00 2.57
779 1103 8.762426 ACTTCGTTGAGTTTAGTTAGTTCATTC 58.238 33.333 0.00 0.00 0.00 2.67
780 1104 8.651391 TTCGTTGAGTTTAGTTAGTTCATTCA 57.349 30.769 0.00 0.00 0.00 2.57
781 1105 8.651391 TCGTTGAGTTTAGTTAGTTCATTCAA 57.349 30.769 0.00 0.00 0.00 2.69
782 1106 8.761497 TCGTTGAGTTTAGTTAGTTCATTCAAG 58.239 33.333 0.00 0.00 0.00 3.02
783 1107 8.009974 CGTTGAGTTTAGTTAGTTCATTCAAGG 58.990 37.037 0.00 0.00 0.00 3.61
784 1108 8.837389 GTTGAGTTTAGTTAGTTCATTCAAGGT 58.163 33.333 0.00 0.00 0.00 3.50
785 1109 8.974060 TGAGTTTAGTTAGTTCATTCAAGGTT 57.026 30.769 0.00 0.00 0.00 3.50
786 1110 8.836413 TGAGTTTAGTTAGTTCATTCAAGGTTG 58.164 33.333 0.00 0.00 0.00 3.77
787 1111 8.747538 AGTTTAGTTAGTTCATTCAAGGTTGT 57.252 30.769 0.00 0.00 0.00 3.32
788 1112 8.837389 AGTTTAGTTAGTTCATTCAAGGTTGTC 58.163 33.333 0.00 0.00 0.00 3.18
789 1113 7.739498 TTAGTTAGTTCATTCAAGGTTGTCC 57.261 36.000 0.00 0.00 0.00 4.02
790 1114 5.690865 AGTTAGTTCATTCAAGGTTGTCCA 58.309 37.500 0.00 0.00 35.89 4.02
791 1115 5.765182 AGTTAGTTCATTCAAGGTTGTCCAG 59.235 40.000 0.00 0.00 35.89 3.86
792 1116 4.437682 AGTTCATTCAAGGTTGTCCAGA 57.562 40.909 0.00 0.00 35.89 3.86
793 1117 4.137543 AGTTCATTCAAGGTTGTCCAGAC 58.862 43.478 0.00 0.00 35.89 3.51
794 1118 4.137543 GTTCATTCAAGGTTGTCCAGACT 58.862 43.478 0.00 0.00 35.89 3.24
795 1119 5.071788 AGTTCATTCAAGGTTGTCCAGACTA 59.928 40.000 0.00 0.00 35.89 2.59
796 1120 4.894784 TCATTCAAGGTTGTCCAGACTAC 58.105 43.478 4.10 4.10 36.55 2.73
797 1121 4.593206 TCATTCAAGGTTGTCCAGACTACT 59.407 41.667 11.24 0.00 37.26 2.57
798 1122 5.071788 TCATTCAAGGTTGTCCAGACTACTT 59.928 40.000 11.24 2.32 37.26 2.24
799 1123 5.367945 TTCAAGGTTGTCCAGACTACTTT 57.632 39.130 11.24 7.85 36.98 2.66
800 1124 4.703897 TCAAGGTTGTCCAGACTACTTTG 58.296 43.478 22.11 22.11 46.68 2.77
801 1125 3.771577 AGGTTGTCCAGACTACTTTGG 57.228 47.619 11.24 0.00 37.26 3.28
802 1126 2.152016 GGTTGTCCAGACTACTTTGGC 58.848 52.381 11.24 0.00 37.26 4.52
803 1127 2.224548 GGTTGTCCAGACTACTTTGGCT 60.225 50.000 11.24 0.00 37.26 4.75
804 1128 2.808543 GTTGTCCAGACTACTTTGGCTG 59.191 50.000 5.31 0.00 34.90 4.85
805 1129 2.325484 TGTCCAGACTACTTTGGCTGA 58.675 47.619 0.00 0.00 34.38 4.26
806 1130 2.703536 TGTCCAGACTACTTTGGCTGAA 59.296 45.455 0.00 0.00 34.38 3.02
807 1131 3.135712 TGTCCAGACTACTTTGGCTGAAA 59.864 43.478 0.00 0.00 34.38 2.69
808 1132 4.134563 GTCCAGACTACTTTGGCTGAAAA 58.865 43.478 0.00 0.00 34.38 2.29
809 1133 4.762251 GTCCAGACTACTTTGGCTGAAAAT 59.238 41.667 0.00 0.00 34.38 1.82
810 1134 5.241728 GTCCAGACTACTTTGGCTGAAAATT 59.758 40.000 0.00 0.00 34.38 1.82
811 1135 6.430000 GTCCAGACTACTTTGGCTGAAAATTA 59.570 38.462 0.00 0.00 34.38 1.40
812 1136 6.430000 TCCAGACTACTTTGGCTGAAAATTAC 59.570 38.462 0.00 0.00 34.38 1.89
813 1137 6.206634 CCAGACTACTTTGGCTGAAAATTACA 59.793 38.462 0.00 0.00 0.00 2.41
814 1138 7.078228 CAGACTACTTTGGCTGAAAATTACAC 58.922 38.462 0.00 0.00 0.00 2.90
815 1139 6.998673 AGACTACTTTGGCTGAAAATTACACT 59.001 34.615 0.00 0.00 0.00 3.55
816 1140 7.502561 AGACTACTTTGGCTGAAAATTACACTT 59.497 33.333 0.00 0.00 0.00 3.16
817 1141 7.649057 ACTACTTTGGCTGAAAATTACACTTC 58.351 34.615 0.00 0.00 0.00 3.01
818 1142 6.715347 ACTTTGGCTGAAAATTACACTTCT 57.285 33.333 0.00 0.00 0.00 2.85
819 1143 6.739112 ACTTTGGCTGAAAATTACACTTCTC 58.261 36.000 0.00 0.00 0.00 2.87
820 1144 5.705609 TTGGCTGAAAATTACACTTCTCC 57.294 39.130 0.00 0.00 0.00 3.71
821 1145 4.724399 TGGCTGAAAATTACACTTCTCCA 58.276 39.130 0.00 0.00 0.00 3.86
822 1146 5.136828 TGGCTGAAAATTACACTTCTCCAA 58.863 37.500 0.00 0.00 0.00 3.53
823 1147 5.596361 TGGCTGAAAATTACACTTCTCCAAA 59.404 36.000 0.00 0.00 0.00 3.28
824 1148 6.152379 GGCTGAAAATTACACTTCTCCAAAG 58.848 40.000 0.00 0.00 0.00 2.77
825 1149 6.239036 GGCTGAAAATTACACTTCTCCAAAGT 60.239 38.462 0.00 0.00 0.00 2.66
826 1150 7.203218 GCTGAAAATTACACTTCTCCAAAGTT 58.797 34.615 0.00 0.00 0.00 2.66
827 1151 7.379797 GCTGAAAATTACACTTCTCCAAAGTTC 59.620 37.037 0.00 0.00 0.00 3.01
828 1152 8.287439 TGAAAATTACACTTCTCCAAAGTTCA 57.713 30.769 0.00 0.00 0.00 3.18
829 1153 8.744652 TGAAAATTACACTTCTCCAAAGTTCAA 58.255 29.630 0.00 0.00 0.00 2.69
830 1154 9.581099 GAAAATTACACTTCTCCAAAGTTCAAA 57.419 29.630 0.00 0.00 0.00 2.69
831 1155 9.936759 AAAATTACACTTCTCCAAAGTTCAAAA 57.063 25.926 0.00 0.00 0.00 2.44
832 1156 8.926715 AATTACACTTCTCCAAAGTTCAAAAC 57.073 30.769 0.00 0.00 0.00 2.43
833 1157 7.696992 TTACACTTCTCCAAAGTTCAAAACT 57.303 32.000 0.00 0.00 45.46 2.66
834 1158 5.954335 ACACTTCTCCAAAGTTCAAAACTG 58.046 37.500 0.00 0.00 41.91 3.16
835 1159 4.800471 CACTTCTCCAAAGTTCAAAACTGC 59.200 41.667 0.00 0.00 41.91 4.40
836 1160 4.462483 ACTTCTCCAAAGTTCAAAACTGCA 59.538 37.500 0.00 0.00 41.91 4.41
837 1161 5.127682 ACTTCTCCAAAGTTCAAAACTGCAT 59.872 36.000 0.00 0.00 41.91 3.96
838 1162 5.596836 TCTCCAAAGTTCAAAACTGCATT 57.403 34.783 0.00 0.00 41.91 3.56
839 1163 5.976458 TCTCCAAAGTTCAAAACTGCATTT 58.024 33.333 0.00 0.00 41.91 2.32
840 1164 6.405538 TCTCCAAAGTTCAAAACTGCATTTT 58.594 32.000 0.00 0.00 41.91 1.82
848 1172 2.636647 AAACTGCATTTTGGGGGTTG 57.363 45.000 0.62 0.00 0.00 3.77
849 1173 1.799933 AACTGCATTTTGGGGGTTGA 58.200 45.000 0.00 0.00 0.00 3.18
850 1174 1.799933 ACTGCATTTTGGGGGTTGAA 58.200 45.000 0.00 0.00 0.00 2.69
851 1175 2.122768 ACTGCATTTTGGGGGTTGAAA 58.877 42.857 0.00 0.00 0.00 2.69
852 1176 2.710471 ACTGCATTTTGGGGGTTGAAAT 59.290 40.909 0.00 0.00 0.00 2.17
853 1177 3.244526 ACTGCATTTTGGGGGTTGAAATC 60.245 43.478 0.00 0.00 0.00 2.17
854 1178 2.978278 TGCATTTTGGGGGTTGAAATCT 59.022 40.909 0.00 0.00 0.00 2.40
855 1179 3.393941 TGCATTTTGGGGGTTGAAATCTT 59.606 39.130 0.00 0.00 0.00 2.40
856 1180 4.002982 GCATTTTGGGGGTTGAAATCTTC 58.997 43.478 0.00 0.00 0.00 2.87
857 1181 4.504689 GCATTTTGGGGGTTGAAATCTTCA 60.505 41.667 0.00 0.00 38.04 3.02
858 1182 5.619220 CATTTTGGGGGTTGAAATCTTCAA 58.381 37.500 0.00 0.00 46.68 2.69
888 1212 6.391227 GTTTGAAACCTTCTCATCTTGGAA 57.609 37.500 0.00 0.00 0.00 3.53
889 1213 6.209361 GTTTGAAACCTTCTCATCTTGGAAC 58.791 40.000 0.00 0.00 0.00 3.62
890 1214 4.065088 TGAAACCTTCTCATCTTGGAACG 58.935 43.478 0.00 0.00 0.00 3.95
891 1215 2.100605 ACCTTCTCATCTTGGAACGC 57.899 50.000 0.00 0.00 0.00 4.84
892 1216 1.347707 ACCTTCTCATCTTGGAACGCA 59.652 47.619 0.00 0.00 0.00 5.24
893 1217 1.734465 CCTTCTCATCTTGGAACGCAC 59.266 52.381 0.00 0.00 0.00 5.34
894 1218 2.416747 CTTCTCATCTTGGAACGCACA 58.583 47.619 0.00 0.00 0.00 4.57
895 1219 2.768253 TCTCATCTTGGAACGCACAT 57.232 45.000 0.00 0.00 0.00 3.21
896 1220 3.057969 TCTCATCTTGGAACGCACATT 57.942 42.857 0.00 0.00 0.00 2.71
897 1221 3.411446 TCTCATCTTGGAACGCACATTT 58.589 40.909 0.00 0.00 0.00 2.32
898 1222 3.436704 TCTCATCTTGGAACGCACATTTC 59.563 43.478 0.00 0.00 0.00 2.17
899 1223 3.411446 TCATCTTGGAACGCACATTTCT 58.589 40.909 0.00 0.00 0.00 2.52
900 1224 3.820467 TCATCTTGGAACGCACATTTCTT 59.180 39.130 0.00 0.00 0.00 2.52
901 1225 3.896648 TCTTGGAACGCACATTTCTTC 57.103 42.857 0.00 0.00 0.00 2.87
902 1226 3.476552 TCTTGGAACGCACATTTCTTCT 58.523 40.909 0.00 0.00 0.00 2.85
903 1227 3.882888 TCTTGGAACGCACATTTCTTCTT 59.117 39.130 0.00 0.00 0.00 2.52
904 1228 3.896648 TGGAACGCACATTTCTTCTTC 57.103 42.857 0.00 0.00 0.00 2.87
905 1229 3.476552 TGGAACGCACATTTCTTCTTCT 58.523 40.909 0.00 0.00 0.00 2.85
906 1230 3.882888 TGGAACGCACATTTCTTCTTCTT 59.117 39.130 0.00 0.00 0.00 2.52
907 1231 4.024048 TGGAACGCACATTTCTTCTTCTTC 60.024 41.667 0.00 0.00 0.00 2.87
908 1232 4.214332 GGAACGCACATTTCTTCTTCTTCT 59.786 41.667 0.00 0.00 0.00 2.85
909 1233 5.278022 GGAACGCACATTTCTTCTTCTTCTT 60.278 40.000 0.00 0.00 0.00 2.52
910 1234 5.757850 ACGCACATTTCTTCTTCTTCTTT 57.242 34.783 0.00 0.00 0.00 2.52
911 1235 6.136541 ACGCACATTTCTTCTTCTTCTTTT 57.863 33.333 0.00 0.00 0.00 2.27
912 1236 6.564328 ACGCACATTTCTTCTTCTTCTTTTT 58.436 32.000 0.00 0.00 0.00 1.94
913 1237 6.473455 ACGCACATTTCTTCTTCTTCTTTTTG 59.527 34.615 0.00 0.00 0.00 2.44
914 1238 6.692681 CGCACATTTCTTCTTCTTCTTTTTGA 59.307 34.615 0.00 0.00 0.00 2.69
915 1239 7.220683 CGCACATTTCTTCTTCTTCTTTTTGAA 59.779 33.333 0.00 0.00 0.00 2.69
916 1240 8.872845 GCACATTTCTTCTTCTTCTTTTTGAAA 58.127 29.630 0.00 0.00 33.79 2.69
918 1242 9.076596 ACATTTCTTCTTCTTCTTTTTGAAACG 57.923 29.630 0.00 0.00 33.79 3.60
919 1243 8.534778 CATTTCTTCTTCTTCTTTTTGAAACGG 58.465 33.333 0.00 0.00 33.79 4.44
920 1244 6.131544 TCTTCTTCTTCTTTTTGAAACGGG 57.868 37.500 0.00 0.00 33.79 5.28
921 1245 5.883673 TCTTCTTCTTCTTTTTGAAACGGGA 59.116 36.000 0.00 0.00 33.79 5.14
922 1246 6.376018 TCTTCTTCTTCTTTTTGAAACGGGAA 59.624 34.615 0.00 0.00 33.79 3.97
923 1247 6.518208 TCTTCTTCTTTTTGAAACGGGAAA 57.482 33.333 0.00 0.00 33.79 3.13
924 1248 6.926313 TCTTCTTCTTTTTGAAACGGGAAAA 58.074 32.000 0.00 0.00 33.79 2.29
925 1249 7.033185 TCTTCTTCTTTTTGAAACGGGAAAAG 58.967 34.615 0.00 0.00 40.16 2.27
926 1250 5.656480 TCTTCTTTTTGAAACGGGAAAAGG 58.344 37.500 7.65 0.00 39.58 3.11
927 1251 4.394439 TCTTTTTGAAACGGGAAAAGGG 57.606 40.909 7.65 0.00 39.58 3.95
928 1252 4.024670 TCTTTTTGAAACGGGAAAAGGGA 58.975 39.130 7.65 0.00 39.58 4.20
929 1253 3.804786 TTTTGAAACGGGAAAAGGGAC 57.195 42.857 0.00 0.00 0.00 4.46
930 1254 2.438800 TTGAAACGGGAAAAGGGACA 57.561 45.000 0.00 0.00 0.00 4.02
931 1255 2.668144 TGAAACGGGAAAAGGGACAT 57.332 45.000 0.00 0.00 0.00 3.06
932 1256 2.510613 TGAAACGGGAAAAGGGACATC 58.489 47.619 0.00 0.00 0.00 3.06
933 1257 2.158593 TGAAACGGGAAAAGGGACATCA 60.159 45.455 0.00 0.00 0.00 3.07
934 1258 2.200373 AACGGGAAAAGGGACATCAG 57.800 50.000 0.00 0.00 0.00 2.90
935 1259 0.328258 ACGGGAAAAGGGACATCAGG 59.672 55.000 0.00 0.00 0.00 3.86
936 1260 1.032114 CGGGAAAAGGGACATCAGGC 61.032 60.000 0.00 0.00 0.00 4.85
937 1261 0.039618 GGGAAAAGGGACATCAGGCA 59.960 55.000 0.00 0.00 0.00 4.75
938 1262 1.549950 GGGAAAAGGGACATCAGGCAA 60.550 52.381 0.00 0.00 0.00 4.52
939 1263 2.247358 GGAAAAGGGACATCAGGCAAA 58.753 47.619 0.00 0.00 0.00 3.68
940 1264 2.232208 GGAAAAGGGACATCAGGCAAAG 59.768 50.000 0.00 0.00 0.00 2.77
941 1265 2.978156 AAAGGGACATCAGGCAAAGA 57.022 45.000 0.00 0.00 0.00 2.52
942 1266 2.978156 AAGGGACATCAGGCAAAGAA 57.022 45.000 0.00 0.00 0.00 2.52
943 1267 2.978156 AGGGACATCAGGCAAAGAAA 57.022 45.000 0.00 0.00 0.00 2.52
949 1273 0.524862 ATCAGGCAAAGAAAGCTGCG 59.475 50.000 0.00 0.00 39.55 5.18
954 1278 1.518903 GCAAAGAAAGCTGCGGGAGT 61.519 55.000 0.00 0.00 0.00 3.85
956 1280 0.108585 AAAGAAAGCTGCGGGAGTCA 59.891 50.000 0.00 0.00 0.00 3.41
960 1284 1.188219 AAAGCTGCGGGAGTCAGAGA 61.188 55.000 0.00 0.00 36.53 3.10
967 1291 1.686052 GCGGGAGTCAGAGATCATTCT 59.314 52.381 0.00 0.00 33.88 2.40
990 1316 0.912487 AGGGAAGGAACCGTGGCATA 60.912 55.000 0.00 0.00 0.00 3.14
1013 1339 0.109365 TTGCAAATGGAACGCCGATG 60.109 50.000 0.00 0.00 36.79 3.84
1035 1361 3.484953 ACTATCACACCAAGGGACCTA 57.515 47.619 0.00 0.00 27.79 3.08
1041 1367 0.905357 CACCAAGGGACCTAGAGTGG 59.095 60.000 5.46 5.46 0.00 4.00
1083 1409 2.266055 CCGAAGGCCCTGTCACTC 59.734 66.667 0.00 0.00 46.14 3.51
1105 1431 6.127479 ACTCTCACTTCTGGAAGATATCACAC 60.127 42.308 16.06 0.00 46.36 3.82
1108 1434 7.561356 TCTCACTTCTGGAAGATATCACACATA 59.439 37.037 16.06 0.00 46.36 2.29
1127 1453 2.007360 AGTTTCTCTGATGAGCAGCG 57.993 50.000 0.00 0.00 44.52 5.18
1137 1463 2.001361 ATGAGCAGCGAATTGGCAGC 62.001 55.000 19.73 19.73 44.71 5.25
1148 1474 0.899717 ATTGGCAGCGGTGGATTTGT 60.900 50.000 17.54 0.00 0.00 2.83
1155 1481 1.862602 GCGGTGGATTTGTGGTGGTC 61.863 60.000 0.00 0.00 0.00 4.02
1160 1486 4.444306 CGGTGGATTTGTGGTGGTCTATAT 60.444 45.833 0.00 0.00 0.00 0.86
1273 1607 5.654209 GGGAAAGCTTGAGAATAGGATTGTT 59.346 40.000 0.00 0.00 0.00 2.83
1284 1788 2.270352 AGGATTGTTGCCGTGAAGAA 57.730 45.000 0.00 0.00 0.00 2.52
1297 1801 4.503910 CCGTGAAGAAGATGTCCAATACA 58.496 43.478 0.00 0.00 43.86 2.29
1375 1879 7.971455 AGCACAAAAATATAGTACGGTTTCTC 58.029 34.615 0.00 0.00 0.00 2.87
1378 1882 7.063780 CACAAAAATATAGTACGGTTTCTCGGT 59.936 37.037 0.00 0.00 0.00 4.69
1417 1921 5.127491 CAAGGTAGTGTGGAAAGGTACAAA 58.873 41.667 0.00 0.00 0.00 2.83
1453 1957 3.008157 TGGCGGATGTACAAGAAAGGTTA 59.992 43.478 0.00 0.00 0.00 2.85
1476 1980 6.463995 ACTCTGCTTTGAGTATCTTCCTAG 57.536 41.667 5.95 0.00 44.53 3.02
1480 1984 5.519808 TGCTTTGAGTATCTTCCTAGAGGA 58.480 41.667 0.00 0.00 43.73 3.71
1530 2047 6.663093 AGGATCATGTGGCATGTAAAGTTTTA 59.337 34.615 8.68 0.00 0.00 1.52
1583 2201 1.783071 TGTACTCCATCCCGCATACA 58.217 50.000 0.00 0.00 0.00 2.29
1584 2202 2.325484 TGTACTCCATCCCGCATACAT 58.675 47.619 0.00 0.00 0.00 2.29
1586 2204 2.260844 ACTCCATCCCGCATACATTG 57.739 50.000 0.00 0.00 0.00 2.82
1588 2206 2.146342 CTCCATCCCGCATACATTGTC 58.854 52.381 0.00 0.00 0.00 3.18
1590 2208 2.172505 TCCATCCCGCATACATTGTCTT 59.827 45.455 0.00 0.00 0.00 3.01
1591 2209 3.389656 TCCATCCCGCATACATTGTCTTA 59.610 43.478 0.00 0.00 0.00 2.10
1592 2210 4.041567 TCCATCCCGCATACATTGTCTTAT 59.958 41.667 0.00 0.00 0.00 1.73
1593 2211 5.247337 TCCATCCCGCATACATTGTCTTATA 59.753 40.000 0.00 0.00 0.00 0.98
1594 2212 5.937540 CCATCCCGCATACATTGTCTTATAA 59.062 40.000 0.00 0.00 0.00 0.98
1596 2214 5.919755 TCCCGCATACATTGTCTTATAACA 58.080 37.500 0.00 0.00 0.00 2.41
1597 2215 6.530120 TCCCGCATACATTGTCTTATAACAT 58.470 36.000 0.00 0.00 0.00 2.71
1598 2216 6.649141 TCCCGCATACATTGTCTTATAACATC 59.351 38.462 0.00 0.00 0.00 3.06
1599 2217 6.128282 CCCGCATACATTGTCTTATAACATCC 60.128 42.308 0.00 0.00 0.00 3.51
1601 2219 6.401047 CGCATACATTGTCTTATAACATCCCG 60.401 42.308 0.00 0.00 0.00 5.14
1604 2240 5.376625 ACATTGTCTTATAACATCCCGCAT 58.623 37.500 0.00 0.00 0.00 4.73
1609 2245 5.756347 TGTCTTATAACATCCCGCATACAAC 59.244 40.000 0.00 0.00 0.00 3.32
1619 2255 5.149973 TCCCGCATACAACACTAAACTTA 57.850 39.130 0.00 0.00 0.00 2.24
1622 2258 5.063060 CCCGCATACAACACTAAACTTACTC 59.937 44.000 0.00 0.00 0.00 2.59
1627 2263 9.032420 GCATACAACACTAAACTTACTCTATCC 57.968 37.037 0.00 0.00 0.00 2.59
1634 2270 7.894364 ACACTAAACTTACTCTATCCTCTTCCA 59.106 37.037 0.00 0.00 0.00 3.53
1639 2275 6.494952 ACTTACTCTATCCTCTTCCACTTCA 58.505 40.000 0.00 0.00 0.00 3.02
1640 2276 6.954684 ACTTACTCTATCCTCTTCCACTTCAA 59.045 38.462 0.00 0.00 0.00 2.69
1698 2334 6.476706 GCTACCAAATTATCACAGGAATTTGC 59.523 38.462 12.44 1.25 45.44 3.68
1728 2364 7.201848 GGGTTGCATCATCTTCATCAGAATAAA 60.202 37.037 0.00 0.00 34.16 1.40
1752 2388 3.173151 TGTCCACTTAGATCTGAAGCCA 58.827 45.455 5.18 0.00 0.00 4.75
1765 2401 3.879295 TCTGAAGCCAGCAAATATACTGC 59.121 43.478 2.19 2.19 40.20 4.40
1794 2430 7.126726 TGATAATTTTGTCCCAAAAATTGCG 57.873 32.000 14.69 0.00 45.06 4.85
1809 2445 4.552166 AATTGCGGATTTTGGTCTATCG 57.448 40.909 0.00 0.00 0.00 2.92
1811 2447 3.254470 TGCGGATTTTGGTCTATCGAA 57.746 42.857 0.00 0.00 0.00 3.71
1814 2450 4.142116 TGCGGATTTTGGTCTATCGAAGTA 60.142 41.667 0.00 0.00 0.00 2.24
1820 2456 6.476243 TTTTGGTCTATCGAAGTACTTTGC 57.524 37.500 16.88 1.32 0.00 3.68
1848 2484 3.761752 TGCAAAGCCAGGTTATTACTTCC 59.238 43.478 0.00 0.00 0.00 3.46
1850 2486 4.142381 GCAAAGCCAGGTTATTACTTCCAG 60.142 45.833 0.00 0.00 0.00 3.86
1878 2662 5.534654 TGGAACATTGTAAGTTTGCTAAGCT 59.465 36.000 0.00 0.00 0.00 3.74
1953 2778 3.233507 ACCTTGCTCAACCAATCACATT 58.766 40.909 0.00 0.00 0.00 2.71
1999 2824 4.535526 ATGGCACCAGAATTTTGTAACC 57.464 40.909 0.00 0.00 0.00 2.85
2000 2825 3.300388 TGGCACCAGAATTTTGTAACCA 58.700 40.909 0.00 0.00 0.00 3.67
2019 2844 5.353394 ACCATACTGAAATCACATACCGT 57.647 39.130 0.00 0.00 0.00 4.83
2028 2853 6.277605 TGAAATCACATACCGTCATTCGTAT 58.722 36.000 0.00 0.00 37.94 3.06
2046 2871 4.099120 CGTATCGGCTTGATATCTACAGC 58.901 47.826 3.98 8.63 41.49 4.40
2052 2877 3.071602 GGCTTGATATCTACAGCCTTGGA 59.928 47.826 23.53 0.00 39.18 3.53
2055 2880 5.686124 GCTTGATATCTACAGCCTTGGAGTT 60.686 44.000 3.98 0.00 36.57 3.01
2064 2889 8.034313 TCTACAGCCTTGGAGTTATAATCATT 57.966 34.615 0.00 0.00 36.57 2.57
2067 2892 7.118723 ACAGCCTTGGAGTTATAATCATTGAA 58.881 34.615 0.00 0.00 0.00 2.69
2088 2913 0.611714 TACTCACCGGAAAGAAGGGC 59.388 55.000 9.46 0.00 0.00 5.19
2146 3006 6.790825 GTCTTCTTTCGAAAATAAAGACCGTG 59.209 38.462 28.81 11.69 41.43 4.94
2155 3015 6.362283 CGAAAATAAAGACCGTGCTTCAAAAT 59.638 34.615 0.00 0.00 0.00 1.82
2161 3021 3.569701 AGACCGTGCTTCAAAATCAATGT 59.430 39.130 0.00 0.00 0.00 2.71
2180 3040 8.621532 TCAATGTATTACTTGCTTCTCTTGTT 57.378 30.769 0.00 0.00 0.00 2.83
2198 3058 5.234972 TCTTGTTAGATGCAGCATAATGTCG 59.765 40.000 8.22 0.00 0.00 4.35
2246 4567 8.780616 AATGAACCATGGACCATATATTTTGA 57.219 30.769 21.47 0.00 0.00 2.69
2249 4570 7.285172 TGAACCATGGACCATATATTTTGACTG 59.715 37.037 21.47 0.00 0.00 3.51
2253 4574 8.355169 CCATGGACCATATATTTTGACTGAAAG 58.645 37.037 5.56 0.00 42.29 2.62
2268 4589 7.652524 TGACTGAAAGACTTAGAGATGCTAT 57.347 36.000 0.00 0.00 37.43 2.97
2269 4590 7.487484 TGACTGAAAGACTTAGAGATGCTATG 58.513 38.462 0.00 0.00 37.43 2.23
2303 4624 8.935614 AATACTAAAACTAGGCTTTGAACCTT 57.064 30.769 0.00 0.00 38.81 3.50
2304 4625 8.935614 ATACTAAAACTAGGCTTTGAACCTTT 57.064 30.769 0.00 0.00 38.81 3.11
2307 4628 5.707242 AAACTAGGCTTTGAACCTTTAGC 57.293 39.130 0.00 0.00 38.81 3.09
2308 4629 3.335579 ACTAGGCTTTGAACCTTTAGCG 58.664 45.455 0.00 0.00 38.81 4.26
2309 4630 1.534729 AGGCTTTGAACCTTTAGCGG 58.465 50.000 0.00 0.00 31.87 5.52
2310 4631 1.073284 AGGCTTTGAACCTTTAGCGGA 59.927 47.619 0.00 0.00 31.87 5.54
2311 4632 2.092323 GGCTTTGAACCTTTAGCGGAT 58.908 47.619 0.00 0.00 34.50 4.18
2312 4633 2.159379 GGCTTTGAACCTTTAGCGGATG 60.159 50.000 0.00 0.00 34.50 3.51
2313 4634 2.159379 GCTTTGAACCTTTAGCGGATGG 60.159 50.000 0.00 0.00 0.00 3.51
2314 4635 3.343617 CTTTGAACCTTTAGCGGATGGA 58.656 45.455 0.00 0.00 0.00 3.41
2315 4636 3.426787 TTGAACCTTTAGCGGATGGAA 57.573 42.857 0.00 0.00 0.00 3.53
2316 4637 3.426787 TGAACCTTTAGCGGATGGAAA 57.573 42.857 0.00 0.00 0.00 3.13
2317 4638 3.343617 TGAACCTTTAGCGGATGGAAAG 58.656 45.455 0.00 0.00 0.00 2.62
2318 4639 1.751437 ACCTTTAGCGGATGGAAAGC 58.249 50.000 0.00 0.00 0.00 3.51
2319 4640 1.004277 ACCTTTAGCGGATGGAAAGCA 59.996 47.619 0.00 0.00 0.00 3.91
2320 4641 1.401905 CCTTTAGCGGATGGAAAGCAC 59.598 52.381 0.00 0.00 0.00 4.40
