Multiple sequence alignment - TraesCS1A01G003600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G003600 chr1A 100.000 9632 0 0 1 9632 2237819 2228188 0.000000e+00 17788.0
1 TraesCS1A01G003600 chr1A 93.234 1877 124 3 1896 3769 17271987 17273863 0.000000e+00 2760.0
2 TraesCS1A01G003600 chr5A 93.747 1887 113 5 1888 3771 422060382 422062266 0.000000e+00 2826.0
3 TraesCS1A01G003600 chr5A 93.620 1881 112 8 1892 3769 575230568 575228693 0.000000e+00 2802.0
4 TraesCS1A01G003600 chr5A 92.891 1885 127 6 1894 3772 294025101 294023218 0.000000e+00 2732.0
5 TraesCS1A01G003600 chr5A 92.599 1878 133 6 1898 3772 459687610 459689484 0.000000e+00 2693.0
6 TraesCS1A01G003600 chr3A 93.767 1877 110 6 1896 3769 709699630 709697758 0.000000e+00 2811.0
7 TraesCS1A01G003600 chr3A 92.948 1886 124 6 1894 3773 722306012 722304130 0.000000e+00 2737.0
8 TraesCS1A01G003600 chr3A 74.791 956 228 11 7475 8425 738523814 738524761 1.500000e-112 418.0
9 TraesCS1A01G003600 chr3A 74.714 961 229 12 7471 8425 738434586 738435538 5.380000e-112 416.0
10 TraesCS1A01G003600 chr3A 75.385 390 90 4 8039 8425 738622654 738623040 5.940000e-42 183.0
11 TraesCS1A01G003600 chr2A 93.195 1881 125 3 1894 3772 735929691 735927812 0.000000e+00 2761.0
12 TraesCS1A01G003600 chr6A 93.083 1865 126 3 1896 3758 59329924 59328061 0.000000e+00 2726.0
13 TraesCS1A01G003600 chr6A 95.893 633 25 1 9000 9632 611652014 611652645 0.000000e+00 1024.0
14 TraesCS1A01G003600 chr1D 91.617 1849 135 11 6936 8768 2438096 2436252 0.000000e+00 2538.0
15 TraesCS1A01G003600 chr1D 93.555 1381 68 9 1 1365 2449842 2448467 0.000000e+00 2037.0
16 TraesCS1A01G003600 chr1D 87.380 1458 176 7 5395 6846 2439572 2438117 0.000000e+00 1666.0
17 TraesCS1A01G003600 chr1D 83.401 247 35 5 4787 5030 209757694 209757937 3.500000e-54 224.0
18 TraesCS1A01G003600 chr1D 93.939 99 5 1 8765 8862 2436207 2436109 2.170000e-31 148.0
19 TraesCS1A01G003600 chrUn 95.899 634 25 1 9000 9632 134416604 134417237 0.000000e+00 1026.0
20 TraesCS1A01G003600 chrUn 95.268 634 29 1 9000 9632 30673353 30673986 0.000000e+00 1003.0
21 TraesCS1A01G003600 chrUn 95.268 634 29 1 9000 9632 134511155 134511788 0.000000e+00 1003.0
22 TraesCS1A01G003600 chr7D 95.426 634 27 2 9000 9632 140907215 140906583 0.000000e+00 1009.0
23 TraesCS1A01G003600 chr7D 77.519 1072 226 12 7368 8434 591009214 591008153 1.770000e-176 630.0
24 TraesCS1A01G003600 chr7D 85.714 259 33 3 4782 5037 531584768 531584511 4.430000e-68 270.0
25 TraesCS1A01G003600 chr7D 87.786 131 15 1 4905 5034 546749848 546749978 1.680000e-32 152.0
26 TraesCS1A01G003600 chr7D 97.561 41 1 0 3863 3903 198436533 198436493 4.830000e-08 71.3
27 TraesCS1A01G003600 chr7A 95.426 634 28 1 9000 9632 43608137 43607504 0.000000e+00 1009.0
28 TraesCS1A01G003600 chr7A 95.268 634 29 1 9000 9632 43624777 43624144 0.000000e+00 1003.0
29 TraesCS1A01G003600 chr7A 83.688 141 20 3 4904 5041 53871993 53872133 7.850000e-26 130.0
30 TraesCS1A01G003600 chr7A 97.500 40 1 0 3863 3902 207527447 207527408 1.740000e-07 69.4
31 TraesCS1A01G003600 chr6D 95.426 634 28 1 9000 9632 980125 979492 0.000000e+00 1009.0
32 TraesCS1A01G003600 chr6D 95.268 634 27 3 9000 9632 78553296 78553927 0.000000e+00 1002.0
33 TraesCS1A01G003600 chr5B 86.783 628 74 6 4770 5389 598400067 598399441 0.000000e+00 691.0
34 TraesCS1A01G003600 chr6B 86.284 627 76 7 4763 5383 391097378 391096756 0.000000e+00 673.0
35 TraesCS1A01G003600 chr5D 88.294 299 35 0 4777 5075 533118617 533118319 9.200000e-95 359.0
36 TraesCS1A01G003600 chr5D 87.410 278 28 5 5088 5363 533118347 533118075 7.260000e-81 313.0
37 TraesCS1A01G003600 chr2D 83.730 252 29 11 4792 5034 174597997 174597749 2.710000e-55 228.0
38 TraesCS1A01G003600 chr4A 86.452 155 19 2 4890 5043 665715595 665715442 1.660000e-37 169.0
39 TraesCS1A01G003600 chr1B 92.857 42 1 2 8153 8193 19218506 19218466 1.040000e-04 60.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G003600 chr1A 2228188 2237819 9631 True 17788.000000 17788 100.000000 1 9632 1 chr1A.!!$R1 9631
1 TraesCS1A01G003600 chr1A 17271987 17273863 1876 False 2760.000000 2760 93.234000 1896 3769 1 chr1A.!!$F1 1873
2 TraesCS1A01G003600 chr5A 422060382 422062266 1884 False 2826.000000 2826 93.747000 1888 3771 1 chr5A.!!$F1 1883
3 TraesCS1A01G003600 chr5A 575228693 575230568 1875 True 2802.000000 2802 93.620000 1892 3769 1 chr5A.!!$R2 1877
4 TraesCS1A01G003600 chr5A 294023218 294025101 1883 True 2732.000000 2732 92.891000 1894 3772 1 chr5A.!!$R1 1878
5 TraesCS1A01G003600 chr5A 459687610 459689484 1874 False 2693.000000 2693 92.599000 1898 3772 1 chr5A.!!$F2 1874
6 TraesCS1A01G003600 chr3A 709697758 709699630 1872 True 2811.000000 2811 93.767000 1896 3769 1 chr3A.!!$R1 1873
7 TraesCS1A01G003600 chr3A 722304130 722306012 1882 True 2737.000000 2737 92.948000 1894 3773 1 chr3A.!!$R2 1879
8 TraesCS1A01G003600 chr3A 738523814 738524761 947 False 418.000000 418 74.791000 7475 8425 1 chr3A.!!$F2 950
9 TraesCS1A01G003600 chr3A 738434586 738435538 952 False 416.000000 416 74.714000 7471 8425 1 chr3A.!!$F1 954
10 TraesCS1A01G003600 chr2A 735927812 735929691 1879 True 2761.000000 2761 93.195000 1894 3772 1 chr2A.!!$R1 1878
11 TraesCS1A01G003600 chr6A 59328061 59329924 1863 True 2726.000000 2726 93.083000 1896 3758 1 chr6A.!!$R1 1862
12 TraesCS1A01G003600 chr6A 611652014 611652645 631 False 1024.000000 1024 95.893000 9000 9632 1 chr6A.!!$F1 632
13 TraesCS1A01G003600 chr1D 2448467 2449842 1375 True 2037.000000 2037 93.555000 1 1365 1 chr1D.!!$R1 1364
14 TraesCS1A01G003600 chr1D 2436109 2439572 3463 True 1450.666667 2538 90.978667 5395 8862 3 chr1D.!!$R2 3467
15 TraesCS1A01G003600 chrUn 134416604 134417237 633 False 1026.000000 1026 95.899000 9000 9632 1 chrUn.!!$F2 632
16 TraesCS1A01G003600 chrUn 30673353 30673986 633 False 1003.000000 1003 95.268000 9000 9632 1 chrUn.!!$F1 632
17 TraesCS1A01G003600 chrUn 134511155 134511788 633 False 1003.000000 1003 95.268000 9000 9632 1 chrUn.!!$F3 632
18 TraesCS1A01G003600 chr7D 140906583 140907215 632 True 1009.000000 1009 95.426000 9000 9632 1 chr7D.!!$R1 632
19 TraesCS1A01G003600 chr7D 591008153 591009214 1061 True 630.000000 630 77.519000 7368 8434 1 chr7D.!!$R4 1066
20 TraesCS1A01G003600 chr7A 43607504 43608137 633 True 1009.000000 1009 95.426000 9000 9632 1 chr7A.!!$R1 632
21 TraesCS1A01G003600 chr7A 43624144 43624777 633 True 1003.000000 1003 95.268000 9000 9632 1 chr7A.!!$R2 632
22 TraesCS1A01G003600 chr6D 979492 980125 633 True 1009.000000 1009 95.426000 9000 9632 1 chr6D.!!$R1 632
23 TraesCS1A01G003600 chr6D 78553296 78553927 631 False 1002.000000 1002 95.268000 9000 9632 1 chr6D.!!$F1 632
24 TraesCS1A01G003600 chr5B 598399441 598400067 626 True 691.000000 691 86.783000 4770 5389 1 chr5B.!!$R1 619
25 TraesCS1A01G003600 chr6B 391096756 391097378 622 True 673.000000 673 86.284000 4763 5383 1 chr6B.!!$R1 620
26 TraesCS1A01G003600 chr5D 533118075 533118617 542 True 336.000000 359 87.852000 4777 5363 2 chr5D.!!$R1 586


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
742 756 0.472471 TGGACTCAAGGACGGCTTTT 59.528 50.0 0.00 0.00 0.00 2.27 F
1395 1411 0.037975 GGGCATTGGTGTTCAGCTTG 60.038 55.0 3.76 3.22 0.00 4.01 F
1651 1667 0.028242 CTAAACCACACGCACGCAAA 59.972 50.0 0.00 0.00 0.00 3.68 F
1882 1898 0.108585 TTCAACACAGCTCACCTCCC 59.891 55.0 0.00 0.00 0.00 4.30 F
1884 1900 0.179020 CAACACAGCTCACCTCCCAA 60.179 55.0 0.00 0.00 0.00 4.12 F
1976 1993 0.530288 GCGCAAAAATTAGGCCTGGA 59.470 50.0 17.99 3.92 0.00 3.86 F
3080 3107 0.743345 CGTCGGGAAACAGGGGAATC 60.743 60.0 0.00 0.00 0.00 2.52 F
4217 4248 0.041238 AGCTAGACTACCCAGCCACA 59.959 55.0 0.00 0.00 35.88 4.17 F
4433 4464 0.032815 TGGCGTGAGTCATCAACGAA 59.967 50.0 5.16 0.00 43.37 3.85 F
4568 4599 0.034186 GGCATCACCACTCCCATCAA 60.034 55.0 0.00 0.00 38.86 2.57 F
5080 5116 0.036875 ACACCAAAGCTAGACCTGGC 59.963 55.0 0.00 0.00 37.33 4.85 F
6451 6493 0.029834 CAGCTCAACTGCACCAACAC 59.970 55.0 0.00 0.00 40.19 3.32 F
7169 7225 0.387622 CAACAGACCAGGCATTTGCG 60.388 55.0 0.00 0.00 43.26 4.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1632 1648 0.028242 TTTGCGTGCGTGTGGTTTAG 59.972 50.000 0.00 0.0 0.00 1.85 R
3068 3095 0.322546 GAGTGCCGATTCCCCTGTTT 60.323 55.000 0.00 0.0 0.00 2.83 R
3165 3192 1.001764 TCCGCGAACAGGAGTCCTA 60.002 57.895 12.53 0.0 33.19 2.94 R
3878 3909 1.207791 AGCCAGCAGTTGCCTATACT 58.792 50.000 0.00 0.0 43.38 2.12 R
3883 3914 1.816961 GCATATAGCCAGCAGTTGCCT 60.817 52.381 0.00 0.0 38.58 4.75 R
3884 3915 0.595095 GCATATAGCCAGCAGTTGCC 59.405 55.000 0.00 0.0 38.58 4.52 R
4414 4445 0.032815 TTCGTTGATGACTCACGCCA 59.967 50.000 0.00 0.0 0.00 5.69 R
5582 5622 0.033504 AGTTCGATCGTGCAACTGGT 59.966 50.000 17.04 0.0 31.75 4.00 R
6363 6405 0.108585 ACACTGATGTTCCCGCACTT 59.891 50.000 0.00 0.0 34.46 3.16 R
6364 6406 0.108585 AACACTGATGTTCCCGCACT 59.891 50.000 0.00 0.0 46.46 4.40 R
6613 6655 0.034574 AACGGCCCATTGCACAGATA 60.035 50.000 0.00 0.0 43.89 1.98 R
8293 8350 1.202336 ACAAACTTGAGCAGCAGCAAC 60.202 47.619 3.17 0.0 45.49 4.17 R
8964 9070 0.320160 ACGGTTGGAAAGTACTCGGC 60.320 55.000 0.00 0.0 0.00 5.54 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
64 67 3.279434 CCTAAACTATGGTGCTTGGTCC 58.721 50.000 0.00 0.00 0.00 4.46
75 78 1.860078 CTTGGTCCGACTTGAACGC 59.140 57.895 0.00 0.00 0.00 4.84
82 85 2.095567 GTCCGACTTGAACGCTGTACTA 60.096 50.000 0.00 0.00 0.00 1.82
145 148 2.256117 AGTTGAGCGCTAACTTGGTT 57.744 45.000 11.50 0.00 34.91 3.67
444 458 8.137437 TGAAATAAGCAGCTAGGCATAATTTTC 58.863 33.333 0.00 1.05 35.83 2.29
454 468 6.127054 GCTAGGCATAATTTTCCCTTCCTTTT 60.127 38.462 0.00 0.00 0.00 2.27
462 476 7.433708 AATTTTCCCTTCCTTTTATTTTGCG 57.566 32.000 0.00 0.00 0.00 4.85
482 496 2.213499 GGGGAACACAGCATAATCGAG 58.787 52.381 0.00 0.00 0.00 4.04
591 605 2.491291 TTGCAGCAGAAGCACAACA 58.509 47.368 0.00 0.00 45.49 3.33
679 693 2.067386 ACAAACCCCTTAACTGCCCTA 58.933 47.619 0.00 0.00 0.00 3.53
732 746 1.069022 CATTTGCGGTGTGGACTCAAG 60.069 52.381 0.00 0.00 0.00 3.02
734 748 1.691195 TTGCGGTGTGGACTCAAGGA 61.691 55.000 0.00 0.00 0.00 3.36
742 756 0.472471 TGGACTCAAGGACGGCTTTT 59.528 50.000 0.00 0.00 0.00 2.27
846 860 5.221106 CCATGTTGCTTTTCTCTCACAAGAA 60.221 40.000 0.00 0.00 33.50 2.52
851 865 3.316308 GCTTTTCTCTCACAAGAAGGCAA 59.684 43.478 0.00 0.00 36.66 4.52
863 877 1.527433 GAAGGCAAGGCAGTTCCACC 61.527 60.000 0.00 0.00 37.29 4.61
945 959 1.741993 CAAGAAAGCAACGACGTTGG 58.258 50.000 34.49 20.16 42.99 3.77
976 990 3.052490 TCCCAAGGAAAACCTTTTCTCCA 60.052 43.478 9.75 0.00 44.49 3.86
979 993 5.116180 CCAAGGAAAACCTTTTCTCCAAAC 58.884 41.667 9.75 0.00 44.49 2.93
980 994 5.337975 CCAAGGAAAACCTTTTCTCCAAACA 60.338 40.000 9.75 0.00 44.49 2.83
981 995 6.348498 CAAGGAAAACCTTTTCTCCAAACAT 58.652 36.000 9.75 0.00 44.49 2.71
982 996 7.418483 CCAAGGAAAACCTTTTCTCCAAACATA 60.418 37.037 9.75 0.00 44.49 2.29
983 997 7.855784 AGGAAAACCTTTTCTCCAAACATAT 57.144 32.000 9.75 0.00 44.49 1.78
986 1000 9.337396 GGAAAACCTTTTCTCCAAACATATTTT 57.663 29.630 9.75 0.00 44.49 1.82
1011 1027 8.969260 TTGCAGTATTAGAGATGATTGTTCAT 57.031 30.769 0.00 0.00 45.39 2.57
1034 1050 1.274703 TGGAAGGTGGAGATGAGCCC 61.275 60.000 0.00 0.00 0.00 5.19
1060 1076 2.362717 GGCGTAGTTATTCCTCTGCTCT 59.637 50.000 0.00 0.00 0.00 4.09
1072 1088 4.380531 TCCTCTGCTCTTACTTGTTTGTG 58.619 43.478 0.00 0.00 0.00 3.33
1073 1089 3.058639 CCTCTGCTCTTACTTGTTTGTGC 60.059 47.826 0.00 0.00 0.00 4.57
1130 1146 4.552365 CATCCCATCCGCTGCCGT 62.552 66.667 0.00 0.00 0.00 5.68
1149 1165 3.737172 CTCGCCGGTTGCCAAAGG 61.737 66.667 1.90 0.00 36.24 3.11
1152 1168 4.056125 GCCGGTTGCCAAAGGAGC 62.056 66.667 1.90 0.00 0.00 4.70
1164 1180 0.393537 AAAGGAGCTGCGGGAATCTG 60.394 55.000 0.00 0.00 0.00 2.90
1167 1183 1.219124 GAGCTGCGGGAATCTGACA 59.781 57.895 0.00 0.00 0.00 3.58
1195 1211 2.436646 CCTTTGGCATCGGCTCGT 60.437 61.111 0.00 0.00 40.87 4.18
1221 1237 1.302832 CTTCCGGCAGCCAGACTTT 60.303 57.895 13.30 0.00 0.00 2.66
1222 1238 1.580845 CTTCCGGCAGCCAGACTTTG 61.581 60.000 13.30 0.00 0.00 2.77
1236 1252 3.690139 CAGACTTTGAGCTCATCTGCAAT 59.310 43.478 25.26 6.81 31.14 3.56
1240 1256 5.005740 ACTTTGAGCTCATCTGCAATAACA 58.994 37.500 19.04 0.00 34.99 2.41
1242 1258 2.931969 TGAGCTCATCTGCAATAACACG 59.068 45.455 13.74 0.00 34.99 4.49
1250 1266 2.482336 TCTGCAATAACACGACGCAAAT 59.518 40.909 0.00 0.00 31.10 2.32
1268 1284 1.341156 ATCCCAAGGCTCTTCCTCCG 61.341 60.000 0.00 0.00 46.94 4.63
1306 1322 3.065786 GGTCACCTACGACATCGACATTA 59.934 47.826 8.54 0.00 43.02 1.90
1313 1329 4.778842 ACGACATCGACATTAATTCTGC 57.221 40.909 8.54 0.00 43.02 4.26
1316 1332 5.005779 ACGACATCGACATTAATTCTGCTTC 59.994 40.000 8.54 0.00 43.02 3.86
1318 1334 4.576463 ACATCGACATTAATTCTGCTTCCC 59.424 41.667 0.00 0.00 0.00 3.97
1326 1342 2.808906 ATTCTGCTTCCCCAGGTAAC 57.191 50.000 0.00 0.00 33.64 2.50
1327 1343 1.440618 TTCTGCTTCCCCAGGTAACA 58.559 50.000 0.00 0.00 41.41 2.41
1330 1346 1.073923 CTGCTTCCCCAGGTAACACTT 59.926 52.381 0.00 0.00 41.41 3.16
1335 1351 1.486145 CCCCAGGTAACACTTCCGGT 61.486 60.000 0.00 0.00 41.41 5.28
1341 1357 1.065998 GGTAACACTTCCGGTATGGCA 60.066 52.381 0.00 0.00 37.80 4.92
1343 1359 1.750193 AACACTTCCGGTATGGCATG 58.250 50.000 10.98 0.00 37.80 4.06
1379 1395 8.943909 ACTCATTATTACTATTATAAGCGGGC 57.056 34.615 0.00 0.00 0.00 6.13
1380 1396 8.537016 ACTCATTATTACTATTATAAGCGGGCA 58.463 33.333 0.00 0.00 0.00 5.36
1381 1397 9.547753 CTCATTATTACTATTATAAGCGGGCAT 57.452 33.333 0.00 0.00 0.00 4.40
1382 1398 9.899661 TCATTATTACTATTATAAGCGGGCATT 57.100 29.630 0.00 0.00 0.00 3.56
1383 1399 9.935682 CATTATTACTATTATAAGCGGGCATTG 57.064 33.333 0.00 0.00 0.00 2.82
1384 1400 8.500753 TTATTACTATTATAAGCGGGCATTGG 57.499 34.615 0.00 0.00 0.00 3.16
1385 1401 4.367039 ACTATTATAAGCGGGCATTGGT 57.633 40.909 0.00 0.00 0.00 3.67
1386 1402 4.072131 ACTATTATAAGCGGGCATTGGTG 58.928 43.478 0.00 0.00 0.00 4.17
1387 1403 2.428544 TTATAAGCGGGCATTGGTGT 57.571 45.000 0.00 0.00 0.00 4.16
1388 1404 2.428544 TATAAGCGGGCATTGGTGTT 57.571 45.000 0.00 0.00 0.00 3.32
1389 1405 1.102978 ATAAGCGGGCATTGGTGTTC 58.897 50.000 0.00 0.00 0.00 3.18
1390 1406 0.250945 TAAGCGGGCATTGGTGTTCA 60.251 50.000 0.00 0.00 0.00 3.18
1391 1407 1.526575 AAGCGGGCATTGGTGTTCAG 61.527 55.000 0.00 0.00 0.00 3.02
1392 1408 2.568090 CGGGCATTGGTGTTCAGC 59.432 61.111 0.00 0.00 0.00 4.26
1393 1409 1.973281 CGGGCATTGGTGTTCAGCT 60.973 57.895 3.76 0.00 0.00 4.24
1394 1410 1.526575 CGGGCATTGGTGTTCAGCTT 61.527 55.000 3.76 0.00 0.00 3.74
1395 1411 0.037975 GGGCATTGGTGTTCAGCTTG 60.038 55.000 3.76 3.22 0.00 4.01
1396 1412 0.675633 GGCATTGGTGTTCAGCTTGT 59.324 50.000 3.76 0.00 0.00 3.16
1397 1413 1.069049 GGCATTGGTGTTCAGCTTGTT 59.931 47.619 3.76 0.00 0.00 2.83
1398 1414 2.129607 GCATTGGTGTTCAGCTTGTTG 58.870 47.619 3.76 0.00 0.00 3.33
1399 1415 2.746269 CATTGGTGTTCAGCTTGTTGG 58.254 47.619 3.76 0.00 0.00 3.77
1400 1416 0.459489 TTGGTGTTCAGCTTGTTGGC 59.541 50.000 3.76 0.00 0.00 4.52
1401 1417 1.363807 GGTGTTCAGCTTGTTGGCC 59.636 57.895 0.00 0.00 0.00 5.36
1402 1418 1.363807 GTGTTCAGCTTGTTGGCCC 59.636 57.895 0.00 0.00 0.00 5.80
1403 1419 1.076412 TGTTCAGCTTGTTGGCCCA 60.076 52.632 0.00 0.00 0.00 5.36
1404 1420 1.108727 TGTTCAGCTTGTTGGCCCAG 61.109 55.000 0.00 0.00 0.00 4.45
1405 1421 1.109323 GTTCAGCTTGTTGGCCCAGT 61.109 55.000 0.00 0.00 0.00 4.00
1406 1422 0.823356 TTCAGCTTGTTGGCCCAGTC 60.823 55.000 0.00 0.00 0.00 3.51
1407 1423 1.529010 CAGCTTGTTGGCCCAGTCA 60.529 57.895 0.00 0.00 0.00 3.41
1408 1424 1.108727 CAGCTTGTTGGCCCAGTCAA 61.109 55.000 0.00 0.00 0.00 3.18
1409 1425 1.109323 AGCTTGTTGGCCCAGTCAAC 61.109 55.000 0.00 5.14 46.76 3.18
1412 1428 3.443588 GTTGGCCCAGTCAACACC 58.556 61.111 0.00 0.00 45.99 4.16
1413 1429 2.203280 TTGGCCCAGTCAACACCG 60.203 61.111 0.00 0.00 0.00 4.94
1414 1430 3.050354 TTGGCCCAGTCAACACCGT 62.050 57.895 0.00 0.00 0.00 4.83
1415 1431 2.668550 GGCCCAGTCAACACCGTC 60.669 66.667 0.00 0.00 0.00 4.79
1416 1432 3.041940 GCCCAGTCAACACCGTCG 61.042 66.667 0.00 0.00 0.00 5.12
1417 1433 2.732016 CCCAGTCAACACCGTCGA 59.268 61.111 0.00 0.00 0.00 4.20
1418 1434 1.372997 CCCAGTCAACACCGTCGAG 60.373 63.158 0.00 0.00 0.00 4.04
1419 1435 1.362717 CCAGTCAACACCGTCGAGT 59.637 57.895 0.00 0.00 0.00 4.18
1420 1436 0.594602 CCAGTCAACACCGTCGAGTA 59.405 55.000 0.00 0.00 0.00 2.59
1421 1437 1.201647 CCAGTCAACACCGTCGAGTAT 59.798 52.381 0.00 0.00 0.00 2.12
1422 1438 2.352421 CCAGTCAACACCGTCGAGTATT 60.352 50.000 0.00 0.00 0.00 1.89
1423 1439 2.661675 CAGTCAACACCGTCGAGTATTG 59.338 50.000 0.00 0.00 0.00 1.90
1424 1440 2.295349 AGTCAACACCGTCGAGTATTGT 59.705 45.455 0.00 0.00 0.00 2.71
1425 1441 2.660236 GTCAACACCGTCGAGTATTGTC 59.340 50.000 0.00 0.00 0.00 3.18
1426 1442 2.555325 TCAACACCGTCGAGTATTGTCT 59.445 45.455 0.00 0.00 0.00 3.41
1427 1443 2.631418 ACACCGTCGAGTATTGTCTG 57.369 50.000 0.00 0.00 0.00 3.51
1428 1444 2.156917 ACACCGTCGAGTATTGTCTGA 58.843 47.619 0.00 0.00 0.00 3.27
1429 1445 2.095364 ACACCGTCGAGTATTGTCTGAC 60.095 50.000 0.00 0.00 0.00 3.51
1435 1451 4.774586 GTCGAGTATTGTCTGACGATAGG 58.225 47.826 16.28 9.98 43.77 2.57
1436 1452 4.510711 GTCGAGTATTGTCTGACGATAGGA 59.489 45.833 16.28 11.73 43.77 2.94
1437 1453 5.007430 GTCGAGTATTGTCTGACGATAGGAA 59.993 44.000 16.28 0.00 43.77 3.36
1438 1454 5.007430 TCGAGTATTGTCTGACGATAGGAAC 59.993 44.000 16.28 8.77 43.77 3.62
1439 1455 5.171147 AGTATTGTCTGACGATAGGAACG 57.829 43.478 16.28 0.00 43.77 3.95
1440 1456 4.880120 AGTATTGTCTGACGATAGGAACGA 59.120 41.667 16.28 0.00 43.77 3.85
1441 1457 3.482722 TTGTCTGACGATAGGAACGAC 57.517 47.619 2.98 0.00 43.77 4.34
1442 1458 1.395954 TGTCTGACGATAGGAACGACG 59.604 52.381 2.98 0.00 43.77 5.12
1443 1459 1.662629 GTCTGACGATAGGAACGACGA 59.337 52.381 0.00 0.00 43.77 4.20
1444 1460 2.287373 GTCTGACGATAGGAACGACGAT 59.713 50.000 0.00 0.00 43.77 3.73
1445 1461 3.492383 GTCTGACGATAGGAACGACGATA 59.508 47.826 0.00 0.00 43.77 2.92
1446 1462 4.025396 GTCTGACGATAGGAACGACGATAA 60.025 45.833 0.00 0.00 43.77 1.75
1447 1463 4.571984 TCTGACGATAGGAACGACGATAAA 59.428 41.667 0.00 0.00 43.77 1.40
1448 1464 4.840911 TGACGATAGGAACGACGATAAAG 58.159 43.478 0.00 0.00 43.77 1.85
1449 1465 3.625938 ACGATAGGAACGACGATAAAGC 58.374 45.455 0.00 0.00 43.77 3.51
1450 1466 2.650765 CGATAGGAACGACGATAAAGCG 59.349 50.000 0.00 0.00 37.29 4.68
1451 1467 3.605461 CGATAGGAACGACGATAAAGCGA 60.605 47.826 0.00 0.00 34.83 4.93
1452 1468 2.642139 AGGAACGACGATAAAGCGAA 57.358 45.000 0.00 0.00 34.83 4.70
1453 1469 2.527100 AGGAACGACGATAAAGCGAAG 58.473 47.619 0.00 0.00 34.83 3.79
1466 1482 3.105782 CGAAGCGACGCTGAGCAA 61.106 61.111 25.24 0.00 39.62 3.91
1467 1483 2.447887 CGAAGCGACGCTGAGCAAT 61.448 57.895 25.24 6.07 39.62 3.56
1468 1484 1.346538 GAAGCGACGCTGAGCAATC 59.653 57.895 25.24 12.28 39.62 2.67
1469 1485 1.079543 AAGCGACGCTGAGCAATCT 60.080 52.632 25.24 1.07 39.62 2.40
1470 1486 0.173481 AAGCGACGCTGAGCAATCTA 59.827 50.000 25.24 0.00 39.62 1.98
1471 1487 0.248825 AGCGACGCTGAGCAATCTAG 60.249 55.000 23.84 0.00 37.57 2.43
1472 1488 0.248661 GCGACGCTGAGCAATCTAGA 60.249 55.000 13.73 0.00 0.00 2.43
1473 1489 1.471964 CGACGCTGAGCAATCTAGAC 58.528 55.000 4.88 0.00 0.00 2.59
1474 1490 1.471964 GACGCTGAGCAATCTAGACG 58.528 55.000 4.88 0.00 0.00 4.18
1475 1491 1.064208 GACGCTGAGCAATCTAGACGA 59.936 52.381 4.88 0.00 0.00 4.20
1476 1492 1.472878 ACGCTGAGCAATCTAGACGAA 59.527 47.619 4.88 0.00 0.00 3.85
1477 1493 2.115595 CGCTGAGCAATCTAGACGAAG 58.884 52.381 4.88 0.00 0.00 3.79
1493 1509 3.921677 ACGAAGTTCTTTTATGCCGAGA 58.078 40.909 0.56 0.00 37.78 4.04
1494 1510 4.504858 ACGAAGTTCTTTTATGCCGAGAT 58.495 39.130 0.56 0.00 37.78 2.75
1495 1511 4.330074 ACGAAGTTCTTTTATGCCGAGATG 59.670 41.667 0.56 0.00 37.78 2.90
1496 1512 4.330074 CGAAGTTCTTTTATGCCGAGATGT 59.670 41.667 0.56 0.00 0.00 3.06
1497 1513 5.518847 CGAAGTTCTTTTATGCCGAGATGTA 59.481 40.000 0.56 0.00 0.00 2.29
1498 1514 6.508088 CGAAGTTCTTTTATGCCGAGATGTAC 60.508 42.308 0.56 0.00 0.00 2.90
1499 1515 5.730550 AGTTCTTTTATGCCGAGATGTACA 58.269 37.500 0.00 0.00 0.00 2.90
1500 1516 6.170506 AGTTCTTTTATGCCGAGATGTACAA 58.829 36.000 0.00 0.00 0.00 2.41
1501 1517 6.653320 AGTTCTTTTATGCCGAGATGTACAAA 59.347 34.615 0.00 0.00 0.00 2.83
1502 1518 7.336931 AGTTCTTTTATGCCGAGATGTACAAAT 59.663 33.333 0.00 0.00 0.00 2.32
1503 1519 7.624360 TCTTTTATGCCGAGATGTACAAATT 57.376 32.000 0.00 0.00 0.00 1.82
1504 1520 7.471721 TCTTTTATGCCGAGATGTACAAATTG 58.528 34.615 0.00 0.00 0.00 2.32
1505 1521 5.749596 TTATGCCGAGATGTACAAATTGG 57.250 39.130 0.00 6.12 0.00 3.16
1506 1522 3.342377 TGCCGAGATGTACAAATTGGA 57.658 42.857 17.30 0.00 0.00 3.53