2321 4642 1.401905 CTTTAGCGGATGGAAAGCACC 59.598 52.381 0.00 0.00 0.00 5.01
2322 4643 0.742990 TTAGCGGATGGAAAGCACCG 60.743 55.000 0.00 0.00 46.74 4.94
2323 4644 1.609635 TAGCGGATGGAAAGCACCGA 61.610 55.000 0.00 0.00 46.94 4.69
2324 4645 2.750888 GCGGATGGAAAGCACCGAC 61.751 63.158 0.00 0.00 46.94 4.79
2325 4646 1.375396 CGGATGGAAAGCACCGACA 60.375 57.895 0.00 0.00 46.94 4.35
2326 4647 0.953471 CGGATGGAAAGCACCGACAA 60.953 55.000 0.00 0.00 46.94 3.18
2327 4648 0.521735 GGATGGAAAGCACCGACAAC 59.478 55.000 0.00 0.00 0.00 3.32
2328 4649 1.523758 GATGGAAAGCACCGACAACT 58.476 50.000 0.00 0.00 0.00 3.16
2329 4650 1.464997 GATGGAAAGCACCGACAACTC 59.535 52.381 0.00 0.00 0.00 3.01
2330 4651 0.468226 TGGAAAGCACCGACAACTCT 59.532 50.000 0.00 0.00 0.00 3.24
2331 4652 1.689813 TGGAAAGCACCGACAACTCTA 59.310 47.619 0.00 0.00 0.00 2.43
2332 4653 2.067013 GGAAAGCACCGACAACTCTAC 58.933 52.381 0.00 0.00 0.00 2.59
2333 4654 2.067013 GAAAGCACCGACAACTCTACC 58.933 52.381 0.00 0.00 0.00 3.18
2334 4655 1.045407 AAGCACCGACAACTCTACCA 58.955 50.000 0.00 0.00 0.00 3.25
2335 4656 0.317479 AGCACCGACAACTCTACCAC 59.683 55.000 0.00 0.00 0.00 4.16
2336 4657 0.032952 GCACCGACAACTCTACCACA 59.967 55.000 0.00 0.00 0.00 4.17
2337 4658 1.779569 CACCGACAACTCTACCACAC 58.220 55.000 0.00 0.00 0.00 3.82
2338 4659 1.340248 CACCGACAACTCTACCACACT 59.660 52.381 0.00 0.00 0.00 3.55
2339 4660 2.037144 ACCGACAACTCTACCACACTT 58.963 47.619 0.00 0.00 0.00 3.16
2340 4661 2.035576 ACCGACAACTCTACCACACTTC 59.964 50.000 0.00 0.00 0.00 3.01
2341 4662 2.035449 CCGACAACTCTACCACACTTCA 59.965 50.000 0.00 0.00 0.00 3.02
2342 4663 3.491964 CCGACAACTCTACCACACTTCAA 60.492 47.826 0.00 0.00 0.00 2.69
2343 4664 3.736252 CGACAACTCTACCACACTTCAAG 59.264 47.826 0.00 0.00 0.00 3.02
2344 4665 4.499188 CGACAACTCTACCACACTTCAAGA 60.499 45.833 0.00 0.00 0.00 3.02
2345 4666 4.950050 ACAACTCTACCACACTTCAAGAG 58.050 43.478 0.00 0.00 39.65 2.85
2346 4667 4.202264 ACAACTCTACCACACTTCAAGAGG 60.202 45.833 0.00 0.00 38.38 3.69
2347 4668 3.577919 ACTCTACCACACTTCAAGAGGT 58.422 45.455 0.00 0.00 38.38 3.85
2348 4669 3.322254 ACTCTACCACACTTCAAGAGGTG 59.678 47.826 10.34 10.34 43.14 4.00
2349 4670 2.632996 TCTACCACACTTCAAGAGGTGG 59.367 50.000 23.13 23.13 45.10 4.61
2350 4671 1.213296 ACCACACTTCAAGAGGTGGT 58.787 50.000 24.13 24.13 46.35 4.16
2351 4672 2.348411 CCACACTTCAAGAGGTGGTT 57.652 50.000 19.01 0.00 41.98 3.67
2352 4673 2.222027 CCACACTTCAAGAGGTGGTTC 58.778 52.381 19.01 0.00 41.98 3.62
2353 4674 2.421388 CCACACTTCAAGAGGTGGTTCA 60.421 50.000 19.01 0.00 41.98 3.18
2354 4675 3.278574 CACACTTCAAGAGGTGGTTCAA 58.721 45.455 15.41 0.00 41.98 2.69
2355 4676 3.065371 CACACTTCAAGAGGTGGTTCAAC 59.935 47.826 15.41 0.00 41.98 3.18
2356 4677 2.618709 CACTTCAAGAGGTGGTTCAACC 59.381 50.000 0.00 0.00 40.85 3.77
2368 4689 4.554960 TGGTTCAACCATATGTACGGAA 57.445 40.909 4.67 0.00 44.79 4.30
2369 4690 4.509616 TGGTTCAACCATATGTACGGAAG 58.490 43.478 4.67 0.00 44.79 3.46
2370 4691 3.875134 GGTTCAACCATATGTACGGAAGG 59.125 47.826 0.01 0.00 38.42 3.46
2371 4692 4.510571 GTTCAACCATATGTACGGAAGGT 58.489 43.478 1.24 0.00 0.00 3.50
2372 4693 4.829872 TCAACCATATGTACGGAAGGTT 57.170 40.909 1.24 6.75 39.76 3.50
2373 4694 4.875544 CAACCATATGTACGGAAGGTTG 57.124 45.455 19.08 19.08 46.63 3.77
2374 4695 4.829872 AACCATATGTACGGAAGGTTGA 57.170 40.909 10.59 0.00 37.90 3.18
2375 4696 4.829872 ACCATATGTACGGAAGGTTGAA 57.170 40.909 1.24 0.00 0.00 2.69
2376 4697 4.510571 ACCATATGTACGGAAGGTTGAAC 58.489 43.478 1.24 0.00 0.00 3.18
2377 4698 4.224370 ACCATATGTACGGAAGGTTGAACT 59.776 41.667 1.24 0.00 0.00 3.01
2378 4699 5.422970 ACCATATGTACGGAAGGTTGAACTA 59.577 40.000 1.24 0.00 0.00 2.24
2379 4700 5.751990 CCATATGTACGGAAGGTTGAACTAC 59.248 44.000 1.24 0.00 0.00 2.73
2380 4701 4.877378 ATGTACGGAAGGTTGAACTACA 57.123 40.909 0.00 0.00 0.00 2.74
2381 4702 4.669206 TGTACGGAAGGTTGAACTACAA 57.331 40.909 0.00 0.00 36.02 2.41
2400 4721 7.568267 CTACAACTGTAGTACTGTCATGTTG 57.432 40.000 17.55 23.14 42.22 3.33
2401 4722 4.750098 ACAACTGTAGTACTGTCATGTTGC 59.250 41.667 23.78 0.00 37.59 4.17
2402 4723 3.575630 ACTGTAGTACTGTCATGTTGCG 58.424 45.455 5.39 0.00 0.00 4.85
2403 4724 2.333926 TGTAGTACTGTCATGTTGCGC 58.666 47.619 5.39 0.00 0.00 6.09
2404 4725 1.659098 GTAGTACTGTCATGTTGCGCC 59.341 52.381 4.18 0.00 0.00 6.53
2405 4726 0.034756 AGTACTGTCATGTTGCGCCA 59.965 50.000 4.18 0.00 0.00 5.69
2406 4727 0.871722 GTACTGTCATGTTGCGCCAA 59.128 50.000 4.18 0.00 0.00 4.52
2407 4728 1.468520 GTACTGTCATGTTGCGCCAAT 59.531 47.619 4.18 0.00 0.00 3.16
2408 4729 1.819928 ACTGTCATGTTGCGCCAATA 58.180 45.000 4.18 0.00 0.00 1.90
2409 4730 2.368439 ACTGTCATGTTGCGCCAATAT 58.632 42.857 4.18 0.17 0.00 1.28
2410 4731 2.754552 ACTGTCATGTTGCGCCAATATT 59.245 40.909 4.18 0.00 0.00 1.28
2411 4732 3.193267 ACTGTCATGTTGCGCCAATATTT 59.807 39.130 4.18 0.00 0.00 1.40
2412 4733 4.397730 ACTGTCATGTTGCGCCAATATTTA 59.602 37.500 4.18 0.00 0.00 1.40
2413 4734 4.919206 TGTCATGTTGCGCCAATATTTAG 58.081 39.130 4.18 0.00 0.00 1.85
2414 4735 3.730715 GTCATGTTGCGCCAATATTTAGC 59.269 43.478 4.18 0.00 0.00 3.09
2415 4736 3.379688 TCATGTTGCGCCAATATTTAGCA 59.620 39.130 4.18 6.60 35.90 3.49
2416 4737 3.143807 TGTTGCGCCAATATTTAGCAC 57.856 42.857 4.18 0.00 37.57 4.40
2417 4738 2.159310 TGTTGCGCCAATATTTAGCACC 60.159 45.455 4.18 3.79 37.57 5.01
2418 4739 2.051334 TGCGCCAATATTTAGCACCT 57.949 45.000 4.18 0.00 32.43 4.00
2419 4740 1.946768 TGCGCCAATATTTAGCACCTC 59.053 47.619 4.18 0.00 32.43 3.85
2420 4741 1.946768 GCGCCAATATTTAGCACCTCA 59.053 47.619 0.00 0.00 0.00 3.86
2421 4742 2.357637 GCGCCAATATTTAGCACCTCAA 59.642 45.455 0.00 0.00 0.00 3.02
2422 4743 3.181491 GCGCCAATATTTAGCACCTCAAA 60.181 43.478 0.00 0.00 0.00 2.69
2423 4744 4.676723 GCGCCAATATTTAGCACCTCAAAA 60.677 41.667 0.00 0.00 0.00 2.44
2424 4745 5.591099 CGCCAATATTTAGCACCTCAAAAT 58.409 37.500 7.75 0.00 0.00 1.82
2434 4755 3.569701 AGCACCTCAAAATCACACGAATT 59.430 39.130 0.00 0.00 0.00 2.17
2440 4761 6.653320 ACCTCAAAATCACACGAATTAGCTTA 59.347 34.615 0.00 0.00 0.00 3.09
2453 4774 7.277981 CACGAATTAGCTTATTTGTGTAGGAGT 59.722 37.037 26.98 1.41 41.72 3.85
2454 4775 7.277981 ACGAATTAGCTTATTTGTGTAGGAGTG 59.722 37.037 15.81 0.00 32.22 3.51
2455 4776 7.254455 CGAATTAGCTTATTTGTGTAGGAGTGG 60.254 40.741 0.00 0.00 0.00 4.00
2461 4782 0.768622 TTGTGTAGGAGTGGGGTTGG 59.231 55.000 0.00 0.00 0.00 3.77
2462 4783 0.104882 TGTGTAGGAGTGGGGTTGGA 60.105 55.000 0.00 0.00 0.00 3.53
2478 4799 3.624777 GTTGGACAATCTCATCACCCAT 58.375 45.455 0.00 0.00 0.00 4.00
2498 4819 4.399303 CCATTGTCCAAGTTATCTCCAACC 59.601 45.833 0.00 0.00 0.00 3.77
2499 4820 4.993705 TTGTCCAAGTTATCTCCAACCT 57.006 40.909 0.00 0.00 0.00 3.50
2503 4824 5.163141 TGTCCAAGTTATCTCCAACCTGAAA 60.163 40.000 0.00 0.00 0.00 2.69
2507 4828 7.508977 TCCAAGTTATCTCCAACCTGAAATTTT 59.491 33.333 0.00 0.00 0.00 1.82
2511 4832 9.093458 AGTTATCTCCAACCTGAAATTTTGAAT 57.907 29.630 0.00 0.00 0.00 2.57
2548 4872 9.010029 GGTTGAATTGATACTTAGTTTCTTCCA 57.990 33.333 4.61 0.00 0.00 3.53
2564 4888 9.300681 AGTTTCTTCCAATATGTCAGATGAAAA 57.699 29.630 0.00 0.00 35.48 2.29
2571 4895 7.006509 CCAATATGTCAGATGAAAATAGGGGT 58.993 38.462 0.00 0.00 0.00 4.95
2572 4896 7.040201 CCAATATGTCAGATGAAAATAGGGGTG 60.040 40.741 0.00 0.00 0.00 4.61
2592 4916 1.538047 CACCCCAGTCATGTTCTTGG 58.462 55.000 0.00 0.00 0.00 3.61
2631 4964 9.554724 TTAGTTCGAAATCTTAATTGATGTTGC 57.445 29.630 0.00 0.00 0.00 4.17
2642 4975 8.629158 TCTTAATTGATGTTGCTTTGTGTAAGT 58.371 29.630 0.00 0.00 36.19 2.24
2664 4997 0.615850 TTGACATCATGTACGGGGCA 59.384 50.000 0.00 0.00 0.00 5.36
2667 5000 0.819259 ACATCATGTACGGGGCATGC 60.819 55.000 9.90 9.90 42.34 4.06
2671 5160 3.047807 ATGTACGGGGCATGCTGCT 62.048 57.895 18.92 0.25 44.28 4.24
2679 5168 1.154205 GGGCATGCTGCTGTACTACG 61.154 60.000 18.92 0.00 44.28 3.51
2690 5179 6.529125 TGCTGCTGTACTACGTACTTTAATTC 59.471 38.462 0.00 0.00 39.49 2.17
2710 5199 9.527157 TTAATTCCACATTTAGAAAGATGGTGA 57.473 29.630 0.00 0.81 31.88 4.02
2711 5200 8.421249 AATTCCACATTTAGAAAGATGGTGAA 57.579 30.769 0.00 0.00 31.88 3.18
2749 5239 8.610248 TCAGAAATTCAATTTGTAGGTCGTTA 57.390 30.769 0.00 0.00 31.47 3.18
2767 5257 6.017687 GGTCGTTAAAAGTTGGAGTAACATGT 60.018 38.462 0.00 0.00 41.88 3.21
2781 5271 6.128172 GGAGTAACATGTTGGAGAAATCACAG 60.128 42.308 21.42 0.00 0.00 3.66
2785 5275 3.490439 TGTTGGAGAAATCACAGAGCA 57.510 42.857 0.00 0.00 0.00 4.26
2793 5283 5.412594 GGAGAAATCACAGAGCAATGTACAA 59.587 40.000 0.00 0.00 0.00 2.41
2835 5325 5.204292 TGTGCTGAGATAGGAATAGAGTGT 58.796 41.667 0.00 0.00 0.00 3.55
2836 5326 5.068329 TGTGCTGAGATAGGAATAGAGTGTG 59.932 44.000 0.00 0.00 0.00 3.82
2851 5341 0.935196 GTGTGTCGACTTCAACCCAC 59.065 55.000 17.92 4.33 0.00 4.61
2932 5422 4.379813 GCGGATATATCAAAACTGGCATGG 60.380 45.833 14.60 0.00 0.00 3.66
2943 5433 3.222173 ACTGGCATGGTTACTTCACAA 57.778 42.857 0.00 0.00 0.00 3.33
2953 5444 7.094549 GCATGGTTACTTCACAACAGGTAAATA 60.095 37.037 0.00 0.00 0.00 1.40
2957 5448 8.843262 GGTTACTTCACAACAGGTAAATAACTT 58.157 33.333 0.00 0.00 0.00 2.66
2960 5451 6.204108 ACTTCACAACAGGTAAATAACTTCCG 59.796 38.462 0.00 0.00 0.00 4.30
2961 5452 4.998672 TCACAACAGGTAAATAACTTCCGG 59.001 41.667 0.00 0.00 0.00 5.14
2963 5454 4.041938 ACAACAGGTAAATAACTTCCGGGA 59.958 41.667 0.00 0.00 0.00 5.14
2973 5464 0.541863 ACTTCCGGGACATCCATGAC 59.458 55.000 0.00 0.00 37.91 3.06
2984 5475 1.073444 CATCCATGACATCCCTCCCAG 59.927 57.143 0.00 0.00 0.00 4.45
2994 5489 5.015813 ACATCCCTCCCAGAAAAATCTTT 57.984 39.130 0.00 0.00 0.00 2.52
2995 5490 5.406163 ACATCCCTCCCAGAAAAATCTTTT 58.594 37.500 0.00 0.00 0.00 2.27
2998 5493 5.654370 TCCCTCCCAGAAAAATCTTTTGAT 58.346 37.500 0.00 0.00 41.73 2.57
3001 5496 6.212187 CCCTCCCAGAAAAATCTTTTGATCTT 59.788 38.462 0.00 0.00 38.40 2.40
3019 5514 5.355071 TGATCTTGTGTACATCTCCATTTGC 59.645 40.000 0.00 0.00 0.00 3.68
3032 5528 1.788308 CCATTTGCACTTTGTTGCTCG 59.212 47.619 0.00 0.00 43.41 5.03
3033 5529 2.462889 CATTTGCACTTTGTTGCTCGT 58.537 42.857 0.00 0.00 43.41 4.18
3037 5533 0.110192 GCACTTTGTTGCTCGTAGCC 60.110 55.000 4.73 0.00 41.51 3.93
3047 5543 0.597118 GCTCGTAGCCAGCAGATGAG 60.597 60.000 8.63 8.63 36.82 2.90
3048 5544 0.597118 CTCGTAGCCAGCAGATGAGC 60.597 60.000 0.00 0.00 0.00 4.26
3064 5560 6.603940 AGATGAGCTGAAGTCTTCTTAACT 57.396 37.500 13.67 5.71 33.64 2.24
3066 5562 4.887748 TGAGCTGAAGTCTTCTTAACTGG 58.112 43.478 13.67 0.00 33.64 4.00
3068 5564 5.163301 TGAGCTGAAGTCTTCTTAACTGGTT 60.163 40.000 13.67 0.00 33.64 3.67
3069 5565 6.041637 TGAGCTGAAGTCTTCTTAACTGGTTA 59.958 38.462 13.67 0.00 33.64 2.85
3070 5566 7.010339 AGCTGAAGTCTTCTTAACTGGTTAT 57.990 36.000 13.67 0.00 33.64 1.89
3071 5567 8.135382 AGCTGAAGTCTTCTTAACTGGTTATA 57.865 34.615 13.67 0.00 33.64 0.98
3072 5568 8.763601 AGCTGAAGTCTTCTTAACTGGTTATAT 58.236 33.333 13.67 0.00 33.64 0.86
3073 5569 8.821894 GCTGAAGTCTTCTTAACTGGTTATATG 58.178 37.037 13.67 0.00 33.64 1.78
3074 5570 9.319143 CTGAAGTCTTCTTAACTGGTTATATGG 57.681 37.037 13.67 0.00 33.64 2.74
3075 5571 9.042450 TGAAGTCTTCTTAACTGGTTATATGGA 57.958 33.333 13.67 0.00 33.64 3.41
3077 5573 9.838339 AAGTCTTCTTAACTGGTTATATGGATG 57.162 33.333 0.00 0.00 31.46 3.51
3078 5574 7.934120 AGTCTTCTTAACTGGTTATATGGATGC 59.066 37.037 0.00 0.00 0.00 3.91
3079 5575 7.715249 GTCTTCTTAACTGGTTATATGGATGCA 59.285 37.037 0.00 0.00 0.00 3.96
3080 5576 7.715249 TCTTCTTAACTGGTTATATGGATGCAC 59.285 37.037 0.00 0.00 0.00 4.57
3081 5577 6.894682 TCTTAACTGGTTATATGGATGCACA 58.105 36.000 0.00 0.00 0.00 4.57
3082 5578 7.517320 TCTTAACTGGTTATATGGATGCACAT 58.483 34.615 0.00 0.00 34.90 3.21
3083 5579 7.998383 TCTTAACTGGTTATATGGATGCACATT 59.002 33.333 0.00 0.00 32.39 2.71
3084 5580 6.395426 AACTGGTTATATGGATGCACATTG 57.605 37.500 0.00 0.00 32.39 2.82
3085 5581 5.448654 ACTGGTTATATGGATGCACATTGT 58.551 37.500 0.00 0.00 32.39 2.71
3086 5582 5.893255 ACTGGTTATATGGATGCACATTGTT 59.107 36.000 0.00 0.00 32.39 2.83
3087 5583 7.059788 ACTGGTTATATGGATGCACATTGTTA 58.940 34.615 0.00 0.00 32.39 2.41
3088 5584 7.013274 ACTGGTTATATGGATGCACATTGTTAC 59.987 37.037 0.00 0.00 32.39 2.50
3089 5585 6.830838 TGGTTATATGGATGCACATTGTTACA 59.169 34.615 0.00 0.00 32.39 2.41
3090 5586 7.505248 TGGTTATATGGATGCACATTGTTACAT 59.495 33.333 0.00 2.47 32.39 2.29
3091 5587 7.809331 GGTTATATGGATGCACATTGTTACATG 59.191 37.037 6.77 0.00 32.39 3.21
3092 5588 8.567104 GTTATATGGATGCACATTGTTACATGA 58.433 33.333 0.00 0.00 32.39 3.07
3093 5589 4.700268 TGGATGCACATTGTTACATGAC 57.300 40.909 0.00 0.00 0.00 3.06
3094 5590 3.126686 TGGATGCACATTGTTACATGACG 59.873 43.478 0.00 0.00 0.00 4.35
3095 5591 3.373748 GGATGCACATTGTTACATGACGA 59.626 43.478 0.00 0.00 0.00 4.20
3096 5592 3.804518 TGCACATTGTTACATGACGAC 57.195 42.857 0.00 0.00 0.00 4.34
3097 5593 3.134458 TGCACATTGTTACATGACGACA 58.866 40.909 0.00 0.00 0.00 4.35
3098 5594 3.750652 TGCACATTGTTACATGACGACAT 59.249 39.130 0.00 0.00 37.19 3.06
3099 5595 4.932200 TGCACATTGTTACATGACGACATA 59.068 37.500 0.00 0.00 35.09 2.29
3100 5596 5.409826 TGCACATTGTTACATGACGACATAA 59.590 36.000 0.00 0.00 35.09 1.90
3101 5597 5.959527 GCACATTGTTACATGACGACATAAG 59.040 40.000 0.00 0.00 35.09 1.73
3102 5598 5.959527 CACATTGTTACATGACGACATAAGC 59.040 40.000 0.00 0.00 35.09 3.09
3103 5599 5.064707 ACATTGTTACATGACGACATAAGCC 59.935 40.000 0.00 0.00 35.09 4.35
3104 5600 4.195225 TGTTACATGACGACATAAGCCA 57.805 40.909 0.00 0.00 35.09 4.75
3105 5601 4.570930 TGTTACATGACGACATAAGCCAA 58.429 39.130 0.00 0.00 35.09 4.52
3106 5602 4.998033 TGTTACATGACGACATAAGCCAAA 59.002 37.500 0.00 0.00 35.09 3.28
3107 5603 5.470437 TGTTACATGACGACATAAGCCAAAA 59.530 36.000 0.00 0.00 35.09 2.44
3108 5604 4.685169 ACATGACGACATAAGCCAAAAG 57.315 40.909 0.00 0.00 35.09 2.27
3109 5605 3.119849 ACATGACGACATAAGCCAAAAGC 60.120 43.478 0.00 0.00 37.13 3.51
3110 5606 1.810151 TGACGACATAAGCCAAAAGCC 59.190 47.619 0.00 0.00 45.47 4.35
3111 5607 1.810151 GACGACATAAGCCAAAAGCCA 59.190 47.619 0.00 0.00 45.47 4.75
3112 5608 2.227865 GACGACATAAGCCAAAAGCCAA 59.772 45.455 0.00 0.00 45.47 4.52
3113 5609 2.625790 ACGACATAAGCCAAAAGCCAAA 59.374 40.909 0.00 0.00 45.47 3.28
3114 5610 3.244976 CGACATAAGCCAAAAGCCAAAG 58.755 45.455 0.00 0.00 45.47 2.77
3115 5611 3.305335 CGACATAAGCCAAAAGCCAAAGT 60.305 43.478 0.00 0.00 45.47 2.66
3116 5612 4.237724 GACATAAGCCAAAAGCCAAAGTC 58.762 43.478 0.00 0.00 45.47 3.01
3117 5613 3.640967 ACATAAGCCAAAAGCCAAAGTCA 59.359 39.130 0.00 0.00 45.47 3.41
3118 5614 4.100808 ACATAAGCCAAAAGCCAAAGTCAA 59.899 37.500 0.00 0.00 45.47 3.18
3119 5615 3.625649 AAGCCAAAAGCCAAAGTCAAA 57.374 38.095 0.00 0.00 45.47 2.69
3120 5616 3.625649 AGCCAAAAGCCAAAGTCAAAA 57.374 38.095 0.00 0.00 45.47 2.44
3121 5617 3.534554 AGCCAAAAGCCAAAGTCAAAAG 58.465 40.909 0.00 0.00 45.47 2.27
3122 5618 2.032054 GCCAAAAGCCAAAGTCAAAAGC 59.968 45.455 0.00 0.00 34.35 3.51
3123 5619 3.534554 CCAAAAGCCAAAGTCAAAAGCT 58.465 40.909 0.00 0.00 34.64 3.74
3124 5620 3.557185 CCAAAAGCCAAAGTCAAAAGCTC 59.443 43.478 0.00 0.00 32.19 4.09
3125 5621 4.183101 CAAAAGCCAAAGTCAAAAGCTCA 58.817 39.130 0.00 0.00 32.19 4.26
3126 5622 3.443099 AAGCCAAAGTCAAAAGCTCAC 57.557 42.857 0.00 0.00 32.19 3.51
3127 5623 2.378038 AGCCAAAGTCAAAAGCTCACA 58.622 42.857 0.00 0.00 0.00 3.58
3128 5624 2.760092 AGCCAAAGTCAAAAGCTCACAA 59.240 40.909 0.00 0.00 0.00 3.33
3129 5625 3.195396 AGCCAAAGTCAAAAGCTCACAAA 59.805 39.130 0.00 0.00 0.00 2.83
3130 5626 4.122046 GCCAAAGTCAAAAGCTCACAAAT 58.878 39.130 0.00 0.00 0.00 2.32
3131 5627 5.068987 AGCCAAAGTCAAAAGCTCACAAATA 59.931 36.000 0.00 0.00 0.00 1.40
3132 5628 5.403466 GCCAAAGTCAAAAGCTCACAAATAG 59.597 40.000 0.00 0.00 0.00 1.73
3133 5629 5.922544 CCAAAGTCAAAAGCTCACAAATAGG 59.077 40.000 0.00 0.00 0.00 2.57
3134 5630 6.461509 CCAAAGTCAAAAGCTCACAAATAGGT 60.462 38.462 0.00 0.00 0.00 3.08
3135 5631 5.695851 AGTCAAAAGCTCACAAATAGGTG 57.304 39.130 0.00 0.00 40.16 4.00
3136 5632 4.022849 AGTCAAAAGCTCACAAATAGGTGC 60.023 41.667 0.00 0.00 38.66 5.01
3137 5633 4.022849 GTCAAAAGCTCACAAATAGGTGCT 60.023 41.667 0.00 0.00 38.66 4.40
3138 5634 4.584325 TCAAAAGCTCACAAATAGGTGCTT 59.416 37.500 0.00 0.00 41.67 3.91
3140 5636 5.535753 AAAGCTCACAAATAGGTGCTTTT 57.464 34.783 0.00 0.00 44.83 2.27
3141 5637 5.535753 AAGCTCACAAATAGGTGCTTTTT 57.464 34.783 0.00 0.00 37.46 1.94
3162 5658 4.615588 TTGGCTTTTAGGACAAAATGGG 57.384 40.909 0.00 0.00 30.45 4.00
3163 5659 3.850752 TGGCTTTTAGGACAAAATGGGA 58.149 40.909 0.00 0.00 0.00 4.37
3164 5660 4.227197 TGGCTTTTAGGACAAAATGGGAA 58.773 39.130 0.00 0.00 0.00 3.97
3165 5661 4.656112 TGGCTTTTAGGACAAAATGGGAAA 59.344 37.500 0.00 0.00 0.00 3.13
3166 5662 5.309282 TGGCTTTTAGGACAAAATGGGAAAT 59.691 36.000 0.00 0.00 0.00 2.17
3167 5663 5.874810 GGCTTTTAGGACAAAATGGGAAATC 59.125 40.000 0.00 0.00 0.00 2.17
3168 5664 5.874810 GCTTTTAGGACAAAATGGGAAATCC 59.125 40.000 0.00 0.00 0.00 3.01
3180 5676 4.864704 TGGGAAATCCAAAGTTAAGCAC 57.135 40.909 1.22 0.00 43.84 4.40
3181 5677 4.219115 TGGGAAATCCAAAGTTAAGCACA 58.781 39.130 1.22 0.00 43.84 4.57
3182 5678 4.651503 TGGGAAATCCAAAGTTAAGCACAA 59.348 37.500 1.22 0.00 43.84 3.33
3183 5679 4.988540 GGGAAATCCAAAGTTAAGCACAAC 59.011 41.667 1.22 0.00 37.91 3.32
3184 5680 4.988540 GGAAATCCAAAGTTAAGCACAACC 59.011 41.667 0.00 0.00 35.64 3.77
3185 5681 5.452636 GGAAATCCAAAGTTAAGCACAACCA 60.453 40.000 0.00 0.00 35.64 3.67
3186 5682 5.606348 AATCCAAAGTTAAGCACAACCAA 57.394 34.783 0.00 0.00 0.00 3.67
3187 5683 4.647424 TCCAAAGTTAAGCACAACCAAG 57.353 40.909 0.00 0.00 0.00 3.61
3188 5684 3.123050 CCAAAGTTAAGCACAACCAAGC 58.877 45.455 0.00 0.00 0.00 4.01
3189 5685 3.430098 CCAAAGTTAAGCACAACCAAGCA 60.430 43.478 0.00 0.00 0.00 3.91
3190 5686 3.436700 AAGTTAAGCACAACCAAGCAC 57.563 42.857 0.00 0.00 0.00 4.40
3191 5687 2.654863 AGTTAAGCACAACCAAGCACT 58.345 42.857 0.00 0.00 0.00 4.40
3192 5688 2.618709 AGTTAAGCACAACCAAGCACTC 59.381 45.455 0.00 0.00 0.00 3.51
3193 5689 1.604604 TAAGCACAACCAAGCACTCC 58.395 50.000 0.00 0.00 0.00 3.85
3194 5690 1.109323 AAGCACAACCAAGCACTCCC 61.109 55.000 0.00 0.00 0.00 4.30
3195 5691 1.529244 GCACAACCAAGCACTCCCT 60.529 57.895 0.00 0.00 0.00 4.20
3196 5692 1.518903 GCACAACCAAGCACTCCCTC 61.519 60.000 0.00 0.00 0.00 4.30
3197 5693 0.890996 CACAACCAAGCACTCCCTCC 60.891 60.000 0.00 0.00 0.00 4.30
3198 5694 1.352622 ACAACCAAGCACTCCCTCCA 61.353 55.000 0.00 0.00 0.00 3.86
3199 5695 0.890996 CAACCAAGCACTCCCTCCAC 60.891 60.000 0.00 0.00 0.00 4.02
3200 5696 2.069165 AACCAAGCACTCCCTCCACC 62.069 60.000 0.00 0.00 0.00 4.61
3201 5697 2.227036 CCAAGCACTCCCTCCACCT 61.227 63.158 0.00 0.00 0.00 4.00
3202 5698 1.763770 CAAGCACTCCCTCCACCTT 59.236 57.895 0.00 0.00 0.00 3.50
3203 5699 0.607489 CAAGCACTCCCTCCACCTTG 60.607 60.000 0.00 0.00 0.00 3.61
3204 5700 2.360475 GCACTCCCTCCACCTTGC 60.360 66.667 0.00 0.00 0.00 4.01
3205 5701 2.900106 GCACTCCCTCCACCTTGCT 61.900 63.158 0.00 0.00 0.00 3.91
3206 5702 1.002868 CACTCCCTCCACCTTGCTG 60.003 63.158 0.00 0.00 0.00 4.41
3207 5703 2.227036 ACTCCCTCCACCTTGCTGG 61.227 63.158 0.00 0.00 42.93 4.85
3208 5704 2.935481 TCCCTCCACCTTGCTGGG 60.935 66.667 0.00 0.00 41.11 4.45
3209 5705 2.935481 CCCTCCACCTTGCTGGGA 60.935 66.667 2.69 0.00 40.23 4.37
3210 5706 2.311854 CCCTCCACCTTGCTGGGAT 61.312 63.158 2.69 0.00 40.23 3.85
3211 5707 1.693640 CCTCCACCTTGCTGGGATT 59.306 57.895 2.69 0.00 41.11 3.01
3212 5708 0.040204 CCTCCACCTTGCTGGGATTT 59.960 55.000 2.69 0.00 41.11 2.17
3213 5709 1.550869 CCTCCACCTTGCTGGGATTTT 60.551 52.381 2.69 0.00 41.11 1.82
3214 5710 2.291540 CCTCCACCTTGCTGGGATTTTA 60.292 50.000 2.69 0.00 41.11 1.52
3215 5711 2.755103 CTCCACCTTGCTGGGATTTTAC 59.245 50.000 2.69 0.00 41.11 2.01
3216 5712 2.378547 TCCACCTTGCTGGGATTTTACT 59.621 45.455 2.69 0.00 41.11 2.24
3217 5713 3.589735 TCCACCTTGCTGGGATTTTACTA 59.410 43.478 2.69 0.00 41.11 1.82
3218 5714 4.229582 TCCACCTTGCTGGGATTTTACTAT 59.770 41.667 2.69 0.00 41.11 2.12
3219 5715 4.339247 CCACCTTGCTGGGATTTTACTATG 59.661 45.833 2.69 0.00 41.11 2.23
3220 5716 5.192927 CACCTTGCTGGGATTTTACTATGA 58.807 41.667 2.69 0.00 41.11 2.15
3221 5717 5.652014 CACCTTGCTGGGATTTTACTATGAA 59.348 40.000 2.69 0.00 41.11 2.57
3222 5718 6.152661 CACCTTGCTGGGATTTTACTATGAAA 59.847 38.462 2.69 0.00 41.11 2.69
3223 5719 6.152831 ACCTTGCTGGGATTTTACTATGAAAC 59.847 38.462 2.69 0.00 41.11 2.78
3224 5720 6.378280 CCTTGCTGGGATTTTACTATGAAACT 59.622 38.462 0.00 0.00 0.00 2.66
3225 5721 7.556275 CCTTGCTGGGATTTTACTATGAAACTA 59.444 37.037 0.00 0.00 0.00 2.24
3226 5722 9.125026 CTTGCTGGGATTTTACTATGAAACTAT 57.875 33.333 0.00 0.00 0.00 2.12
3227 5723 8.450578 TGCTGGGATTTTACTATGAAACTATG 57.549 34.615 0.00 0.00 0.00 2.23
3228 5724 8.052748 TGCTGGGATTTTACTATGAAACTATGT 58.947 33.333 0.00 0.00 0.00 2.29
3229 5725 8.903820 GCTGGGATTTTACTATGAAACTATGTT 58.096 33.333 0.00 0.00 0.00 2.71
3232 5728 9.931210 GGGATTTTACTATGAAACTATGTTTCG 57.069 33.333 15.46 6.79 0.00 3.46
3233 5729 9.931210 GGATTTTACTATGAAACTATGTTTCGG 57.069 33.333 15.46 11.42 0.00 4.30
3237 5733 6.604735 ACTATGAAACTATGTTTCGGATGC 57.395 37.500 15.46 0.00 0.00 3.91
3238 5734 6.112734 ACTATGAAACTATGTTTCGGATGCA 58.887 36.000 15.46 0.00 0.00 3.96
3239 5735 5.895636 ATGAAACTATGTTTCGGATGCAA 57.104 34.783 15.46 0.81 0.00 4.08
3240 5736 5.697473 TGAAACTATGTTTCGGATGCAAA 57.303 34.783 15.46 0.00 0.00 3.68
3241 5737 6.078202 TGAAACTATGTTTCGGATGCAAAA 57.922 33.333 15.46 0.00 0.00 2.44
3242 5738 6.686630 TGAAACTATGTTTCGGATGCAAAAT 58.313 32.000 15.46 0.00 0.00 1.82
3243 5739 6.585702 TGAAACTATGTTTCGGATGCAAAATG 59.414 34.615 15.46 0.00 0.00 2.32
3244 5740 5.895636 ACTATGTTTCGGATGCAAAATGA 57.104 34.783 0.00 0.00 0.00 2.57
3245 5741 6.266168 ACTATGTTTCGGATGCAAAATGAA 57.734 33.333 0.00 0.00 0.00 2.57
3246 5742 6.324819 ACTATGTTTCGGATGCAAAATGAAG 58.675 36.000 0.00 0.00 0.00 3.02
3247 5743 4.582701 TGTTTCGGATGCAAAATGAAGT 57.417 36.364 0.00 0.00 0.00 3.01
3248 5744 4.942852 TGTTTCGGATGCAAAATGAAGTT 58.057 34.783 0.00 0.00 0.00 2.66
3249 5745 5.355596 TGTTTCGGATGCAAAATGAAGTTT 58.644 33.333 0.00 0.00 0.00 2.66
3250 5746 5.461737 TGTTTCGGATGCAAAATGAAGTTTC 59.538 36.000 0.00 0.00 0.00 2.78
3251 5747 4.844998 TCGGATGCAAAATGAAGTTTCA 57.155 36.364 0.00 0.00 42.14 2.69
3253 5749 5.401550 TCGGATGCAAAATGAAGTTTCATC 58.598 37.500 7.74 0.00 46.60 2.92
3254 5750 5.048154 TCGGATGCAAAATGAAGTTTCATCA 60.048 36.000 7.74 2.83 46.60 3.07
3255 5751 5.634439 CGGATGCAAAATGAAGTTTCATCAA 59.366 36.000 7.74 0.00 46.60 2.57
3256 5752 6.183360 CGGATGCAAAATGAAGTTTCATCAAG 60.183 38.462 7.74 2.90 46.60 3.02
3257 5753 6.647895 GGATGCAAAATGAAGTTTCATCAAGT 59.352 34.615 7.74 0.00 46.60 3.16
3258 5754 7.172019 GGATGCAAAATGAAGTTTCATCAAGTT 59.828 33.333 7.74 0.00 46.60 2.66
3259 5755 7.846644 TGCAAAATGAAGTTTCATCAAGTTT 57.153 28.000 7.74 2.93 46.60 2.66
3260 5756 7.908230 TGCAAAATGAAGTTTCATCAAGTTTC 58.092 30.769 7.74 2.10 46.60 2.78
3261 5757 7.548427 TGCAAAATGAAGTTTCATCAAGTTTCA 59.452 29.630 7.74 4.02 46.60 2.69
3262 5758 8.060090 GCAAAATGAAGTTTCATCAAGTTTCAG 58.940 33.333 7.74 0.00 46.60 3.02
3263 5759 8.545420 CAAAATGAAGTTTCATCAAGTTTCAGG 58.455 33.333 7.74 0.00 46.60 3.86
3264 5760 7.587037 AATGAAGTTTCATCAAGTTTCAGGA 57.413 32.000 7.74 0.00 46.60 3.86
3265 5761 7.587037 ATGAAGTTTCATCAAGTTTCAGGAA 57.413 32.000 1.58 0.00 44.17 3.36
3266 5762 7.403312 TGAAGTTTCATCAAGTTTCAGGAAA 57.597 32.000 0.00 0.00 31.01 3.13
3267 5763 8.010733 TGAAGTTTCATCAAGTTTCAGGAAAT 57.989 30.769 0.00 0.00 30.29 2.17
3268 5764 8.477256 TGAAGTTTCATCAAGTTTCAGGAAATT 58.523 29.630 0.00 0.00 30.29 1.82
3269 5765 9.965824 GAAGTTTCATCAAGTTTCAGGAAATTA 57.034 29.630 0.00 0.00 32.36 1.40
3273 5769 9.709495 TTTCATCAAGTTTCAGGAAATTATTGG 57.291 29.630 12.93 4.13 32.36 3.16
3274 5770 8.648698 TCATCAAGTTTCAGGAAATTATTGGA 57.351 30.769 12.93 5.59 32.36 3.53
3275 5771 9.258629 TCATCAAGTTTCAGGAAATTATTGGAT 57.741 29.630 12.93 0.00 32.36 3.41
3341 5837 7.905604 TGAAATGCATCTAAGTATTATCGGG 57.094 36.000 0.00 0.00 0.00 5.14
3342 5838 7.450074 TGAAATGCATCTAAGTATTATCGGGT 58.550 34.615 0.00 0.00 0.00 5.28
3343 5839 7.936847 TGAAATGCATCTAAGTATTATCGGGTT 59.063 33.333 0.00 0.00 0.00 4.11
3344 5840 8.691661 AAATGCATCTAAGTATTATCGGGTTT 57.308 30.769 0.00 0.00 0.00 3.27
3345 5841 8.691661 AATGCATCTAAGTATTATCGGGTTTT 57.308 30.769 0.00 0.00 0.00 2.43
3346 5842 9.787435 AATGCATCTAAGTATTATCGGGTTTTA 57.213 29.630 0.00 0.00 0.00 1.52
3347 5843 8.827177 TGCATCTAAGTATTATCGGGTTTTAG 57.173 34.615 0.00 0.00 0.00 1.85
3348 5844 8.644216 TGCATCTAAGTATTATCGGGTTTTAGA 58.356 33.333 0.00 0.00 32.27 2.10
3349 5845 9.141400 GCATCTAAGTATTATCGGGTTTTAGAG 57.859 37.037 0.00 0.00 31.53 2.43
3350 5846 9.640963 CATCTAAGTATTATCGGGTTTTAGAGG 57.359 37.037 0.00 0.00 31.53 3.69
3351 5847 9.597681 ATCTAAGTATTATCGGGTTTTAGAGGA 57.402 33.333 0.00 0.00 31.53 3.71
3352 5848 9.075678 TCTAAGTATTATCGGGTTTTAGAGGAG 57.924 37.037 0.00 0.00 0.00 3.69
3353 5849 7.909485 AAGTATTATCGGGTTTTAGAGGAGA 57.091 36.000 0.00 0.00 0.00 3.71
3354 5850 8.493787 AAGTATTATCGGGTTTTAGAGGAGAT 57.506 34.615 0.00 0.00 0.00 2.75
3355 5851 8.124808 AGTATTATCGGGTTTTAGAGGAGATC 57.875 38.462 0.00 0.00 0.00 2.75
3356 5852 6.996180 ATTATCGGGTTTTAGAGGAGATCA 57.004 37.500 0.00 0.00 0.00 2.92
3357 5853 6.801718 TTATCGGGTTTTAGAGGAGATCAA 57.198 37.500 0.00 0.00 0.00 2.57
3358 5854 4.467198 TCGGGTTTTAGAGGAGATCAAC 57.533 45.455 0.00 0.00 0.00 3.18
3359 5855 4.094476 TCGGGTTTTAGAGGAGATCAACT 58.906 43.478 0.00 0.00 0.00 3.16
3360 5856 4.081642 TCGGGTTTTAGAGGAGATCAACTG 60.082 45.833 0.00 0.00 0.00 3.16
3361 5857 4.322801 CGGGTTTTAGAGGAGATCAACTGT 60.323 45.833 0.00 0.00 0.00 3.55
3362 5858 5.179533 GGGTTTTAGAGGAGATCAACTGTC 58.820 45.833 0.00 0.00 0.00 3.51
3363 5859 4.865365 GGTTTTAGAGGAGATCAACTGTCG 59.135 45.833 0.00 0.00 0.00 4.35
3364 5860 4.720649 TTTAGAGGAGATCAACTGTCGG 57.279 45.455 0.00 0.00 0.00 4.79
3365 5861 1.479709 AGAGGAGATCAACTGTCGGG 58.520 55.000 0.00 0.00 0.00 5.14
3366 5862 1.187087 GAGGAGATCAACTGTCGGGT 58.813 55.000 0.00 0.00 0.00 5.28
3367 5863 2.025226 AGAGGAGATCAACTGTCGGGTA 60.025 50.000 0.00 0.00 0.00 3.69
3368 5864 2.758979 GAGGAGATCAACTGTCGGGTAA 59.241 50.000 0.00 0.00 0.00 2.85
3369 5865 3.170717 AGGAGATCAACTGTCGGGTAAA 58.829 45.455 0.00 0.00 0.00 2.01
3370 5866 3.195825 AGGAGATCAACTGTCGGGTAAAG 59.804 47.826 0.00 0.00 0.00 1.85
3371 5867 2.930682 GAGATCAACTGTCGGGTAAAGC 59.069 50.000 0.00 0.00 0.00 3.51
3372 5868 2.567615 AGATCAACTGTCGGGTAAAGCT 59.432 45.455 0.00 0.00 0.00 3.74
3373 5869 2.163818 TCAACTGTCGGGTAAAGCTG 57.836 50.000 0.00 0.00 0.00 4.24
3374 5870 1.414919 TCAACTGTCGGGTAAAGCTGT 59.585 47.619 0.00 0.00 0.00 4.40
3375 5871 2.158871 TCAACTGTCGGGTAAAGCTGTT 60.159 45.455 0.00 0.00 0.00 3.16
3376 5872 2.616842 CAACTGTCGGGTAAAGCTGTTT 59.383 45.455 0.00 0.00 0.00 2.83
3377 5873 2.218603 ACTGTCGGGTAAAGCTGTTTG 58.781 47.619 0.00 0.00 0.00 2.93
3378 5874 1.535462 CTGTCGGGTAAAGCTGTTTGG 59.465 52.381 0.00 0.00 0.00 3.28
3379 5875 0.240145 GTCGGGTAAAGCTGTTTGGC 59.760 55.000 0.00 0.00 0.00 4.52
3380 5876 0.891904 TCGGGTAAAGCTGTTTGGCC 60.892 55.000 0.00 0.00 0.00 5.36
3381 5877 1.873270 CGGGTAAAGCTGTTTGGCCC 61.873 60.000 0.00 6.39 38.14 5.80
3382 5878 0.830023 GGGTAAAGCTGTTTGGCCCA 60.830 55.000 0.00 0.00 39.82 5.36
3383 5879 1.044611 GGTAAAGCTGTTTGGCCCAA 58.955 50.000 0.00 0.00 0.00 4.12
3384 5880 1.414550 GGTAAAGCTGTTTGGCCCAAA 59.585 47.619 4.38 4.38 0.00 3.28
3385 5881 2.158885 GGTAAAGCTGTTTGGCCCAAAA 60.159 45.455 11.20 0.87 35.03 2.44
3386 5882 2.797177 AAAGCTGTTTGGCCCAAAAA 57.203 40.000 11.20 4.38 35.03 1.94
3402 5898 0.607620 AAAAACCATGGGTGCATCCG 59.392 50.000 18.09 0.00 35.34 4.18
3403 5899 1.257055 AAAACCATGGGTGCATCCGG 61.257 55.000 18.09 10.13 35.34 5.14
3404 5900 2.439553 AAACCATGGGTGCATCCGGT 62.440 55.000 18.09 10.87 35.34 5.28
3405 5901 2.829914 CCATGGGTGCATCCGGTG 60.830 66.667 12.39 12.71 37.00 4.94
3417 5913 2.575532 CATCCGGTGCATAGATTTGGT 58.424 47.619 0.00 0.00 0.00 3.67
3418 5914 2.325583 TCCGGTGCATAGATTTGGTC 57.674 50.000 0.00 0.00 0.00 4.02
3419 5915 1.557371 TCCGGTGCATAGATTTGGTCA 59.443 47.619 0.00 0.00 0.00 4.02
3420 5916 1.942657 CCGGTGCATAGATTTGGTCAG 59.057 52.381 0.00 0.00 0.00 3.51
3421 5917 2.632377 CGGTGCATAGATTTGGTCAGT 58.368 47.619 0.00 0.00 0.00 3.41
3422 5918 2.352651 CGGTGCATAGATTTGGTCAGTG 59.647 50.000 0.00 0.00 0.00 3.66
3423 5919 2.098117 GGTGCATAGATTTGGTCAGTGC 59.902 50.000 0.00 0.00 38.90 4.40
3424 5920 2.749076 GTGCATAGATTTGGTCAGTGCA 59.251 45.455 0.00 0.00 42.97 4.57
3425 5921 2.749076 TGCATAGATTTGGTCAGTGCAC 59.251 45.455 9.40 9.40 41.47 4.57
3426 5922 3.012518 GCATAGATTTGGTCAGTGCACT 58.987 45.455 15.25 15.25 38.54 4.40
3427 5923 3.181503 GCATAGATTTGGTCAGTGCACTG 60.182 47.826 36.07 36.07 45.08 3.66
3428 5924 1.901591 AGATTTGGTCAGTGCACTGG 58.098 50.000 39.04 24.07 43.91 4.00
3429 5925 1.421268 AGATTTGGTCAGTGCACTGGA 59.579 47.619 39.04 25.71 43.91 3.86
3430 5926 2.040813 AGATTTGGTCAGTGCACTGGAT 59.959 45.455 39.04 25.83 43.91 3.41
3431 5927 3.264193 AGATTTGGTCAGTGCACTGGATA 59.736 43.478 39.04 24.93 43.91 2.59
3432 5928 2.472695 TTGGTCAGTGCACTGGATAC 57.527 50.000 39.04 30.39 43.91 2.24
3433 5929 1.644509 TGGTCAGTGCACTGGATACT 58.355 50.000 39.04 6.86 43.91 2.12
3434 5930 1.977854 TGGTCAGTGCACTGGATACTT 59.022 47.619 39.04 6.05 43.91 2.24
3435 5931 2.371841 TGGTCAGTGCACTGGATACTTT 59.628 45.455 39.04 5.27 43.91 2.66
3436 5932 3.003480 GGTCAGTGCACTGGATACTTTC 58.997 50.000 39.04 18.03 43.91 2.62
3437 5933 3.307059 GGTCAGTGCACTGGATACTTTCT 60.307 47.826 39.04 3.91 43.91 2.52
3438 5934 3.929610 GTCAGTGCACTGGATACTTTCTC 59.070 47.826 39.04 16.68 43.91 2.87
3439 5935 3.834813 TCAGTGCACTGGATACTTTCTCT 59.165 43.478 39.04 3.22 43.91 3.10
3440 5936 4.081972 TCAGTGCACTGGATACTTTCTCTC 60.082 45.833 39.04 0.00 43.91 3.20
3441 5937 3.196685 AGTGCACTGGATACTTTCTCTCC 59.803 47.826 20.97 0.00 37.61 3.71
3442 5938 3.196685 GTGCACTGGATACTTTCTCTCCT 59.803 47.826 10.32 0.00 37.61 3.69
3443 5939 3.840666 TGCACTGGATACTTTCTCTCCTT 59.159 43.478 0.00 0.00 37.61 3.36
3444 5940 4.081420 TGCACTGGATACTTTCTCTCCTTC 60.081 45.833 0.00 0.00 37.61 3.46
3445 5941 4.161377 GCACTGGATACTTTCTCTCCTTCT 59.839 45.833 0.00 0.00 37.61 2.85
3446 5942 5.361285 GCACTGGATACTTTCTCTCCTTCTA 59.639 44.000 0.00 0.00 37.61 2.10
3447 5943 6.041523 GCACTGGATACTTTCTCTCCTTCTAT 59.958 42.308 0.00 0.00 37.61 1.98
3448 5944 7.432869 CACTGGATACTTTCTCTCCTTCTATG 58.567 42.308 0.00 0.00 37.61 2.23
3449 5945 7.286546 CACTGGATACTTTCTCTCCTTCTATGA 59.713 40.741 0.00 0.00 37.61 2.15
3450 5946 7.505585 ACTGGATACTTTCTCTCCTTCTATGAG 59.494 40.741 0.00 0.00 37.61 2.90
3451 5947 6.780031 TGGATACTTTCTCTCCTTCTATGAGG 59.220 42.308 0.00 0.00 36.21 3.86
3452 5948 6.780522 GGATACTTTCTCTCCTTCTATGAGGT 59.219 42.308 0.00 0.00 38.04 3.85
3453 5949 7.945664 GGATACTTTCTCTCCTTCTATGAGGTA 59.054 40.741 0.00 0.00 38.04 3.08
3454 5950 9.357161 GATACTTTCTCTCCTTCTATGAGGTAA 57.643 37.037 0.00 0.00 38.04 2.85
3455 5951 7.654022 ACTTTCTCTCCTTCTATGAGGTAAG 57.346 40.000 0.00 0.00 38.04 2.34
3456 5952 7.415086 ACTTTCTCTCCTTCTATGAGGTAAGA 58.585 38.462 0.00 0.00 38.04 2.10
3457 5953 7.559897 ACTTTCTCTCCTTCTATGAGGTAAGAG 59.440 40.741 0.00 4.20 38.34 2.85
3458 5954 6.833346 TCTCTCCTTCTATGAGGTAAGAGA 57.167 41.667 7.77 7.77 41.16 3.10
3459 5955 7.214460 TCTCTCCTTCTATGAGGTAAGAGAA 57.786 40.000 8.90 0.00 40.80 2.87
3460 5956 7.644062 TCTCTCCTTCTATGAGGTAAGAGAAA 58.356 38.462 8.90 0.00 40.80 2.52
3461 5957 8.285891 TCTCTCCTTCTATGAGGTAAGAGAAAT 58.714 37.037 8.90 0.00 40.80 2.17
3462 5958 9.581289 CTCTCCTTCTATGAGGTAAGAGAAATA 57.419 37.037 4.47 0.00 38.87 1.40
3476 5972 9.803315 GGTAAGAGAAATATTTGATTTGAACCC 57.197 33.333 5.17 0.00 0.00 4.11
3479 5975 8.298729 AGAGAAATATTTGATTTGAACCCTCC 57.701 34.615 5.17 0.00 0.00 4.30
3480 5976 7.895429 AGAGAAATATTTGATTTGAACCCTCCA 59.105 33.333 5.17 0.00 0.00 3.86
3481 5977 8.434589 AGAAATATTTGATTTGAACCCTCCAA 57.565 30.769 5.17 0.00 0.00 3.53
3482 5978 9.050154 AGAAATATTTGATTTGAACCCTCCAAT 57.950 29.630 5.17 0.00 0.00 3.16
3483 5979 9.101655 GAAATATTTGATTTGAACCCTCCAATG 57.898 33.333 5.17 0.00 0.00 2.82
3484 5980 7.976414 ATATTTGATTTGAACCCTCCAATGA 57.024 32.000 0.00 0.00 0.00 2.57
3485 5981 6.879367 ATTTGATTTGAACCCTCCAATGAT 57.121 33.333 0.00 0.00 0.00 2.45
3486 5982 5.920193 TTGATTTGAACCCTCCAATGATC 57.080 39.130 0.00 0.00 0.00 2.92
3487 5983 4.933134 TGATTTGAACCCTCCAATGATCA 58.067 39.130 0.00 0.00 0.00 2.92
3488 5984 5.331906 TGATTTGAACCCTCCAATGATCAA 58.668 37.500 0.00 0.00 0.00 2.57
3489 5985 5.419788 TGATTTGAACCCTCCAATGATCAAG 59.580 40.000 0.00 0.00 0.00 3.02
3490 5986 3.370840 TGAACCCTCCAATGATCAAGG 57.629 47.619 0.00 5.26 0.00 3.61
3494 5990 3.214696 CCCTCCAATGATCAAGGGTAC 57.785 52.381 18.69 0.00 43.04 3.34
3497 5993 4.392940 CCTCCAATGATCAAGGGTACATC 58.607 47.826 15.30 0.00 0.00 3.06
3499 5995 5.039920 TCCAATGATCAAGGGTACATCTG 57.960 43.478 15.30 0.00 0.00 2.90
3500 5996 4.721274 TCCAATGATCAAGGGTACATCTGA 59.279 41.667 15.30 0.00 0.00 3.27
3502 5998 5.430886 CAATGATCAAGGGTACATCTGACA 58.569 41.667 0.00 0.00 0.00 3.58
3505 6001 3.313012 TCAAGGGTACATCTGACAACG 57.687 47.619 0.00 0.00 0.00 4.10
3511 6007 4.039488 AGGGTACATCTGACAACGTAAACA 59.961 41.667 0.00 0.00 0.00 2.83
3513 6009 5.410439 GGGTACATCTGACAACGTAAACATT 59.590 40.000 0.00 0.00 0.00 2.71
3514 6010 6.591062 GGGTACATCTGACAACGTAAACATTA 59.409 38.462 0.00 0.00 0.00 1.90
3524 6020 9.852481 TGACAACGTAAACATTATATTTATCGC 57.148 29.630 0.00 0.00 0.00 4.58
3535 6031 9.555727 ACATTATATTTATCGCAAGTACTTGGT 57.444 29.630 31.42 15.61 40.74 3.67
3541 6037 8.959734 ATTTATCGCAAGTACTTGGTAAAAAC 57.040 30.769 31.42 15.23 40.74 2.43
3542 6038 4.455917 TCGCAAGTACTTGGTAAAAACG 57.544 40.909 31.42 24.08 40.74 3.60
3543 6039 3.248125 TCGCAAGTACTTGGTAAAAACGG 59.752 43.478 31.42 12.65 40.74 4.44
3544 6040 3.248125 CGCAAGTACTTGGTAAAAACGGA 59.752 43.478 31.42 0.00 40.74 4.69
3545 6041 4.609783 CGCAAGTACTTGGTAAAAACGGAG 60.610 45.833 31.42 7.00 40.74 4.63
3546 6042 4.512571 GCAAGTACTTGGTAAAAACGGAGA 59.487 41.667 31.42 0.00 40.74 3.71
3547 6043 5.333875 GCAAGTACTTGGTAAAAACGGAGAG 60.334 44.000 31.42 6.00 40.74 3.20
3548 6044 5.541953 AGTACTTGGTAAAAACGGAGAGT 57.458 39.130 0.00 0.00 0.00 3.24
3549 6045 5.295152 AGTACTTGGTAAAAACGGAGAGTG 58.705 41.667 0.00 0.00 0.00 3.51
3550 6046 4.146745 ACTTGGTAAAAACGGAGAGTGT 57.853 40.909 0.00 0.00 0.00 3.55
3551 6047 4.520179 ACTTGGTAAAAACGGAGAGTGTT 58.480 39.130 0.00 0.00 0.00 3.32
3552 6048 4.945543 ACTTGGTAAAAACGGAGAGTGTTT 59.054 37.500 0.00 0.00 42.58 2.83
3553 6049 5.065602 ACTTGGTAAAAACGGAGAGTGTTTC 59.934 40.000 0.00 0.00 39.41 2.78
3554 6050 4.515361 TGGTAAAAACGGAGAGTGTTTCA 58.485 39.130 0.00 0.00 39.41 2.69
3555 6051 4.942483 TGGTAAAAACGGAGAGTGTTTCAA 59.058 37.500 0.00 0.00 39.41 2.69
3556 6052 5.415077 TGGTAAAAACGGAGAGTGTTTCAAA 59.585 36.000 0.00 0.00 39.41 2.69
3557 6053 6.072064 TGGTAAAAACGGAGAGTGTTTCAAAA 60.072 34.615 0.00 0.00 39.41 2.44
3558 6054 6.807720 GGTAAAAACGGAGAGTGTTTCAAAAA 59.192 34.615 0.00 0.00 39.41 1.94
3582 6078 9.525826 AAAATGATTCTCTTTGTACCATTCTCT 57.474 29.630 0.00 0.00 0.00 3.10
3611 6107 9.513906 TTTCTATACCAAACATTCACAAGATGA 57.486 29.630 0.00 0.00 34.65 2.92
3612 6108 8.492673 TCTATACCAAACATTCACAAGATGAC 57.507 34.615 0.00 0.00 36.92 3.06
3613 6109 4.488126 ACCAAACATTCACAAGATGACG 57.512 40.909 0.00 0.00 36.92 4.35
3614 6110 4.133820 ACCAAACATTCACAAGATGACGA 58.866 39.130 0.00 0.00 36.92 4.20
3615 6111 4.024048 ACCAAACATTCACAAGATGACGAC 60.024 41.667 0.00 0.00 36.92 4.34
3616 6112 4.466828 CAAACATTCACAAGATGACGACC 58.533 43.478 0.00 0.00 36.92 4.79
3617 6113 3.401033 ACATTCACAAGATGACGACCA 57.599 42.857 0.00 0.00 36.92 4.02
3618 6114 3.942829 ACATTCACAAGATGACGACCAT 58.057 40.909 0.00 0.00 36.92 3.55
3619 6115 5.084818 ACATTCACAAGATGACGACCATA 57.915 39.130 0.00 0.00 36.92 2.74
3620 6116 5.674525 ACATTCACAAGATGACGACCATAT 58.325 37.500 0.00 0.00 36.92 1.78
3621 6117 5.525012 ACATTCACAAGATGACGACCATATG 59.475 40.000 0.00 0.00 36.92 1.78
3622 6118 4.736126 TCACAAGATGACGACCATATGT 57.264 40.909 1.24 0.00 36.44 2.29