1507 1523 3.680490 TGCCGAGATGTACAAATTGGAA 58.320 40.909 17.30 7.20 0.00 3.53
1508 1524 3.689161 TGCCGAGATGTACAAATTGGAAG 59.311 43.478 17.30 0.00 0.00 3.46
1509 1525 3.487544 GCCGAGATGTACAAATTGGAAGC 60.488 47.826 17.30 3.69 0.00 3.86
1510 1526 3.941483 CCGAGATGTACAAATTGGAAGCT 59.059 43.478 0.00 0.00 0.00 3.74
1511 1527 5.116180 CCGAGATGTACAAATTGGAAGCTA 58.884 41.667 0.00 0.00 0.00 3.32
1512 1528 5.235186 CCGAGATGTACAAATTGGAAGCTAG 59.765 44.000 0.00 0.00 0.00 3.42
1513 1529 5.277058 CGAGATGTACAAATTGGAAGCTAGC 60.277 44.000 6.62 6.62 0.00 3.42
1514 1530 5.749462 AGATGTACAAATTGGAAGCTAGCT 58.251 37.500 12.68 12.68 0.00 3.32
1515 1531 6.183347 AGATGTACAAATTGGAAGCTAGCTT 58.817 36.000 29.71 29.71 39.23 3.74
1525 1541 3.992260 GAAGCTAGCTTCCTACGATCA 57.008 47.619 37.06 0.00 44.76 2.92
1526 1542 4.308899 GAAGCTAGCTTCCTACGATCAA 57.691 45.455 37.06 0.00 44.76 2.57
1527 1543 4.877282 GAAGCTAGCTTCCTACGATCAAT 58.123 43.478 37.06 11.06 44.76 2.57
1528 1544 4.946478 AGCTAGCTTCCTACGATCAATT 57.054 40.909 12.68 0.00 0.00 2.32
1529 1545 4.877282 AGCTAGCTTCCTACGATCAATTC 58.123 43.478 12.68 0.00 0.00 2.17
1530 1546 4.342378 AGCTAGCTTCCTACGATCAATTCA 59.658 41.667 12.68 0.00 0.00 2.57
1531 1547 4.446051 GCTAGCTTCCTACGATCAATTCAC 59.554 45.833 7.70 0.00 0.00 3.18
1532 1548 3.798202 AGCTTCCTACGATCAATTCACC 58.202 45.455 0.00 0.00 0.00 4.02
1533 1549 2.872858 GCTTCCTACGATCAATTCACCC 59.127 50.000 0.00 0.00 0.00 4.61
1534 1550 3.681594 GCTTCCTACGATCAATTCACCCA 60.682 47.826 0.00 0.00 0.00 4.51
1535 1551 3.819564 TCCTACGATCAATTCACCCAG 57.180 47.619 0.00 0.00 0.00 4.45
1536 1552 2.158957 TCCTACGATCAATTCACCCAGC 60.159 50.000 0.00 0.00 0.00 4.85
1537 1553 2.419990 CCTACGATCAATTCACCCAGCA 60.420 50.000 0.00 0.00 0.00 4.41
1538 1554 1.453155 ACGATCAATTCACCCAGCAC 58.547 50.000 0.00 0.00 0.00 4.40
1539 1555 1.271325 ACGATCAATTCACCCAGCACA 60.271 47.619 0.00 0.00 0.00 4.57
1540 1556 1.811965 CGATCAATTCACCCAGCACAA 59.188 47.619 0.00 0.00 0.00 3.33
1541 1557 2.228582 CGATCAATTCACCCAGCACAAA 59.771 45.455 0.00 0.00 0.00 2.83
1542 1558 3.671433 CGATCAATTCACCCAGCACAAAG 60.671 47.826 0.00 0.00 0.00 2.77
1543 1559 1.340889 TCAATTCACCCAGCACAAAGC 59.659 47.619 0.00 0.00 46.19 3.51
1553 1569 3.691110 GCACAAAGCTAGCTTGCTC 57.309 52.632 29.94 15.45 43.24 4.26
1554 1570 1.163554 GCACAAAGCTAGCTTGCTCT 58.836 50.000 29.94 12.17 43.24 4.09
1555 1571 2.350522 GCACAAAGCTAGCTTGCTCTA 58.649 47.619 29.94 0.00 43.24 2.43
1556 1572 2.351111 GCACAAAGCTAGCTTGCTCTAG 59.649 50.000 29.94 16.74 43.24 2.43
1567 1583 3.096791 GCTCTAGCAAAGCGCCTG 58.903 61.111 2.29 2.58 44.04 4.85
1568 1584 1.448540 GCTCTAGCAAAGCGCCTGA 60.449 57.895 2.29 0.00 44.04 3.86
1569 1585 0.813210 GCTCTAGCAAAGCGCCTGAT 60.813 55.000 2.29 2.86 44.04 2.90
1570 1586 1.661341 CTCTAGCAAAGCGCCTGATT 58.339 50.000 2.29 0.00 44.04 2.57
1571 1587 1.329906 CTCTAGCAAAGCGCCTGATTG 59.670 52.381 2.29 6.11 44.04 2.67
1572 1588 1.066215 TCTAGCAAAGCGCCTGATTGA 60.066 47.619 2.29 4.45 44.04 2.57
1573 1589 1.945394 CTAGCAAAGCGCCTGATTGAT 59.055 47.619 2.29 6.30 44.04 2.57
1574 1590 0.737219 AGCAAAGCGCCTGATTGATC 59.263 50.000 2.29 0.00 44.04 2.92
1575 1591 0.248784 GCAAAGCGCCTGATTGATCC 60.249 55.000 2.29 0.00 32.94 3.36
1576 1592 1.386533 CAAAGCGCCTGATTGATCCT 58.613 50.000 2.29 0.00 0.00 3.24
1577 1593 1.747355 CAAAGCGCCTGATTGATCCTT 59.253 47.619 2.29 0.00 0.00 3.36
1578 1594 1.673168 AAGCGCCTGATTGATCCTTC 58.327 50.000 2.29 0.00 0.00 3.46
1579 1595 0.179034 AGCGCCTGATTGATCCTTCC 60.179 55.000 2.29 0.00 0.00 3.46
1580 1596 1.502163 GCGCCTGATTGATCCTTCCG 61.502 60.000 0.00 0.00 0.00 4.30
1581 1597 0.179073 CGCCTGATTGATCCTTCCGT 60.179 55.000 0.00 0.00 0.00 4.69
1582 1598 1.068588 CGCCTGATTGATCCTTCCGTA 59.931 52.381 0.00 0.00 0.00 4.02
1583 1599 2.483013 CGCCTGATTGATCCTTCCGTAA 60.483 50.000 0.00 0.00 0.00 3.18
1584 1600 3.541632 GCCTGATTGATCCTTCCGTAAA 58.458 45.455 0.00 0.00 0.00 2.01
1585 1601 3.561725 GCCTGATTGATCCTTCCGTAAAG 59.438 47.826 0.00 0.00 34.52 1.85
1586 1602 4.770795 CCTGATTGATCCTTCCGTAAAGT 58.229 43.478 0.00 0.00 32.69 2.66
1587 1603 5.684030 GCCTGATTGATCCTTCCGTAAAGTA 60.684 44.000 0.00 0.00 32.69 2.24
1588 1604 5.986135 CCTGATTGATCCTTCCGTAAAGTAG 59.014 44.000 0.00 0.00 32.69 2.57
1589 1605 5.357257 TGATTGATCCTTCCGTAAAGTAGC 58.643 41.667 0.00 0.00 32.69 3.58
1590 1606 5.128827 TGATTGATCCTTCCGTAAAGTAGCT 59.871 40.000 0.00 0.00 32.69 3.32
1591 1607 4.386867 TGATCCTTCCGTAAAGTAGCTG 57.613 45.455 0.00 0.00 32.69 4.24
1592 1608 2.667473 TCCTTCCGTAAAGTAGCTGC 57.333 50.000 0.00 0.00 32.69 5.25
1593 1609 1.897133 TCCTTCCGTAAAGTAGCTGCA 59.103 47.619 4.12 0.00 32.69 4.41
1594 1610 2.300723 TCCTTCCGTAAAGTAGCTGCAA 59.699 45.455 4.12 0.00 32.69 4.08
1595 1611 2.415512 CCTTCCGTAAAGTAGCTGCAAC 59.584 50.000 4.12 0.00 32.69 4.17
1596 1612 2.088950 TCCGTAAAGTAGCTGCAACC 57.911 50.000 4.12 0.00 0.00 3.77
1597 1613 1.621814 TCCGTAAAGTAGCTGCAACCT 59.378 47.619 4.12 0.00 0.00 3.50
1598 1614 1.732259 CCGTAAAGTAGCTGCAACCTG 59.268 52.381 4.12 0.00 0.00 4.00
1599 1615 1.128692 CGTAAAGTAGCTGCAACCTGC 59.871 52.381 4.12 0.00 45.29 4.85
1609 1625 3.865700 GCAACCTGCAAGTAACACC 57.134 52.632 0.00 0.00 44.26 4.16
1610 1626 1.028905 GCAACCTGCAAGTAACACCA 58.971 50.000 0.00 0.00 44.26 4.17
1611 1627 1.407258 GCAACCTGCAAGTAACACCAA 59.593 47.619 0.00 0.00 44.26 3.67
1612 1628 2.159170 GCAACCTGCAAGTAACACCAAA 60.159 45.455 0.00 0.00 44.26 3.28
1613 1629 3.705604 CAACCTGCAAGTAACACCAAAG 58.294 45.455 0.00 0.00 0.00 2.77
1614 1630 3.290948 ACCTGCAAGTAACACCAAAGA 57.709 42.857 0.00 0.00 0.00 2.52
1615 1631 3.832527 ACCTGCAAGTAACACCAAAGAT 58.167 40.909 0.00 0.00 0.00 2.40
1616 1632 4.980573 ACCTGCAAGTAACACCAAAGATA 58.019 39.130 0.00 0.00 0.00 1.98
1617 1633 4.760204 ACCTGCAAGTAACACCAAAGATAC 59.240 41.667 0.00 0.00 0.00 2.24
1618 1634 4.759693 CCTGCAAGTAACACCAAAGATACA 59.240 41.667 0.00 0.00 0.00 2.29
1619 1635 5.334879 CCTGCAAGTAACACCAAAGATACAC 60.335 44.000 0.00 0.00 0.00 2.90
1620 1636 4.212425 TGCAAGTAACACCAAAGATACACG 59.788 41.667 0.00 0.00 0.00 4.49
1621 1637 4.708601 CAAGTAACACCAAAGATACACGC 58.291 43.478 0.00 0.00 0.00 5.34
1622 1638 2.991190 AGTAACACCAAAGATACACGCG 59.009 45.455 3.53 3.53 0.00 6.01
1623 1639 0.515564 AACACCAAAGATACACGCGC 59.484 50.000 5.73 0.00 0.00 6.86
1624 1640 1.058748 CACCAAAGATACACGCGCG 59.941 57.895 30.96 30.96 0.00 6.86
1625 1641 1.373748 ACCAAAGATACACGCGCGT 60.374 52.632 32.73 32.73 0.00 6.01
1626 1642 0.109179 ACCAAAGATACACGCGCGTA 60.109 50.000 37.24 22.76 0.00 4.42
1627 1643 0.296642 CCAAAGATACACGCGCGTAC 59.703 55.000 37.24 24.77 0.00 3.67
1628 1644 0.045336 CAAAGATACACGCGCGTACG 60.045 55.000 37.24 26.51 44.07 3.67
1629 1645 0.179192 AAAGATACACGCGCGTACGA 60.179 50.000 37.24 23.35 43.93 3.43
1630 1646 0.179192 AAGATACACGCGCGTACGAA 60.179 50.000 37.24 20.78 43.93 3.85
1631 1647 0.179192 AGATACACGCGCGTACGAAA 60.179 50.000 37.24 18.89 43.93 3.46
1632 1648 0.045585 GATACACGCGCGTACGAAAC 60.046 55.000 37.24 19.92 43.93 2.78
1633 1649 0.454957 ATACACGCGCGTACGAAACT 60.455 50.000 37.24 13.03 43.93 2.66
1634 1650 0.164863 TACACGCGCGTACGAAACTA 59.835 50.000 37.24 12.70 43.93 2.24
1635 1651 0.660005 ACACGCGCGTACGAAACTAA 60.660 50.000 37.24 0.00 43.93 2.24
1636 1652 0.430484 CACGCGCGTACGAAACTAAA 59.570 50.000 37.24 0.00 43.93 1.85
1637 1653 0.430858 ACGCGCGTACGAAACTAAAC 59.569 50.000 37.08 0.00 43.93 2.01
1638 1654 0.246489 CGCGCGTACGAAACTAAACC 60.246 55.000 24.19 0.00 43.93 3.27
1639 1655 0.783579 GCGCGTACGAAACTAAACCA 59.216 50.000 21.65 0.00 43.93 3.67
1640 1656 1.460751 GCGCGTACGAAACTAAACCAC 60.461 52.381 21.65 0.00 43.93 4.16
1641 1657 1.786004 CGCGTACGAAACTAAACCACA 59.214 47.619 21.65 0.00 43.93 4.17
1642 1658 2.408865 CGCGTACGAAACTAAACCACAC 60.409 50.000 21.65 0.00 43.93 3.82
1643 1659 2.408865 GCGTACGAAACTAAACCACACG 60.409 50.000 21.65 0.00 0.00 4.49
1644 1660 2.408865 CGTACGAAACTAAACCACACGC 60.409 50.000 10.44 0.00 0.00 5.34
1645 1661 1.654317 ACGAAACTAAACCACACGCA 58.346 45.000 0.00 0.00 0.00 5.24
1646 1662 1.328374 ACGAAACTAAACCACACGCAC 59.672 47.619 0.00 0.00 0.00 5.34
1647 1663 1.655325 CGAAACTAAACCACACGCACG 60.655 52.381 0.00 0.00 0.00 5.34
1648 1664 0.028374 AAACTAAACCACACGCACGC 59.972 50.000 0.00 0.00 0.00 5.34
1649 1665 1.090625 AACTAAACCACACGCACGCA 61.091 50.000 0.00 0.00 0.00 5.24
1650 1666 1.090625 ACTAAACCACACGCACGCAA 61.091 50.000 0.00 0.00 0.00 4.85
1651 1667 0.028242 CTAAACCACACGCACGCAAA 59.972 50.000 0.00 0.00 0.00 3.68
1652 1668 0.450583 TAAACCACACGCACGCAAAA 59.549 45.000 0.00 0.00 0.00 2.44
1653 1669 0.800300 AAACCACACGCACGCAAAAG 60.800 50.000 0.00 0.00 0.00 2.27
1654 1670 1.649390 AACCACACGCACGCAAAAGA 61.649 50.000 0.00 0.00 0.00 2.52
1655 1671 1.282570 CCACACGCACGCAAAAGAT 59.717 52.632 0.00 0.00 0.00 2.40
1656 1672 0.317770 CCACACGCACGCAAAAGATT 60.318 50.000 0.00 0.00 0.00 2.40
1657 1673 0.771756 CACACGCACGCAAAAGATTG 59.228 50.000 0.00 0.00 39.65 2.67
1658 1674 0.317770 ACACGCACGCAAAAGATTGG 60.318 50.000 0.00 0.00 37.02 3.16
1659 1675 0.317770 CACGCACGCAAAAGATTGGT 60.318 50.000 0.00 0.00 37.02 3.67
1660 1676 0.383949 ACGCACGCAAAAGATTGGTT 59.616 45.000 0.00 0.00 37.02 3.67
1661 1677 1.202359 ACGCACGCAAAAGATTGGTTT 60.202 42.857 0.00 0.00 37.02 3.27
1662 1678 1.189884 CGCACGCAAAAGATTGGTTTG 59.810 47.619 0.00 0.00 38.69 2.93
1663 1679 2.468831 GCACGCAAAAGATTGGTTTGA 58.531 42.857 1.23 0.00 38.05 2.69
1664 1680 3.059166 GCACGCAAAAGATTGGTTTGAT 58.941 40.909 1.23 0.00 38.05 2.57
1665 1681 3.494251 GCACGCAAAAGATTGGTTTGATT 59.506 39.130 1.23 0.00 38.05 2.57
1666 1682 4.608890 GCACGCAAAAGATTGGTTTGATTG 60.609 41.667 1.23 0.00 38.05 2.67
1667 1683 3.494251 ACGCAAAAGATTGGTTTGATTGC 59.506 39.130 1.23 0.00 38.05 3.56
1668 1684 3.120580 CGCAAAAGATTGGTTTGATTGCC 60.121 43.478 0.00 0.00 38.05 4.52
1669 1685 3.814283 GCAAAAGATTGGTTTGATTGCCA 59.186 39.130 1.23 0.00 38.05 4.92
1671 1687 5.221009 GCAAAAGATTGGTTTGATTGCCAAA 60.221 36.000 0.00 0.00 46.34 3.28
1672 1688 6.432107 CAAAAGATTGGTTTGATTGCCAAAG 58.568 36.000 0.00 0.00 46.34 2.77
1673 1689 4.276058 AGATTGGTTTGATTGCCAAAGG 57.724 40.909 0.00 0.00 46.34 3.11
1674 1690 3.647590 AGATTGGTTTGATTGCCAAAGGT 59.352 39.130 0.00 0.00 46.34 3.50
1675 1691 3.922171 TTGGTTTGATTGCCAAAGGTT 57.078 38.095 0.00 0.00 44.64 3.50
1676 1692 3.467374 TGGTTTGATTGCCAAAGGTTC 57.533 42.857 0.00 0.00 44.64 3.62
1677 1693 2.223923 TGGTTTGATTGCCAAAGGTTCG 60.224 45.455 0.00 0.00 44.64 3.95
1678 1694 2.223947 GGTTTGATTGCCAAAGGTTCGT 60.224 45.455 0.00 0.00 44.64 3.85
1679 1695 3.004944 GGTTTGATTGCCAAAGGTTCGTA 59.995 43.478 0.00 0.00 44.64 3.43
1680 1696 4.321675 GGTTTGATTGCCAAAGGTTCGTAT 60.322 41.667 0.00 0.00 44.64 3.06
1681 1697 4.695217 TTGATTGCCAAAGGTTCGTATC 57.305 40.909 0.00 0.00 0.00 2.24
1682 1698 2.675844 TGATTGCCAAAGGTTCGTATCG 59.324 45.455 0.00 0.00 0.00 2.92
1683 1699 2.459060 TTGCCAAAGGTTCGTATCGA 57.541 45.000 0.00 0.00 0.00 3.59
1684 1700 2.004583 TGCCAAAGGTTCGTATCGAG 57.995 50.000 0.00 0.00 37.14 4.04
1685 1701 0.651031 GCCAAAGGTTCGTATCGAGC 59.349 55.000 0.00 0.00 37.14 5.03
1692 1708 1.557651 GTTCGTATCGAGCCTTGTCC 58.442 55.000 0.00 0.00 37.14 4.02
1693 1709 1.134560 GTTCGTATCGAGCCTTGTCCT 59.865 52.381 0.00 0.00 37.14 3.85
1694 1710 1.471119 TCGTATCGAGCCTTGTCCTT 58.529 50.000 0.00 0.00 0.00 3.36
1695 1711 2.646930 TCGTATCGAGCCTTGTCCTTA 58.353 47.619 0.00 0.00 0.00 2.69
1696 1712 2.357009 TCGTATCGAGCCTTGTCCTTAC 59.643 50.000 0.00 0.00 0.00 2.34
1697 1713 2.358267 CGTATCGAGCCTTGTCCTTACT 59.642 50.000 0.00 0.00 0.00 2.24
1698 1714 3.181489 CGTATCGAGCCTTGTCCTTACTT 60.181 47.826 0.00 0.00 0.00 2.24
1699 1715 3.983044 ATCGAGCCTTGTCCTTACTTT 57.017 42.857 0.00 0.00 0.00 2.66
1700 1716 5.449588 CGTATCGAGCCTTGTCCTTACTTTA 60.450 44.000 0.00 0.00 0.00 1.85
1701 1717 5.615925 ATCGAGCCTTGTCCTTACTTTAT 57.384 39.130 0.00 0.00 0.00 1.40
1702 1718 5.416271 TCGAGCCTTGTCCTTACTTTATT 57.584 39.130 0.00 0.00 0.00 1.40
1703 1719 5.175859 TCGAGCCTTGTCCTTACTTTATTG 58.824 41.667 0.00 0.00 0.00 1.90
1704 1720 4.201822 CGAGCCTTGTCCTTACTTTATTGC 60.202 45.833 0.00 0.00 0.00 3.56
1705 1721 4.923415 AGCCTTGTCCTTACTTTATTGCT 58.077 39.130 0.00 0.00 0.00 3.91
1706 1722 5.325239 AGCCTTGTCCTTACTTTATTGCTT 58.675 37.500 0.00 0.00 0.00 3.91
1707 1723 5.183904 AGCCTTGTCCTTACTTTATTGCTTG 59.816 40.000 0.00 0.00 0.00 4.01
1708 1724 5.048013 GCCTTGTCCTTACTTTATTGCTTGT 60.048 40.000 0.00 0.00 0.00 3.16
1709 1725 6.516693 GCCTTGTCCTTACTTTATTGCTTGTT 60.517 38.462 0.00 0.00 0.00 2.83
1710 1726 7.308951 GCCTTGTCCTTACTTTATTGCTTGTTA 60.309 37.037 0.00 0.00 0.00 2.41
1711 1727 8.573035 CCTTGTCCTTACTTTATTGCTTGTTAA 58.427 33.333 0.00 0.00 0.00 2.01
1712 1728 9.394477 CTTGTCCTTACTTTATTGCTTGTTAAC 57.606 33.333 0.00 0.00 0.00 2.01
1713 1729 7.577979 TGTCCTTACTTTATTGCTTGTTAACG 58.422 34.615 0.26 0.00 0.00 3.18
1714 1730 7.019418 GTCCTTACTTTATTGCTTGTTAACGG 58.981 38.462 0.26 0.00 0.00 4.44
1715 1731 6.711645 TCCTTACTTTATTGCTTGTTAACGGT 59.288 34.615 0.26 0.00 0.00 4.83
1716 1732 7.877097 TCCTTACTTTATTGCTTGTTAACGGTA 59.123 33.333 0.26 0.00 0.00 4.02
1717 1733 7.959109 CCTTACTTTATTGCTTGTTAACGGTAC 59.041 37.037 0.26 0.00 0.00 3.34
1718 1734 6.864360 ACTTTATTGCTTGTTAACGGTACA 57.136 33.333 0.26 0.00 0.00 2.90
1719 1735 7.443259 ACTTTATTGCTTGTTAACGGTACAT 57.557 32.000 0.26 0.00 0.00 2.29
1720 1736 7.524065 ACTTTATTGCTTGTTAACGGTACATC 58.476 34.615 0.26 0.00 0.00 3.06
1721 1737 7.389607 ACTTTATTGCTTGTTAACGGTACATCT 59.610 33.333 0.26 0.00 0.00 2.90
1722 1738 7.675962 TTATTGCTTGTTAACGGTACATCTT 57.324 32.000 0.26 0.00 0.00 2.40
1723 1739 8.774890 TTATTGCTTGTTAACGGTACATCTTA 57.225 30.769 0.26 0.00 0.00 2.10
1724 1740 6.470557 TTGCTTGTTAACGGTACATCTTAC 57.529 37.500 0.26 0.00 0.00 2.34
1725 1741 5.539979 TGCTTGTTAACGGTACATCTTACA 58.460 37.500 0.26 0.00 0.00 2.41
1726 1742 5.990386 TGCTTGTTAACGGTACATCTTACAA 59.010 36.000 0.26 0.00 0.00 2.41
1727 1743 6.146510 TGCTTGTTAACGGTACATCTTACAAG 59.853 38.462 13.63 13.63 42.35 3.16
1728 1744 6.146673 GCTTGTTAACGGTACATCTTACAAGT 59.853 38.462 17.35 0.00 41.80 3.16
1729 1745 7.410800 TTGTTAACGGTACATCTTACAAGTG 57.589 36.000 0.26 0.00 0.00 3.16
1730 1746 5.927689 TGTTAACGGTACATCTTACAAGTGG 59.072 40.000 0.26 0.00 0.00 4.00
1731 1747 3.604875 ACGGTACATCTTACAAGTGGG 57.395 47.619 0.00 0.00 0.00 4.61
1732 1748 2.235402 ACGGTACATCTTACAAGTGGGG 59.765 50.000 0.00 0.00 0.00 4.96
1733 1749 2.235402 CGGTACATCTTACAAGTGGGGT 59.765 50.000 0.00 0.00 0.00 4.95
1734 1750 3.307199 CGGTACATCTTACAAGTGGGGTT 60.307 47.826 0.00 0.00 0.00 4.11
1735 1751 4.659115 GGTACATCTTACAAGTGGGGTTT 58.341 43.478 0.00 0.00 0.00 3.27
1736 1752 5.569227 CGGTACATCTTACAAGTGGGGTTTA 60.569 44.000 0.00 0.00 0.00 2.01
1737 1753 5.645067 GGTACATCTTACAAGTGGGGTTTAC 59.355 44.000 0.00 0.00 0.00 2.01
1738 1754 5.313280 ACATCTTACAAGTGGGGTTTACA 57.687 39.130 0.00 0.00 0.00 2.41
1739 1755 5.313712 ACATCTTACAAGTGGGGTTTACAG 58.686 41.667 0.00 0.00 0.00 2.74
1740 1756 5.072600 ACATCTTACAAGTGGGGTTTACAGA 59.927 40.000 0.00 0.00 0.00 3.41
1741 1757 4.964593 TCTTACAAGTGGGGTTTACAGAC 58.035 43.478 0.00 0.00 0.00 3.51
1742 1758 2.249844 ACAAGTGGGGTTTACAGACG 57.750 50.000 0.00 0.00 0.00 4.18
1743 1759 1.487558 ACAAGTGGGGTTTACAGACGT 59.512 47.619 0.00 0.00 0.00 4.34
1744 1760 2.699846 ACAAGTGGGGTTTACAGACGTA 59.300 45.455 0.00 0.00 0.00 3.57
1745 1761 3.325716 ACAAGTGGGGTTTACAGACGTAT 59.674 43.478 0.00 0.00 0.00 3.06
1746 1762 4.527816 ACAAGTGGGGTTTACAGACGTATA 59.472 41.667 0.00 0.00 0.00 1.47
1747 1763 5.011943 ACAAGTGGGGTTTACAGACGTATAA 59.988 40.000 0.00 0.00 0.00 0.98
1748 1764 5.743636 AGTGGGGTTTACAGACGTATAAA 57.256 39.130 0.00 0.00 0.00 1.40
1749 1765 6.303903 AGTGGGGTTTACAGACGTATAAAT 57.696 37.500 0.00 0.00 0.00 1.40
1750 1766 7.422465 AGTGGGGTTTACAGACGTATAAATA 57.578 36.000 0.00 0.00 0.00 1.40
1751 1767 7.495055 AGTGGGGTTTACAGACGTATAAATAG 58.505 38.462 0.00 0.00 0.00 1.73
1752 1768 6.201615 GTGGGGTTTACAGACGTATAAATAGC 59.798 42.308 0.00 0.00 0.00 2.97
1753 1769 6.127111 TGGGGTTTACAGACGTATAAATAGCA 60.127 38.462 0.00 0.00 0.00 3.49
1754 1770 6.423001 GGGGTTTACAGACGTATAAATAGCAG 59.577 42.308 0.00 0.00 0.00 4.24
1755 1771 6.073927 GGGTTTACAGACGTATAAATAGCAGC 60.074 42.308 0.00 0.00 0.00 5.25
1756 1772 6.700520 GGTTTACAGACGTATAAATAGCAGCT 59.299 38.462 0.00 0.00 0.00 4.24
1757 1773 7.864379 GGTTTACAGACGTATAAATAGCAGCTA 59.136 37.037 4.10 4.10 0.00 3.32
1758 1774 8.903723 GTTTACAGACGTATAAATAGCAGCTAG 58.096 37.037 8.43 0.00 0.00 3.42
1759 1775 6.015027 ACAGACGTATAAATAGCAGCTAGG 57.985 41.667 8.43 0.00 0.00 3.02
1760 1776 4.859798 CAGACGTATAAATAGCAGCTAGGC 59.140 45.833 8.43 0.00 0.00 3.93
1772 1788 1.799933 AGCTAGGCTGCCTGATTACT 58.200 50.000 30.83 16.51 37.57 2.24
1773 1789 2.122768 AGCTAGGCTGCCTGATTACTT 58.877 47.619 30.83 4.64 37.57 2.24
1774 1790 2.158842 AGCTAGGCTGCCTGATTACTTG 60.159 50.000 30.83 10.94 37.57 3.16
1775 1791 2.158900 GCTAGGCTGCCTGATTACTTGA 60.159 50.000 30.83 6.65 34.61 3.02
1776 1792 2.409948 AGGCTGCCTGATTACTTGAC 57.590 50.000 22.71 0.00 29.57 3.18
1777 1793 1.009829 GGCTGCCTGATTACTTGACG 58.990 55.000 12.43 0.00 0.00 4.35
1778 1794 1.009829 GCTGCCTGATTACTTGACGG 58.990 55.000 0.00 0.00 0.00 4.79
1779 1795 1.405526 GCTGCCTGATTACTTGACGGA 60.406 52.381 0.00 0.00 0.00 4.69
1780 1796 2.935238 GCTGCCTGATTACTTGACGGAA 60.935 50.000 0.00 0.00 0.00 4.30
1781 1797 3.535561 CTGCCTGATTACTTGACGGAAT 58.464 45.455 0.00 0.00 0.00 3.01
1782 1798 3.531538 TGCCTGATTACTTGACGGAATC 58.468 45.455 0.00 0.00 0.00 2.52
1783 1799 3.055458 TGCCTGATTACTTGACGGAATCA 60.055 43.478 0.00 0.00 37.27 2.57
1787 1803 6.814076 CTGATTACTTGACGGAATCAGTAC 57.186 41.667 13.99 0.00 46.01 2.73
1788 1804 6.275494 TGATTACTTGACGGAATCAGTACA 57.725 37.500 0.00 0.00 38.99 2.90
1789 1805 6.330278 TGATTACTTGACGGAATCAGTACAG 58.670 40.000 0.00 0.00 38.99 2.74
1790 1806 5.970317 TTACTTGACGGAATCAGTACAGA 57.030 39.130 0.00 0.00 38.99 3.41
1791 1807 4.866508 ACTTGACGGAATCAGTACAGAA 57.133 40.909 0.00 0.00 38.99 3.02
1792 1808 4.810790 ACTTGACGGAATCAGTACAGAAG 58.189 43.478 0.00 0.00 38.99 2.85
1793 1809 4.523173 ACTTGACGGAATCAGTACAGAAGA 59.477 41.667 0.00 0.00 38.99 2.87
1794 1810 4.436242 TGACGGAATCAGTACAGAAGAC 57.564 45.455 0.00 0.00 31.91 3.01
1795 1811 4.079970 TGACGGAATCAGTACAGAAGACT 58.920 43.478 0.00 0.00 31.91 3.24
1796 1812 5.250982 TGACGGAATCAGTACAGAAGACTA 58.749 41.667 0.00 0.00 31.91 2.59
1797 1813 5.708697 TGACGGAATCAGTACAGAAGACTAA 59.291 40.000 0.00 0.00 31.91 2.24
1798 1814 6.377429 TGACGGAATCAGTACAGAAGACTAAT 59.623 38.462 0.00 0.00 31.91 1.73
1799 1815 6.797454 ACGGAATCAGTACAGAAGACTAATC 58.203 40.000 0.00 0.00 0.00 1.75
1800 1816 6.183360 ACGGAATCAGTACAGAAGACTAATCC 60.183 42.308 0.00 0.00 0.00 3.01
1801 1817 6.039941 CGGAATCAGTACAGAAGACTAATCCT 59.960 42.308 0.00 0.00 0.00 3.24
1802 1818 7.228906 CGGAATCAGTACAGAAGACTAATCCTA 59.771 40.741 0.00 0.00 0.00 2.94
1803 1819 8.354426 GGAATCAGTACAGAAGACTAATCCTAC 58.646 40.741 0.00 0.00 0.00 3.18
1804 1820 8.824756 AATCAGTACAGAAGACTAATCCTACA 57.175 34.615 0.00 0.00 0.00 2.74
1805 1821 7.627298 TCAGTACAGAAGACTAATCCTACAC 57.373 40.000 0.00 0.00 0.00 2.90
1806 1822 6.315642 TCAGTACAGAAGACTAATCCTACACG 59.684 42.308 0.00 0.00 0.00 4.49
1807 1823 4.985538 ACAGAAGACTAATCCTACACGG 57.014 45.455 0.00 0.00 0.00 4.94
1808 1824 4.342359 ACAGAAGACTAATCCTACACGGT 58.658 43.478 0.00 0.00 0.00 4.83
1809 1825 5.503927 ACAGAAGACTAATCCTACACGGTA 58.496 41.667 0.00 0.00 0.00 4.02
1810 1826 5.948162 ACAGAAGACTAATCCTACACGGTAA 59.052 40.000 0.00 0.00 0.00 2.85
1811 1827 6.127786 ACAGAAGACTAATCCTACACGGTAAC 60.128 42.308 0.00 0.00 0.00 2.50
1812 1828 6.095160 CAGAAGACTAATCCTACACGGTAACT 59.905 42.308 0.00 0.00 0.00 2.24
1813 1829 7.281774 CAGAAGACTAATCCTACACGGTAACTA 59.718 40.741 0.00 0.00 0.00 2.24
1814 1830 7.831193 AGAAGACTAATCCTACACGGTAACTAA 59.169 37.037 0.00 0.00 0.00 2.24
1815 1831 8.530804 AAGACTAATCCTACACGGTAACTAAT 57.469 34.615 0.00 0.00 0.00 1.73
1816 1832 8.530804 AGACTAATCCTACACGGTAACTAATT 57.469 34.615 0.00 0.00 0.00 1.40
1817 1833 8.411683 AGACTAATCCTACACGGTAACTAATTG 58.588 37.037 0.00 0.00 0.00 2.32
1818 1834 7.495055 ACTAATCCTACACGGTAACTAATTGG 58.505 38.462 0.00 0.00 0.00 3.16
1819 1835 6.549433 AATCCTACACGGTAACTAATTGGA 57.451 37.500 0.00 0.00 0.00 3.53
1820 1836 6.742559 ATCCTACACGGTAACTAATTGGAT 57.257 37.500 0.00 0.00 0.00 3.41
1821 1837 7.844493 ATCCTACACGGTAACTAATTGGATA 57.156 36.000 0.00 0.00 31.57 2.59
1822 1838 7.042797 TCCTACACGGTAACTAATTGGATAC 57.957 40.000 0.00 0.00 0.00 2.24
1823 1839 6.040842 TCCTACACGGTAACTAATTGGATACC 59.959 42.308 15.67 15.67 35.51 2.73