3623 6119 4.432712 TCACAAGATGACGACCATATGTG 58.567 43.478 20.82 20.82 45.29 3.21
3624 6120 3.001634 CACAAGATGACGACCATATGTGC 59.998 47.826 18.00 0.00 41.78 4.57
3625 6121 2.533266 AGATGACGACCATATGTGCC 57.467 50.000 1.24 0.00 35.17 5.01
3626 6122 2.042464 AGATGACGACCATATGTGCCT 58.958 47.619 1.24 0.00 35.17 4.75
3627 6123 2.435805 AGATGACGACCATATGTGCCTT 59.564 45.455 1.24 0.00 35.17 4.35
3628 6124 2.309528 TGACGACCATATGTGCCTTC 57.690 50.000 1.24 0.00 0.00 3.46
3629 6125 1.552792 TGACGACCATATGTGCCTTCA 59.447 47.619 1.24 0.00 0.00 3.02
3630 6126 1.933853 GACGACCATATGTGCCTTCAC 59.066 52.381 1.24 0.00 43.40 3.18
3643 6139 5.643379 GTGCCTTCACAAAATAGAATGGA 57.357 39.130 0.00 0.00 42.66 3.41
3644 6140 6.212888 GTGCCTTCACAAAATAGAATGGAT 57.787 37.500 0.00 0.00 42.66 3.41
3645 6141 6.633856 GTGCCTTCACAAAATAGAATGGATT 58.366 36.000 0.00 0.00 42.66 3.01
3646 6142 7.099120 GTGCCTTCACAAAATAGAATGGATTT 58.901 34.615 0.00 0.00 42.66 2.17
3647 6143 7.603784 GTGCCTTCACAAAATAGAATGGATTTT 59.396 33.333 0.00 0.00 42.66 1.82
3648 6144 8.156165 TGCCTTCACAAAATAGAATGGATTTTT 58.844 29.630 0.00 0.00 34.93 1.94
3693 6189 4.212213 ACACTACTAGAATCGATGTCGC 57.788 45.455 0.00 0.00 39.60 5.19
3695 6191 4.215201 CACTACTAGAATCGATGTCGCTG 58.785 47.826 0.00 0.00 39.60 5.18
3696 6192 2.783828 ACTAGAATCGATGTCGCTGG 57.216 50.000 0.00 0.00 39.60 4.85
3698 6194 3.211865 ACTAGAATCGATGTCGCTGGTA 58.788 45.455 0.00 0.00 39.60 3.25
3700 6196 2.025155 AGAATCGATGTCGCTGGTACT 58.975 47.619 0.00 0.00 39.60 2.73
3702 6198 3.251245 AGAATCGATGTCGCTGGTACTAG 59.749 47.826 0.00 1.08 39.60 2.57
3703 6199 1.306148 TCGATGTCGCTGGTACTAGG 58.694 55.000 8.46 0.00 39.60 3.02
3704 6200 0.311165 CGATGTCGCTGGTACTAGGG 59.689 60.000 16.03 16.03 0.00 3.53
3705 6201 1.688772 GATGTCGCTGGTACTAGGGA 58.311 55.000 20.00 20.00 37.31 4.20
3706 6202 2.029623 GATGTCGCTGGTACTAGGGAA 58.970 52.381 24.39 15.91 40.68 3.97
3707 6203 1.927487 TGTCGCTGGTACTAGGGAAA 58.073 50.000 24.39 18.18 40.68 3.13
3708 6204 1.822990 TGTCGCTGGTACTAGGGAAAG 59.177 52.381 24.39 0.00 40.68 2.62
3709 6205 1.823610 GTCGCTGGTACTAGGGAAAGT 59.176 52.381 24.39 0.00 40.68 2.66
3710 6206 1.822990 TCGCTGGTACTAGGGAAAGTG 59.177 52.381 21.31 0.00 36.80 3.16
3711 6207 1.549170 CGCTGGTACTAGGGAAAGTGT 59.451 52.381 17.04 0.00 32.84 3.55
3712 6208 2.674177 CGCTGGTACTAGGGAAAGTGTG 60.674 54.545 17.04 0.00 32.84 3.82
3713 6209 2.565834 GCTGGTACTAGGGAAAGTGTGA 59.434 50.000 8.46 0.00 0.00 3.58
3714 6210 3.007614 GCTGGTACTAGGGAAAGTGTGAA 59.992 47.826 8.46 0.00 0.00 3.18
3715 6211 4.566987 CTGGTACTAGGGAAAGTGTGAAC 58.433 47.826 0.00 0.00 0.00 3.18
3716 6212 3.006110 TGGTACTAGGGAAAGTGTGAACG 59.994 47.826 0.00 0.00 0.00 3.95
3717 6213 3.006217 GGTACTAGGGAAAGTGTGAACGT 59.994 47.826 0.00 0.00 0.00 3.99
3718 6214 3.832615 ACTAGGGAAAGTGTGAACGTT 57.167 42.857 0.00 0.00 0.00 3.99
3719 6215 3.463944 ACTAGGGAAAGTGTGAACGTTG 58.536 45.455 5.00 0.00 0.00 4.10
3720 6216 1.021968 AGGGAAAGTGTGAACGTTGC 58.978 50.000 5.00 0.00 0.00 4.17
3721 6217 0.030235 GGGAAAGTGTGAACGTTGCC 59.970 55.000 5.00 0.00 33.44 4.52
3722 6218 0.736053 GGAAAGTGTGAACGTTGCCA 59.264 50.000 5.00 0.00 0.00 4.92
3723 6219 1.133407 GGAAAGTGTGAACGTTGCCAA 59.867 47.619 5.00 0.00 0.00 4.52
3724 6220 2.450160 GAAAGTGTGAACGTTGCCAAG 58.550 47.619 5.00 0.00 0.00 3.61
3725 6221 1.459450 AAGTGTGAACGTTGCCAAGT 58.541 45.000 5.00 0.00 0.00 3.16
3726 6222 1.459450 AGTGTGAACGTTGCCAAGTT 58.541 45.000 5.00 0.00 0.00 2.66
3727 6223 1.816224 AGTGTGAACGTTGCCAAGTTT 59.184 42.857 5.00 0.00 0.00 2.66
3728 6224 2.159435 AGTGTGAACGTTGCCAAGTTTC 60.159 45.455 5.00 0.00 0.00 2.78
3729 6225 1.813178 TGTGAACGTTGCCAAGTTTCA 59.187 42.857 5.00 0.00 0.00 2.69
3730 6226 2.182014 GTGAACGTTGCCAAGTTTCAC 58.818 47.619 5.00 12.78 0.00 3.18
3731 6227 1.813178 TGAACGTTGCCAAGTTTCACA 59.187 42.857 5.00 0.00 0.00 3.58
3732 6228 2.425312 TGAACGTTGCCAAGTTTCACAT 59.575 40.909 5.00 0.00 0.00 3.21
3733 6229 2.774439 ACGTTGCCAAGTTTCACATC 57.226 45.000 0.00 0.00 0.00 3.06
3734 6230 2.020720 ACGTTGCCAAGTTTCACATCA 58.979 42.857 0.00 0.00 0.00 3.07
3735 6231 2.223479 ACGTTGCCAAGTTTCACATCAC 60.223 45.455 0.00 0.00 0.00 3.06
3736 6232 2.033299 CGTTGCCAAGTTTCACATCACT 59.967 45.455 0.00 0.00 0.00 3.41
3737 6233 3.374745 GTTGCCAAGTTTCACATCACTG 58.625 45.455 0.00 0.00 0.00 3.66
3738 6234 1.337703 TGCCAAGTTTCACATCACTGC 59.662 47.619 0.00 0.00 0.00 4.40
3739 6235 1.336240 GCCAAGTTTCACATCACTGCC 60.336 52.381 0.00 0.00 0.00 4.85
3740 6236 1.955778 CCAAGTTTCACATCACTGCCA 59.044 47.619 0.00 0.00 0.00 4.92
3741 6237 2.361757 CCAAGTTTCACATCACTGCCAA 59.638 45.455 0.00 0.00 0.00 4.52
3742 6238 3.551454 CCAAGTTTCACATCACTGCCAAG 60.551 47.826 0.00 0.00 0.00 3.61
3743 6239 2.936202 AGTTTCACATCACTGCCAAGT 58.064 42.857 0.00 0.00 36.98 3.16
3744 6240 4.085357 AGTTTCACATCACTGCCAAGTA 57.915 40.909 0.00 0.00 33.79 2.24
3745 6241 3.815401 AGTTTCACATCACTGCCAAGTAC 59.185 43.478 0.00 0.00 33.79 2.73
3746 6242 3.483808 TTCACATCACTGCCAAGTACA 57.516 42.857 0.00 0.00 33.79 2.90
3747 6243 3.483808 TCACATCACTGCCAAGTACAA 57.516 42.857 0.00 0.00 33.79 2.41
3748 6244 3.814625 TCACATCACTGCCAAGTACAAA 58.185 40.909 0.00 0.00 33.79 2.83
3749 6245 4.397420 TCACATCACTGCCAAGTACAAAT 58.603 39.130 0.00 0.00 33.79 2.32
3750 6246 4.826733 TCACATCACTGCCAAGTACAAATT 59.173 37.500 0.00 0.00 33.79 1.82
3751 6247 5.301551 TCACATCACTGCCAAGTACAAATTT 59.698 36.000 0.00 0.00 33.79 1.82
3752 6248 5.403166 CACATCACTGCCAAGTACAAATTTG 59.597 40.000 16.67 16.67 33.79 2.32
3753 6249 5.301551 ACATCACTGCCAAGTACAAATTTGA 59.698 36.000 24.64 5.76 33.79 2.69
3754 6250 5.843673 TCACTGCCAAGTACAAATTTGAA 57.156 34.783 24.64 0.00 33.79 2.69
3755 6251 6.403866 TCACTGCCAAGTACAAATTTGAAT 57.596 33.333 24.64 5.87 33.79 2.57
3756 6252 6.446318 TCACTGCCAAGTACAAATTTGAATC 58.554 36.000 24.64 13.06 33.79 2.52
3757 6253 6.040278 TCACTGCCAAGTACAAATTTGAATCA 59.960 34.615 24.64 10.37 33.79 2.57
3758 6254 6.700960 CACTGCCAAGTACAAATTTGAATCAA 59.299 34.615 24.64 0.00 33.79 2.57
3759 6255 7.224362 CACTGCCAAGTACAAATTTGAATCAAA 59.776 33.333 24.64 11.10 34.62 2.69
3760 6256 7.224557 ACTGCCAAGTACAAATTTGAATCAAAC 59.775 33.333 24.64 11.42 33.61 2.93
3761 6257 7.271511 TGCCAAGTACAAATTTGAATCAAACT 58.728 30.769 24.64 13.18 36.13 2.66
3762 6258 7.437862 TGCCAAGTACAAATTTGAATCAAACTC 59.562 33.333 24.64 6.44 36.13 3.01
3763 6259 7.358352 GCCAAGTACAAATTTGAATCAAACTCG 60.358 37.037 24.64 4.76 36.13 4.18
3764 6260 7.114811 CCAAGTACAAATTTGAATCAAACTCGG 59.885 37.037 24.64 11.55 36.13 4.63
3765 6261 6.149633 AGTACAAATTTGAATCAAACTCGGC 58.850 36.000 24.64 0.99 36.13 5.54
3766 6262 4.942852 ACAAATTTGAATCAAACTCGGCA 58.057 34.783 24.64 0.00 36.13 5.69
3767 6263 4.984161 ACAAATTTGAATCAAACTCGGCAG 59.016 37.500 24.64 0.50 36.13 4.85
3768 6264 5.221224 ACAAATTTGAATCAAACTCGGCAGA 60.221 36.000 24.64 0.00 36.13 4.26
3769 6265 5.649782 AATTTGAATCAAACTCGGCAGAT 57.350 34.783 10.91 0.00 36.13 2.90
3770 6266 6.757897 AATTTGAATCAAACTCGGCAGATA 57.242 33.333 10.91 0.00 36.13 1.98
3771 6267 5.545658 TTTGAATCAAACTCGGCAGATAC 57.454 39.130 4.03 0.00 0.00 2.24
3772 6268 4.200838 TGAATCAAACTCGGCAGATACA 57.799 40.909 0.00 0.00 0.00 2.29
3773 6269 4.574892 TGAATCAAACTCGGCAGATACAA 58.425 39.130 0.00 0.00 0.00 2.41
3774 6270 4.631377 TGAATCAAACTCGGCAGATACAAG 59.369 41.667 0.00 0.00 0.00 3.16
3775 6271 2.346803 TCAAACTCGGCAGATACAAGC 58.653 47.619 0.00 0.00 0.00 4.01
3776 6272 2.028112 TCAAACTCGGCAGATACAAGCT 60.028 45.455 0.00 0.00 0.00 3.74
3777 6273 2.744202 CAAACTCGGCAGATACAAGCTT 59.256 45.455 0.00 0.00 0.00 3.74
3778 6274 2.770164 ACTCGGCAGATACAAGCTTT 57.230 45.000 0.00 0.00 0.00 3.51
3779 6275 2.350522 ACTCGGCAGATACAAGCTTTG 58.649 47.619 0.00 0.00 0.00 2.77
3780 6276 1.063174 CTCGGCAGATACAAGCTTTGC 59.937 52.381 10.91 10.91 0.00 3.68
3782 6278 0.099436 GGCAGATACAAGCTTTGCCG 59.901 55.000 20.28 1.81 44.10 5.69
3783 6279 1.086696 GCAGATACAAGCTTTGCCGA 58.913 50.000 8.58 0.00 0.00 5.54
3784 6280 1.063174 GCAGATACAAGCTTTGCCGAG 59.937 52.381 8.58 0.00 0.00 4.63
3785 6281 1.063174 CAGATACAAGCTTTGCCGAGC 59.937 52.381 0.00 0.42 43.02 5.03
3791 6287 4.760047 GCTTTGCCGAGCTCCCGA 62.760 66.667 8.47 0.00 39.57 5.14
3792 6288 2.187946 CTTTGCCGAGCTCCCGAT 59.812 61.111 8.47 0.00 0.00 4.18
3793 6289 1.441729 CTTTGCCGAGCTCCCGATA 59.558 57.895 8.47 0.00 0.00 2.92
3794 6290 0.598680 CTTTGCCGAGCTCCCGATAG 60.599 60.000 8.47 0.00 0.00 2.08
3795 6291 1.040893 TTTGCCGAGCTCCCGATAGA 61.041 55.000 8.47 0.00 39.76 1.98
3796 6292 1.040893 TTGCCGAGCTCCCGATAGAA 61.041 55.000 8.47 0.00 39.76 2.10
3797 6293 0.827925 TGCCGAGCTCCCGATAGAAT 60.828 55.000 8.47 0.00 39.76 2.40
3798 6294 0.389166 GCCGAGCTCCCGATAGAATG 60.389 60.000 8.47 0.00 39.76 2.67
3799 6295 1.248486 CCGAGCTCCCGATAGAATGA 58.752 55.000 8.47 0.00 39.76 2.57
3800 6296 1.613925 CCGAGCTCCCGATAGAATGAA 59.386 52.381 8.47 0.00 39.76 2.57
3801 6297 2.608261 CCGAGCTCCCGATAGAATGAAC 60.608 54.545 8.47 0.00 39.76 3.18
3802 6298 2.294791 CGAGCTCCCGATAGAATGAACT 59.705 50.000 8.47 0.00 39.76 3.01
3803 6299 3.610585 CGAGCTCCCGATAGAATGAACTC 60.611 52.174 8.47 0.00 39.76 3.01
3804 6300 2.294791 AGCTCCCGATAGAATGAACTCG 59.705 50.000 0.00 0.00 39.76 4.18
3807 6303 2.509052 CCGATAGAATGAACTCGGCA 57.491 50.000 0.00 0.00 43.51 5.69
3808 6304 2.821546 CCGATAGAATGAACTCGGCAA 58.178 47.619 0.00 0.00 43.51 4.52
3809 6305 3.194861 CCGATAGAATGAACTCGGCAAA 58.805 45.455 0.00 0.00 43.51 3.68
3810 6306 3.621268 CCGATAGAATGAACTCGGCAAAA 59.379 43.478 0.00 0.00 43.51 2.44
3811 6307 4.273480 CCGATAGAATGAACTCGGCAAAAT 59.727 41.667 0.00 0.00 43.51 1.82
3812 6308 5.465390 CCGATAGAATGAACTCGGCAAAATA 59.535 40.000 0.00 0.00 43.51 1.40
3813 6309 6.147821 CCGATAGAATGAACTCGGCAAAATAT 59.852 38.462 0.00 0.00 43.51 1.28
3814 6310 7.230222 CGATAGAATGAACTCGGCAAAATATC 58.770 38.462 0.00 0.00 39.76 1.63
3815 6311 7.095649 CGATAGAATGAACTCGGCAAAATATCA 60.096 37.037 0.00 0.00 39.76 2.15
3816 6312 6.369059 AGAATGAACTCGGCAAAATATCAG 57.631 37.500 0.00 0.00 0.00 2.90
3817 6313 6.115446 AGAATGAACTCGGCAAAATATCAGA 58.885 36.000 0.00 0.00 0.00 3.27
3818 6314 5.998454 ATGAACTCGGCAAAATATCAGAG 57.002 39.130 0.00 0.00 0.00 3.35
3819 6315 3.623060 TGAACTCGGCAAAATATCAGAGC 59.377 43.478 0.00 0.00 0.00 4.09
3820 6316 3.550437 ACTCGGCAAAATATCAGAGCT 57.450 42.857 0.00 0.00 0.00 4.09
3821 6317 3.462021 ACTCGGCAAAATATCAGAGCTC 58.538 45.455 5.27 5.27 0.00 4.09
3822 6318 2.473816 TCGGCAAAATATCAGAGCTCG 58.526 47.619 8.37 3.55 0.00 5.03
3823 6319 1.528586 CGGCAAAATATCAGAGCTCGG 59.471 52.381 8.37 7.99 0.00 4.63
3824 6320 1.265365 GGCAAAATATCAGAGCTCGGC 59.735 52.381 9.22 0.00 0.00 5.54
3825 6321 2.216898 GCAAAATATCAGAGCTCGGCT 58.783 47.619 9.22 1.82 43.88 5.52
3834 6330 4.386413 AGCTCGGCTCAAAACCAG 57.614 55.556 0.00 0.00 30.62 4.00
3835 6331 1.754745 AGCTCGGCTCAAAACCAGA 59.245 52.632 0.00 0.00 30.62 3.86
3836 6332 0.326264 AGCTCGGCTCAAAACCAGAT 59.674 50.000 0.00 0.00 30.62 2.90
3837 6333 1.168714 GCTCGGCTCAAAACCAGATT 58.831 50.000 0.00 0.00 0.00 2.40
3838 6334 1.131315 GCTCGGCTCAAAACCAGATTC 59.869 52.381 0.00 0.00 0.00 2.52
3839 6335 2.426522 CTCGGCTCAAAACCAGATTCA 58.573 47.619 0.00 0.00 0.00 2.57
3840 6336 2.813754 CTCGGCTCAAAACCAGATTCAA 59.186 45.455 0.00 0.00 0.00 2.69
3841 6337 2.813754 TCGGCTCAAAACCAGATTCAAG 59.186 45.455 0.00 0.00 0.00 3.02
3842 6338 2.554032 CGGCTCAAAACCAGATTCAAGT 59.446 45.455 0.00 0.00 0.00 3.16
3843 6339 3.751175 CGGCTCAAAACCAGATTCAAGTA 59.249 43.478 0.00 0.00 0.00 2.24
3844 6340 4.142816 CGGCTCAAAACCAGATTCAAGTAG 60.143 45.833 0.00 0.00 0.00 2.57
3845 6341 4.762251 GGCTCAAAACCAGATTCAAGTAGT 59.238 41.667 0.00 0.00 0.00 2.73
3846 6342 5.335191 GGCTCAAAACCAGATTCAAGTAGTG 60.335 44.000 0.00 0.00 0.00 2.74
3847 6343 5.239525 GCTCAAAACCAGATTCAAGTAGTGT 59.760 40.000 0.00 0.00 0.00 3.55
3848 6344 6.238759 GCTCAAAACCAGATTCAAGTAGTGTT 60.239 38.462 0.00 0.00 0.00 3.32
3849 6345 7.041372 GCTCAAAACCAGATTCAAGTAGTGTTA 60.041 37.037 0.00 0.00 0.00 2.41
3850 6346 8.918202 TCAAAACCAGATTCAAGTAGTGTTAT 57.082 30.769 0.00 0.00 0.00 1.89
3851 6347 8.783093 TCAAAACCAGATTCAAGTAGTGTTATG 58.217 33.333 0.00 0.00 0.00 1.90
3852 6348 8.567948 CAAAACCAGATTCAAGTAGTGTTATGT 58.432 33.333 0.00 0.00 0.00 2.29
3853 6349 7.672983 AACCAGATTCAAGTAGTGTTATGTG 57.327 36.000 0.00 0.00 0.00 3.21
3854 6350 6.173339 ACCAGATTCAAGTAGTGTTATGTGG 58.827 40.000 0.00 0.00 38.52 4.17
3855 6351 6.173339 CCAGATTCAAGTAGTGTTATGTGGT 58.827 40.000 0.00 0.00 33.31 4.16
3856 6352 6.655003 CCAGATTCAAGTAGTGTTATGTGGTT 59.345 38.462 0.00 0.00 33.31 3.67
3857 6353 7.822334 CCAGATTCAAGTAGTGTTATGTGGTTA 59.178 37.037 0.00 0.00 33.31 2.85
3858 6354 9.214957 CAGATTCAAGTAGTGTTATGTGGTTAA 57.785 33.333 0.00 0.00 0.00 2.01
3859 6355 9.959721 AGATTCAAGTAGTGTTATGTGGTTAAT 57.040 29.630 0.00 0.00 0.00 1.40
3862 6358 9.562408 TTCAAGTAGTGTTATGTGGTTAATTCA 57.438 29.630 0.00 0.00 0.00 2.57
3863 6359 9.562408 TCAAGTAGTGTTATGTGGTTAATTCAA 57.438 29.630 0.00 0.00 0.00 2.69
3866 6362 9.569122 AGTAGTGTTATGTGGTTAATTCAAAGT 57.431 29.630 0.00 0.00 0.00 2.66
3869 6365 7.651704 AGTGTTATGTGGTTAATTCAAAGTTGC 59.348 33.333 0.00 0.00 0.00 4.17
3870 6366 7.436673 GTGTTATGTGGTTAATTCAAAGTTGCA 59.563 33.333 0.00 0.00 0.00 4.08
3871 6367 7.436673 TGTTATGTGGTTAATTCAAAGTTGCAC 59.563 33.333 0.00 0.00 0.00 4.57
3872 6368 5.590530 TGTGGTTAATTCAAAGTTGCACT 57.409 34.783 0.00 0.00 0.00 4.40
3873 6369 5.971763 TGTGGTTAATTCAAAGTTGCACTT 58.028 33.333 0.00 0.00 40.80 3.16
3874 6370 5.809562 TGTGGTTAATTCAAAGTTGCACTTG 59.190 36.000 0.00 0.00 38.66 3.16
3875 6371 5.234116 GTGGTTAATTCAAAGTTGCACTTGG 59.766 40.000 0.00 0.00 38.66 3.61
3876 6372 4.749598 GGTTAATTCAAAGTTGCACTTGGG 59.250 41.667 0.00 0.00 38.66 4.12
3877 6373 5.452636 GGTTAATTCAAAGTTGCACTTGGGA 60.453 40.000 0.00 0.00 38.66 4.37
3878 6374 4.326504 AATTCAAAGTTGCACTTGGGAG 57.673 40.909 0.00 0.00 38.66 4.30
3879 6375 1.032014 TCAAAGTTGCACTTGGGAGC 58.968 50.000 0.00 0.00 38.66 4.70
3880 6376 0.746063 CAAAGTTGCACTTGGGAGCA 59.254 50.000 0.00 0.00 38.66 4.26
3881 6377 1.342174 CAAAGTTGCACTTGGGAGCAT 59.658 47.619 0.00 0.00 38.66 3.79
3882 6378 2.557924 CAAAGTTGCACTTGGGAGCATA 59.442 45.455 0.00 0.00 38.66 3.14
3883 6379 2.119801 AGTTGCACTTGGGAGCATAG 57.880 50.000 0.00 0.00 38.69 2.23
3884 6380 1.098050 GTTGCACTTGGGAGCATAGG 58.902 55.000 0.00 0.00 38.69 2.57
3885 6381 0.680921 TTGCACTTGGGAGCATAGGC 60.681 55.000 0.00 0.00 38.69 3.93
3896 6392 3.882131 GCATAGGCTCTTGGGTGAA 57.118 52.632 0.00 0.00 36.96 3.18
3897 6393 2.128771 GCATAGGCTCTTGGGTGAAA 57.871 50.000 0.00 0.00 36.96 2.69
3898 6394 2.446435 GCATAGGCTCTTGGGTGAAAA 58.554 47.619 0.00 0.00 36.96 2.29
3899 6395 2.825532 GCATAGGCTCTTGGGTGAAAAA 59.174 45.455 0.00 0.00 36.96 1.94
3900 6396 3.367395 GCATAGGCTCTTGGGTGAAAAAC 60.367 47.826 0.00 0.00 36.96 2.43
3901 6397 2.452600 AGGCTCTTGGGTGAAAAACA 57.547 45.000 0.00 0.00 0.00 2.83
3902 6398 2.745968 AGGCTCTTGGGTGAAAAACAA 58.254 42.857 0.00 0.00 0.00 2.83
3903 6399 3.103742 AGGCTCTTGGGTGAAAAACAAA 58.896 40.909 0.00 0.00 0.00 2.83
3904 6400 3.132824 AGGCTCTTGGGTGAAAAACAAAG 59.867 43.478 0.00 0.00 0.00 2.77
3905 6401 3.132111 GGCTCTTGGGTGAAAAACAAAGA 59.868 43.478 0.00 0.00 33.98 2.52
3906 6402 4.382577 GGCTCTTGGGTGAAAAACAAAGAA 60.383 41.667 0.00 0.00 34.44 2.52
3907 6403 5.175127 GCTCTTGGGTGAAAAACAAAGAAA 58.825 37.500 0.00 0.00 34.44 2.52
3908 6404 5.641636 GCTCTTGGGTGAAAAACAAAGAAAA 59.358 36.000 0.00 0.00 34.44 2.29
3909 6405 6.148645 GCTCTTGGGTGAAAAACAAAGAAAAA 59.851 34.615 0.00 0.00 34.44 1.94
3910 6406 7.148255 GCTCTTGGGTGAAAAACAAAGAAAAAT 60.148 33.333 0.00 0.00 34.44 1.82
3911 6407 8.628630 TCTTGGGTGAAAAACAAAGAAAAATT 57.371 26.923 0.00 0.00 32.82 1.82
3912 6408 8.726068 TCTTGGGTGAAAAACAAAGAAAAATTC 58.274 29.630 0.00 0.00 32.82 2.17
3913 6409 7.986085 TGGGTGAAAAACAAAGAAAAATTCA 57.014 28.000 0.00 0.00 0.00 2.57
3914 6410 8.396272 TGGGTGAAAAACAAAGAAAAATTCAA 57.604 26.923 0.00 0.00 0.00 2.69
3915 6411 8.850156 TGGGTGAAAAACAAAGAAAAATTCAAA 58.150 25.926 0.00 0.00 0.00 2.69
3916 6412 9.853555 GGGTGAAAAACAAAGAAAAATTCAAAT 57.146 25.926 0.00 0.00 0.00 2.32
3973 6469 9.996554 ATATTTCATGATAGTCGTAATTGTCCA 57.003 29.630 0.00 0.00 0.00 4.02
3974 6470 8.731275 ATTTCATGATAGTCGTAATTGTCCAA 57.269 30.769 0.00 0.00 0.00 3.53
3975 6471 7.770801 TTCATGATAGTCGTAATTGTCCAAG 57.229 36.000 0.00 0.00 0.00 3.61
3976 6472 5.753438 TCATGATAGTCGTAATTGTCCAAGC 59.247 40.000 0.00 0.00 0.00 4.01
3977 6473 5.079689 TGATAGTCGTAATTGTCCAAGCA 57.920 39.130 0.00 0.00 0.00 3.91
3978 6474 5.483811 TGATAGTCGTAATTGTCCAAGCAA 58.516 37.500 0.00 0.00 0.00 3.91
3979 6475 5.935206 TGATAGTCGTAATTGTCCAAGCAAA 59.065 36.000 0.00 0.00 31.63 3.68
3980 6476 6.428465 TGATAGTCGTAATTGTCCAAGCAAAA 59.572 34.615 0.00 0.00 31.63 2.44
3981 6477 5.508200 AGTCGTAATTGTCCAAGCAAAAA 57.492 34.783 0.00 0.00 31.63 1.94
3982 6478 6.084326 AGTCGTAATTGTCCAAGCAAAAAT 57.916 33.333 0.00 0.00 31.63 1.82
3983 6479 5.920273 AGTCGTAATTGTCCAAGCAAAAATG 59.080 36.000 0.00 0.00 31.63 2.32
3984 6480 5.118510 GTCGTAATTGTCCAAGCAAAAATGG 59.881 40.000 0.00 0.00 38.09 3.16
3985 6481 5.010112 TCGTAATTGTCCAAGCAAAAATGGA 59.990 36.000 0.00 0.00 43.32 3.41
3986 6482 5.345741 CGTAATTGTCCAAGCAAAAATGGAG 59.654 40.000 0.00 0.00 46.01 3.86
3987 6483 3.749665 TTGTCCAAGCAAAAATGGAGG 57.250 42.857 0.00 0.00 46.01 4.30
3988 6484 1.969923 TGTCCAAGCAAAAATGGAGGG 59.030 47.619 0.00 0.00 46.01 4.30
3989 6485 2.247358 GTCCAAGCAAAAATGGAGGGA 58.753 47.619 0.00 0.00 46.01 4.20
3990 6486 2.232208 GTCCAAGCAAAAATGGAGGGAG 59.768 50.000 0.00 0.00 46.01 4.30
3991 6487 2.158325 TCCAAGCAAAAATGGAGGGAGT 60.158 45.455 0.00 0.00 40.74 3.85
3992 6488 2.028748 CCAAGCAAAAATGGAGGGAGTG 60.029 50.000 0.00 0.00 39.12 3.51
3993 6489 2.629617 CAAGCAAAAATGGAGGGAGTGT 59.370 45.455 0.00 0.00 0.00 3.55
3994 6490 2.242043 AGCAAAAATGGAGGGAGTGTG 58.758 47.619 0.00 0.00 0.00 3.82
3995 6491 2.158475 AGCAAAAATGGAGGGAGTGTGA 60.158 45.455 0.00 0.00 0.00 3.58