1824 1840 5.945144 ACACGGTAACTAATTGGATACCT 57.055 39.130 20.90 9.41 36.48 3.08
1825 1841 7.231317 CCTACACGGTAACTAATTGGATACCTA 59.769 40.741 20.90 9.78 36.48 3.08
1826 1842 7.607615 ACACGGTAACTAATTGGATACCTAT 57.392 36.000 20.90 10.09 36.48 2.57
1827 1843 8.710749 ACACGGTAACTAATTGGATACCTATA 57.289 34.615 20.90 0.00 36.48 1.31
1828 1844 8.579863 ACACGGTAACTAATTGGATACCTATAC 58.420 37.037 20.90 1.18 36.48 1.47
1829 1845 7.752239 CACGGTAACTAATTGGATACCTATACG 59.248 40.741 20.90 12.42 36.48 3.06
1830 1846 7.448469 ACGGTAACTAATTGGATACCTATACGT 59.552 37.037 20.90 12.91 36.48 3.57
1831 1847 8.946085 CGGTAACTAATTGGATACCTATACGTA 58.054 37.037 20.90 0.00 36.48 3.57
1833 1849 9.760660 GTAACTAATTGGATACCTATACGTACG 57.239 37.037 15.01 15.01 0.00 3.67
1834 1850 7.986085 ACTAATTGGATACCTATACGTACGT 57.014 36.000 25.98 25.98 0.00 3.57
1835 1851 7.810658 ACTAATTGGATACCTATACGTACGTG 58.189 38.462 30.25 16.00 0.00 4.49
1836 1852 6.639632 AATTGGATACCTATACGTACGTGT 57.360 37.500 30.25 25.72 0.00 4.49
1837 1853 7.744087 AATTGGATACCTATACGTACGTGTA 57.256 36.000 30.25 25.44 0.00 2.90
1838 1854 7.744087 ATTGGATACCTATACGTACGTGTAA 57.256 36.000 30.25 13.66 0.00 2.41
1839 1855 7.744087 TTGGATACCTATACGTACGTGTAAT 57.256 36.000 30.25 18.13 0.00 1.89
1840 1856 7.364522 TGGATACCTATACGTACGTGTAATC 57.635 40.000 30.25 23.49 0.00 1.75
1841 1857 6.371548 TGGATACCTATACGTACGTGTAATCC 59.628 42.308 29.15 29.15 32.27 3.01
1842 1858 4.732285 ACCTATACGTACGTGTAATCCG 57.268 45.455 30.25 15.16 0.00 4.18
1843 1859 4.377021 ACCTATACGTACGTGTAATCCGA 58.623 43.478 30.25 8.49 0.00 4.55
1844 1860 4.997395 ACCTATACGTACGTGTAATCCGAT 59.003 41.667 30.25 15.26 0.00 4.18
1845 1861 5.120830 ACCTATACGTACGTGTAATCCGATC 59.879 44.000 30.25 0.00 0.00 3.69
1846 1862 2.763249 ACGTACGTGTAATCCGATCC 57.237 50.000 22.14 0.00 0.00 3.36
1847 1863 2.292267 ACGTACGTGTAATCCGATCCT 58.708 47.619 22.14 0.00 0.00 3.24
1848 1864 2.032550 ACGTACGTGTAATCCGATCCTG 59.967 50.000 22.14 0.00 0.00 3.86
1849 1865 2.288729 CGTACGTGTAATCCGATCCTGA 59.711 50.000 7.22 0.00 0.00 3.86
1850 1866 2.865343 ACGTGTAATCCGATCCTGAC 57.135 50.000 0.00 0.00 0.00 3.51
1851 1867 1.065102 ACGTGTAATCCGATCCTGACG 59.935 52.381 0.00 0.00 0.00 4.35
1852 1868 1.065102 CGTGTAATCCGATCCTGACGT 59.935 52.381 0.00 0.00 0.00 4.34
1853 1869 2.479049 CGTGTAATCCGATCCTGACGTT 60.479 50.000 0.00 0.00 0.00 3.99
1854 1870 2.858344 GTGTAATCCGATCCTGACGTTG 59.142 50.000 0.00 0.00 0.00 4.10
1855 1871 2.159156 TGTAATCCGATCCTGACGTTGG 60.159 50.000 0.00 0.00 0.00 3.77
1856 1872 0.178068 AATCCGATCCTGACGTTGGG 59.822 55.000 8.38 5.25 0.00 4.12
1857 1873 0.976073 ATCCGATCCTGACGTTGGGT 60.976 55.000 8.38 1.64 0.00 4.51
1858 1874 1.189524 TCCGATCCTGACGTTGGGTT 61.190 55.000 8.38 0.78 0.00 4.11
1859 1875 0.321298 CCGATCCTGACGTTGGGTTT 60.321 55.000 8.38 0.00 0.00 3.27
1860 1876 1.066716 CCGATCCTGACGTTGGGTTTA 60.067 52.381 8.38 0.00 0.00 2.01
1861 1877 1.997606 CGATCCTGACGTTGGGTTTAC 59.002 52.381 8.38 0.00 0.00 2.01
1862 1878 2.353406 CGATCCTGACGTTGGGTTTACT 60.353 50.000 8.38 0.00 0.00 2.24
1863 1879 3.671716 GATCCTGACGTTGGGTTTACTT 58.328 45.455 8.38 0.00 0.00 2.24
1864 1880 3.564053 TCCTGACGTTGGGTTTACTTT 57.436 42.857 8.38 0.00 0.00 2.66
1865 1881 3.469739 TCCTGACGTTGGGTTTACTTTC 58.530 45.455 8.38 0.00 0.00 2.62
1866 1882 3.118334 TCCTGACGTTGGGTTTACTTTCA 60.118 43.478 8.38 0.00 0.00 2.69
1867 1883 3.628487 CCTGACGTTGGGTTTACTTTCAA 59.372 43.478 0.00 0.00 0.00 2.69
1868 1884 4.496840 CCTGACGTTGGGTTTACTTTCAAC 60.497 45.833 0.00 0.00 36.93 3.18
1869 1885 4.008330 TGACGTTGGGTTTACTTTCAACA 58.992 39.130 0.00 0.00 39.33 3.33
1870 1886 4.142643 TGACGTTGGGTTTACTTTCAACAC 60.143 41.667 0.00 0.00 39.33 3.32
1871 1887 3.757493 ACGTTGGGTTTACTTTCAACACA 59.243 39.130 0.00 0.00 39.33 3.72
1872 1888 4.142556 ACGTTGGGTTTACTTTCAACACAG 60.143 41.667 0.00 0.00 38.76 3.66
1873 1889 4.109766 GTTGGGTTTACTTTCAACACAGC 58.890 43.478 0.00 0.00 38.76 4.40
1874 1890 3.626930 TGGGTTTACTTTCAACACAGCT 58.373 40.909 0.00 0.00 32.43 4.24
1875 1891 3.630312 TGGGTTTACTTTCAACACAGCTC 59.370 43.478 0.00 0.00 32.43 4.09
1876 1892 3.630312 GGGTTTACTTTCAACACAGCTCA 59.370 43.478 0.00 0.00 0.00 4.26
1877 1893 4.497507 GGGTTTACTTTCAACACAGCTCAC 60.498 45.833 0.00 0.00 0.00 3.51
1878 1894 4.497507 GGTTTACTTTCAACACAGCTCACC 60.498 45.833 0.00 0.00 0.00 4.02
1879 1895 2.717639 ACTTTCAACACAGCTCACCT 57.282 45.000 0.00 0.00 0.00 4.00
1880 1896 2.565841 ACTTTCAACACAGCTCACCTC 58.434 47.619 0.00 0.00 0.00 3.85
1881 1897 1.876156 CTTTCAACACAGCTCACCTCC 59.124 52.381 0.00 0.00 0.00 4.30
1882 1898 0.108585 TTCAACACAGCTCACCTCCC 59.891 55.000 0.00 0.00 0.00 4.30
1883 1899 1.053835 TCAACACAGCTCACCTCCCA 61.054 55.000 0.00 0.00 0.00 4.37
1884 1900 0.179020 CAACACAGCTCACCTCCCAA 60.179 55.000 0.00 0.00 0.00 4.12
1885 1901 0.550914 AACACAGCTCACCTCCCAAA 59.449 50.000 0.00 0.00 0.00 3.28
1886 1902 0.773644 ACACAGCTCACCTCCCAAAT 59.226 50.000 0.00 0.00 0.00 2.32
1887 1903 1.145738 ACACAGCTCACCTCCCAAATT 59.854 47.619 0.00 0.00 0.00 1.82
1888 1904 1.815003 CACAGCTCACCTCCCAAATTC 59.185 52.381 0.00 0.00 0.00 2.17
1889 1905 1.272147 ACAGCTCACCTCCCAAATTCC 60.272 52.381 0.00 0.00 0.00 3.01
1890 1906 1.005215 CAGCTCACCTCCCAAATTCCT 59.995 52.381 0.00 0.00 0.00 3.36
1891 1907 1.283321 AGCTCACCTCCCAAATTCCTC 59.717 52.381 0.00 0.00 0.00 3.71
1892 1908 1.283321 GCTCACCTCCCAAATTCCTCT 59.717 52.381 0.00 0.00 0.00 3.69
1976 1993 0.530288 GCGCAAAAATTAGGCCTGGA 59.470 50.000 17.99 3.92 0.00 3.86
1995 2012 4.329545 GCGAGTTGGTCCCCAGCA 62.330 66.667 0.00 0.00 37.20 4.41
2057 2076 0.942252 AAGTTTGGCGAAGTTCGTCC 59.058 50.000 25.77 24.41 45.07 4.79
2106 2125 4.093703 ACGATAAATTTCGGCACATTTCGA 59.906 37.500 4.68 0.00 43.33 3.71
2226 2245 1.878656 CTTCTCCTCCTTGACGCGGT 61.879 60.000 12.47 0.00 0.00 5.68
2298 2320 2.162921 ATTGTCGTCGTCGTCGTCGT 62.163 55.000 18.44 0.15 45.27 4.34
2303 2325 1.368019 GTCGTCGTCGTCGTTGTCA 60.368 57.895 11.41 0.00 38.33 3.58
3031 3058 2.733593 GCGCACGACCTCGACTTT 60.734 61.111 0.30 0.00 43.02 2.66
3044 3071 1.741706 TCGACTTTCTCGGCGAAGTAT 59.258 47.619 12.13 0.00 43.16 2.12
3080 3107 0.743345 CGTCGGGAAACAGGGGAATC 60.743 60.000 0.00 0.00 0.00 2.52
3547 3576 1.141019 GAAGATGAGGCGCCGTGTA 59.859 57.895 23.20 9.23 0.00 2.90
3687 3718 1.506028 AAAAATCGGGCTCCTGGGGA 61.506 55.000 0.00 0.00 0.00 4.81
3773 3804 0.839946 GGCTGGAGATGCCCTAAGAA 59.160 55.000 0.00 0.00 44.32 2.52
3774 3805 1.202746 GGCTGGAGATGCCCTAAGAAG 60.203 57.143 0.00 0.00 44.32 2.85
3775 3806 1.813477 GCTGGAGATGCCCTAAGAAGC 60.813 57.143 0.00 0.00 34.97 3.86
3776 3807 1.487976 CTGGAGATGCCCTAAGAAGCA 59.512 52.381 0.00 0.00 44.45 3.91
3777 3808 1.915489 TGGAGATGCCCTAAGAAGCAA 59.085 47.619 0.00 0.00 43.36 3.91
3778 3809 2.293170 GGAGATGCCCTAAGAAGCAAC 58.707 52.381 0.00 0.00 43.36 4.17
3779 3810 2.092699 GGAGATGCCCTAAGAAGCAACT 60.093 50.000 0.00 0.00 43.81 3.16
3780 3811 3.134804 GGAGATGCCCTAAGAAGCAACTA 59.865 47.826 0.00 0.00 41.55 2.24
3781 3812 4.384208 GGAGATGCCCTAAGAAGCAACTAA 60.384 45.833 0.00 0.00 41.55 2.24
3782 3813 5.372373 GAGATGCCCTAAGAAGCAACTAAT 58.628 41.667 0.00 0.00 41.55 1.73
3783 3814 5.372373 AGATGCCCTAAGAAGCAACTAATC 58.628 41.667 0.00 0.00 43.36 1.75
3784 3815 4.844349 TGCCCTAAGAAGCAACTAATCT 57.156 40.909 0.00 0.00 35.69 2.40
3785 3816 5.179452 TGCCCTAAGAAGCAACTAATCTT 57.821 39.130 0.00 0.00 35.69 2.40
3786 3817 5.186198 TGCCCTAAGAAGCAACTAATCTTC 58.814 41.667 0.00 0.00 39.08 2.87
3787 3818 5.186198 GCCCTAAGAAGCAACTAATCTTCA 58.814 41.667 5.02 0.00 40.72 3.02
3788 3819 5.648092 GCCCTAAGAAGCAACTAATCTTCAA 59.352 40.000 5.02 0.00 40.72 2.69
3789 3820 6.183360 GCCCTAAGAAGCAACTAATCTTCAAG 60.183 42.308 5.02 2.42 40.72 3.02
3790 3821 7.106239 CCCTAAGAAGCAACTAATCTTCAAGA 58.894 38.462 0.00 0.00 40.72 3.02
3791 3822 7.279758 CCCTAAGAAGCAACTAATCTTCAAGAG 59.720 40.741 0.00 0.00 40.72 2.85
3792 3823 8.037758 CCTAAGAAGCAACTAATCTTCAAGAGA 58.962 37.037 0.00 0.00 40.72 3.10
3793 3824 7.903995 AAGAAGCAACTAATCTTCAAGAGAG 57.096 36.000 0.00 0.00 40.72 3.20
3794 3825 7.003402 AGAAGCAACTAATCTTCAAGAGAGT 57.997 36.000 0.00 0.00 40.72 3.24
3795 3826 7.449247 AGAAGCAACTAATCTTCAAGAGAGTT 58.551 34.615 10.45 10.45 40.72 3.01
3796 3827 7.936301 AGAAGCAACTAATCTTCAAGAGAGTTT 59.064 33.333 12.75 2.39 40.72 2.66
3797 3828 7.432350 AGCAACTAATCTTCAAGAGAGTTTG 57.568 36.000 12.75 10.32 37.93 2.93
3798 3829 6.429385 AGCAACTAATCTTCAAGAGAGTTTGG 59.571 38.462 12.75 6.43 37.93 3.28
3799 3830 6.606768 CAACTAATCTTCAAGAGAGTTTGGC 58.393 40.000 12.75 0.00 37.93 4.52
3800 3831 6.120507 ACTAATCTTCAAGAGAGTTTGGCT 57.879 37.500 0.00 0.00 37.93 4.75
3801 3832 6.538263 ACTAATCTTCAAGAGAGTTTGGCTT 58.462 36.000 0.00 0.00 37.93 4.35
3802 3833 5.956068 AATCTTCAAGAGAGTTTGGCTTC 57.044 39.130 0.00 0.00 37.93 3.86
3803 3834 4.696479 TCTTCAAGAGAGTTTGGCTTCT 57.304 40.909 0.00 0.00 0.00 2.85
3804 3835 5.041191 TCTTCAAGAGAGTTTGGCTTCTT 57.959 39.130 0.00 0.00 0.00 2.52
3805 3836 5.440610 TCTTCAAGAGAGTTTGGCTTCTTT 58.559 37.500 0.00 0.00 0.00 2.52
3806 3837 5.529060 TCTTCAAGAGAGTTTGGCTTCTTTC 59.471 40.000 0.00 0.00 0.00 2.62
3807 3838 5.041191 TCAAGAGAGTTTGGCTTCTTTCT 57.959 39.130 0.00 0.00 0.00 2.52
3808 3839 5.059833 TCAAGAGAGTTTGGCTTCTTTCTC 58.940 41.667 0.00 0.00 33.10 2.87
3809 3840 4.972751 AGAGAGTTTGGCTTCTTTCTCT 57.027 40.909 0.00 0.00 37.24 3.10
3810 3841 4.893608 AGAGAGTTTGGCTTCTTTCTCTC 58.106 43.478 10.72 10.72 44.42 3.20
3811 3842 4.346418 AGAGAGTTTGGCTTCTTTCTCTCA 59.654 41.667 17.96 0.00 45.64 3.27
3812 3843 5.012975 AGAGAGTTTGGCTTCTTTCTCTCAT 59.987 40.000 17.96 5.10 45.64 2.90
3813 3844 5.629125 AGAGTTTGGCTTCTTTCTCTCATT 58.371 37.500 0.00 0.00 0.00 2.57
3814 3845 5.704978 AGAGTTTGGCTTCTTTCTCTCATTC 59.295 40.000 0.00 0.00 0.00 2.67
3815 3846 5.380043 AGTTTGGCTTCTTTCTCTCATTCA 58.620 37.500 0.00 0.00 0.00 2.57
3816 3847 6.008960 AGTTTGGCTTCTTTCTCTCATTCAT 58.991 36.000 0.00 0.00 0.00 2.57
3817 3848 6.150809 AGTTTGGCTTCTTTCTCTCATTCATC 59.849 38.462 0.00 0.00 0.00 2.92
3818 3849 5.169992 TGGCTTCTTTCTCTCATTCATCA 57.830 39.130 0.00 0.00 0.00 3.07
3819 3850 5.563592 TGGCTTCTTTCTCTCATTCATCAA 58.436 37.500 0.00 0.00 0.00 2.57
3820 3851 6.005823 TGGCTTCTTTCTCTCATTCATCAAA 58.994 36.000 0.00 0.00 0.00 2.69
3821 3852 6.491062 TGGCTTCTTTCTCTCATTCATCAAAA 59.509 34.615 0.00 0.00 0.00 2.44