3996 6492 2.029918 GCAAAAATGGAGGGAGTGTGAC 60.030 50.000 0.00 0.00 0.00 3.67
3997 6493 3.490348 CAAAAATGGAGGGAGTGTGACT 58.510 45.455 0.00 0.00 0.00 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
7 8 5.721232 AGTAAATCAAGTGAGTCCGGTTAG 58.279 41.667 0.00 0.00 0.00 2.34
100 101 5.651139 GTGTTGGATGTCTAGTAGTAGTCCA 59.349 44.000 10.11 10.11 30.59 4.02
162 163 9.273016 CAACTAGAACAAATAAACTCTGGAGAA 57.727 33.333 4.49 0.00 0.00 2.87
163 164 7.387948 GCAACTAGAACAAATAAACTCTGGAGA 59.612 37.037 4.49 0.00 0.00 3.71
165 166 6.430000 GGCAACTAGAACAAATAAACTCTGGA 59.570 38.462 0.00 0.00 0.00 3.86
187 188 2.490718 ACCTAAGGTGATTGCAAAGGCA 60.491 45.455 1.71 0.00 41.20 4.75
188 189 2.171003 ACCTAAGGTGATTGCAAAGGC 58.829 47.619 1.71 0.00 35.77 4.35
189 190 3.947834 CCTACCTAAGGTGATTGCAAAGG 59.052 47.826 1.71 6.37 40.94 3.11
213 214 6.667848 GGGGATATCCTCCTTTTCAAGAAAAA 59.332 38.462 21.18 0.00 44.28 1.94
214 215 6.194967 GGGGATATCCTCCTTTTCAAGAAAA 58.805 40.000 21.18 7.65 44.28 2.29
215 216 5.766590 GGGGATATCCTCCTTTTCAAGAAA 58.233 41.667 21.18 0.00 44.28 2.52
216 217 5.388599 GGGGATATCCTCCTTTTCAAGAA 57.611 43.478 21.18 0.00 44.28 2.52
227 228 1.990614 GAGGCCGGGGGATATCCTC 60.991 68.421 21.18 17.78 36.86 3.71
228 229 2.122954 GAGGCCGGGGGATATCCT 59.877 66.667 21.18 0.00 35.95 3.24
229 230 2.122954 AGAGGCCGGGGGATATCC 59.877 66.667 13.87 13.87 0.00 2.59
230 231 2.960688 GCAGAGGCCGGGGGATATC 61.961 68.421 2.18 0.00 0.00 1.63
231 232 2.930562 GCAGAGGCCGGGGGATAT 60.931 66.667 2.18 0.00 0.00 1.63
232 233 3.792325 ATGCAGAGGCCGGGGGATA 62.792 63.158 2.18 0.00 40.13 2.59
236 237 4.559063 CTGATGCAGAGGCCGGGG 62.559 72.222 2.18 0.00 40.13 5.73
237 238 4.559063 CCTGATGCAGAGGCCGGG 62.559 72.222 2.18 0.00 40.13 5.73
238 239 3.473647 TCCTGATGCAGAGGCCGG 61.474 66.667 9.34 0.00 40.13 6.13
239 240 2.202987 GTCCTGATGCAGAGGCCG 60.203 66.667 9.34 0.00 40.13 6.13
240 241 2.037620 ATCGTCCTGATGCAGAGGCC 62.038 60.000 9.34 0.00 40.13 5.19
241 242 1.445095 ATCGTCCTGATGCAGAGGC 59.555 57.895 9.34 4.81 35.45 4.70
249 250 1.164662 GCTGCATGCATCGTCCTGAT 61.165 55.000 22.97 0.00 42.31 2.90
250 251 1.816679 GCTGCATGCATCGTCCTGA 60.817 57.895 22.97 0.00 42.31 3.86
251 252 2.713770 GCTGCATGCATCGTCCTG 59.286 61.111 22.97 8.76 42.31 3.86
252 253 2.515523 GGCTGCATGCATCGTCCT 60.516 61.111 22.97 0.00 45.15 3.85
253 254 0.815213 TAAGGCTGCATGCATCGTCC 60.815 55.000 22.97 18.70 45.15 4.79
254 255 1.196354 GATAAGGCTGCATGCATCGTC 59.804 52.381 22.97 12.50 45.15 4.20
255 256 1.233019 GATAAGGCTGCATGCATCGT 58.767 50.000 22.97 16.29 45.15 3.73
256 257 1.069432 GTGATAAGGCTGCATGCATCG 60.069 52.381 22.97 12.00 45.15 3.84
257 258 1.268899 GGTGATAAGGCTGCATGCATC 59.731 52.381 22.97 17.75 45.15 3.91
258 259 1.133575 AGGTGATAAGGCTGCATGCAT 60.134 47.619 22.97 9.00 45.15 3.96
259 260 0.256752 AGGTGATAAGGCTGCATGCA 59.743 50.000 21.29 21.29 45.15 3.96
260 261 1.396653 AAGGTGATAAGGCTGCATGC 58.603 50.000 11.82 11.82 41.94 4.06
261 262 3.144506 CCTAAGGTGATAAGGCTGCATG 58.855 50.000 0.50 0.00 0.00 4.06
262 263 2.780010 ACCTAAGGTGATAAGGCTGCAT 59.220 45.455 0.50 0.00 32.98 3.96
263 264 2.196595 ACCTAAGGTGATAAGGCTGCA 58.803 47.619 0.50 0.00 32.98 4.41
264 265 3.244249 CCTACCTAAGGTGATAAGGCTGC 60.244 52.174 0.00 0.00 40.94 5.25
265 266 4.608948 CCTACCTAAGGTGATAAGGCTG 57.391 50.000 0.00 0.00 40.94 4.85
275 276 6.633832 AACACACAGTTCACCTACCTAAGGT 61.634 44.000 0.00 0.00 45.54 3.50
276 277 4.202326 AACACACAGTTCACCTACCTAAGG 60.202 45.833 0.00 0.00 43.91 2.69
277 278 4.602340 ACACACAGTTCACCTACCTAAG 57.398 45.455 0.00 0.00 0.00 2.18
278 279 5.129815 AGAAACACACAGTTCACCTACCTAA 59.870 40.000 0.00 0.00 40.26 2.69
279 280 4.652421 AGAAACACACAGTTCACCTACCTA 59.348 41.667 0.00 0.00 40.26 3.08
280 281 3.454812 AGAAACACACAGTTCACCTACCT 59.545 43.478 0.00 0.00 40.26 3.08
281 282 3.805207 AGAAACACACAGTTCACCTACC 58.195 45.455 0.00 0.00 40.26 3.18
282 283 7.871463 AGTATAAGAAACACACAGTTCACCTAC 59.129 37.037 0.00 0.00 40.26 3.18
283 284 7.870954 CAGTATAAGAAACACACAGTTCACCTA 59.129 37.037 0.00 0.00 40.26 3.08
284 285 6.706270 CAGTATAAGAAACACACAGTTCACCT 59.294 38.462 0.00 0.00 40.26 4.00
285 286 6.704493 TCAGTATAAGAAACACACAGTTCACC 59.296 38.462 0.00 0.00 40.26 4.02
286 287 7.709269 TCAGTATAAGAAACACACAGTTCAC 57.291 36.000 0.00 0.00 40.26 3.18
287 288 7.328493 CGATCAGTATAAGAAACACACAGTTCA 59.672 37.037 0.00 0.00 40.26 3.18
288 289 7.541091 TCGATCAGTATAAGAAACACACAGTTC 59.459 37.037 0.00 0.00 40.26 3.01
289 290 7.375834 TCGATCAGTATAAGAAACACACAGTT 58.624 34.615 0.00 0.00 43.89 3.16
290 291 6.920817 TCGATCAGTATAAGAAACACACAGT 58.079 36.000 0.00 0.00 0.00 3.55
291 292 7.812309 TTCGATCAGTATAAGAAACACACAG 57.188 36.000 0.00 0.00 0.00 3.66
292 293 8.014322 GTTTCGATCAGTATAAGAAACACACA 57.986 34.615 12.63 0.00 45.66 3.72
297 298 7.290857 TGCAGTTTCGATCAGTATAAGAAAC 57.709 36.000 10.31 10.31 46.30 2.78
298 299 7.413000 GCTTGCAGTTTCGATCAGTATAAGAAA 60.413 37.037 0.00 0.00 0.00 2.52
299 300 6.036083 GCTTGCAGTTTCGATCAGTATAAGAA 59.964 38.462 0.00 0.00 0.00 2.52
300 301 5.520288 GCTTGCAGTTTCGATCAGTATAAGA 59.480 40.000 0.00 0.00 0.00 2.10
301 302 5.291858 TGCTTGCAGTTTCGATCAGTATAAG 59.708 40.000 0.00 0.00 0.00 1.73
302 303 5.175127 TGCTTGCAGTTTCGATCAGTATAA 58.825 37.500 0.00 0.00 0.00 0.98
303 304 4.754322 TGCTTGCAGTTTCGATCAGTATA 58.246 39.130 0.00 0.00 0.00 1.47
304 305 3.599343 TGCTTGCAGTTTCGATCAGTAT 58.401 40.909 0.00 0.00 0.00 2.12
305 306 2.995939 CTGCTTGCAGTTTCGATCAGTA 59.004 45.455 13.89 0.00 0.00 2.74
306 307 1.802960 CTGCTTGCAGTTTCGATCAGT 59.197 47.619 13.89 0.00 0.00 3.41
307 308 2.071540 TCTGCTTGCAGTTTCGATCAG 58.928 47.619 20.20 0.00 0.00 2.90
308 309 1.800586 GTCTGCTTGCAGTTTCGATCA 59.199 47.619 20.20 0.00 0.00 2.92
309 310 1.201855 CGTCTGCTTGCAGTTTCGATC 60.202 52.381 20.20 5.20 0.00 3.69
310 311 0.792640 CGTCTGCTTGCAGTTTCGAT 59.207 50.000 20.20 0.00 0.00 3.59
311 312 1.221466 CCGTCTGCTTGCAGTTTCGA 61.221 55.000 24.49 7.82 0.00 3.71
312 313 1.205064 CCGTCTGCTTGCAGTTTCG 59.795 57.895 20.20 20.10 0.00 3.46
313 314 0.514691 CTCCGTCTGCTTGCAGTTTC 59.485 55.000 20.20 11.92 0.00 2.78
314 315 0.886490 CCTCCGTCTGCTTGCAGTTT 60.886 55.000 20.20 0.00 0.00 2.66
315 316 1.302033 CCTCCGTCTGCTTGCAGTT 60.302 57.895 20.20 0.00 0.00 3.16
316 317 2.164865 CTCCTCCGTCTGCTTGCAGT 62.165 60.000 20.20 0.00 0.00 4.40
317 318 1.447489 CTCCTCCGTCTGCTTGCAG 60.447 63.158 15.74 15.74 0.00 4.41
318 319 2.659016 CTCCTCCGTCTGCTTGCA 59.341 61.111 0.00 0.00 0.00 4.08
319 320 2.125350 CCTCCTCCGTCTGCTTGC 60.125 66.667 0.00 0.00 0.00 4.01
320 321 2.125350 GCCTCCTCCGTCTGCTTG 60.125 66.667 0.00 0.00 0.00 4.01
321 322 3.764466 CGCCTCCTCCGTCTGCTT 61.764 66.667 0.00 0.00 0.00 3.91
322 323 3.640257 TACGCCTCCTCCGTCTGCT 62.640 63.158 0.00 0.00 39.88 4.24
323 324 2.615262 CTTACGCCTCCTCCGTCTGC 62.615 65.000 0.00 0.00 39.88 4.26
324 325 1.030488 TCTTACGCCTCCTCCGTCTG 61.030 60.000 0.00 0.00 39.88 3.51
325 326 0.106619 ATCTTACGCCTCCTCCGTCT 60.107 55.000 0.00 0.00 39.88 4.18
326 327 0.745468 AATCTTACGCCTCCTCCGTC 59.255 55.000 0.00 0.00 39.88 4.79
327 328 0.745468 GAATCTTACGCCTCCTCCGT 59.255 55.000 0.00 0.00 42.26 4.69
328 329 0.317938 CGAATCTTACGCCTCCTCCG 60.318 60.000 0.00 0.00 0.00 4.63
329 330 1.030457 TCGAATCTTACGCCTCCTCC 58.970 55.000 0.00 0.00 0.00 4.30
330 331 1.677052 AGTCGAATCTTACGCCTCCTC 59.323 52.381 0.00 0.00 0.00 3.71
331 332 1.765230 AGTCGAATCTTACGCCTCCT 58.235 50.000 0.00 0.00 0.00 3.69
332 333 2.617774 AGTAGTCGAATCTTACGCCTCC 59.382 50.000 0.00 0.00 0.00 4.30
333 334 3.967203 AGTAGTCGAATCTTACGCCTC 57.033 47.619 0.00 0.00 0.00 4.70
334 335 3.693085 TCAAGTAGTCGAATCTTACGCCT 59.307 43.478 0.00 0.00 0.00 5.52
335 336 4.025015 TCAAGTAGTCGAATCTTACGCC 57.975 45.455 0.00 0.00 0.00 5.68
336 337 6.690098 TGTATTCAAGTAGTCGAATCTTACGC 59.310 38.462 0.00 0.00 33.90 4.42
337 338 8.121086 TCTGTATTCAAGTAGTCGAATCTTACG 58.879 37.037 0.00 0.00 33.90 3.18
338 339 9.953697 ATCTGTATTCAAGTAGTCGAATCTTAC 57.046 33.333 0.00 0.00 33.90 2.34
342 343 7.921214 TCCAATCTGTATTCAAGTAGTCGAATC 59.079 37.037 0.00 0.00 33.90 2.52
351 352 5.192522 AGGGTCATCCAATCTGTATTCAAGT 59.807 40.000 0.00 0.00 38.24 3.16
352 353 5.688807 AGGGTCATCCAATCTGTATTCAAG 58.311 41.667 0.00 0.00 38.24 3.02
353 354 5.715439 AGGGTCATCCAATCTGTATTCAA 57.285 39.130 0.00 0.00 38.24 2.69
354 355 5.715439 AAGGGTCATCCAATCTGTATTCA 57.285 39.130 0.00 0.00 38.24 2.57
357 358 6.332976 AGAAAAGGGTCATCCAATCTGTAT 57.667 37.500 0.00 0.00 38.24 2.29
359 360 4.664688 AGAAAAGGGTCATCCAATCTGT 57.335 40.909 0.00 0.00 38.24 3.41
360 361 5.259632 AGAAGAAAAGGGTCATCCAATCTG 58.740 41.667 0.00 0.00 38.24 2.90
361 362 5.527026 AGAAGAAAAGGGTCATCCAATCT 57.473 39.130 0.00 0.00 38.24 2.40
362 363 5.623141 GCAAGAAGAAAAGGGTCATCCAATC 60.623 44.000 0.00 0.00 38.24 2.67
364 365 3.573967 GCAAGAAGAAAAGGGTCATCCAA 59.426 43.478 0.00 0.00 38.24 3.53
365 366 3.157087 GCAAGAAGAAAAGGGTCATCCA 58.843 45.455 0.00 0.00 38.24 3.41
366 367 2.493675 GGCAAGAAGAAAAGGGTCATCC 59.506 50.000 0.00 0.00 0.00 3.51
367 368 2.162408 CGGCAAGAAGAAAAGGGTCATC 59.838 50.000 0.00 0.00 0.00 2.92
368 369 2.162681 CGGCAAGAAGAAAAGGGTCAT 58.837 47.619 0.00 0.00 0.00 3.06
371 486 0.476771 TCCGGCAAGAAGAAAAGGGT 59.523 50.000 0.00 0.00 0.00 4.34
374 489 2.079925 CTCCTCCGGCAAGAAGAAAAG 58.920 52.381 0.00 0.00 0.00 2.27
376 491 1.348064 TCTCCTCCGGCAAGAAGAAA 58.652 50.000 0.00 0.00 0.00 2.52
377 492 1.573108 ATCTCCTCCGGCAAGAAGAA 58.427 50.000 0.00 0.00 0.00 2.52
384 499 0.617535 TCCTCAAATCTCCTCCGGCA 60.618 55.000 0.00 0.00 0.00 5.69
389 504 4.282496 TCTGTAGGTCCTCAAATCTCCTC 58.718 47.826 0.00 0.00 0.00 3.71
390 505 4.338795 TCTGTAGGTCCTCAAATCTCCT 57.661 45.455 0.00 0.00 0.00 3.69
391 506 4.223032 TGTTCTGTAGGTCCTCAAATCTCC 59.777 45.833 0.00 0.00 0.00 3.71
392 507 5.172205 GTGTTCTGTAGGTCCTCAAATCTC 58.828 45.833 0.00 0.00 0.00 2.75
394 509 4.894784 TGTGTTCTGTAGGTCCTCAAATC 58.105 43.478 0.00 0.00 0.00 2.17
396 511 4.346709 TCATGTGTTCTGTAGGTCCTCAAA 59.653 41.667 0.00 0.00 0.00 2.69
397 512 3.901222 TCATGTGTTCTGTAGGTCCTCAA 59.099 43.478 0.00 0.00 0.00 3.02
398 513 3.506398 TCATGTGTTCTGTAGGTCCTCA 58.494 45.455 0.00 0.00 0.00 3.86
399 514 3.764434 TCTCATGTGTTCTGTAGGTCCTC 59.236 47.826 0.00 0.00 0.00 3.71
400 515 3.766591 CTCTCATGTGTTCTGTAGGTCCT 59.233 47.826 0.00 0.00 0.00 3.85
402 517 5.392767 TTCTCTCATGTGTTCTGTAGGTC 57.607 43.478 0.00 0.00 0.00 3.85
403 518 4.322349 GCTTCTCTCATGTGTTCTGTAGGT 60.322 45.833 0.00 0.00 0.00 3.08
404 519 4.180057 GCTTCTCTCATGTGTTCTGTAGG 58.820 47.826 0.00 0.00 0.00 3.18
406 521 4.814147 CTGCTTCTCTCATGTGTTCTGTA 58.186 43.478 0.00 0.00 0.00 2.74
407 522 3.661944 CTGCTTCTCTCATGTGTTCTGT 58.338 45.455 0.00 0.00 0.00 3.41
408 523 2.415857 GCTGCTTCTCTCATGTGTTCTG 59.584 50.000 0.00 0.00 0.00 3.02
409 524 2.302445 AGCTGCTTCTCTCATGTGTTCT 59.698 45.455 0.00 0.00 0.00 3.01
410 525 2.697654 AGCTGCTTCTCTCATGTGTTC 58.302 47.619 0.00 0.00 0.00 3.18
411 526 2.855209 AGCTGCTTCTCTCATGTGTT 57.145 45.000 0.00 0.00 0.00 3.32
412 527 2.830923 AGTAGCTGCTTCTCTCATGTGT 59.169 45.455 7.79 0.00 0.00 3.72
413 528 3.523606 AGTAGCTGCTTCTCTCATGTG 57.476 47.619 7.79 0.00 0.00 3.21
414 529 4.501229 GCATAGTAGCTGCTTCTCTCATGT 60.501 45.833 10.41 0.00 36.68 3.21
415 530 3.989167 GCATAGTAGCTGCTTCTCTCATG 59.011 47.826 10.41 11.57 36.68 3.07
416 531 4.255833 GCATAGTAGCTGCTTCTCTCAT 57.744 45.455 10.41 0.00 36.68 2.90
417 532 3.724508 GCATAGTAGCTGCTTCTCTCA 57.275 47.619 10.41 0.00 36.68 3.27
437 552 2.613730 TTACTCGACGAGCTTGACAG 57.386 50.000 24.38 4.84 32.04 3.51
438 553 2.606308 GGTTTACTCGACGAGCTTGACA 60.606 50.000 24.38 0.45 32.04 3.58
439 554 1.984297 GGTTTACTCGACGAGCTTGAC 59.016 52.381 24.38 16.44 32.04 3.18
440 555 1.400629 CGGTTTACTCGACGAGCTTGA 60.401 52.381 24.38 5.80 32.04 3.02
441 556 0.982673 CGGTTTACTCGACGAGCTTG 59.017 55.000 24.38 0.00 32.04 4.01
442 557 0.877071 TCGGTTTACTCGACGAGCTT 59.123 50.000 24.38 8.95 32.04 3.74
443 558 0.877071 TTCGGTTTACTCGACGAGCT 59.123 50.000 24.38 13.84 36.65 4.09
444 559 1.844962 GATTCGGTTTACTCGACGAGC 59.155 52.381 24.38 8.15 36.65 5.03
445 560 2.159476 TGGATTCGGTTTACTCGACGAG 60.159 50.000 22.97 22.97 36.65 4.18
446 561 1.811965 TGGATTCGGTTTACTCGACGA 59.188 47.619 0.00 0.00 36.30 4.20
447 562 2.267188 TGGATTCGGTTTACTCGACG 57.733 50.000 0.00 0.00 36.30 5.12
448 563 3.582780 ACTTGGATTCGGTTTACTCGAC 58.417 45.455 0.00 0.00 36.30 4.20
449 564 3.947910 ACTTGGATTCGGTTTACTCGA 57.052 42.857 0.00 0.00 34.62 4.04
450 565 3.991773 TGAACTTGGATTCGGTTTACTCG 59.008 43.478 0.00 0.00 0.00 4.18
451 566 4.995487 ACTGAACTTGGATTCGGTTTACTC 59.005 41.667 0.00 0.00 44.18 2.59
452 567 4.969484 ACTGAACTTGGATTCGGTTTACT 58.031 39.130 0.00 0.00 44.18 2.24
453 568 4.153655 GGACTGAACTTGGATTCGGTTTAC 59.846 45.833 1.74 0.00 46.09 2.01
454 569 4.202377 TGGACTGAACTTGGATTCGGTTTA 60.202 41.667 1.74 0.00 46.09 2.01
455 570 3.146847 GGACTGAACTTGGATTCGGTTT 58.853 45.455 1.74 0.00 46.09 3.27
456 571 2.105821 TGGACTGAACTTGGATTCGGTT 59.894 45.455 1.74 0.00 46.09 4.44
458 573 2.472695 TGGACTGAACTTGGATTCGG 57.527 50.000 0.00 0.00 40.29 4.30
459 574 5.156355 CAAAATGGACTGAACTTGGATTCG 58.844 41.667 0.00 0.00 0.00 3.34
460 575 6.089249 ACAAAATGGACTGAACTTGGATTC 57.911 37.500 0.00 0.00 0.00 2.52
461 576 6.098124 TGAACAAAATGGACTGAACTTGGATT 59.902 34.615 0.00 0.00 0.00 3.01
462 577 5.598005 TGAACAAAATGGACTGAACTTGGAT 59.402 36.000 0.00 0.00 0.00 3.41
463 578 4.952957 TGAACAAAATGGACTGAACTTGGA 59.047 37.500 0.00 0.00 0.00 3.53
464 579 5.043248 GTGAACAAAATGGACTGAACTTGG 58.957 41.667 0.00 0.00 0.00 3.61
465 580 4.734854 CGTGAACAAAATGGACTGAACTTG 59.265 41.667 0.00 0.00 0.00 3.16
466 581 4.398044 ACGTGAACAAAATGGACTGAACTT 59.602 37.500 0.00 0.00 0.00 2.66
467 582 3.945285 ACGTGAACAAAATGGACTGAACT 59.055 39.130 0.00 0.00 0.00 3.01
468 583 4.035017 CACGTGAACAAAATGGACTGAAC 58.965 43.478 10.90 0.00 0.00 3.18
469 584 3.942115 TCACGTGAACAAAATGGACTGAA 59.058 39.130 17.62 0.00 0.00 3.02
470 585 3.311322 GTCACGTGAACAAAATGGACTGA 59.689 43.478 21.95 0.00 0.00 3.41
471 586 3.064682 TGTCACGTGAACAAAATGGACTG 59.935 43.478 21.95 0.00 0.00 3.51
472 587 3.275143 TGTCACGTGAACAAAATGGACT 58.725 40.909 21.95 0.00 0.00 3.85
473 588 3.684103 TGTCACGTGAACAAAATGGAC 57.316 42.857 21.95 4.72 0.00 4.02
474 589 4.703645 TTTGTCACGTGAACAAAATGGA 57.296 36.364 28.21 15.52 31.44 3.41
475 590 5.964887 ATTTTGTCACGTGAACAAAATGG 57.035 34.783 37.04 11.56 46.10 3.16
478 593 5.060662 TGGATTTTGTCACGTGAACAAAA 57.939 34.783 34.44 34.44 44.15 2.44
479 594 4.703645 TGGATTTTGTCACGTGAACAAA 57.296 36.364 27.37 27.37 0.00 2.83
480 595 4.156922 ACTTGGATTTTGTCACGTGAACAA 59.843 37.500 21.95 21.75 0.00 2.83
481 596 3.692101 ACTTGGATTTTGTCACGTGAACA 59.308 39.130 21.95 17.27 0.00 3.18
482 597 4.287238 ACTTGGATTTTGTCACGTGAAC 57.713 40.909 21.95 14.83 0.00 3.18
483 598 4.396478 TCAACTTGGATTTTGTCACGTGAA 59.604 37.500 21.95 4.71 0.00 3.18
484 599 3.942115 TCAACTTGGATTTTGTCACGTGA 59.058 39.130 15.76 15.76 0.00 4.35
485 600 4.285807 TCAACTTGGATTTTGTCACGTG 57.714 40.909 9.94 9.94 0.00 4.49
486 601 4.974368 TTCAACTTGGATTTTGTCACGT 57.026 36.364 0.00 0.00 0.00 4.49
487 602 5.339990 ACTTTCAACTTGGATTTTGTCACG 58.660 37.500 0.00 0.00 0.00 4.35
488 603 6.455513 GCAACTTTCAACTTGGATTTTGTCAC 60.456 38.462 0.00 0.00 0.00 3.67
489 604 5.580297 GCAACTTTCAACTTGGATTTTGTCA 59.420 36.000 0.00 0.00 0.00 3.58
490 605 5.812127 AGCAACTTTCAACTTGGATTTTGTC 59.188 36.000 0.00 0.00 0.00 3.18
491 606 5.733676 AGCAACTTTCAACTTGGATTTTGT 58.266 33.333 0.00 0.00 0.00 2.83
492 607 6.667007 AAGCAACTTTCAACTTGGATTTTG 57.333 33.333 0.00 0.00 0.00 2.44
493 608 7.607607 AGAAAAGCAACTTTCAACTTGGATTTT 59.392 29.630 8.19 0.00 37.70 1.82
494 609 7.105588 AGAAAAGCAACTTTCAACTTGGATTT 58.894 30.769 8.19 0.00 37.70 2.17
495 610 6.643388 AGAAAAGCAACTTTCAACTTGGATT 58.357 32.000 8.19 0.00 37.70 3.01
496 611 6.225981 AGAAAAGCAACTTTCAACTTGGAT 57.774 33.333 8.19 0.00 37.70 3.41
497 612 5.659440 AGAAAAGCAACTTTCAACTTGGA 57.341 34.783 8.19 0.00 37.70 3.53
498 613 5.291858 GGAAGAAAAGCAACTTTCAACTTGG 59.708 40.000 8.19 0.00 37.70 3.61
499 614 6.101997 AGGAAGAAAAGCAACTTTCAACTTG 58.898 36.000 8.19 0.00 37.70 3.16
500 615 6.286240 AGGAAGAAAAGCAACTTTCAACTT 57.714 33.333 8.19 1.15 37.70 2.66
501 616 5.921962 AGGAAGAAAAGCAACTTTCAACT 57.078 34.783 8.19 2.00 37.70 3.16
502 617 6.333416 AGAAGGAAGAAAAGCAACTTTCAAC 58.667 36.000 8.19 2.96 37.70 3.18
503 618 6.530019 AGAAGGAAGAAAAGCAACTTTCAA 57.470 33.333 8.19 0.00 37.70 2.69
504 619 6.263168 CCTAGAAGGAAGAAAAGCAACTTTCA 59.737 38.462 8.19 0.00 37.67 2.69
505 620 6.486993 TCCTAGAAGGAAGAAAAGCAACTTTC 59.513 38.462 0.00 0.00 42.51 2.62
506 621 6.365520 TCCTAGAAGGAAGAAAAGCAACTTT 58.634 36.000 0.00 0.00 42.51 2.66
507 622 5.941788 TCCTAGAAGGAAGAAAAGCAACTT 58.058 37.500 0.00 0.00 42.51 2.66
508 623 5.568620 TCCTAGAAGGAAGAAAAGCAACT 57.431 39.130 0.00 0.00 42.51 3.16
520 635 7.202307 AGATCTCTGAATCTGATCCTAGAAGGA 60.202 40.741 0.00 0.00 40.57 3.36
521 636 6.950041 AGATCTCTGAATCTGATCCTAGAAGG 59.050 42.308 0.00 0.00 37.80 3.46
522 637 8.301720 CAAGATCTCTGAATCTGATCCTAGAAG 58.698 40.741 0.00 0.00 37.80 2.85
523 638 7.255906 GCAAGATCTCTGAATCTGATCCTAGAA 60.256 40.741 0.00 0.00 37.80 2.10
524 639 6.209192 GCAAGATCTCTGAATCTGATCCTAGA 59.791 42.308 0.00 0.00 37.80 2.43
525 640 6.392354 GCAAGATCTCTGAATCTGATCCTAG 58.608 44.000 0.00 0.00 37.80 3.02
526 641 5.245751 GGCAAGATCTCTGAATCTGATCCTA 59.754 44.000 0.00 0.00 37.80 2.94
527 642 4.040706 GGCAAGATCTCTGAATCTGATCCT 59.959 45.833 0.00 0.00 37.80 3.24
528 643 4.202336 TGGCAAGATCTCTGAATCTGATCC 60.202 45.833 0.00 5.40 37.80 3.36
529 644 4.958509 TGGCAAGATCTCTGAATCTGATC 58.041 43.478 0.00 0.00 36.14 2.92
530 645 5.309638 CATGGCAAGATCTCTGAATCTGAT 58.690 41.667 0.00 0.00 36.14 2.90
531 646 4.444449 CCATGGCAAGATCTCTGAATCTGA 60.444 45.833 0.00 0.00 36.14 3.27
532 647 3.815962 CCATGGCAAGATCTCTGAATCTG 59.184 47.826 0.00 0.00 36.14 2.90
533 648 3.458857 ACCATGGCAAGATCTCTGAATCT 59.541 43.478 13.04 0.00 37.61 2.40
534 649 3.814283 GACCATGGCAAGATCTCTGAATC 59.186 47.826 13.04 0.00 0.00 2.52
535 650 3.201487 TGACCATGGCAAGATCTCTGAAT 59.799 43.478 13.04 0.00 0.00 2.57
536 651 2.573009 TGACCATGGCAAGATCTCTGAA 59.427 45.455 13.04 0.00 0.00 3.02
537 652 2.190538 TGACCATGGCAAGATCTCTGA 58.809 47.619 13.04 0.00 0.00 3.27
538 653 2.704464 TGACCATGGCAAGATCTCTG 57.296 50.000 13.04 0.00 0.00 3.35
539 654 3.265221 TCTTTGACCATGGCAAGATCTCT 59.735 43.478 13.04 0.00 0.00 3.10
540 655 3.614092 TCTTTGACCATGGCAAGATCTC 58.386 45.455 13.04 0.00 0.00 2.75
541 656 3.726557 TCTTTGACCATGGCAAGATCT 57.273 42.857 13.04 0.00 0.00 2.75
542 657 6.444633 CAATATCTTTGACCATGGCAAGATC 58.555 40.000 26.48 13.21 0.00 2.75
543 658 5.221382 GCAATATCTTTGACCATGGCAAGAT 60.221 40.000 26.16 26.16 0.00 2.40
544 659 4.098349 GCAATATCTTTGACCATGGCAAGA 59.902 41.667 19.03 19.03 0.00 3.02
545 660 4.142116 TGCAATATCTTTGACCATGGCAAG 60.142 41.667 13.04 11.90 0.00 4.01
546 661 3.768215 TGCAATATCTTTGACCATGGCAA 59.232 39.130 13.04 14.28 0.00 4.52
547 662 3.363627 TGCAATATCTTTGACCATGGCA 58.636 40.909 13.04 8.31 0.00 4.92
548 663 4.389890 TTGCAATATCTTTGACCATGGC 57.610 40.909 13.04 5.35 0.00 4.40
549 664 6.575267 TGATTTGCAATATCTTTGACCATGG 58.425 36.000 11.19 11.19 0.00 3.66
550 665 7.485810 TCTGATTTGCAATATCTTTGACCATG 58.514 34.615 16.99 0.00 0.00 3.66
551 666 7.649533 TCTGATTTGCAATATCTTTGACCAT 57.350 32.000 16.99 0.00 0.00 3.55
552 667 7.465353 TTCTGATTTGCAATATCTTTGACCA 57.535 32.000 16.99 0.00 0.00 4.02
553 668 7.009907 GCTTTCTGATTTGCAATATCTTTGACC 59.990 37.037 16.99 4.82 0.00 4.02
554 669 7.758528 AGCTTTCTGATTTGCAATATCTTTGAC 59.241 33.333 16.99 7.48 0.00 3.18
555 670 7.833786 AGCTTTCTGATTTGCAATATCTTTGA 58.166 30.769 16.99 11.88 0.00 2.69
556 671 9.234384 CTAGCTTTCTGATTTGCAATATCTTTG 57.766 33.333 16.99 10.52 0.00 2.77
557 672 7.919621 GCTAGCTTTCTGATTTGCAATATCTTT 59.080 33.333 7.70 0.00 0.00 2.52
558 673 7.067859 TGCTAGCTTTCTGATTTGCAATATCTT 59.932 33.333 17.23 0.00 0.00 2.40
559 674 6.544931 TGCTAGCTTTCTGATTTGCAATATCT 59.455 34.615 17.23 0.00 0.00 1.98
560 675 6.636044 GTGCTAGCTTTCTGATTTGCAATATC 59.364 38.462 17.23 7.27 0.00 1.63
561 676 6.320672 AGTGCTAGCTTTCTGATTTGCAATAT 59.679 34.615 17.23 0.00 0.00 1.28
562 677 5.649395 AGTGCTAGCTTTCTGATTTGCAATA 59.351 36.000 17.23 0.00 0.00 1.90
563 678 4.461781 AGTGCTAGCTTTCTGATTTGCAAT 59.538 37.500 17.23 0.00 0.00 3.56
564 679 3.822735 AGTGCTAGCTTTCTGATTTGCAA 59.177 39.130 17.23 0.00 0.00 4.08
565 680 3.189910 CAGTGCTAGCTTTCTGATTTGCA 59.810 43.478 17.23 0.00 0.00 4.08
566 681 3.190118 ACAGTGCTAGCTTTCTGATTTGC 59.810 43.478 27.90 0.00 0.00 3.68
567 682 4.694509 AGACAGTGCTAGCTTTCTGATTTG 59.305 41.667 27.90 12.85 0.00 2.32
568 683 4.904241 AGACAGTGCTAGCTTTCTGATTT 58.096 39.130 27.90 14.67 0.00 2.17
569 684 4.550076 AGACAGTGCTAGCTTTCTGATT 57.450 40.909 27.90 17.92 0.00 2.57
570 685 4.550076 AAGACAGTGCTAGCTTTCTGAT 57.450 40.909 27.90 18.44 0.00 2.90
571 686 4.202253 TGAAAGACAGTGCTAGCTTTCTGA 60.202 41.667 27.90 9.93 43.92 3.27
572 687 4.060900 TGAAAGACAGTGCTAGCTTTCTG 58.939 43.478 23.11 23.11 43.92 3.02
573 688 4.314121 CTGAAAGACAGTGCTAGCTTTCT 58.686 43.478 17.23 8.98 43.92 2.52
574 689 4.660352 CTGAAAGACAGTGCTAGCTTTC 57.340 45.455 17.23 15.66 43.88 2.62
586 701 4.021104 ACGAGGATTCATGACTGAAAGACA 60.021 41.667 0.00 0.00 44.29 3.41
587 702 4.499183 ACGAGGATTCATGACTGAAAGAC 58.501 43.478 0.00 0.00 44.29 3.01
588 703 4.808414 ACGAGGATTCATGACTGAAAGA 57.192 40.909 0.00 0.00 44.29 2.52
589 704 4.032217 CGAACGAGGATTCATGACTGAAAG 59.968 45.833 0.00 0.00 44.29 2.62
590 705 3.926527 CGAACGAGGATTCATGACTGAAA 59.073 43.478 0.00 0.00 44.29 2.69
591 706 3.192633 TCGAACGAGGATTCATGACTGAA 59.807 43.478 0.00 0.00 45.15 3.02
592 707 2.752903 TCGAACGAGGATTCATGACTGA 59.247 45.455 0.00 0.00 0.00 3.41
593 708 3.111838 CTCGAACGAGGATTCATGACTG 58.888 50.000 15.22 0.00 38.51 3.51
594 709 2.755655 ACTCGAACGAGGATTCATGACT 59.244 45.455 24.33 0.00 45.88 3.41
595 710 3.152261 ACTCGAACGAGGATTCATGAC 57.848 47.619 24.33 0.00 45.88 3.06
596 711 3.868757 AACTCGAACGAGGATTCATGA 57.131 42.857 24.33 0.00 45.88 3.07
597 712 6.589830 AAATAACTCGAACGAGGATTCATG 57.410 37.500 24.33 2.41 45.88 3.07
598 713 7.611213 AAAAATAACTCGAACGAGGATTCAT 57.389 32.000 24.33 13.91 45.88 2.57
648 763 9.632638 AGAAAACAATAGCATTCCTGTATGTAT 57.367 29.630 0.00 0.00 0.00 2.29
651 766 7.765307 ACAGAAAACAATAGCATTCCTGTATG 58.235 34.615 0.00 0.00 0.00 2.39
653 768 6.939730 TGACAGAAAACAATAGCATTCCTGTA 59.060 34.615 0.00 0.00 0.00 2.74
657 772 6.681777 ACTTGACAGAAAACAATAGCATTCC 58.318 36.000 0.00 0.00 0.00 3.01
660 775 5.922544 GCAACTTGACAGAAAACAATAGCAT 59.077 36.000 0.00 0.00 0.00 3.79
662 777 5.523369 AGCAACTTGACAGAAAACAATAGC 58.477 37.500 0.00 0.00 0.00 2.97
663 778 7.992180 AAAGCAACTTGACAGAAAACAATAG 57.008 32.000 0.00 0.00 0.00 1.73
665 780 7.099120 AGAAAAGCAACTTGACAGAAAACAAT 58.901 30.769 0.00 0.00 0.00 2.71
668 783 6.808704 AGAAGAAAAGCAACTTGACAGAAAAC 59.191 34.615 0.00 0.00 0.00 2.43
673 788 7.020914 ACTTAGAAGAAAAGCAACTTGACAG 57.979 36.000 0.00 0.00 0.00 3.51
675 790 7.011482 TCTGACTTAGAAGAAAAGCAACTTGAC 59.989 37.037 0.00 0.00 30.84 3.18
676 791 7.047891 TCTGACTTAGAAGAAAAGCAACTTGA 58.952 34.615 0.00 0.00 30.84 3.02
677 792 7.251704 TCTGACTTAGAAGAAAAGCAACTTG 57.748 36.000 0.00 0.00 30.84 3.16
694 1018 2.686915 GCATAATGCCAGCTTCTGACTT 59.313 45.455 0.00 0.00 37.42 3.01
695 1019 2.295885 GCATAATGCCAGCTTCTGACT 58.704 47.619 0.00 0.00 37.42 3.41
707 1031 5.170021 TCAACTGACAAATTGGCATAATGC 58.830 37.500 0.33 0.00 44.08 3.56
708 1032 6.392354 ACTCAACTGACAAATTGGCATAATG 58.608 36.000 0.33 2.17 33.12 1.90
709 1033 6.594788 ACTCAACTGACAAATTGGCATAAT 57.405 33.333 0.33 0.00 33.12 1.28
710 1034 6.403866 AACTCAACTGACAAATTGGCATAA 57.596 33.333 0.33 0.00 33.12 1.90
711 1035 6.403866 AAACTCAACTGACAAATTGGCATA 57.596 33.333 0.33 0.00 33.12 3.14
712 1036 4.942761 AACTCAACTGACAAATTGGCAT 57.057 36.364 0.33 0.00 33.12 4.40
713 1037 4.734398 AAACTCAACTGACAAATTGGCA 57.266 36.364 0.00 0.00 32.24 4.92
714 1038 5.831997 ACTAAACTCAACTGACAAATTGGC 58.168 37.500 0.00 0.00 0.00 4.52
715 1039 7.026631 TGACTAAACTCAACTGACAAATTGG 57.973 36.000 0.00 0.00 0.00 3.16
716 1040 8.909708 TTTGACTAAACTCAACTGACAAATTG 57.090 30.769 0.00 0.00 29.62 2.32
719 1043 9.921637 AAATTTTGACTAAACTCAACTGACAAA 57.078 25.926 0.00 0.00 29.62 2.83
720 1044 9.352784 CAAATTTTGACTAAACTCAACTGACAA 57.647 29.630 2.88 0.00 29.62 3.18
721 1045 7.973388 CCAAATTTTGACTAAACTCAACTGACA 59.027 33.333 10.72 0.00 29.62 3.58
722 1046 7.043391 GCCAAATTTTGACTAAACTCAACTGAC 60.043 37.037 10.72 0.00 29.62 3.51
723 1047 6.978080 GCCAAATTTTGACTAAACTCAACTGA 59.022 34.615 10.72 0.00 29.62 3.41
724 1048 6.756074 TGCCAAATTTTGACTAAACTCAACTG 59.244 34.615 10.72 0.00 29.62 3.16
725 1049 6.756542 GTGCCAAATTTTGACTAAACTCAACT 59.243 34.615 10.72 0.00 29.62 3.16
726 1050 6.533367 TGTGCCAAATTTTGACTAAACTCAAC 59.467 34.615 10.72 0.00 29.62 3.18
727 1051 6.634805 TGTGCCAAATTTTGACTAAACTCAA 58.365 32.000 10.72 0.00 0.00 3.02
728 1052 6.214191 TGTGCCAAATTTTGACTAAACTCA 57.786 33.333 10.72 0.00 0.00 3.41
729 1053 7.277760 AGTTTGTGCCAAATTTTGACTAAACTC 59.722 33.333 17.05 3.87 31.29 3.01
730 1054 7.102993 AGTTTGTGCCAAATTTTGACTAAACT 58.897 30.769 17.05 17.05 31.89 2.66
731 1055 7.302350 AGTTTGTGCCAAATTTTGACTAAAC 57.698 32.000 10.72 13.20 0.00 2.01
732 1056 7.201478 CGAAGTTTGTGCCAAATTTTGACTAAA 60.201 33.333 10.72 3.25 0.00 1.85
733 1057 6.254589 CGAAGTTTGTGCCAAATTTTGACTAA 59.745 34.615 10.72 2.90 0.00 2.24
734 1058 5.746245 CGAAGTTTGTGCCAAATTTTGACTA 59.254 36.000 10.72 0.00 0.00 2.59
735 1059 4.566360 CGAAGTTTGTGCCAAATTTTGACT 59.434 37.500 10.72 2.36 0.00 3.41
736 1060 4.328712 ACGAAGTTTGTGCCAAATTTTGAC 59.671 37.500 20.12 0.00 37.78 3.18
737 1061 4.499183 ACGAAGTTTGTGCCAAATTTTGA 58.501 34.783 20.12 0.00 37.78 2.69
738 1062 4.856115 ACGAAGTTTGTGCCAAATTTTG 57.144 36.364 15.38 15.38 37.78 2.44
754 1078 8.761497 TGAATGAACTAACTAAACTCAACGAAG 58.239 33.333 0.00 0.00 0.00 3.79
755 1079 8.651391 TGAATGAACTAACTAAACTCAACGAA 57.349 30.769 0.00 0.00 0.00 3.85
756 1080 8.651391 TTGAATGAACTAACTAAACTCAACGA 57.349 30.769 0.00 0.00 0.00 3.85
757 1081 8.009974 CCTTGAATGAACTAACTAAACTCAACG 58.990 37.037 0.00 0.00 0.00 4.10
758 1082 8.837389 ACCTTGAATGAACTAACTAAACTCAAC 58.163 33.333 0.00 0.00 0.00 3.18
759 1083 8.974060 ACCTTGAATGAACTAACTAAACTCAA 57.026 30.769 0.00 0.00 0.00 3.02
760 1084 8.836413 CAACCTTGAATGAACTAACTAAACTCA 58.164 33.333 0.00 0.00 0.00 3.41
761 1085 8.837389 ACAACCTTGAATGAACTAACTAAACTC 58.163 33.333 0.00 0.00 0.00 3.01
762 1086 8.747538 ACAACCTTGAATGAACTAACTAAACT 57.252 30.769 0.00 0.00 0.00 2.66
763 1087 8.074370 GGACAACCTTGAATGAACTAACTAAAC 58.926 37.037 0.00 0.00 0.00 2.01
764 1088 7.776030 TGGACAACCTTGAATGAACTAACTAAA 59.224 33.333 0.00 0.00 37.04 1.85
765 1089 7.284074 TGGACAACCTTGAATGAACTAACTAA 58.716 34.615 0.00 0.00 37.04 2.24
766 1090 6.833041 TGGACAACCTTGAATGAACTAACTA 58.167 36.000 0.00 0.00 37.04 2.24
767 1091 5.690865 TGGACAACCTTGAATGAACTAACT 58.309 37.500 0.00 0.00 37.04 2.24
768 1092 5.763204 TCTGGACAACCTTGAATGAACTAAC 59.237 40.000 0.00 0.00 37.04 2.34
769 1093 5.763204 GTCTGGACAACCTTGAATGAACTAA 59.237 40.000 0.00 0.00 37.04 2.24
770 1094 5.071788 AGTCTGGACAACCTTGAATGAACTA 59.928 40.000 3.51 0.00 37.04 2.24
771 1095 4.137543 GTCTGGACAACCTTGAATGAACT 58.862 43.478 0.00 0.00 37.04 3.01
772 1096 4.137543 AGTCTGGACAACCTTGAATGAAC 58.862 43.478 3.51 0.00 37.04 3.18
773 1097 4.437682 AGTCTGGACAACCTTGAATGAA 57.562 40.909 3.51 0.00 37.04 2.57
774 1098 4.593206 AGTAGTCTGGACAACCTTGAATGA 59.407 41.667 3.51 0.00 37.04 2.57
775 1099 4.899502 AGTAGTCTGGACAACCTTGAATG 58.100 43.478 3.51 0.00 37.04 2.67
776 1100 5.568620 AAGTAGTCTGGACAACCTTGAAT 57.431 39.130 3.51 0.00 37.04 2.57
777 1101 5.123227 CAAAGTAGTCTGGACAACCTTGAA 58.877 41.667 3.51 0.00 37.04 2.69
778 1102 4.444306 CCAAAGTAGTCTGGACAACCTTGA 60.444 45.833 3.51 0.00 34.35 3.02
779 1103 3.815401 CCAAAGTAGTCTGGACAACCTTG 59.185 47.826 3.51 2.26 34.35 3.61
780 1104 3.747708 GCCAAAGTAGTCTGGACAACCTT 60.748 47.826 0.00 0.00 34.35 3.50
781 1105 2.224548 GCCAAAGTAGTCTGGACAACCT 60.225 50.000 0.00 0.00 34.35 3.50
782 1106 2.152016 GCCAAAGTAGTCTGGACAACC 58.848 52.381 0.00 0.00 34.35 3.77
783 1107 2.808543 CAGCCAAAGTAGTCTGGACAAC 59.191 50.000 0.00 0.00 34.35 3.32
784 1108 2.703536 TCAGCCAAAGTAGTCTGGACAA 59.296 45.455 0.00 0.00 34.35 3.18
785 1109 2.325484 TCAGCCAAAGTAGTCTGGACA 58.675 47.619 0.00 0.00 34.35 4.02
786 1110 3.402628 TTCAGCCAAAGTAGTCTGGAC 57.597 47.619 0.00 0.00 34.35 4.02
787 1111 4.431416 TTTTCAGCCAAAGTAGTCTGGA 57.569 40.909 0.00 0.00 34.35 3.86
788 1112 5.712152 AATTTTCAGCCAAAGTAGTCTGG 57.288 39.130 0.00 0.00 35.67 3.86
789 1113 7.041098 AGTGTAATTTTCAGCCAAAGTAGTCTG 60.041 37.037 0.00 0.00 0.00 3.51
790 1114 6.998673 AGTGTAATTTTCAGCCAAAGTAGTCT 59.001 34.615 0.00 0.00 0.00 3.24
791 1115 7.203255 AGTGTAATTTTCAGCCAAAGTAGTC 57.797 36.000 0.00 0.00 0.00 2.59
792 1116 7.502561 AGAAGTGTAATTTTCAGCCAAAGTAGT 59.497 33.333 0.00 0.00 0.00 2.73
793 1117 7.875971 AGAAGTGTAATTTTCAGCCAAAGTAG 58.124 34.615 0.00 0.00 0.00 2.57
794 1118 7.040686 GGAGAAGTGTAATTTTCAGCCAAAGTA 60.041 37.037 0.00 0.00 0.00 2.24
795 1119 6.239036 GGAGAAGTGTAATTTTCAGCCAAAGT 60.239 38.462 0.00 0.00 0.00 2.66
796 1120 6.152379 GGAGAAGTGTAATTTTCAGCCAAAG 58.848 40.000 0.00 0.00 0.00 2.77
797 1121 5.596361 TGGAGAAGTGTAATTTTCAGCCAAA 59.404 36.000 0.00 0.00 31.49 3.28
798 1122 5.136828 TGGAGAAGTGTAATTTTCAGCCAA 58.863 37.500 0.00 0.00 31.49 4.52
799 1123 4.724399 TGGAGAAGTGTAATTTTCAGCCA 58.276 39.130 0.00 0.00 31.76 4.75
800 1124 5.705609 TTGGAGAAGTGTAATTTTCAGCC 57.294 39.130 0.00 0.00 0.00 4.85
801 1125 6.739112 ACTTTGGAGAAGTGTAATTTTCAGC 58.261 36.000 0.00 0.00 0.00 4.26
802 1126 8.405531 TGAACTTTGGAGAAGTGTAATTTTCAG 58.594 33.333 0.00 0.00 0.00 3.02
803 1127 8.287439 TGAACTTTGGAGAAGTGTAATTTTCA 57.713 30.769 0.00 0.00 0.00 2.69
804 1128 9.581099 TTTGAACTTTGGAGAAGTGTAATTTTC 57.419 29.630 0.00 0.00 0.00 2.29
805 1129 9.936759 TTTTGAACTTTGGAGAAGTGTAATTTT 57.063 25.926 0.00 0.00 0.00 1.82
806 1130 9.366216 GTTTTGAACTTTGGAGAAGTGTAATTT 57.634 29.630 0.00 0.00 0.00 1.82
807 1131 8.749354 AGTTTTGAACTTTGGAGAAGTGTAATT 58.251 29.630 0.00 0.00 39.04 1.40
808 1132 8.190784 CAGTTTTGAACTTTGGAGAAGTGTAAT 58.809 33.333 0.00 0.00 40.46 1.89
809 1133 7.535139 CAGTTTTGAACTTTGGAGAAGTGTAA 58.465 34.615 0.00 0.00 40.46 2.41
810 1134 6.404293 GCAGTTTTGAACTTTGGAGAAGTGTA 60.404 38.462 0.00 0.00 40.46 2.90
811 1135 5.622233 GCAGTTTTGAACTTTGGAGAAGTGT 60.622 40.000 0.00 0.00 40.46 3.55
812 1136 4.800471 GCAGTTTTGAACTTTGGAGAAGTG 59.200 41.667 0.00 0.00 40.46 3.16
813 1137 4.462483 TGCAGTTTTGAACTTTGGAGAAGT 59.538 37.500 0.00 0.00 40.46 3.01
814 1138 4.997565 TGCAGTTTTGAACTTTGGAGAAG 58.002 39.130 0.00 0.00 40.46 2.85
815 1139 5.596836 ATGCAGTTTTGAACTTTGGAGAA 57.403 34.783 0.00 0.00 40.46 2.87
816 1140 5.596836 AATGCAGTTTTGAACTTTGGAGA 57.403 34.783 0.00 0.00 40.46 3.71
817 1141 6.667007 AAAATGCAGTTTTGAACTTTGGAG 57.333 33.333 6.26 0.00 40.46 3.86
828 1152 2.507471 TCAACCCCCAAAATGCAGTTTT 59.493 40.909 9.83 5.32 40.59 2.43
829 1153 2.122768 TCAACCCCCAAAATGCAGTTT 58.877 42.857 6.26 6.26 0.00 2.66
830 1154 1.799933 TCAACCCCCAAAATGCAGTT 58.200 45.000 0.00 0.00 0.00 3.16
831 1155 1.799933 TTCAACCCCCAAAATGCAGT 58.200 45.000 0.00 0.00 0.00 4.40
832 1156 2.926778 TTTCAACCCCCAAAATGCAG 57.073 45.000 0.00 0.00 0.00 4.41
833 1157 2.978278 AGATTTCAACCCCCAAAATGCA 59.022 40.909 0.00 0.00 0.00 3.96
834 1158 3.701205 AGATTTCAACCCCCAAAATGC 57.299 42.857 0.00 0.00 0.00 3.56
835 1159 5.226194 TGAAGATTTCAACCCCCAAAATG 57.774 39.130 0.00 0.00 36.59 2.32
836 1160 5.903198 TTGAAGATTTCAACCCCCAAAAT 57.097 34.783 0.36 0.00 44.21 1.82
865 1189 6.209361 GTTCCAAGATGAGAAGGTTTCAAAC 58.791 40.000 0.00 0.00 0.00 2.93
866 1190 5.008613 CGTTCCAAGATGAGAAGGTTTCAAA 59.991 40.000 0.00 0.00 0.00 2.69
867 1191 4.515191 CGTTCCAAGATGAGAAGGTTTCAA 59.485 41.667 0.00 0.00 0.00 2.69
868 1192 4.065088 CGTTCCAAGATGAGAAGGTTTCA 58.935 43.478 0.00 0.00 0.00 2.69
869 1193 3.120165 GCGTTCCAAGATGAGAAGGTTTC 60.120 47.826 0.00 0.00 32.01 2.78
870 1194 2.814336 GCGTTCCAAGATGAGAAGGTTT 59.186 45.455 0.00 0.00 32.01 3.27
871 1195 2.224523 TGCGTTCCAAGATGAGAAGGTT 60.225 45.455 0.00 0.00 32.01 3.50
872 1196 1.347707 TGCGTTCCAAGATGAGAAGGT 59.652 47.619 0.00 0.00 32.01 3.50
873 1197 1.734465 GTGCGTTCCAAGATGAGAAGG 59.266 52.381 0.00 0.00 0.00 3.46
874 1198 2.416747 TGTGCGTTCCAAGATGAGAAG 58.583 47.619 0.00 0.00 0.00 2.85
875 1199 2.542020 TGTGCGTTCCAAGATGAGAA 57.458 45.000 0.00 0.00 0.00 2.87
876 1200 2.768253 ATGTGCGTTCCAAGATGAGA 57.232 45.000 0.00 0.00 0.00 3.27
877 1201 3.438087 AGAAATGTGCGTTCCAAGATGAG 59.562 43.478 0.00 0.00 0.00 2.90
878 1202 3.411446 AGAAATGTGCGTTCCAAGATGA 58.589 40.909 0.00 0.00 0.00 2.92
879 1203 3.837213 AGAAATGTGCGTTCCAAGATG 57.163 42.857 0.00 0.00 0.00 2.90
880 1204 4.074970 AGAAGAAATGTGCGTTCCAAGAT 58.925 39.130 0.00 0.00 0.00 2.40
881 1205 3.476552 AGAAGAAATGTGCGTTCCAAGA 58.523 40.909 0.00 0.00 0.00 3.02
882 1206 3.904136 AGAAGAAATGTGCGTTCCAAG 57.096 42.857 0.00 0.00 0.00 3.61
883 1207 3.882888 AGAAGAAGAAATGTGCGTTCCAA 59.117 39.130 0.00 0.00 0.00 3.53
884 1208 3.476552 AGAAGAAGAAATGTGCGTTCCA 58.523 40.909 0.00 0.00 0.00 3.53
885 1209 4.214332 AGAAGAAGAAGAAATGTGCGTTCC 59.786 41.667 0.00 0.00 0.00 3.62
886 1210 5.349824 AGAAGAAGAAGAAATGTGCGTTC 57.650 39.130 0.00 0.00 0.00 3.95
887 1211 5.757850 AAGAAGAAGAAGAAATGTGCGTT 57.242 34.783 0.00 0.00 0.00 4.84
888 1212 5.757850 AAAGAAGAAGAAGAAATGTGCGT 57.242 34.783 0.00 0.00 0.00 5.24
889 1213 6.692681 TCAAAAAGAAGAAGAAGAAATGTGCG 59.307 34.615 0.00 0.00 0.00 5.34
890 1214 7.992180 TCAAAAAGAAGAAGAAGAAATGTGC 57.008 32.000 0.00 0.00 0.00 4.57
892 1216 9.076596 CGTTTCAAAAAGAAGAAGAAGAAATGT 57.923 29.630 0.00 0.00 37.57 2.71
893 1217 8.534778 CCGTTTCAAAAAGAAGAAGAAGAAATG 58.465 33.333 0.00 0.00 37.57 2.32
894 1218 7.706607 CCCGTTTCAAAAAGAAGAAGAAGAAAT 59.293 33.333 0.00 0.00 37.57 2.17
895 1219 7.033185 CCCGTTTCAAAAAGAAGAAGAAGAAA 58.967 34.615 0.00 0.00 37.57 2.52
896 1220 6.376018 TCCCGTTTCAAAAAGAAGAAGAAGAA 59.624 34.615 0.00 0.00 37.57 2.52
897 1221 5.883673 TCCCGTTTCAAAAAGAAGAAGAAGA 59.116 36.000 0.00 0.00 37.57 2.87
898 1222 6.131544 TCCCGTTTCAAAAAGAAGAAGAAG 57.868 37.500 0.00 0.00 37.57 2.85
899 1223 6.518208 TTCCCGTTTCAAAAAGAAGAAGAA 57.482 33.333 0.00 0.00 37.57 2.52
900 1224 6.518208 TTTCCCGTTTCAAAAAGAAGAAGA 57.482 33.333 0.00 0.00 37.57 2.87
901 1225 6.255670 CCTTTTCCCGTTTCAAAAAGAAGAAG 59.744 38.462 8.06 0.00 40.69 2.85
902 1226 6.103330 CCTTTTCCCGTTTCAAAAAGAAGAA 58.897 36.000 8.06 0.00 40.69 2.52
903 1227 5.394773 CCCTTTTCCCGTTTCAAAAAGAAGA 60.395 40.000 8.06 0.00 40.69 2.87
904 1228 4.808895 CCCTTTTCCCGTTTCAAAAAGAAG 59.191 41.667 8.06 0.00 40.69 2.85
905 1229 4.466726 TCCCTTTTCCCGTTTCAAAAAGAA 59.533 37.500 8.06 0.00 40.69 2.52
906 1230 4.024670 TCCCTTTTCCCGTTTCAAAAAGA 58.975 39.130 8.06 0.00 40.69 2.52
907 1231 4.116961 GTCCCTTTTCCCGTTTCAAAAAG 58.883 43.478 0.00 0.00 38.90 2.27
908 1232 3.514309 TGTCCCTTTTCCCGTTTCAAAAA 59.486 39.130 0.00 0.00 0.00 1.94
909 1233 3.097614 TGTCCCTTTTCCCGTTTCAAAA 58.902 40.909 0.00 0.00 0.00 2.44
910 1234 2.736347 TGTCCCTTTTCCCGTTTCAAA 58.264 42.857 0.00 0.00 0.00 2.69
911 1235 2.438800 TGTCCCTTTTCCCGTTTCAA 57.561 45.000 0.00 0.00 0.00 2.69
912 1236 2.158593 TGATGTCCCTTTTCCCGTTTCA 60.159 45.455 0.00 0.00 0.00 2.69
913 1237 2.488153 CTGATGTCCCTTTTCCCGTTTC 59.512 50.000 0.00 0.00 0.00 2.78
914 1238 2.514803 CTGATGTCCCTTTTCCCGTTT 58.485 47.619 0.00 0.00 0.00 3.60
915 1239 1.271926 CCTGATGTCCCTTTTCCCGTT 60.272 52.381 0.00 0.00 0.00 4.44
916 1240 0.328258 CCTGATGTCCCTTTTCCCGT 59.672 55.000 0.00 0.00 0.00 5.28
917 1241 1.032114 GCCTGATGTCCCTTTTCCCG 61.032 60.000 0.00 0.00 0.00 5.14
918 1242 0.039618 TGCCTGATGTCCCTTTTCCC 59.960 55.000 0.00 0.00 0.00 3.97