3822 3853 7.177921 TGGCTTCTTTCTCTCATTCATCAAAAT 59.822 33.333 0.00 0.00 0.00 1.82
3823 3854 7.701501 GGCTTCTTTCTCTCATTCATCAAAATC 59.298 37.037 0.00 0.00 0.00 2.17
3824 3855 7.701501 GCTTCTTTCTCTCATTCATCAAAATCC 59.298 37.037 0.00 0.00 0.00 3.01
3825 3856 7.312657 TCTTTCTCTCATTCATCAAAATCCG 57.687 36.000 0.00 0.00 0.00 4.18
3826 3857 5.490139 TTCTCTCATTCATCAAAATCCGC 57.510 39.130 0.00 0.00 0.00 5.54
3827 3858 4.516323 TCTCTCATTCATCAAAATCCGCA 58.484 39.130 0.00 0.00 0.00 5.69
3828 3859 4.943093 TCTCTCATTCATCAAAATCCGCAA 59.057 37.500 0.00 0.00 0.00 4.85
3829 3860 4.985413 TCTCATTCATCAAAATCCGCAAC 58.015 39.130 0.00 0.00 0.00 4.17
3830 3861 4.458642 TCTCATTCATCAAAATCCGCAACA 59.541 37.500 0.00 0.00 0.00 3.33
3831 3862 5.048154 TCTCATTCATCAAAATCCGCAACAA 60.048 36.000 0.00 0.00 0.00 2.83
3832 3863 5.536260 TCATTCATCAAAATCCGCAACAAA 58.464 33.333 0.00 0.00 0.00 2.83
3833 3864 5.404968 TCATTCATCAAAATCCGCAACAAAC 59.595 36.000 0.00 0.00 0.00 2.93
3834 3865 3.648009 TCATCAAAATCCGCAACAAACC 58.352 40.909 0.00 0.00 0.00 3.27
3835 3866 3.068732 TCATCAAAATCCGCAACAAACCA 59.931 39.130 0.00 0.00 0.00 3.67
3836 3867 3.526931 TCAAAATCCGCAACAAACCAA 57.473 38.095 0.00 0.00 0.00 3.67
3837 3868 4.065321 TCAAAATCCGCAACAAACCAAT 57.935 36.364 0.00 0.00 0.00 3.16
3838 3869 5.201713 TCAAAATCCGCAACAAACCAATA 57.798 34.783 0.00 0.00 0.00 1.90
3839 3870 5.601662 TCAAAATCCGCAACAAACCAATAA 58.398 33.333 0.00 0.00 0.00 1.40
3840 3871 5.463724 TCAAAATCCGCAACAAACCAATAAC 59.536 36.000 0.00 0.00 0.00 1.89
3841 3872 4.864704 AATCCGCAACAAACCAATAACT 57.135 36.364 0.00 0.00 0.00 2.24
3842 3873 5.968528 AATCCGCAACAAACCAATAACTA 57.031 34.783 0.00 0.00 0.00 2.24
3843 3874 5.968528 ATCCGCAACAAACCAATAACTAA 57.031 34.783 0.00 0.00 0.00 2.24
3844 3875 5.110940 TCCGCAACAAACCAATAACTAAC 57.889 39.130 0.00 0.00 0.00 2.34
3845 3876 4.023021 TCCGCAACAAACCAATAACTAACC 60.023 41.667 0.00 0.00 0.00 2.85
3846 3877 4.261656 CCGCAACAAACCAATAACTAACCA 60.262 41.667 0.00 0.00 0.00 3.67
3847 3878 4.677832 CGCAACAAACCAATAACTAACCAC 59.322 41.667 0.00 0.00 0.00 4.16
3848 3879 5.506649 CGCAACAAACCAATAACTAACCACT 60.507 40.000 0.00 0.00 0.00 4.00
3849 3880 5.689961 GCAACAAACCAATAACTAACCACTG 59.310 40.000 0.00 0.00 0.00 3.66
3850 3881 6.212955 CAACAAACCAATAACTAACCACTGG 58.787 40.000 0.00 0.00 0.00 4.00
3851 3882 5.697067 ACAAACCAATAACTAACCACTGGA 58.303 37.500 0.71 0.00 0.00 3.86
3852 3883 6.130569 ACAAACCAATAACTAACCACTGGAA 58.869 36.000 0.71 0.00 0.00 3.53
3853 3884 6.780522 ACAAACCAATAACTAACCACTGGAAT 59.219 34.615 0.71 0.00 0.00 3.01
3854 3885 7.289084 ACAAACCAATAACTAACCACTGGAATT 59.711 33.333 0.71 0.00 0.00 2.17
3855 3886 8.798402 CAAACCAATAACTAACCACTGGAATTA 58.202 33.333 0.71 0.00 0.00 1.40
3856 3887 9.541884 AAACCAATAACTAACCACTGGAATTAT 57.458 29.630 0.71 0.00 0.00 1.28
3857 3888 8.519799 ACCAATAACTAACCACTGGAATTATG 57.480 34.615 0.71 0.00 0.00 1.90
3858 3889 7.068226 ACCAATAACTAACCACTGGAATTATGC 59.932 37.037 0.71 0.00 0.00 3.14
3859 3890 6.861065 ATAACTAACCACTGGAATTATGCG 57.139 37.500 0.71 0.00 0.00 4.73
3860 3891 4.481368 ACTAACCACTGGAATTATGCGA 57.519 40.909 0.71 0.00 0.00 5.10
3861 3892 4.189231 ACTAACCACTGGAATTATGCGAC 58.811 43.478 0.71 0.00 0.00 5.19
3862 3893 3.350219 AACCACTGGAATTATGCGACT 57.650 42.857 0.71 0.00 0.00 4.18
3863 3894 3.350219 ACCACTGGAATTATGCGACTT 57.650 42.857 0.71 0.00 0.00 3.01
3864 3895 4.481368 ACCACTGGAATTATGCGACTTA 57.519 40.909 0.71 0.00 0.00 2.24
3865 3896 4.839121 ACCACTGGAATTATGCGACTTAA 58.161 39.130 0.71 0.00 0.00 1.85
3866 3897 5.250200 ACCACTGGAATTATGCGACTTAAA 58.750 37.500 0.71 0.00 0.00 1.52
3867 3898 5.354234 ACCACTGGAATTATGCGACTTAAAG 59.646 40.000 0.71 0.00 0.00 1.85
3868 3899 5.266242 CACTGGAATTATGCGACTTAAAGC 58.734 41.667 0.00 0.00 0.00 3.51
3879 3910 6.358118 TGCGACTTAAAGCATGGTTAATAG 57.642 37.500 11.15 10.63 38.59 1.73
3880 3911 5.878116 TGCGACTTAAAGCATGGTTAATAGT 59.122 36.000 11.15 13.57 38.59 2.12
3881 3912 7.042950 TGCGACTTAAAGCATGGTTAATAGTA 58.957 34.615 11.15 0.00 38.59 1.82
3882 3913 7.713507 TGCGACTTAAAGCATGGTTAATAGTAT 59.286 33.333 11.15 0.00 38.59 2.12
3883 3914 9.199982 GCGACTTAAAGCATGGTTAATAGTATA 57.800 33.333 11.15 0.00 0.00 1.47
3886 3917 9.503399 ACTTAAAGCATGGTTAATAGTATAGGC 57.497 33.333 11.15 0.00 0.00 3.93
3887 3918 9.502091 CTTAAAGCATGGTTAATAGTATAGGCA 57.498 33.333 11.15 0.00 0.00 4.75
3888 3919 9.854668 TTAAAGCATGGTTAATAGTATAGGCAA 57.145 29.630 11.15 0.00 0.00 4.52
3889 3920 7.745620 AAGCATGGTTAATAGTATAGGCAAC 57.254 36.000 8.73 0.00 0.00 4.17
3904 3935 1.311859 GCAACTGCTGGCTATATGCA 58.688 50.000 0.00 0.00 39.93 3.96
3905 3936 1.002033 GCAACTGCTGGCTATATGCAC 60.002 52.381 0.00 0.00 39.93 4.57
3906 3937 2.291365 CAACTGCTGGCTATATGCACA 58.709 47.619 0.00 0.00 45.15 4.57
3907 3938 2.882761 CAACTGCTGGCTATATGCACAT 59.117 45.455 0.00 0.00 45.15 3.21
3908 3939 2.501261 ACTGCTGGCTATATGCACATG 58.499 47.619 0.00 0.00 45.15 3.21
3909 3940 2.158711 ACTGCTGGCTATATGCACATGT 60.159 45.455 0.00 0.00 45.15 3.21
3910 3941 3.071457 ACTGCTGGCTATATGCACATGTA 59.929 43.478 0.00 0.00 45.15 2.29
3911 3942 3.402110 TGCTGGCTATATGCACATGTAC 58.598 45.455 0.00 0.00 45.15 2.90
3912 3943 3.071457 TGCTGGCTATATGCACATGTACT 59.929 43.478 0.00 0.00 45.15 2.73
3913 3944 3.681897 GCTGGCTATATGCACATGTACTC 59.318 47.826 0.00 0.00 45.15 2.59
3914 3945 4.562347 GCTGGCTATATGCACATGTACTCT 60.562 45.833 0.00 0.00 45.15 3.24
3915 3946 5.336770 GCTGGCTATATGCACATGTACTCTA 60.337 44.000 0.00 0.00 45.15 2.43
3916 3947 6.664428 TGGCTATATGCACATGTACTCTAA 57.336 37.500 0.00 0.00 45.15 2.10
3917 3948 7.061566 TGGCTATATGCACATGTACTCTAAA 57.938 36.000 0.00 0.00 45.15 1.85
3918 3949 7.154656 TGGCTATATGCACATGTACTCTAAAG 58.845 38.462 0.00 0.00 45.15 1.85
3919 3950 7.155328 GGCTATATGCACATGTACTCTAAAGT 58.845 38.462 0.00 0.00 45.15 2.66
3920 3951 7.329717 GGCTATATGCACATGTACTCTAAAGTC 59.670 40.741 0.00 0.00 45.15 3.01
3921 3952 7.867909 GCTATATGCACATGTACTCTAAAGTCA 59.132 37.037 0.00 0.00 42.31 3.41
3922 3953 9.920133 CTATATGCACATGTACTCTAAAGTCAT 57.080 33.333 0.00 0.00 36.92 3.06
3923 3954 8.824159 ATATGCACATGTACTCTAAAGTCATC 57.176 34.615 0.00 0.00 36.92 2.92
3924 3955 6.036577 TGCACATGTACTCTAAAGTCATCA 57.963 37.500 0.00 0.00 36.92 3.07
3925 3956 6.643388 TGCACATGTACTCTAAAGTCATCAT 58.357 36.000 0.00 0.00 36.92 2.45
3926 3957 7.781056 TGCACATGTACTCTAAAGTCATCATA 58.219 34.615 0.00 0.00 36.92 2.15
3927 3958 8.424133 TGCACATGTACTCTAAAGTCATCATAT 58.576 33.333 0.00 0.00 36.92 1.78
3928 3959 9.914131 GCACATGTACTCTAAAGTCATCATATA 57.086 33.333 0.00 0.00 36.92 0.86
3956 3987 7.921214 AGTCACTCATACAATACAATAAGGTCG 59.079 37.037 0.00 0.00 0.00 4.79
3957 3988 7.919091 GTCACTCATACAATACAATAAGGTCGA 59.081 37.037 0.00 0.00 0.00 4.20
3958 3989 8.135529 TCACTCATACAATACAATAAGGTCGAG 58.864 37.037 0.00 0.00 0.00 4.04
3959 3990 6.924060 ACTCATACAATACAATAAGGTCGAGC 59.076 38.462 6.48 6.48 0.00 5.03
3960 3991 6.220930 TCATACAATACAATAAGGTCGAGCC 58.779 40.000 11.73 3.31 37.58 4.70
3972 4003 2.810164 GGTCGAGCCTATCCTATTCCT 58.190 52.381 2.39 0.00 0.00 3.36
3973 4004 3.965694 GGTCGAGCCTATCCTATTCCTA 58.034 50.000 2.39 0.00 0.00 2.94
3974 4005 4.342359 GGTCGAGCCTATCCTATTCCTAA 58.658 47.826 2.39 0.00 0.00 2.69
3975 4006 4.158209 GGTCGAGCCTATCCTATTCCTAAC 59.842 50.000 2.39 0.00 0.00 2.34
3976 4007 5.011586 GTCGAGCCTATCCTATTCCTAACT 58.988 45.833 0.00 0.00 0.00 2.24
3977 4008 6.179040 GTCGAGCCTATCCTATTCCTAACTA 58.821 44.000 0.00 0.00 0.00 2.24
3978 4009 6.316890 GTCGAGCCTATCCTATTCCTAACTAG 59.683 46.154 0.00 0.00 0.00 2.57
3979 4010 5.066764 CGAGCCTATCCTATTCCTAACTAGC 59.933 48.000 0.00 0.00 0.00 3.42
3980 4011 5.905088 AGCCTATCCTATTCCTAACTAGCA 58.095 41.667 0.00 0.00 0.00 3.49
3981 4012 6.507568 AGCCTATCCTATTCCTAACTAGCAT 58.492 40.000 0.00 0.00 0.00 3.79
3982 4013 7.653503 AGCCTATCCTATTCCTAACTAGCATA 58.346 38.462 0.00 0.00 0.00 3.14
3983 4014 8.293216 AGCCTATCCTATTCCTAACTAGCATAT 58.707 37.037 0.00 0.00 0.00 1.78
3984 4015 8.581578 GCCTATCCTATTCCTAACTAGCATATC 58.418 40.741 0.00 0.00 0.00 1.63
3985 4016 9.084533 CCTATCCTATTCCTAACTAGCATATCC 57.915 40.741 0.00 0.00 0.00 2.59
3986 4017 9.875708 CTATCCTATTCCTAACTAGCATATCCT 57.124 37.037 0.00 0.00 0.00 3.24
3987 4018 7.962995 TCCTATTCCTAACTAGCATATCCTG 57.037 40.000 0.00 0.00 0.00 3.86
3988 4019 6.897966 TCCTATTCCTAACTAGCATATCCTGG 59.102 42.308 0.00 0.00 0.00 4.45
3989 4020 6.897966 CCTATTCCTAACTAGCATATCCTGGA 59.102 42.308 0.00 0.00 0.00 3.86
3990 4021 7.566879 CCTATTCCTAACTAGCATATCCTGGAT 59.433 40.741 14.66 14.66 0.00 3.41
3991 4022 7.821134 ATTCCTAACTAGCATATCCTGGATT 57.179 36.000 15.55 0.00 0.00 3.01
3992 4023 8.917414 ATTCCTAACTAGCATATCCTGGATTA 57.083 34.615 15.55 0.00 0.00 1.75
3993 4024 7.719871 TCCTAACTAGCATATCCTGGATTAC 57.280 40.000 15.55 4.92 0.00 1.89
3994 4025 7.246027 TCCTAACTAGCATATCCTGGATTACA 58.754 38.462 15.55 0.00 0.00 2.41
3995 4026 7.733047 TCCTAACTAGCATATCCTGGATTACAA 59.267 37.037 15.55 0.00 0.00 2.41
3996 4027 8.543774 CCTAACTAGCATATCCTGGATTACAAT 58.456 37.037 15.55 0.00 0.00 2.71
3997 4028 9.950496 CTAACTAGCATATCCTGGATTACAATT 57.050 33.333 15.55 4.38 0.00 2.32
3998 4029 8.854614 AACTAGCATATCCTGGATTACAATTC 57.145 34.615 15.55 0.00 0.00 2.17
3999 4030 7.977818 ACTAGCATATCCTGGATTACAATTCA 58.022 34.615 15.55 0.00 0.00 2.57
4000 4031 8.439971 ACTAGCATATCCTGGATTACAATTCAA 58.560 33.333 15.55 0.00 0.00 2.69
4001 4032 7.756395 AGCATATCCTGGATTACAATTCAAG 57.244 36.000 15.55 0.00 0.00 3.02
4002 4033 7.520798 AGCATATCCTGGATTACAATTCAAGA 58.479 34.615 15.55 0.00 0.00 3.02
4003 4034 8.168725 AGCATATCCTGGATTACAATTCAAGAT 58.831 33.333 15.55 1.05 31.58 2.40
4004 4035 8.800332 GCATATCCTGGATTACAATTCAAGATT 58.200 33.333 15.55 0.00 29.87 2.40
4006 4037 6.455360 TCCTGGATTACAATTCAAGATTGC 57.545 37.500 0.00 0.00 32.55 3.56
4007 4038 5.951148 TCCTGGATTACAATTCAAGATTGCA 59.049 36.000 0.00 0.00 32.55 4.08
4008 4039 6.038356 CCTGGATTACAATTCAAGATTGCAC 58.962 40.000 0.00 0.00 32.55 4.57
4009 4040 6.127535 CCTGGATTACAATTCAAGATTGCACT 60.128 38.462 0.00 0.00 32.55 4.40
4010 4041 7.067372 CCTGGATTACAATTCAAGATTGCACTA 59.933 37.037 0.00 0.00 32.55 2.74
4011 4042 8.347004 TGGATTACAATTCAAGATTGCACTAA 57.653 30.769 0.00 0.00 32.55 2.24
4012 4043 8.243426 TGGATTACAATTCAAGATTGCACTAAC 58.757 33.333 0.00 0.00 32.55 2.34