919 1243 1.923356 TTGCCTGATGTCCCTTTTCC 58.077 50.000 0.00 0.00 0.00 3.13
920 1244 3.157087 TCTTTGCCTGATGTCCCTTTTC 58.843 45.455 0.00 0.00 0.00 2.29
921 1245 3.243359 TCTTTGCCTGATGTCCCTTTT 57.757 42.857 0.00 0.00 0.00 2.27
922 1246 2.978156 TCTTTGCCTGATGTCCCTTT 57.022 45.000 0.00 0.00 0.00 3.11
923 1247 2.978156 TTCTTTGCCTGATGTCCCTT 57.022 45.000 0.00 0.00 0.00 3.95
924 1248 2.800250 CTTTCTTTGCCTGATGTCCCT 58.200 47.619 0.00 0.00 0.00 4.20
925 1249 1.203287 GCTTTCTTTGCCTGATGTCCC 59.797 52.381 0.00 0.00 0.00 4.46
926 1250 2.094854 CAGCTTTCTTTGCCTGATGTCC 60.095 50.000 0.00 0.00 0.00 4.02
927 1251 2.670509 GCAGCTTTCTTTGCCTGATGTC 60.671 50.000 0.00 0.00 34.28 3.06
928 1252 1.271656 GCAGCTTTCTTTGCCTGATGT 59.728 47.619 0.00 0.00 34.28 3.06
929 1253 1.731424 CGCAGCTTTCTTTGCCTGATG 60.731 52.381 0.00 0.00 37.00 3.07
930 1254 0.524862 CGCAGCTTTCTTTGCCTGAT 59.475 50.000 0.00 0.00 37.00 2.90
931 1255 1.518056 CCGCAGCTTTCTTTGCCTGA 61.518 55.000 0.00 0.00 37.00 3.86
932 1256 1.080974 CCGCAGCTTTCTTTGCCTG 60.081 57.895 0.00 0.00 37.00 4.85
933 1257 2.270986 CCCGCAGCTTTCTTTGCCT 61.271 57.895 0.00 0.00 37.00 4.75
934 1258 2.205243 CTCCCGCAGCTTTCTTTGCC 62.205 60.000 0.00 0.00 37.00 4.52
935 1259 1.211190 CTCCCGCAGCTTTCTTTGC 59.789 57.895 0.00 0.00 36.97 3.68
936 1260 0.519077 GACTCCCGCAGCTTTCTTTG 59.481 55.000 0.00 0.00 0.00 2.77
937 1261 0.108585 TGACTCCCGCAGCTTTCTTT 59.891 50.000 0.00 0.00 0.00 2.52
938 1262 0.321122 CTGACTCCCGCAGCTTTCTT 60.321 55.000 0.00 0.00 0.00 2.52
939 1263 1.188219 TCTGACTCCCGCAGCTTTCT 61.188 55.000 0.00 0.00 33.45 2.52
940 1264 0.739112 CTCTGACTCCCGCAGCTTTC 60.739 60.000 0.00 0.00 33.45 2.62
941 1265 1.188219 TCTCTGACTCCCGCAGCTTT 61.188 55.000 0.00 0.00 33.45 3.51
942 1266 0.975040 ATCTCTGACTCCCGCAGCTT 60.975 55.000 0.00 0.00 33.45 3.74
943 1267 1.381056 ATCTCTGACTCCCGCAGCT 60.381 57.895 0.00 0.00 33.45 4.24
967 1291 1.752198 CACGGTTCCTTCCCTGTCA 59.248 57.895 0.00 0.00 0.00 3.58
990 1316 2.425312 TCGGCGTTCCATTTGCAATTAT 59.575 40.909 6.85 0.00 0.00 1.28
1013 1339 3.105283 AGGTCCCTTGGTGTGATAGTAC 58.895 50.000 0.00 0.00 0.00 2.73
1035 1361 5.121811 GTTTCATCACATAGCATCCACTCT 58.878 41.667 0.00 0.00 0.00 3.24
1041 1367 2.613595 TGCCGTTTCATCACATAGCATC 59.386 45.455 0.00 0.00 0.00 3.91
1068 1394 0.036858 GTGAGAGTGACAGGGCCTTC 60.037 60.000 1.32 6.02 0.00 3.46
1078 1404 6.096141 GTGATATCTTCCAGAAGTGAGAGTGA 59.904 42.308 3.98 0.00 39.38 3.41
1083 1409 5.970592 TGTGTGATATCTTCCAGAAGTGAG 58.029 41.667 3.98 0.00 39.38 3.51
1105 1431 3.490155 CGCTGCTCATCAGAGAAACTATG 59.510 47.826 0.00 0.00 45.72 2.23
1108 1434 1.547820 TCGCTGCTCATCAGAGAAACT 59.452 47.619 0.00 0.00 46.33 2.66
1127 1453 0.532115 AAATCCACCGCTGCCAATTC 59.468 50.000 0.00 0.00 0.00 2.17
1137 1463 0.250727 AGACCACCACAAATCCACCG 60.251 55.000 0.00 0.00 0.00 4.94
1148 1474 7.924358 AGTTATTGTACCATATAGACCACCA 57.076 36.000 0.00 0.00 0.00 4.17
1155 1481 7.308589 GCAGCCCAAAGTTATTGTACCATATAG 60.309 40.741 0.00 0.00 0.00 1.31
1160 1486 2.823154 GCAGCCCAAAGTTATTGTACCA 59.177 45.455 0.00 0.00 0.00 3.25
1167 1493 0.394352 CCGGAGCAGCCCAAAGTTAT 60.394 55.000 0.00 0.00 0.00 1.89
1173 1499 2.351924 AAAAGACCGGAGCAGCCCAA 62.352 55.000 9.46 0.00 0.00 4.12
1176 1502 0.678048 ATCAAAAGACCGGAGCAGCC 60.678 55.000 9.46 0.00 0.00 4.85
1224 1558 4.202295 ACAGTGAGAAGATGCTTTGTCAGA 60.202 41.667 0.00 0.00 31.87 3.27
1232 1566 3.107402 TCCCTACAGTGAGAAGATGCT 57.893 47.619 0.00 0.00 0.00 3.79
1273 1607 0.684535 TGGACATCTTCTTCACGGCA 59.315 50.000 0.00 0.00 0.00 5.69
1284 1788 8.765517 TCTCATGCATATATGTATTGGACATCT 58.234 33.333 13.03 0.00 46.33 2.90
1297 1801 6.602406 GCTGGAATTCCTTCTCATGCATATAT 59.398 38.462 24.73 0.00 36.82 0.86
1378 1882 0.515127 CTTGCGTGTCGGCACAATAA 59.485 50.000 21.70 10.43 45.50 1.40
1399 1903 5.633655 TTCCTTTGTACCTTTCCACACTA 57.366 39.130 0.00 0.00 0.00 2.74
1417 1921 1.094785 CCGCCATGACGAATTTTCCT 58.905 50.000 1.83 0.00 34.06 3.36
1453 1957 8.556617 CCTCTAGGAAGATACTCAAAGCAGAGT 61.557 44.444 10.64 10.64 43.89 3.24
1476 1980 8.081633 CAGTGATATACTCATGAAGACTTCCTC 58.918 40.741 12.66 0.00 37.60 3.71
1480 1984 7.667575 ACCAGTGATATACTCATGAAGACTT 57.332 36.000 0.00 0.00 37.60 3.01
1554 2071 5.655488 CGGGATGGAGTACAATATGATCTC 58.345 45.833 0.00 0.00 0.00 2.75
1564 2081 1.783071 TGTATGCGGGATGGAGTACA 58.217 50.000 0.00 0.00 0.00 2.90
1567 2185 1.490490 ACAATGTATGCGGGATGGAGT 59.510 47.619 0.00 0.00 0.00 3.85
1569 2187 1.768275 AGACAATGTATGCGGGATGGA 59.232 47.619 0.00 0.00 0.00 3.41
1574 2192 6.128282 GGATGTTATAAGACAATGTATGCGGG 60.128 42.308 0.00 0.00 32.47 6.13
1575 2193 6.128282 GGGATGTTATAAGACAATGTATGCGG 60.128 42.308 0.00 0.00 32.47 5.69
1583 2201 6.530120 TGTATGCGGGATGTTATAAGACAAT 58.470 36.000 0.00 0.00 32.47 2.71
1584 2202 5.919755 TGTATGCGGGATGTTATAAGACAA 58.080 37.500 0.00 0.00 32.47 3.18
1586 2204 5.756347 TGTTGTATGCGGGATGTTATAAGAC 59.244 40.000 0.00 0.00 0.00 3.01
1588 2206 5.758296 AGTGTTGTATGCGGGATGTTATAAG 59.242 40.000 0.00 0.00 0.00 1.73
1590 2208 5.284861 AGTGTTGTATGCGGGATGTTATA 57.715 39.130 0.00 0.00 0.00 0.98
1591 2209 4.150897 AGTGTTGTATGCGGGATGTTAT 57.849 40.909 0.00 0.00 0.00 1.89
1592 2210 3.620427 AGTGTTGTATGCGGGATGTTA 57.380 42.857 0.00 0.00 0.00 2.41
1593 2211 2.489938 AGTGTTGTATGCGGGATGTT 57.510 45.000 0.00 0.00 0.00 2.71
1594 2212 3.620427 TTAGTGTTGTATGCGGGATGT 57.380 42.857 0.00 0.00 0.00 3.06
1596 2214 4.216411 AGTTTAGTGTTGTATGCGGGAT 57.784 40.909 0.00 0.00 0.00 3.85
1597 2215 3.688694 AGTTTAGTGTTGTATGCGGGA 57.311 42.857 0.00 0.00 0.00 5.14
1598 2216 4.933400 AGTAAGTTTAGTGTTGTATGCGGG 59.067 41.667 0.00 0.00 0.00 6.13
1599 2217 5.867716 AGAGTAAGTTTAGTGTTGTATGCGG 59.132 40.000 0.00 0.00 0.00 5.69
1601 2219 9.032420 GGATAGAGTAAGTTTAGTGTTGTATGC 57.968 37.037 0.00 0.00 0.00 3.14
1604 2240 9.750783 AGAGGATAGAGTAAGTTTAGTGTTGTA 57.249 33.333 0.00 0.00 0.00 2.41
1609 2245 8.192110 GTGGAAGAGGATAGAGTAAGTTTAGTG 58.808 40.741 0.00 0.00 0.00 2.74
1619 2255 6.019748 TCTTTGAAGTGGAAGAGGATAGAGT 58.980 40.000 0.00 0.00 0.00 3.24
1622 2258 7.786030 TGTATCTTTGAAGTGGAAGAGGATAG 58.214 38.462 0.00 0.00 35.54 2.08
1627 2263 9.092876 GTAAGATGTATCTTTGAAGTGGAAGAG 57.907 37.037 11.95 0.00 44.28 2.85
1634 2270 7.171630 AGTCCGTAAGATGTATCTTTGAAGT 57.828 36.000 11.95 0.00 44.28 3.01
1639 2275 7.036220 CACTGAAGTCCGTAAGATGTATCTTT 58.964 38.462 11.95 0.00 44.28 2.52
1651 2287 0.406750 TCCCTCCACTGAAGTCCGTA 59.593 55.000 0.00 0.00 0.00 4.02
1677 2313 5.732633 TGGCAAATTCCTGTGATAATTTGG 58.267 37.500 17.44 4.94 46.17 3.28
1698 2334 1.341285 TGAAGATGATGCAACCCCTGG 60.341 52.381 0.00 0.00 0.00 4.45
1728 2364 5.189180 GGCTTCAGATCTAAGTGGACAATT 58.811 41.667 0.00 0.00 0.00 2.32
1782 2418 3.145286 ACCAAAATCCGCAATTTTTGGG 58.855 40.909 25.55 17.15 43.51 4.12
1820 2456 2.825861 AACCTGGCTTTGCATTTCAG 57.174 45.000 0.00 0.00 0.00 3.02
1835 2471 4.695606 TCCACCTCTGGAAGTAATAACCT 58.304 43.478 0.00 0.00 44.26 3.50
1848 2484 5.762045 CAAACTTACAATGTTCCACCTCTG 58.238 41.667 0.00 0.00 0.00 3.35
1850 2486 4.278419 AGCAAACTTACAATGTTCCACCTC 59.722 41.667 0.00 0.00 0.00 3.85
1999 2824 7.482654 AATGACGGTATGTGATTTCAGTATG 57.517 36.000 0.00 0.00 29.39 2.39
2000 2825 6.420903 CGAATGACGGTATGTGATTTCAGTAT 59.579 38.462 0.00 0.00 34.33 2.12
2019 2844 5.644977 AGATATCAAGCCGATACGAATGA 57.355 39.130 5.32 0.00 39.44 2.57
2028 2853 2.598565 AGGCTGTAGATATCAAGCCGA 58.401 47.619 25.96 0.00 46.07 5.54
2052 2877 9.273016 CCGGTGAGTATTTCAATGATTATAACT 57.727 33.333 0.00 0.00 37.61 2.24
2055 2880 9.839817 TTTCCGGTGAGTATTTCAATGATTATA 57.160 29.630 0.00 0.00 37.61 0.98
2064 2889 4.564821 CCCTTCTTTCCGGTGAGTATTTCA 60.565 45.833 0.00 0.00 0.00 2.69
2067 2892 2.355818 GCCCTTCTTTCCGGTGAGTATT 60.356 50.000 0.00 0.00 0.00 1.89
2088 2913 5.576774 TCTTACATTGTCAACAGCGTGATAG 59.423 40.000 0.00 0.00 0.00 2.08
2130 2990 4.398549 TGAAGCACGGTCTTTATTTTCG 57.601 40.909 0.00 0.00 0.00 3.46
2141 3001 5.643379 ATACATTGATTTTGAAGCACGGT 57.357 34.783 0.00 0.00 0.00 4.83
2143 3003 8.577939 CAAGTAATACATTGATTTTGAAGCACG 58.422 33.333 0.00 0.00 0.00 5.34
2146 3006 8.693542 AGCAAGTAATACATTGATTTTGAAGC 57.306 30.769 6.73 0.00 0.00 3.86
2155 3015 8.621532 AACAAGAGAAGCAAGTAATACATTGA 57.378 30.769 6.73 0.00 0.00 2.57
2161 3021 8.040727 TGCATCTAACAAGAGAAGCAAGTAATA 58.959 33.333 1.17 0.00 44.68 0.98
2178 3038 3.496130 AGCGACATTATGCTGCATCTAAC 59.504 43.478 19.90 7.43 40.62 2.34
2180 3040 3.391506 AGCGACATTATGCTGCATCTA 57.608 42.857 19.90 9.08 40.62 1.98
2225 4546 7.353525 TCAGTCAAAATATATGGTCCATGGTT 58.646 34.615 15.10 3.75 0.00 3.67
2231 4552 8.738645 AGTCTTTCAGTCAAAATATATGGTCC 57.261 34.615 0.00 0.00 0.00 4.46
2246 4567 7.123397 TGTCATAGCATCTCTAAGTCTTTCAGT 59.877 37.037 0.00 0.00 0.00 3.41
2249 4570 8.885494 ATTGTCATAGCATCTCTAAGTCTTTC 57.115 34.615 0.00 0.00 0.00 2.62
2282 4603 7.306213 GCTAAAGGTTCAAAGCCTAGTTTTAG 58.694 38.462 0.00 0.00 34.81 1.85
2283 4604 6.072893 CGCTAAAGGTTCAAAGCCTAGTTTTA 60.073 38.462 0.00 0.00 34.81 1.52
2288 4609 2.678336 CCGCTAAAGGTTCAAAGCCTAG 59.322 50.000 0.00 0.00 34.81 3.02
2293 4614 3.343617 TCCATCCGCTAAAGGTTCAAAG 58.656 45.455 0.00 0.00 0.00 2.77
2303 4624 0.742990 CGGTGCTTTCCATCCGCTAA 60.743 55.000 0.00 0.00 33.61 3.09
2304 4625 1.153449 CGGTGCTTTCCATCCGCTA 60.153 57.895 0.00 0.00 33.61 4.26
2307 4628 0.953471 TTGTCGGTGCTTTCCATCCG 60.953 55.000 0.00 0.00 38.57 4.18
2308 4629 0.521735 GTTGTCGGTGCTTTCCATCC 59.478 55.000 0.00 0.00 0.00 3.51
2309 4630 1.464997 GAGTTGTCGGTGCTTTCCATC 59.535 52.381 0.00 0.00 0.00 3.51
2310 4631 1.072331 AGAGTTGTCGGTGCTTTCCAT 59.928 47.619 0.00 0.00 0.00 3.41
2311 4632 0.468226 AGAGTTGTCGGTGCTTTCCA 59.532 50.000 0.00 0.00 0.00 3.53
2312 4633 2.067013 GTAGAGTTGTCGGTGCTTTCC 58.933 52.381 0.00 0.00 0.00 3.13
2313 4634 2.067013 GGTAGAGTTGTCGGTGCTTTC 58.933 52.381 0.00 0.00 0.00 2.62
2314 4635 1.414919 TGGTAGAGTTGTCGGTGCTTT 59.585 47.619 0.00 0.00 0.00 3.51
2315 4636 1.045407 TGGTAGAGTTGTCGGTGCTT 58.955 50.000 0.00 0.00 0.00 3.91
2316 4637 0.317479 GTGGTAGAGTTGTCGGTGCT 59.683 55.000 0.00 0.00 0.00 4.40
2317 4638 0.032952 TGTGGTAGAGTTGTCGGTGC 59.967 55.000 0.00 0.00 0.00 5.01
2318 4639 1.340248 AGTGTGGTAGAGTTGTCGGTG 59.660 52.381 0.00 0.00 0.00 4.94
2319 4640 1.700955 AGTGTGGTAGAGTTGTCGGT 58.299 50.000 0.00 0.00 0.00 4.69
2320 4641 2.035449 TGAAGTGTGGTAGAGTTGTCGG 59.965 50.000 0.00 0.00 0.00 4.79
2321 4642 3.364889 TGAAGTGTGGTAGAGTTGTCG 57.635 47.619 0.00 0.00 0.00 4.35
2322 4643 4.945246 TCTTGAAGTGTGGTAGAGTTGTC 58.055 43.478 0.00 0.00 0.00 3.18
2323 4644 4.202264 CCTCTTGAAGTGTGGTAGAGTTGT 60.202 45.833 0.00 0.00 32.39 3.32
2324 4645 4.202264 ACCTCTTGAAGTGTGGTAGAGTTG 60.202 45.833 5.75 0.00 32.39 3.16
2325 4646 3.967987 ACCTCTTGAAGTGTGGTAGAGTT 59.032 43.478 5.75 0.00 32.39 3.01
2326 4647 3.322254 CACCTCTTGAAGTGTGGTAGAGT 59.678 47.826 8.89 0.00 32.39 3.24
2327 4648 3.306364 CCACCTCTTGAAGTGTGGTAGAG 60.306 52.174 20.69 0.00 39.56 2.43
2328 4649 2.632996 CCACCTCTTGAAGTGTGGTAGA 59.367 50.000 20.69 0.00 39.56 2.59
2329 4650 3.045601 CCACCTCTTGAAGTGTGGTAG 57.954 52.381 20.69 6.99 39.56 3.18
2331 4652 1.213296 ACCACCTCTTGAAGTGTGGT 58.787 50.000 25.51 25.51 46.32 4.16
2332 4653 2.222027 GAACCACCTCTTGAAGTGTGG 58.778 52.381 24.55 24.55 45.05 4.17
2333 4654 2.917933 TGAACCACCTCTTGAAGTGTG 58.082 47.619 9.54 9.54 31.88 3.82
2334 4655 3.279434 GTTGAACCACCTCTTGAAGTGT 58.721 45.455 0.00 0.00 31.88 3.55
2335 4656 2.618709 GGTTGAACCACCTCTTGAAGTG 59.381 50.000 9.98 0.00 38.42 3.16
2336 4657 2.241176 TGGTTGAACCACCTCTTGAAGT 59.759 45.455 14.05 0.00 44.79 3.01
2337 4658 2.930950 TGGTTGAACCACCTCTTGAAG 58.069 47.619 14.05 0.00 44.79 3.02
2348 4669 3.875134 CCTTCCGTACATATGGTTGAACC 59.125 47.826 7.57 7.57 39.22 3.62
2349 4670 4.510571 ACCTTCCGTACATATGGTTGAAC 58.489 43.478 7.80 0.00 33.98 3.18
2350 4671 4.829872 ACCTTCCGTACATATGGTTGAA 57.170 40.909 7.80 3.75 33.98 2.69
2351 4672 4.829872 AACCTTCCGTACATATGGTTGA 57.170 40.909 7.80 0.00 36.57 3.18
2352 4673 4.875544 CAACCTTCCGTACATATGGTTG 57.124 45.455 19.36 19.36 45.14 3.77
2353 4674 4.829872 TCAACCTTCCGTACATATGGTT 57.170 40.909 7.80 8.26 38.18 3.67
2354 4675 4.224370 AGTTCAACCTTCCGTACATATGGT 59.776 41.667 7.80 0.00 33.98 3.55
2355 4676 4.766375 AGTTCAACCTTCCGTACATATGG 58.234 43.478 7.80 0.00 0.00 2.74
2356 4677 6.334989 TGTAGTTCAACCTTCCGTACATATG 58.665 40.000 0.00 0.00 0.00 1.78
2357 4678 6.534475 TGTAGTTCAACCTTCCGTACATAT 57.466 37.500 0.00 0.00 0.00 1.78
2358 4679 5.981088 TGTAGTTCAACCTTCCGTACATA 57.019 39.130 0.00 0.00 0.00 2.29
2359 4680 4.877378 TGTAGTTCAACCTTCCGTACAT 57.123 40.909 0.00 0.00 0.00 2.29
2360 4681 4.669206 TTGTAGTTCAACCTTCCGTACA 57.331 40.909 0.00 0.00 0.00 2.90
2377 4698 5.924254 GCAACATGACAGTACTACAGTTGTA 59.076 40.000 23.93 0.00 37.86 2.41
2378 4699 4.750098 GCAACATGACAGTACTACAGTTGT 59.250 41.667 23.93 16.07 37.86 3.32
2379 4700 4.143326 CGCAACATGACAGTACTACAGTTG 60.143 45.833 21.96 21.96 38.41 3.16
2380 4701 3.987868 CGCAACATGACAGTACTACAGTT 59.012 43.478 0.00 3.80 0.00 3.16
2381 4702 3.575630 CGCAACATGACAGTACTACAGT 58.424 45.455 0.00 0.00 0.00 3.55
2382 4703 2.345641 GCGCAACATGACAGTACTACAG 59.654 50.000 0.30 0.00 0.00 2.74
2383 4704 2.333926 GCGCAACATGACAGTACTACA 58.666 47.619 0.30 0.00 0.00 2.74
2384 4705 1.659098 GGCGCAACATGACAGTACTAC 59.341 52.381 10.83 0.00 0.00 2.73
2385 4706 1.273886 TGGCGCAACATGACAGTACTA 59.726 47.619 10.83 0.00 0.00 1.82
2386 4707 0.034756 TGGCGCAACATGACAGTACT 59.965 50.000 10.83 0.00 0.00 2.73
2387 4708 0.871722 TTGGCGCAACATGACAGTAC 59.128 50.000 10.83 0.00 0.00 2.73
2388 4709 1.819928 ATTGGCGCAACATGACAGTA 58.180 45.000 10.83 0.00 0.00 2.74
2389 4710 1.819928 TATTGGCGCAACATGACAGT 58.180 45.000 10.83 0.00 0.00 3.55
2390 4711 3.425577 AATATTGGCGCAACATGACAG 57.574 42.857 10.83 0.00 0.00 3.51
2391 4712 3.865011 AAATATTGGCGCAACATGACA 57.135 38.095 10.83 0.00 0.00 3.58
2392 4713 3.730715 GCTAAATATTGGCGCAACATGAC 59.269 43.478 10.83 0.00 0.00 3.06
2393 4714 3.379688 TGCTAAATATTGGCGCAACATGA 59.620 39.130 10.83 0.00 40.39 3.07
2394 4715 3.486841 GTGCTAAATATTGGCGCAACATG 59.513 43.478 10.83 0.00 45.50 3.21
2395 4716 3.705604 GTGCTAAATATTGGCGCAACAT 58.294 40.909 10.83 0.00 45.50 2.71
2396 4717 3.143807 GTGCTAAATATTGGCGCAACA 57.856 42.857 10.83 0.00 45.50 3.33
2400 4721 1.946768 TGAGGTGCTAAATATTGGCGC 59.053 47.619 14.85 14.85 45.47 6.53
2401 4722 4.630894 TTTGAGGTGCTAAATATTGGCG 57.369 40.909 8.49 0.00 40.39 5.69
2402 4723 6.476706 GTGATTTTGAGGTGCTAAATATTGGC 59.523 38.462 6.70 6.70 33.17 4.52
2403 4724 7.489113 GTGTGATTTTGAGGTGCTAAATATTGG 59.511 37.037 0.00 0.00 33.17 3.16
2404 4725 7.218773 CGTGTGATTTTGAGGTGCTAAATATTG 59.781 37.037 0.00 0.00 33.17 1.90
2405 4726 7.120579 TCGTGTGATTTTGAGGTGCTAAATATT 59.879 33.333 0.00 0.00 33.17 1.28
2406 4727 6.597672 TCGTGTGATTTTGAGGTGCTAAATAT 59.402 34.615 0.00 0.00 33.17 1.28
2407 4728 5.935206 TCGTGTGATTTTGAGGTGCTAAATA 59.065 36.000 0.00 0.00 33.17 1.40
2408 4729 4.759693 TCGTGTGATTTTGAGGTGCTAAAT 59.240 37.500 0.00 0.00 35.19 1.40
2409 4730 4.130857 TCGTGTGATTTTGAGGTGCTAAA 58.869 39.130 0.00 0.00 0.00 1.85
2410 4731 3.734463 TCGTGTGATTTTGAGGTGCTAA 58.266 40.909 0.00 0.00 0.00 3.09
2411 4732 3.394674 TCGTGTGATTTTGAGGTGCTA 57.605 42.857 0.00 0.00 0.00 3.49
2412 4733 2.254546 TCGTGTGATTTTGAGGTGCT 57.745 45.000 0.00 0.00 0.00 4.40
2413 4734 3.559238 ATTCGTGTGATTTTGAGGTGC 57.441 42.857 0.00 0.00 0.00 5.01
2414 4735 5.088739 GCTAATTCGTGTGATTTTGAGGTG 58.911 41.667 0.00 0.00 0.00 4.00
2415 4736 5.003804 AGCTAATTCGTGTGATTTTGAGGT 58.996 37.500 0.00 0.00 0.00 3.85
2416 4737 5.551760 AGCTAATTCGTGTGATTTTGAGG 57.448 39.130 0.00 0.00 0.00 3.86
2417 4738 9.559958 AAATAAGCTAATTCGTGTGATTTTGAG 57.440 29.630 0.00 0.00 0.00 3.02
2418 4739 9.340695 CAAATAAGCTAATTCGTGTGATTTTGA 57.659 29.630 0.00 0.00 0.00 2.69
2419 4740 9.128107 ACAAATAAGCTAATTCGTGTGATTTTG 57.872 29.630 0.00 0.00 0.00 2.44
2420 4741 9.128107 CACAAATAAGCTAATTCGTGTGATTTT 57.872 29.630 8.64 0.00 0.00 1.82
2421 4742 8.296713 ACACAAATAAGCTAATTCGTGTGATTT 58.703 29.630 17.11 0.00 35.20 2.17
2422 4743 7.816640 ACACAAATAAGCTAATTCGTGTGATT 58.183 30.769 17.11 0.00 35.20 2.57
2423 4744 7.377766 ACACAAATAAGCTAATTCGTGTGAT 57.622 32.000 17.11 4.43 35.20 3.06
2424 4745 6.795098 ACACAAATAAGCTAATTCGTGTGA 57.205 33.333 17.11 0.00 35.20 3.58
2434 4755 4.163458 CCCCACTCCTACACAAATAAGCTA 59.837 45.833 0.00 0.00 0.00 3.32
2440 4761 2.225017 CCAACCCCACTCCTACACAAAT 60.225 50.000 0.00 0.00 0.00 2.32
2448 4769 0.698818 GATTGTCCAACCCCACTCCT 59.301 55.000 0.00 0.00 0.00 3.69
2453 4774 1.991813 TGATGAGATTGTCCAACCCCA 59.008 47.619 0.00 0.00 0.00 4.96
2454 4775 2.369394 GTGATGAGATTGTCCAACCCC 58.631 52.381 0.00 0.00 0.00 4.95
2455 4776 2.369394 GGTGATGAGATTGTCCAACCC 58.631 52.381 0.00 0.00 0.00 4.11
2461 4782 4.889832 GACAATGGGTGATGAGATTGTC 57.110 45.455 0.00 0.00 44.32 3.18
2462 4783 3.010472 TGGACAATGGGTGATGAGATTGT 59.990 43.478 0.00 0.00 40.80 2.71
2478 4799 4.349636 TCAGGTTGGAGATAACTTGGACAA 59.650 41.667 0.00 0.00 37.97 3.18
2522 4846 9.010029 TGGAAGAAACTAAGTATCAATTCAACC 57.990 33.333 0.00 0.00 0.00 3.77
2538 4862 8.868522 TTTCATCTGACATATTGGAAGAAACT 57.131 30.769 0.00 0.00 0.00 2.66
2548 4872 6.491403 GCACCCCTATTTTCATCTGACATATT 59.509 38.462 0.00 0.00 0.00 1.28
2555 4879 2.689983 GGTGCACCCCTATTTTCATCTG 59.310 50.000 26.31 0.00 0.00 2.90
2571 4895 0.478072 AAGAACATGACTGGGGTGCA 59.522 50.000 0.00 0.00 0.00 4.57
2572 4896 0.883833 CAAGAACATGACTGGGGTGC 59.116 55.000 0.00 0.00 0.00 5.01
2578 4902 8.928733 CAATAAAATTTCCCAAGAACATGACTG 58.071 33.333 0.00 0.00 0.00 3.51
2580 4904 8.831715 ACAATAAAATTTCCCAAGAACATGAC 57.168 30.769 0.00 0.00 0.00 3.06
2611 4944 8.157813 CACAAAGCAACATCAATTAAGATTTCG 58.842 33.333 0.00 0.00 0.00 3.46
2615 4948 9.630098 CTTACACAAAGCAACATCAATTAAGAT 57.370 29.630 0.00 0.00 0.00 2.40
2621 4954 9.195411 CAATAACTTACACAAAGCAACATCAAT 57.805 29.630 0.00 0.00 38.93 2.57
2629 4962 7.503521 TGATGTCAATAACTTACACAAAGCA 57.496 32.000 0.00 0.00 38.93 3.91