4013 4044 8.243426 GGATTACAATTCAAGATTGCACTAACA 58.757 33.333 0.00 0.00 32.55 2.41
4014 4045 9.624697 GATTACAATTCAAGATTGCACTAACAA 57.375 29.630 0.00 0.00 32.55 2.83
4027 4058 8.885494 ATTGCACTAACAATCTCTCTCTAATC 57.115 34.615 0.00 0.00 35.31 1.75
4028 4059 7.652524 TGCACTAACAATCTCTCTCTAATCT 57.347 36.000 0.00 0.00 0.00 2.40
4029 4060 8.072321 TGCACTAACAATCTCTCTCTAATCTT 57.928 34.615 0.00 0.00 0.00 2.40
4030 4061 7.978414 TGCACTAACAATCTCTCTCTAATCTTG 59.022 37.037 0.00 0.00 0.00 3.02
4031 4062 8.194104 GCACTAACAATCTCTCTCTAATCTTGA 58.806 37.037 0.00 0.00 0.00 3.02
4032 4063 9.515020 CACTAACAATCTCTCTCTAATCTTGAC 57.485 37.037 0.00 0.00 0.00 3.18
4033 4064 8.402472 ACTAACAATCTCTCTCTAATCTTGACG 58.598 37.037 0.00 0.00 0.00 4.35
4034 4065 5.587289 ACAATCTCTCTCTAATCTTGACGC 58.413 41.667 0.00 0.00 0.00 5.19
4035 4066 5.359576 ACAATCTCTCTCTAATCTTGACGCT 59.640 40.000 0.00 0.00 0.00 5.07
4036 4067 6.544197 ACAATCTCTCTCTAATCTTGACGCTA 59.456 38.462 0.00 0.00 0.00 4.26
4037 4068 6.801539 ATCTCTCTCTAATCTTGACGCTAG 57.198 41.667 0.00 0.00 0.00 3.42
4038 4069 5.060506 TCTCTCTCTAATCTTGACGCTAGG 58.939 45.833 0.00 0.00 0.00 3.02
4039 4070 4.783055 TCTCTCTAATCTTGACGCTAGGT 58.217 43.478 0.00 0.00 0.00 3.08
4040 4071 4.817464 TCTCTCTAATCTTGACGCTAGGTC 59.183 45.833 4.84 4.84 46.27 3.85
4041 4072 4.783055 TCTCTAATCTTGACGCTAGGTCT 58.217 43.478 11.21 0.00 46.24 3.85
4042 4073 5.194432 TCTCTAATCTTGACGCTAGGTCTT 58.806 41.667 11.21 2.56 46.24 3.01
4043 4074 5.297278 TCTCTAATCTTGACGCTAGGTCTTC 59.703 44.000 11.21 0.00 46.24 2.87
4044 4075 5.194432 TCTAATCTTGACGCTAGGTCTTCT 58.806 41.667 11.21 0.00 46.24 2.85
4045 4076 6.354938 TCTAATCTTGACGCTAGGTCTTCTA 58.645 40.000 11.21 0.00 46.24 2.10
4046 4077 6.999272 TCTAATCTTGACGCTAGGTCTTCTAT 59.001 38.462 11.21 0.83 46.24 1.98
4047 4078 4.902443 TCTTGACGCTAGGTCTTCTATG 57.098 45.455 11.21 0.00 46.24 2.23
4048 4079 4.270834 TCTTGACGCTAGGTCTTCTATGT 58.729 43.478 11.21 0.00 46.24 2.29
4049 4080 4.096532 TCTTGACGCTAGGTCTTCTATGTG 59.903 45.833 11.21 0.00 46.24 3.21
4050 4081 3.353557 TGACGCTAGGTCTTCTATGTGT 58.646 45.455 11.21 0.00 46.24 3.72
4051 4082 3.762288 TGACGCTAGGTCTTCTATGTGTT 59.238 43.478 11.21 0.00 46.24 3.32
4052 4083 4.106197 GACGCTAGGTCTTCTATGTGTTG 58.894 47.826 0.00 0.00 42.62 3.33
4053 4084 3.510360 ACGCTAGGTCTTCTATGTGTTGT 59.490 43.478 0.00 0.00 0.00 3.32
4054 4085 4.021368 ACGCTAGGTCTTCTATGTGTTGTT 60.021 41.667 0.00 0.00 0.00 2.83
4055 4086 4.929808 CGCTAGGTCTTCTATGTGTTGTTT 59.070 41.667 0.00 0.00 0.00 2.83
4056 4087 5.408604 CGCTAGGTCTTCTATGTGTTGTTTT 59.591 40.000 0.00 0.00 0.00 2.43
4057 4088 6.603095 GCTAGGTCTTCTATGTGTTGTTTTG 58.397 40.000 0.00 0.00 0.00 2.44
4058 4089 6.426937 GCTAGGTCTTCTATGTGTTGTTTTGA 59.573 38.462 0.00 0.00 0.00 2.69
4059 4090 7.119846 GCTAGGTCTTCTATGTGTTGTTTTGAT 59.880 37.037 0.00 0.00 0.00 2.57
4060 4091 9.653287 CTAGGTCTTCTATGTGTTGTTTTGATA 57.347 33.333 0.00 0.00 0.00 2.15
4062 4093 9.520515 AGGTCTTCTATGTGTTGTTTTGATATT 57.479 29.630 0.00 0.00 0.00 1.28
4063 4094 9.559958 GGTCTTCTATGTGTTGTTTTGATATTG 57.440 33.333 0.00 0.00 0.00 1.90
4064 4095 9.559958 GTCTTCTATGTGTTGTTTTGATATTGG 57.440 33.333 0.00 0.00 0.00 3.16
4065 4096 8.243426 TCTTCTATGTGTTGTTTTGATATTGGC 58.757 33.333 0.00 0.00 0.00 4.52
4066 4097 7.459795 TCTATGTGTTGTTTTGATATTGGCA 57.540 32.000 0.00 0.00 0.00 4.92
4067 4098 8.065473 TCTATGTGTTGTTTTGATATTGGCAT 57.935 30.769 0.00 0.00 0.00 4.40
4068 4099 6.971527 ATGTGTTGTTTTGATATTGGCATG 57.028 33.333 0.00 0.00 0.00 4.06
4069 4100 5.851720 TGTGTTGTTTTGATATTGGCATGT 58.148 33.333 0.00 0.00 0.00 3.21
4070 4101 6.286758 TGTGTTGTTTTGATATTGGCATGTT 58.713 32.000 0.00 0.00 0.00 2.71
4071 4102 6.202379 TGTGTTGTTTTGATATTGGCATGTTG 59.798 34.615 0.00 0.00 0.00 3.33
4072 4103 6.423302 GTGTTGTTTTGATATTGGCATGTTGA 59.577 34.615 0.00 0.00 0.00 3.18
4073 4104 6.423302 TGTTGTTTTGATATTGGCATGTTGAC 59.577 34.615 0.00 0.00 0.00 3.18
4074 4105 5.159925 TGTTTTGATATTGGCATGTTGACG 58.840 37.500 0.00 0.00 0.00 4.35
4075 4106 5.048434 TGTTTTGATATTGGCATGTTGACGA 60.048 36.000 0.00 0.00 0.00 4.20
4076 4107 5.833406 TTTGATATTGGCATGTTGACGAT 57.167 34.783 0.00 0.00 33.14 3.73
4077 4108 5.833406 TTGATATTGGCATGTTGACGATT 57.167 34.783 0.00 0.00 30.53 3.34
4078 4109 5.422666 TGATATTGGCATGTTGACGATTC 57.577 39.130 0.00 0.00 30.53 2.52
4079 4110 4.880696 TGATATTGGCATGTTGACGATTCA 59.119 37.500 0.00 0.00 30.53 2.57
4080 4111 5.532032 TGATATTGGCATGTTGACGATTCAT 59.468 36.000 0.00 0.00 30.53 2.57
4081 4112 3.763097 TTGGCATGTTGACGATTCATC 57.237 42.857 0.00 0.00 0.00 2.92
4082 4113 2.016318 TGGCATGTTGACGATTCATCC 58.984 47.619 0.00 0.00 0.00 3.51
4083 4114 2.292267 GGCATGTTGACGATTCATCCT 58.708 47.619 0.00 0.00 0.00 3.24
4084 4115 2.684881 GGCATGTTGACGATTCATCCTT 59.315 45.455 0.00 0.00 0.00 3.36
4085 4116 3.488047 GGCATGTTGACGATTCATCCTTG 60.488 47.826 0.00 0.00 0.00 3.61
4086 4117 3.488047 GCATGTTGACGATTCATCCTTGG 60.488 47.826 0.00 0.00 0.00 3.61
4087 4118 3.417069 TGTTGACGATTCATCCTTGGT 57.583 42.857 0.00 0.00 0.00 3.67
4088 4119 3.334691 TGTTGACGATTCATCCTTGGTC 58.665 45.455 0.00 0.00 0.00 4.02
4089 4120 3.244387 TGTTGACGATTCATCCTTGGTCA 60.244 43.478 0.00 0.00 33.05 4.02
4090 4121 3.251479 TGACGATTCATCCTTGGTCAG 57.749 47.619 0.00 0.00 31.45 3.51
4091 4122 1.936547 GACGATTCATCCTTGGTCAGC 59.063 52.381 0.00 0.00 0.00 4.26
4092 4123 1.556911 ACGATTCATCCTTGGTCAGCT 59.443 47.619 0.00 0.00 0.00 4.24
4093 4124 2.026822 ACGATTCATCCTTGGTCAGCTT 60.027 45.455 0.00 0.00 0.00 3.74
4094 4125 3.012518 CGATTCATCCTTGGTCAGCTTT 58.987 45.455 0.00 0.00 0.00 3.51
4095 4126 3.441572 CGATTCATCCTTGGTCAGCTTTT 59.558 43.478 0.00 0.00 0.00 2.27
4096 4127 4.437930 CGATTCATCCTTGGTCAGCTTTTC 60.438 45.833 0.00 0.00 0.00 2.29
4097 4128 3.795688 TCATCCTTGGTCAGCTTTTCT 57.204 42.857 0.00 0.00 0.00 2.52
4098 4129 3.415212 TCATCCTTGGTCAGCTTTTCTG 58.585 45.455 0.00 0.00 44.21 3.02
4099 4130 1.609208 TCCTTGGTCAGCTTTTCTGC 58.391 50.000 0.00 0.00 42.56 4.26
4100 4131 1.143684 TCCTTGGTCAGCTTTTCTGCT 59.856 47.619 0.00 0.00 45.18 4.24
4101 4132 1.538950 CCTTGGTCAGCTTTTCTGCTC 59.461 52.381 0.00 0.00 41.98 4.26
4102 4133 2.224606 CTTGGTCAGCTTTTCTGCTCA 58.775 47.619 0.00 0.00 41.98 4.26
4103 4134 1.597742 TGGTCAGCTTTTCTGCTCAC 58.402 50.000 0.00 0.00 41.98 3.51
4104 4135 1.141657 TGGTCAGCTTTTCTGCTCACT 59.858 47.619 0.00 0.00 41.98 3.41
4105 4136 1.803555 GGTCAGCTTTTCTGCTCACTC 59.196 52.381 0.00 0.00 41.98 3.51
4106 4137 1.803555 GTCAGCTTTTCTGCTCACTCC 59.196 52.381 0.00 0.00 41.98 3.85
4107 4138 1.417517 TCAGCTTTTCTGCTCACTCCA 59.582 47.619 0.00 0.00 41.98 3.86
4108 4139 1.534595 CAGCTTTTCTGCTCACTCCAC 59.465 52.381 0.00 0.00 41.98 4.02
4109 4140 1.141657 AGCTTTTCTGCTCACTCCACA 59.858 47.619 0.00 0.00 39.34 4.17
4110 4141 1.265365 GCTTTTCTGCTCACTCCACAC 59.735 52.381 0.00 0.00 0.00 3.82
4111 4142 2.564771 CTTTTCTGCTCACTCCACACA 58.435 47.619 0.00 0.00 0.00 3.72
4112 4143 2.708216 TTTCTGCTCACTCCACACAA 57.292 45.000 0.00 0.00 0.00 3.33
4113 4144 1.953559 TTCTGCTCACTCCACACAAC 58.046 50.000 0.00 0.00 0.00 3.32
4114 4145 1.123077 TCTGCTCACTCCACACAACT 58.877 50.000 0.00 0.00 0.00 3.16
4115 4146 1.069204 TCTGCTCACTCCACACAACTC 59.931 52.381 0.00 0.00 0.00 3.01
4116 4147 0.829990 TGCTCACTCCACACAACTCA 59.170 50.000 0.00 0.00 0.00 3.41
4117 4148 1.209261 TGCTCACTCCACACAACTCAA 59.791 47.619 0.00 0.00 0.00 3.02
4118 4149 2.288666 GCTCACTCCACACAACTCAAA 58.711 47.619 0.00 0.00 0.00 2.69
4119 4150 2.880890 GCTCACTCCACACAACTCAAAT 59.119 45.455 0.00 0.00 0.00 2.32
4120 4151 3.316308 GCTCACTCCACACAACTCAAATT 59.684 43.478 0.00 0.00 0.00 1.82
4121 4152 4.790766 GCTCACTCCACACAACTCAAATTG 60.791 45.833 0.00 0.00 35.59 2.32
4122 4153 3.066621 TCACTCCACACAACTCAAATTGC 59.933 43.478 0.00 0.00 32.47 3.56
4123 4154 3.067180 CACTCCACACAACTCAAATTGCT 59.933 43.478 0.00 0.00 32.47 3.91
4124 4155 3.067180 ACTCCACACAACTCAAATTGCTG 59.933 43.478 0.00 0.00 32.47 4.41
4125 4156 3.286353 TCCACACAACTCAAATTGCTGA 58.714 40.909 0.00 0.00 32.47 4.26
4126 4157 3.066621 TCCACACAACTCAAATTGCTGAC 59.933 43.478 0.00 0.00 32.47 3.51
4127 4158 3.067180 CCACACAACTCAAATTGCTGACT 59.933 43.478 0.00 0.00 32.47 3.41
4128 4159 4.275689 CCACACAACTCAAATTGCTGACTA 59.724 41.667 0.00 0.00 32.47 2.59
4129 4160 5.446709 CACACAACTCAAATTGCTGACTAG 58.553 41.667 0.00 0.00 32.47 2.57
4130 4161 5.237127 CACACAACTCAAATTGCTGACTAGA 59.763 40.000 0.00 0.00 32.47 2.43
4131 4162 6.000219 ACACAACTCAAATTGCTGACTAGAT 59.000 36.000 0.00 0.00 32.47 1.98
4132 4163 6.488006 ACACAACTCAAATTGCTGACTAGATT 59.512 34.615 0.00 0.00 32.47 2.40
4133 4164 6.800408 CACAACTCAAATTGCTGACTAGATTG 59.200 38.462 0.00 0.00 32.47 2.67
4134 4165 6.488006 ACAACTCAAATTGCTGACTAGATTGT 59.512 34.615 0.00 0.00 32.47 2.71
4135 4166 6.734104 ACTCAAATTGCTGACTAGATTGTC 57.266 37.500 0.00 0.00 37.47 3.18
4136 4167 5.645497 ACTCAAATTGCTGACTAGATTGTCC 59.355 40.000 0.00 0.00 36.21 4.02
4137 4168 4.631377 TCAAATTGCTGACTAGATTGTCCG 59.369 41.667 0.00 0.00 36.21 4.79
4138 4169 3.895232 ATTGCTGACTAGATTGTCCGT 57.105 42.857 0.00 0.00 36.21 4.69
4139 4170 2.941453 TGCTGACTAGATTGTCCGTC 57.059 50.000 0.00 0.00 36.21 4.79
4140 4171 2.167662 TGCTGACTAGATTGTCCGTCA 58.832 47.619 0.00 0.00 36.21 4.35
4141 4172 2.094700 TGCTGACTAGATTGTCCGTCAC 60.095 50.000 0.00 0.00 36.21 3.67
4142 4173 2.094700 GCTGACTAGATTGTCCGTCACA 60.095 50.000 0.00 0.00 36.21 3.58
4150 4181 2.743636 TTGTCCGTCACAATCTCTCC 57.256 50.000 0.00 0.00 40.29 3.71
4151 4182 1.924731 TGTCCGTCACAATCTCTCCT 58.075 50.000 0.00 0.00 29.30 3.69
4152 4183 2.248248 TGTCCGTCACAATCTCTCCTT 58.752 47.619 0.00 0.00 29.30 3.36
4153 4184 2.632996 TGTCCGTCACAATCTCTCCTTT 59.367 45.455 0.00 0.00 29.30 3.11
4154 4185 3.830178 TGTCCGTCACAATCTCTCCTTTA 59.170 43.478 0.00 0.00 29.30 1.85
4155 4186 4.282449 TGTCCGTCACAATCTCTCCTTTAA 59.718 41.667 0.00 0.00 29.30 1.52
4156 4187 5.046591 TGTCCGTCACAATCTCTCCTTTAAT 60.047 40.000 0.00 0.00 29.30 1.40
4157 4188 5.875359 GTCCGTCACAATCTCTCCTTTAATT 59.125 40.000 0.00 0.00 0.00 1.40
4158 4189 6.371825 GTCCGTCACAATCTCTCCTTTAATTT 59.628 38.462 0.00 0.00 0.00 1.82
4159 4190 6.940298 TCCGTCACAATCTCTCCTTTAATTTT 59.060 34.615 0.00 0.00 0.00 1.82
4160 4191 7.023575 CCGTCACAATCTCTCCTTTAATTTTG 58.976 38.462 0.00 0.00 0.00 2.44