2642 4975 3.118223 TGCCCCGTACATGATGTCAATAA 60.118 43.478 0.00 0.00 0.00 1.40
2644 4977 1.211703 TGCCCCGTACATGATGTCAAT 59.788 47.619 0.00 0.00 0.00 2.57
2690 5179 7.636150 AGATTCACCATCTTTCTAAATGTGG 57.364 36.000 0.00 0.00 39.47 4.17
2745 5235 6.635239 CCAACATGTTACTCCAACTTTTAACG 59.365 38.462 11.53 0.00 38.05 3.18
2749 5239 6.126409 TCTCCAACATGTTACTCCAACTTTT 58.874 36.000 11.53 0.00 38.05 2.27
2767 5257 4.401022 ACATTGCTCTGTGATTTCTCCAA 58.599 39.130 0.00 0.00 0.00 3.53
2781 5271 2.744202 CTGGTCCAGTTGTACATTGCTC 59.256 50.000 11.09 0.00 0.00 4.26
2785 5275 3.306502 CGTACCTGGTCCAGTTGTACATT 60.307 47.826 25.70 4.81 32.57 2.71
2793 5283 2.291411 ACATACTCGTACCTGGTCCAGT 60.291 50.000 17.85 6.55 0.00 4.00
2835 5325 1.116308 TCTGTGGGTTGAAGTCGACA 58.884 50.000 19.50 0.00 31.82 4.35
2836 5326 2.135933 CTTCTGTGGGTTGAAGTCGAC 58.864 52.381 7.70 7.70 36.04 4.20
2851 5341 5.139435 TGTTGTGTATCTGGTCTCTTCTG 57.861 43.478 0.00 0.00 0.00 3.02
2932 5422 9.874215 GAAGTTATTTACCTGTTGTGAAGTAAC 57.126 33.333 0.00 0.00 0.00 2.50
2943 5433 3.583966 TGTCCCGGAAGTTATTTACCTGT 59.416 43.478 0.73 0.00 0.00 4.00
2953 5444 1.065418 GTCATGGATGTCCCGGAAGTT 60.065 52.381 0.73 0.00 37.93 2.66
2957 5448 0.758734 GATGTCATGGATGTCCCGGA 59.241 55.000 0.73 0.00 37.93 5.14
2960 5451 3.733709 GGGATGTCATGGATGTCCC 57.266 57.895 9.56 9.56 41.55 4.46
2961 5452 1.072965 GGAGGGATGTCATGGATGTCC 59.927 57.143 0.00 0.00 0.00 4.02
2963 5454 1.143813 GGGAGGGATGTCATGGATGT 58.856 55.000 0.00 0.00 0.00 3.06
2973 5464 5.481473 TCAAAAGATTTTTCTGGGAGGGATG 59.519 40.000 0.00 0.00 0.00 3.51
2994 5489 6.127925 GCAAATGGAGATGTACACAAGATCAA 60.128 38.462 0.00 0.00 30.16 2.57
2995 5490 5.355071 GCAAATGGAGATGTACACAAGATCA 59.645 40.000 0.00 0.00 30.16 2.92
2998 5493 4.455533 GTGCAAATGGAGATGTACACAAGA 59.544 41.667 0.00 0.00 33.13 3.02
3001 5496 4.019792 AGTGCAAATGGAGATGTACACA 57.980 40.909 0.00 0.00 35.01 3.72
3009 5504 3.096489 GCAACAAAGTGCAAATGGAGA 57.904 42.857 0.00 0.00 44.29 3.71
3019 5514 1.195448 CTGGCTACGAGCAACAAAGTG 59.805 52.381 8.71 0.00 44.75 3.16
3047 5543 8.821894 CATATAACCAGTTAAGAAGACTTCAGC 58.178 37.037 17.34 0.00 37.53 4.26
3048 5544 9.319143 CCATATAACCAGTTAAGAAGACTTCAG 57.681 37.037 17.34 0.47 37.53 3.02
3055 5551 7.498900 TGTGCATCCATATAACCAGTTAAGAAG 59.501 37.037 0.00 0.00 0.00 2.85
3057 5553 6.894682 TGTGCATCCATATAACCAGTTAAGA 58.105 36.000 0.00 0.00 0.00 2.10
3061 5557 5.893255 ACAATGTGCATCCATATAACCAGTT 59.107 36.000 0.00 0.00 0.00 3.16
3063 5559 6.395426 AACAATGTGCATCCATATAACCAG 57.605 37.500 0.00 0.00 0.00 4.00
3064 5560 6.830838 TGTAACAATGTGCATCCATATAACCA 59.169 34.615 0.00 0.00 0.00 3.67
3066 5562 8.567104 TCATGTAACAATGTGCATCCATATAAC 58.433 33.333 0.00 0.00 0.00 1.89
3068 5564 7.095271 CGTCATGTAACAATGTGCATCCATATA 60.095 37.037 0.00 0.00 0.00 0.86
3069 5565 6.293571 CGTCATGTAACAATGTGCATCCATAT 60.294 38.462 0.00 0.00 0.00 1.78
3070 5566 5.007528 CGTCATGTAACAATGTGCATCCATA 59.992 40.000 0.00 0.00 0.00 2.74
3071 5567 4.201940 CGTCATGTAACAATGTGCATCCAT 60.202 41.667 0.00 0.00 0.00 3.41
3072 5568 3.126686 CGTCATGTAACAATGTGCATCCA 59.873 43.478 0.00 0.00 0.00 3.41
3073 5569 3.373748 TCGTCATGTAACAATGTGCATCC 59.626 43.478 0.00 0.00 0.00 3.51
3074 5570 4.142924 TGTCGTCATGTAACAATGTGCATC 60.143 41.667 0.00 0.00 0.00 3.91
3075 5571 3.750652 TGTCGTCATGTAACAATGTGCAT 59.249 39.130 0.00 0.00 0.00 3.96
3076 5572 3.134458 TGTCGTCATGTAACAATGTGCA 58.866 40.909 0.00 0.00 0.00 4.57
3077 5573 3.804518 TGTCGTCATGTAACAATGTGC 57.195 42.857 0.00 0.00 0.00 4.57
3078 5574 5.959527 GCTTATGTCGTCATGTAACAATGTG 59.040 40.000 5.36 0.00 35.70 3.21
3079 5575 5.064707 GGCTTATGTCGTCATGTAACAATGT 59.935 40.000 5.36 0.00 35.70 2.71
3080 5576 5.064579 TGGCTTATGTCGTCATGTAACAATG 59.935 40.000 5.36 0.00 35.70 2.82
3081 5577 5.182487 TGGCTTATGTCGTCATGTAACAAT 58.818 37.500 5.36 0.00 35.70 2.71
3082 5578 4.570930 TGGCTTATGTCGTCATGTAACAA 58.429 39.130 5.36 0.00 35.70 2.83
3083 5579 4.195225 TGGCTTATGTCGTCATGTAACA 57.805 40.909 5.36 0.00 35.70 2.41
3084 5580 5.539582 TTTGGCTTATGTCGTCATGTAAC 57.460 39.130 5.36 0.00 35.70 2.50
3085 5581 5.391523 GCTTTTGGCTTATGTCGTCATGTAA 60.392 40.000 5.36 0.00 38.06 2.41
3086 5582 4.094294 GCTTTTGGCTTATGTCGTCATGTA 59.906 41.667 5.36 0.00 38.06 2.29
3087 5583 3.119849 GCTTTTGGCTTATGTCGTCATGT 60.120 43.478 5.36 0.00 38.06 3.21
3088 5584 3.429085 GCTTTTGGCTTATGTCGTCATG 58.571 45.455 5.36 0.00 38.06 3.07
3089 5585 2.423538 GGCTTTTGGCTTATGTCGTCAT 59.576 45.455 0.00 0.00 42.31 3.06
3090 5586 1.810151 GGCTTTTGGCTTATGTCGTCA 59.190 47.619 0.00 0.00 42.31 4.35
3091 5587 1.810151 TGGCTTTTGGCTTATGTCGTC 59.190 47.619 0.00 0.00 46.20 4.20
3092 5588 1.904287 TGGCTTTTGGCTTATGTCGT 58.096 45.000 0.00 0.00 46.20 4.34
3093 5589 3.244976 CTTTGGCTTTTGGCTTATGTCG 58.755 45.455 0.00 0.00 46.20 4.35
3094 5590 4.237724 GACTTTGGCTTTTGGCTTATGTC 58.762 43.478 0.00 0.00 46.20 3.06
3095 5591 3.640967 TGACTTTGGCTTTTGGCTTATGT 59.359 39.130 0.00 0.00 46.20 2.29
3096 5592 4.255833 TGACTTTGGCTTTTGGCTTATG 57.744 40.909 0.00 0.00 46.20 1.90
3097 5593 4.953940 TTGACTTTGGCTTTTGGCTTAT 57.046 36.364 0.00 0.00 46.20 1.73
3098 5594 4.744795 TTTGACTTTGGCTTTTGGCTTA 57.255 36.364 0.00 0.00 46.20 3.09
3099 5595 3.625649 TTTGACTTTGGCTTTTGGCTT 57.374 38.095 0.00 0.00 46.20 4.35
3100 5596 3.534554 CTTTTGACTTTGGCTTTTGGCT 58.465 40.909 0.00 0.00 46.20 4.75
3101 5597 2.032054 GCTTTTGACTTTGGCTTTTGGC 59.968 45.455 0.00 0.00 46.23 4.52
3102 5598 3.534554 AGCTTTTGACTTTGGCTTTTGG 58.465 40.909 0.00 0.00 0.00 3.28
3103 5599 4.033243 GTGAGCTTTTGACTTTGGCTTTTG 59.967 41.667 0.00 0.00 33.13 2.44
3104 5600 4.183865 GTGAGCTTTTGACTTTGGCTTTT 58.816 39.130 0.00 0.00 33.13 2.27
3105 5601 3.195396 TGTGAGCTTTTGACTTTGGCTTT 59.805 39.130 0.00 0.00 33.13 3.51
3106 5602 2.760092 TGTGAGCTTTTGACTTTGGCTT 59.240 40.909 0.00 0.00 33.13 4.35
3107 5603 2.378038 TGTGAGCTTTTGACTTTGGCT 58.622 42.857 0.00 0.00 35.86 4.75
3108 5604 2.869233 TGTGAGCTTTTGACTTTGGC 57.131 45.000 0.00 0.00 0.00 4.52
3109 5605 5.922544 CCTATTTGTGAGCTTTTGACTTTGG 59.077 40.000 0.00 0.00 0.00 3.28
3110 5606 6.418819 CACCTATTTGTGAGCTTTTGACTTTG 59.581 38.462 0.00 0.00 38.55 2.77
3111 5607 6.507023 CACCTATTTGTGAGCTTTTGACTTT 58.493 36.000 0.00 0.00 38.55 2.66
3112 5608 5.507985 GCACCTATTTGTGAGCTTTTGACTT 60.508 40.000 0.00 0.00 38.55 3.01
3113 5609 4.022849 GCACCTATTTGTGAGCTTTTGACT 60.023 41.667 0.00 0.00 38.55 3.41
3114 5610 4.022849 AGCACCTATTTGTGAGCTTTTGAC 60.023 41.667 0.00 0.00 38.55 3.18
3115 5611 4.144297 AGCACCTATTTGTGAGCTTTTGA 58.856 39.130 0.00 0.00 38.55 2.69
3116 5612 4.510038 AGCACCTATTTGTGAGCTTTTG 57.490 40.909 0.00 0.00 38.55 2.44
3117 5613 5.535753 AAAGCACCTATTTGTGAGCTTTT 57.464 34.783 0.00 0.00 46.51 2.27
3119 5615 5.535753 AAAAAGCACCTATTTGTGAGCTT 57.464 34.783 0.00 0.00 43.43 3.74
3138 5634 5.825151 CCCATTTTGTCCTAAAAGCCAAAAA 59.175 36.000 0.00 0.00 39.42 1.94
3139 5635 5.131142 TCCCATTTTGTCCTAAAAGCCAAAA 59.869 36.000 0.00 0.00 40.04 2.44
3140 5636 4.656112 TCCCATTTTGTCCTAAAAGCCAAA 59.344 37.500 0.00 0.00 0.00 3.28
3141 5637 4.227197 TCCCATTTTGTCCTAAAAGCCAA 58.773 39.130 0.00 0.00 0.00 4.52
3142 5638 3.850752 TCCCATTTTGTCCTAAAAGCCA 58.149 40.909 0.00 0.00 0.00 4.75
3143 5639 4.882842 TTCCCATTTTGTCCTAAAAGCC 57.117 40.909 0.00 0.00 0.00 4.35
3144 5640 5.874810 GGATTTCCCATTTTGTCCTAAAAGC 59.125 40.000 0.00 0.00 34.14 3.51
3145 5641 7.003402 TGGATTTCCCATTTTGTCCTAAAAG 57.997 36.000 0.00 0.00 40.82 2.27
3146 5642 7.380423 TTGGATTTCCCATTTTGTCCTAAAA 57.620 32.000 0.00 0.00 46.10 1.52
3147 5643 7.071824 ACTTTGGATTTCCCATTTTGTCCTAAA 59.928 33.333 0.00 0.00 46.10 1.85
3148 5644 6.556874 ACTTTGGATTTCCCATTTTGTCCTAA 59.443 34.615 0.00 0.00 46.10 2.69
3149 5645 6.081356 ACTTTGGATTTCCCATTTTGTCCTA 58.919 36.000 0.00 0.00 46.10 2.94
3150 5646 4.907269 ACTTTGGATTTCCCATTTTGTCCT 59.093 37.500 0.00 0.00 46.10 3.85
3151 5647 5.227569 ACTTTGGATTTCCCATTTTGTCC 57.772 39.130 0.00 0.00 46.10 4.02
3152 5648 7.095229 GCTTAACTTTGGATTTCCCATTTTGTC 60.095 37.037 0.00 0.00 46.10 3.18
3153 5649 6.710295 GCTTAACTTTGGATTTCCCATTTTGT 59.290 34.615 0.00 0.00 46.10 2.83
3154 5650 6.709846 TGCTTAACTTTGGATTTCCCATTTTG 59.290 34.615 0.00 0.00 46.10 2.44
3155 5651 6.710295 GTGCTTAACTTTGGATTTCCCATTTT 59.290 34.615 0.00 0.00 46.10 1.82
3156 5652 6.183361 TGTGCTTAACTTTGGATTTCCCATTT 60.183 34.615 0.00 0.00 46.10 2.32
3157 5653 5.306678 TGTGCTTAACTTTGGATTTCCCATT 59.693 36.000 0.00 0.00 46.10 3.16
3158 5654 4.837860 TGTGCTTAACTTTGGATTTCCCAT 59.162 37.500 0.00 0.00 46.10 4.00
3159 5655 4.219115 TGTGCTTAACTTTGGATTTCCCA 58.781 39.130 0.00 0.00 44.93 4.37
3160 5656 4.864704 TGTGCTTAACTTTGGATTTCCC 57.135 40.909 0.00 0.00 34.29 3.97
3161 5657 4.988540 GGTTGTGCTTAACTTTGGATTTCC 59.011 41.667 4.17 0.00 0.00 3.13
3162 5658 5.596845 TGGTTGTGCTTAACTTTGGATTTC 58.403 37.500 4.17 0.00 0.00 2.17
3163 5659 5.606348 TGGTTGTGCTTAACTTTGGATTT 57.394 34.783 4.17 0.00 0.00 2.17
3164 5660 5.600696 CTTGGTTGTGCTTAACTTTGGATT 58.399 37.500 4.17 0.00 0.00 3.01
3165 5661 4.501400 GCTTGGTTGTGCTTAACTTTGGAT 60.501 41.667 4.17 0.00 0.00 3.41
3166 5662 3.181480 GCTTGGTTGTGCTTAACTTTGGA 60.181 43.478 4.17 0.00 0.00 3.53
3167 5663 3.123050 GCTTGGTTGTGCTTAACTTTGG 58.877 45.455 4.17 0.00 0.00 3.28
3168 5664 3.551485 GTGCTTGGTTGTGCTTAACTTTG 59.449 43.478 4.17 0.00 0.00 2.77
3169 5665 3.447229 AGTGCTTGGTTGTGCTTAACTTT 59.553 39.130 4.17 0.00 0.00 2.66
3170 5666 3.023832 AGTGCTTGGTTGTGCTTAACTT 58.976 40.909 4.17 0.00 0.00 2.66
3171 5667 2.618709 GAGTGCTTGGTTGTGCTTAACT 59.381 45.455 4.17 0.00 0.00 2.24
3172 5668 2.287608 GGAGTGCTTGGTTGTGCTTAAC 60.288 50.000 0.00 0.00 0.00 2.01
3173 5669 1.953686 GGAGTGCTTGGTTGTGCTTAA 59.046 47.619 0.00 0.00 0.00 1.85
3174 5670 1.604604 GGAGTGCTTGGTTGTGCTTA 58.395 50.000 0.00 0.00 0.00 3.09
3175 5671 1.109323 GGGAGTGCTTGGTTGTGCTT 61.109 55.000 0.00 0.00 0.00 3.91
3176 5672 1.529244 GGGAGTGCTTGGTTGTGCT 60.529 57.895 0.00 0.00 0.00 4.40
3177 5673 1.518903 GAGGGAGTGCTTGGTTGTGC 61.519 60.000 0.00 0.00 0.00 4.57
3178 5674 0.890996 GGAGGGAGTGCTTGGTTGTG 60.891 60.000 0.00 0.00 0.00 3.33
3179 5675 1.352622 TGGAGGGAGTGCTTGGTTGT 61.353 55.000 0.00 0.00 0.00 3.32
3180 5676 0.890996 GTGGAGGGAGTGCTTGGTTG 60.891 60.000 0.00 0.00 0.00 3.77
3181 5677 1.456287 GTGGAGGGAGTGCTTGGTT 59.544 57.895 0.00 0.00 0.00 3.67
3182 5678 2.529744 GGTGGAGGGAGTGCTTGGT 61.530 63.158 0.00 0.00 0.00 3.67
3183 5679 1.783250 AAGGTGGAGGGAGTGCTTGG 61.783 60.000 0.00 0.00 0.00 3.61
3184 5680 0.607489 CAAGGTGGAGGGAGTGCTTG 60.607 60.000 0.00 0.00 0.00 4.01
3185 5681 1.763770 CAAGGTGGAGGGAGTGCTT 59.236 57.895 0.00 0.00 0.00 3.91
3186 5682 2.900106 GCAAGGTGGAGGGAGTGCT 61.900 63.158 0.00 0.00 0.00 4.40
3187 5683 2.360475 GCAAGGTGGAGGGAGTGC 60.360 66.667 0.00 0.00 0.00 4.40
3188 5684 1.002868 CAGCAAGGTGGAGGGAGTG 60.003 63.158 0.00 0.00 0.00 3.51
3189 5685 2.227036 CCAGCAAGGTGGAGGGAGT 61.227 63.158 12.79 0.00 40.44 3.85
3190 5686 2.673523 CCAGCAAGGTGGAGGGAG 59.326 66.667 12.79 0.00 40.44 4.30
3191 5687 2.935481 CCCAGCAAGGTGGAGGGA 60.935 66.667 19.21 0.00 42.25 4.20
3192 5688 1.867595 AATCCCAGCAAGGTGGAGGG 61.868 60.000 19.21 3.45 40.44 4.30
3193 5689 0.040204 AAATCCCAGCAAGGTGGAGG 59.960 55.000 19.21 4.21 40.44 4.30
3194 5690 1.928868 AAAATCCCAGCAAGGTGGAG 58.071 50.000 19.21 9.64 40.44 3.86
3195 5691 2.378547 AGTAAAATCCCAGCAAGGTGGA 59.621 45.455 19.21 6.41 40.44 4.02
3196 5692 2.807676 AGTAAAATCCCAGCAAGGTGG 58.192 47.619 11.23 11.23 37.34 4.61
3197 5693 5.192927 TCATAGTAAAATCCCAGCAAGGTG 58.807 41.667 0.00 0.00 34.66 4.00
3198 5694 5.450818 TCATAGTAAAATCCCAGCAAGGT 57.549 39.130 0.00 0.00 34.66 3.50
3199 5695 6.378280 AGTTTCATAGTAAAATCCCAGCAAGG 59.622 38.462 0.00 0.00 37.03 3.61
3200 5696 7.396540 AGTTTCATAGTAAAATCCCAGCAAG 57.603 36.000 0.00 0.00 0.00 4.01
3201 5697 8.902806 CATAGTTTCATAGTAAAATCCCAGCAA 58.097 33.333 0.00 0.00 0.00 3.91
3202 5698 8.052748 ACATAGTTTCATAGTAAAATCCCAGCA 58.947 33.333 0.00 0.00 0.00 4.41
3203 5699 8.451908 ACATAGTTTCATAGTAAAATCCCAGC 57.548 34.615 0.00 0.00 0.00 4.85
3206 5702 9.931210 CGAAACATAGTTTCATAGTAAAATCCC 57.069 33.333 19.09 0.00 0.00 3.85
3207 5703 9.931210 CCGAAACATAGTTTCATAGTAAAATCC 57.069 33.333 19.09 0.00 0.00 3.01
3211 5707 8.609176 GCATCCGAAACATAGTTTCATAGTAAA 58.391 33.333 19.09 1.24 0.00 2.01
3212 5708 7.766738 TGCATCCGAAACATAGTTTCATAGTAA 59.233 33.333 19.09 2.12 0.00 2.24
3213 5709 7.269316 TGCATCCGAAACATAGTTTCATAGTA 58.731 34.615 19.09 5.99 0.00 1.82
3214 5710 6.112734 TGCATCCGAAACATAGTTTCATAGT 58.887 36.000 19.09 3.31 0.00 2.12
3215 5711 6.603237 TGCATCCGAAACATAGTTTCATAG 57.397 37.500 19.09 9.56 0.00 2.23
3216 5712 6.993786 TTGCATCCGAAACATAGTTTCATA 57.006 33.333 19.09 9.07 0.00 2.15
3217 5713 5.895636 TTGCATCCGAAACATAGTTTCAT 57.104 34.783 19.09 6.55 0.00 2.57
3218 5714 5.697473 TTTGCATCCGAAACATAGTTTCA 57.303 34.783 19.09 4.73 0.00 2.69
3219 5715 6.806249 TCATTTTGCATCCGAAACATAGTTTC 59.194 34.615 11.53 11.53 0.00 2.78
3220 5716 6.686630 TCATTTTGCATCCGAAACATAGTTT 58.313 32.000 0.00 0.00 0.00 2.66
3221 5717 6.266168 TCATTTTGCATCCGAAACATAGTT 57.734 33.333 0.00 0.00 0.00 2.24
3222 5718 5.895636 TCATTTTGCATCCGAAACATAGT 57.104 34.783 0.00 0.00 0.00 2.12
3223 5719 6.324819 ACTTCATTTTGCATCCGAAACATAG 58.675 36.000 0.00 0.00 0.00 2.23
3224 5720 6.266168 ACTTCATTTTGCATCCGAAACATA 57.734 33.333 0.00 0.00 0.00 2.29
3225 5721 5.138125 ACTTCATTTTGCATCCGAAACAT 57.862 34.783 0.00 0.00 0.00 2.71
3226 5722 4.582701 ACTTCATTTTGCATCCGAAACA 57.417 36.364 0.00 0.00 0.00 2.83
3227 5723 5.461737 TGAAACTTCATTTTGCATCCGAAAC 59.538 36.000 0.00 0.00 31.01 2.78
3228 5724 5.595885 TGAAACTTCATTTTGCATCCGAAA 58.404 33.333 0.00 0.00 31.01 3.46
3229 5725 5.193663 TGAAACTTCATTTTGCATCCGAA 57.806 34.783 0.00 0.00 31.01 4.30
3230 5726 4.844998 TGAAACTTCATTTTGCATCCGA 57.155 36.364 0.00 0.00 31.01 4.55
3241 5737 8.645110 ATTTCCTGAAACTTGATGAAACTTCAT 58.355 29.630 4.61 4.61 40.65 2.57
3242 5738 7.403312 TTTCCTGAAACTTGATGAAACTTCA 57.597 32.000 0.00 0.00 42.14 3.02
3243 5739 8.877808 AATTTCCTGAAACTTGATGAAACTTC 57.122 30.769 0.00 0.00 32.51 3.01
3247 5743 9.709495 CCAATAATTTCCTGAAACTTGATGAAA 57.291 29.630 10.55 0.00 32.51 2.69
3248 5744 9.087871 TCCAATAATTTCCTGAAACTTGATGAA 57.912 29.630 10.55 0.00 32.51 2.57
3249 5745 8.648698 TCCAATAATTTCCTGAAACTTGATGA 57.351 30.769 10.55 2.39 32.51 2.92
3316 5812 8.103305 ACCCGATAATACTTAGATGCATTTCAT 58.897 33.333 0.00 0.00 38.32 2.57
3317 5813 7.450074 ACCCGATAATACTTAGATGCATTTCA 58.550 34.615 0.00 0.00 0.00 2.69
3318 5814 7.907214 ACCCGATAATACTTAGATGCATTTC 57.093 36.000 0.00 0.00 0.00 2.17
3319 5815 8.691661 AAACCCGATAATACTTAGATGCATTT 57.308 30.769 0.00 0.00 0.00 2.32
3320 5816 8.691661 AAAACCCGATAATACTTAGATGCATT 57.308 30.769 0.00 0.00 0.00 3.56
3321 5817 9.436957 CTAAAACCCGATAATACTTAGATGCAT 57.563 33.333 0.00 0.00 0.00 3.96
3322 5818 8.644216 TCTAAAACCCGATAATACTTAGATGCA 58.356 33.333 0.00 0.00 0.00 3.96
3323 5819 9.141400 CTCTAAAACCCGATAATACTTAGATGC 57.859 37.037 0.00 0.00 0.00 3.91
3324 5820 9.640963 CCTCTAAAACCCGATAATACTTAGATG 57.359 37.037 0.00 0.00 0.00 2.90
3325 5821 9.597681 TCCTCTAAAACCCGATAATACTTAGAT 57.402 33.333 0.00 0.00 0.00 1.98
3326 5822 9.075678 CTCCTCTAAAACCCGATAATACTTAGA 57.924 37.037 0.00 0.00 0.00 2.10
3327 5823 9.075678 TCTCCTCTAAAACCCGATAATACTTAG 57.924 37.037 0.00 0.00 0.00 2.18
3328 5824 9.597681 ATCTCCTCTAAAACCCGATAATACTTA 57.402 33.333 0.00 0.00 0.00 2.24
3329 5825 7.909485 TCTCCTCTAAAACCCGATAATACTT 57.091 36.000 0.00 0.00 0.00 2.24
3330 5826 7.728981 TGATCTCCTCTAAAACCCGATAATACT 59.271 37.037 0.00 0.00 0.00 2.12
3331 5827 7.893658 TGATCTCCTCTAAAACCCGATAATAC 58.106 38.462 0.00 0.00 0.00 1.89
3332 5828 8.365647 GTTGATCTCCTCTAAAACCCGATAATA 58.634 37.037 0.00 0.00 0.00 0.98
3333 5829 6.996180 TGATCTCCTCTAAAACCCGATAAT 57.004 37.500 0.00 0.00 0.00 1.28
3334 5830 6.383147 AGTTGATCTCCTCTAAAACCCGATAA 59.617 38.462 0.00 0.00 0.00 1.75
3335 5831 5.897824 AGTTGATCTCCTCTAAAACCCGATA 59.102 40.000 0.00 0.00 0.00 2.92
3336 5832 4.717280 AGTTGATCTCCTCTAAAACCCGAT 59.283 41.667 0.00 0.00 0.00 4.18
3337 5833 4.081642 CAGTTGATCTCCTCTAAAACCCGA 60.082 45.833 0.00 0.00 0.00 5.14
3338 5834 4.184629 CAGTTGATCTCCTCTAAAACCCG 58.815 47.826 0.00 0.00 0.00 5.28
3339 5835 5.167303 ACAGTTGATCTCCTCTAAAACCC 57.833 43.478 0.00 0.00 0.00 4.11
3340 5836 4.865365 CGACAGTTGATCTCCTCTAAAACC 59.135 45.833 0.00 0.00 0.00 3.27
3341 5837 4.865365 CCGACAGTTGATCTCCTCTAAAAC 59.135 45.833 0.00 0.00 0.00 2.43
3342 5838 4.081642 CCCGACAGTTGATCTCCTCTAAAA 60.082 45.833 0.00 0.00 0.00 1.52
3343 5839 3.447586 CCCGACAGTTGATCTCCTCTAAA 59.552 47.826 0.00 0.00 0.00 1.85
3344 5840 3.024547 CCCGACAGTTGATCTCCTCTAA 58.975 50.000 0.00 0.00 0.00 2.10
3345 5841 2.025226 ACCCGACAGTTGATCTCCTCTA 60.025 50.000 0.00 0.00 0.00 2.43
3346 5842 1.272760 ACCCGACAGTTGATCTCCTCT 60.273 52.381 0.00 0.00 0.00 3.69
3347 5843 1.187087 ACCCGACAGTTGATCTCCTC 58.813 55.000 0.00 0.00 0.00 3.71
3348 5844 2.526888 TACCCGACAGTTGATCTCCT 57.473 50.000 0.00 0.00 0.00 3.69
3349 5845 3.522553 CTTTACCCGACAGTTGATCTCC 58.477 50.000 0.00 0.00 0.00 3.71
3350 5846 2.930682 GCTTTACCCGACAGTTGATCTC 59.069 50.000 0.00 0.00 0.00 2.75
3351 5847 2.567615 AGCTTTACCCGACAGTTGATCT 59.432 45.455 0.00 0.00 0.00 2.75
3352 5848 2.673368 CAGCTTTACCCGACAGTTGATC 59.327 50.000 0.00 0.00 0.00 2.92
3353 5849 2.038557 ACAGCTTTACCCGACAGTTGAT 59.961 45.455 0.00 0.00 0.00 2.57
3354 5850 1.414919 ACAGCTTTACCCGACAGTTGA 59.585 47.619 0.00 0.00 0.00 3.18
3355 5851 1.878953 ACAGCTTTACCCGACAGTTG 58.121 50.000 0.00 0.00 0.00 3.16
3356 5852 2.616842 CAAACAGCTTTACCCGACAGTT 59.383 45.455 0.00 0.00 0.00 3.16
3357 5853 2.218603 CAAACAGCTTTACCCGACAGT 58.781 47.619 0.00 0.00 0.00 3.55
3358 5854 1.535462 CCAAACAGCTTTACCCGACAG 59.465 52.381 0.00 0.00 0.00 3.51
3359 5855 1.600023 CCAAACAGCTTTACCCGACA 58.400 50.000 0.00 0.00 0.00 4.35
3360 5856 0.240145 GCCAAACAGCTTTACCCGAC 59.760 55.000 0.00 0.00 0.00 4.79
3361 5857