4161 4192 7.094805 CCGTCACAATCTCTCCTTTAATTTTGA 60.095 37.037 0.00 0.00 0.00 2.69
4162 4193 8.454106 CGTCACAATCTCTCCTTTAATTTTGAT 58.546 33.333 0.00 0.00 0.00 2.57
4171 4202 9.415544 CTCTCCTTTAATTTTGATTTGACTTGG 57.584 33.333 0.00 0.00 0.00 3.61
4172 4203 8.923270 TCTCCTTTAATTTTGATTTGACTTGGT 58.077 29.630 0.00 0.00 0.00 3.67
4173 4204 8.885494 TCCTTTAATTTTGATTTGACTTGGTG 57.115 30.769 0.00 0.00 0.00 4.17
4174 4205 8.700051 TCCTTTAATTTTGATTTGACTTGGTGA 58.300 29.630 0.00 0.00 0.00 4.02
4175 4206 9.323985 CCTTTAATTTTGATTTGACTTGGTGAA 57.676 29.630 0.00 0.00 0.00 3.18
4184 4215 9.474920 TTGATTTGACTTGGTGAATTTATGAAC 57.525 29.630 0.00 0.00 0.00 3.18
4185 4216 8.637099 TGATTTGACTTGGTGAATTTATGAACA 58.363 29.630 0.00 0.00 0.00 3.18
4186 4217 9.474920 GATTTGACTTGGTGAATTTATGAACAA 57.525 29.630 0.00 0.00 0.00 2.83
4187 4218 9.829507 ATTTGACTTGGTGAATTTATGAACAAA 57.170 25.926 0.00 0.00 0.00 2.83
4188 4219 9.829507 TTTGACTTGGTGAATTTATGAACAAAT 57.170 25.926 0.00 0.00 0.00 2.32
4189 4220 9.829507 TTGACTTGGTGAATTTATGAACAAATT 57.170 25.926 0.00 0.00 40.06 1.82
4206 4237 9.453572 TGAACAAATTCAAATATGAGCTAGACT 57.546 29.630 0.00 0.00 41.99 3.24
4209 4240 9.331282 ACAAATTCAAATATGAGCTAGACTACC 57.669 33.333 0.00 0.00 36.78 3.18
4210 4241 8.778358 CAAATTCAAATATGAGCTAGACTACCC 58.222 37.037 0.00 0.00 36.78 3.69
4211 4242 7.618019 ATTCAAATATGAGCTAGACTACCCA 57.382 36.000 0.00 0.00 36.78 4.51
4212 4243 6.656632 TCAAATATGAGCTAGACTACCCAG 57.343 41.667 0.00 0.00 0.00 4.45
4213 4244 5.011125 TCAAATATGAGCTAGACTACCCAGC 59.989 44.000 0.00 0.00 35.49 4.85
4214 4245 1.710816 ATGAGCTAGACTACCCAGCC 58.289 55.000 0.00 0.00 35.88 4.85
4215 4246 0.335019 TGAGCTAGACTACCCAGCCA 59.665 55.000 0.00 0.00 35.88 4.75
4216 4247 0.747852 GAGCTAGACTACCCAGCCAC 59.252 60.000 0.00 0.00 35.88 5.01
4217 4248 0.041238 AGCTAGACTACCCAGCCACA 59.959 55.000 0.00 0.00 35.88 4.17
4218 4249 0.175989 GCTAGACTACCCAGCCACAC 59.824 60.000 0.00 0.00 0.00 3.82
4219 4250 1.853963 CTAGACTACCCAGCCACACT 58.146 55.000 0.00 0.00 0.00 3.55
4220 4251 2.949054 GCTAGACTACCCAGCCACACTA 60.949 54.545 0.00 0.00 0.00 2.74
4221 4252 1.853963 AGACTACCCAGCCACACTAG 58.146 55.000 0.00 0.00 0.00 2.57
4222 4253 0.175989 GACTACCCAGCCACACTAGC 59.824 60.000 0.00 0.00 0.00 3.42
4223 4254 0.544357 ACTACCCAGCCACACTAGCA 60.544 55.000 0.00 0.00 0.00 3.49
4224 4255 0.613260 CTACCCAGCCACACTAGCAA 59.387 55.000 0.00 0.00 0.00 3.91
4225 4256 0.323629 TACCCAGCCACACTAGCAAC 59.676 55.000 0.00 0.00 0.00 4.17
4226 4257 1.675641 CCCAGCCACACTAGCAACC 60.676 63.158 0.00 0.00 0.00 3.77
4227 4258 1.376466 CCAGCCACACTAGCAACCT 59.624 57.895 0.00 0.00 0.00 3.50
4228 4259 0.250901 CCAGCCACACTAGCAACCTT 60.251 55.000 0.00 0.00 0.00 3.50
4229 4260 0.877071 CAGCCACACTAGCAACCTTG 59.123 55.000 0.00 0.00 0.00 3.61
4230 4261 0.474184 AGCCACACTAGCAACCTTGT 59.526 50.000 0.00 0.00 0.00 3.16
4231 4262 0.593128 GCCACACTAGCAACCTTGTG 59.407 55.000 2.69 2.69 46.04 3.33
4232 4263 1.813862 GCCACACTAGCAACCTTGTGA 60.814 52.381 9.76 0.00 44.26 3.58
4233 4264 1.873591 CCACACTAGCAACCTTGTGAC 59.126 52.381 9.76 0.00 44.26 3.67
4234 4265 2.485479 CCACACTAGCAACCTTGTGACT 60.485 50.000 9.76 0.00 44.26 3.41
4235 4266 3.244078 CCACACTAGCAACCTTGTGACTA 60.244 47.826 9.76 0.00 44.26 2.59
4236 4267 3.741344 CACACTAGCAACCTTGTGACTAC 59.259 47.826 11.18 0.00 44.26 2.73
4237 4268 3.386726 ACACTAGCAACCTTGTGACTACA 59.613 43.478 11.18 0.00 44.26 2.74
4238 4269 3.741344 CACTAGCAACCTTGTGACTACAC 59.259 47.826 0.00 0.00 44.26 2.90
4239 4270 2.256117 AGCAACCTTGTGACTACACC 57.744 50.000 0.00 0.00 45.40 4.16
4240 4271 1.488812 AGCAACCTTGTGACTACACCA 59.511 47.619 0.00 0.00 45.40 4.17
4241 4272 2.106511 AGCAACCTTGTGACTACACCAT 59.893 45.455 0.00 0.00 45.40 3.55
4242 4273 2.484264 GCAACCTTGTGACTACACCATC 59.516 50.000 0.00 0.00 45.40 3.51
4243 4274 3.074412 CAACCTTGTGACTACACCATCC 58.926 50.000 0.00 0.00 45.40 3.51
4244 4275 2.334977 ACCTTGTGACTACACCATCCA 58.665 47.619 0.00 0.00 45.40 3.41
4245 4276 2.038557 ACCTTGTGACTACACCATCCAC 59.961 50.000 0.00 0.00 45.40 4.02
4246 4277 2.615493 CCTTGTGACTACACCATCCACC 60.615 54.545 0.00 0.00 45.40 4.61
4247 4278 0.981183 TGTGACTACACCATCCACCC 59.019 55.000 0.00 0.00 45.40 4.61
4248 4279 1.276622 GTGACTACACCATCCACCCT 58.723 55.000 0.00 0.00 40.74 4.34
4249 4280 2.225420 TGTGACTACACCATCCACCCTA 60.225 50.000 0.00 0.00 45.40 3.53
4250 4281 2.835764 GTGACTACACCATCCACCCTAA 59.164 50.000 0.00 0.00 40.74 2.69
4251 4282 2.835764 TGACTACACCATCCACCCTAAC 59.164 50.000 0.00 0.00 0.00 2.34
4252 4283 1.829222 ACTACACCATCCACCCTAACG 59.171 52.381 0.00 0.00 0.00 3.18
4253 4284 2.104967 CTACACCATCCACCCTAACGA 58.895 52.381 0.00 0.00 0.00 3.85
4254 4285 1.354101 ACACCATCCACCCTAACGAA 58.646 50.000 0.00 0.00 0.00 3.85
4255 4286 1.700739 ACACCATCCACCCTAACGAAA 59.299 47.619 0.00 0.00 0.00 3.46
4256 4287 2.307686 ACACCATCCACCCTAACGAAAT 59.692 45.455 0.00 0.00 0.00 2.17
4257 4288 3.520317 ACACCATCCACCCTAACGAAATA 59.480 43.478 0.00 0.00 0.00 1.40
4258 4289 3.875134 CACCATCCACCCTAACGAAATAC 59.125 47.826 0.00 0.00 0.00 1.89
4259 4290 3.520317 ACCATCCACCCTAACGAAATACA 59.480 43.478 0.00 0.00 0.00 2.29
4260 4291 4.165372 ACCATCCACCCTAACGAAATACAT 59.835 41.667 0.00 0.00 0.00 2.29
4261 4292 4.515191 CCATCCACCCTAACGAAATACATG 59.485 45.833 0.00 0.00 0.00 3.21
4262 4293 3.537580 TCCACCCTAACGAAATACATGC 58.462 45.455 0.00 0.00 0.00 4.06
4263 4294 2.616842 CCACCCTAACGAAATACATGCC 59.383 50.000 0.00 0.00 0.00 4.40
4264 4295 2.286833 CACCCTAACGAAATACATGCCG 59.713 50.000 0.00 0.00 0.00 5.69
4265 4296 1.871039 CCCTAACGAAATACATGCCGG 59.129 52.381 0.00 0.00 0.00 6.13
4266 4297 1.263217 CCTAACGAAATACATGCCGGC 59.737 52.381 22.73 22.73 0.00 6.13
4267 4298 2.210116 CTAACGAAATACATGCCGGCT 58.790 47.619 29.70 10.43 0.00 5.52
4268 4299 2.319136 AACGAAATACATGCCGGCTA 57.681 45.000 29.70 14.84 0.00 3.93
4269 4300 1.578583 ACGAAATACATGCCGGCTAC 58.421 50.000 29.70 8.60 0.00 3.58
4270 4301 0.865769 CGAAATACATGCCGGCTACC 59.134 55.000 29.70 7.00 0.00 3.18
4271 4302 1.540363 CGAAATACATGCCGGCTACCT 60.540 52.381 29.70 9.84 0.00 3.08
4272 4303 2.572290 GAAATACATGCCGGCTACCTT 58.428 47.619 29.70 13.09 0.00 3.50
4273 4304 3.735591 GAAATACATGCCGGCTACCTTA 58.264 45.455 29.70 6.08 0.00 2.69
4274 4305 4.324267 GAAATACATGCCGGCTACCTTAT 58.676 43.478 29.70 8.67 0.00 1.73
4275 4306 2.831685 TACATGCCGGCTACCTTATG 57.168 50.000 29.70 22.91 0.00 1.90
4276 4307 1.128200 ACATGCCGGCTACCTTATGA 58.872 50.000 29.70 3.35 0.00 2.15
4277 4308 1.699634 ACATGCCGGCTACCTTATGAT 59.300 47.619 29.70 6.09 0.00 2.45
4278 4309 2.289694 ACATGCCGGCTACCTTATGATC 60.290 50.000 29.70 0.00 0.00 2.92
4279 4310 1.419381 TGCCGGCTACCTTATGATCA 58.581 50.000 29.70 0.00 0.00 2.92
4280 4311 1.070134 TGCCGGCTACCTTATGATCAC 59.930 52.381 29.70 0.00 0.00 3.06
4281 4312 1.070134 GCCGGCTACCTTATGATCACA 59.930 52.381 22.15 0.00 0.00 3.58
4282 4313 2.289694 GCCGGCTACCTTATGATCACAT 60.290 50.000 22.15 0.00 40.16 3.21
4283 4314 3.589988 CCGGCTACCTTATGATCACATC 58.410 50.000 0.00 0.00 37.87 3.06
4284 4315 3.006859 CCGGCTACCTTATGATCACATCA 59.993 47.826 0.00 0.00 44.55 3.07
4285 4316 3.990469 CGGCTACCTTATGATCACATCAC 59.010 47.826 0.00 0.00 43.01 3.06
4286 4317 4.319177 GGCTACCTTATGATCACATCACC 58.681 47.826 0.00 0.00 43.01 4.02
4287 4318 4.319177 GCTACCTTATGATCACATCACCC 58.681 47.826 0.00 0.00 43.01 4.61
4288 4319 4.040952 GCTACCTTATGATCACATCACCCT 59.959 45.833 0.00 0.00 43.01 4.34
4289 4320 4.428294 ACCTTATGATCACATCACCCTG 57.572 45.455 0.00 0.00 43.01 4.45
4290 4321 3.782523 ACCTTATGATCACATCACCCTGT 59.217 43.478 0.00 0.00 43.01 4.00
4291 4322 4.132336 CCTTATGATCACATCACCCTGTG 58.868 47.826 0.00 0.00 46.34 3.66
4292 4323 2.723322 ATGATCACATCACCCTGTGG 57.277 50.000 0.00 0.00 45.29 4.17
4293 4324 1.655372 TGATCACATCACCCTGTGGA 58.345 50.000 4.54 0.00 45.29 4.02
4294 4325 1.278985 TGATCACATCACCCTGTGGAC 59.721 52.381 4.54 0.97 45.29 4.02
4295 4326 1.556911 GATCACATCACCCTGTGGACT 59.443 52.381 4.54 0.00 45.29 3.85
4296 4327 2.319025 TCACATCACCCTGTGGACTA 57.681 50.000 4.54 0.00 45.29 2.59
4297 4328 1.899814 TCACATCACCCTGTGGACTAC 59.100 52.381 4.54 0.00 45.29 2.73
4298 4329 1.623311 CACATCACCCTGTGGACTACA 59.377 52.381 0.00 0.00 42.26 2.74
4308 4339 2.674796 GTGGACTACACCATCCAGTC 57.325 55.000 0.00 0.00 45.72 3.51
4311 4342 2.969628 GACTACACCATCCAGTCCAG 57.030 55.000 0.00 0.00 33.99 3.86
4312 4343 2.180276 GACTACACCATCCAGTCCAGT 58.820 52.381 0.00 0.00 33.99 4.00
4313 4344 2.166664 GACTACACCATCCAGTCCAGTC 59.833 54.545 0.00 0.00 33.99 3.51
4314 4345 2.225394 ACTACACCATCCAGTCCAGTCT 60.225 50.000 0.00 0.00 0.00 3.24
4315 4346 1.270907 ACACCATCCAGTCCAGTCTC 58.729 55.000 0.00 0.00 0.00 3.36
4316 4347 1.269958 CACCATCCAGTCCAGTCTCA 58.730 55.000 0.00 0.00 0.00 3.27
4317 4348 1.836166 CACCATCCAGTCCAGTCTCAT 59.164 52.381 0.00 0.00 0.00 2.90
4318 4349 1.836166 ACCATCCAGTCCAGTCTCATG 59.164 52.381 0.00 0.00 0.00 3.07
4319 4350 1.836166 CCATCCAGTCCAGTCTCATGT 59.164 52.381 0.00 0.00 0.00 3.21
4320 4351 3.033909 CCATCCAGTCCAGTCTCATGTA 58.966 50.000 0.00 0.00 0.00 2.29
4321 4352 3.069300 CCATCCAGTCCAGTCTCATGTAG 59.931 52.174 0.00 0.00 0.00 2.74
4322 4353 3.739401 TCCAGTCCAGTCTCATGTAGA 57.261 47.619 0.00 0.00 0.00 2.59
4323 4354 3.625853 TCCAGTCCAGTCTCATGTAGAG 58.374 50.000 0.00 0.00 46.14 2.43
4336 4367 5.654901 TCATGTAGAGACTATGACCTCCT 57.345 43.478 0.00 0.00 0.00 3.69
4337 4368 6.019656 TCATGTAGAGACTATGACCTCCTT 57.980 41.667 0.00 0.00 0.00 3.36
4338 4369 7.150447 TCATGTAGAGACTATGACCTCCTTA 57.850 40.000 0.00 0.00 0.00 2.69
4339 4370 7.583625 TCATGTAGAGACTATGACCTCCTTAA 58.416 38.462 0.00 0.00 0.00 1.85
4340 4371 8.059461 TCATGTAGAGACTATGACCTCCTTAAA 58.941 37.037 0.00 0.00 0.00 1.52
4341 4372 7.883391 TGTAGAGACTATGACCTCCTTAAAG 57.117 40.000 0.00 0.00 0.00 1.85
4342 4373 7.640313 TGTAGAGACTATGACCTCCTTAAAGA 58.360 38.462 0.00 0.00 0.00 2.52
4343 4374 7.776030 TGTAGAGACTATGACCTCCTTAAAGAG 59.224 40.741 0.00 0.00 0.00 2.85
4344 4375 6.975949 AGAGACTATGACCTCCTTAAAGAGA 58.024 40.000 2.46 0.00 35.82 3.10
4345 4376 6.831868 AGAGACTATGACCTCCTTAAAGAGAC 59.168 42.308 2.46 0.00 35.82 3.36
4346 4377 6.737608 AGACTATGACCTCCTTAAAGAGACT 58.262 40.000 2.46 0.00 35.82 3.24
4347 4378 6.831868 AGACTATGACCTCCTTAAAGAGACTC 59.168 42.308 2.46 0.00 35.82 3.36
4348 4379 5.894964 ACTATGACCTCCTTAAAGAGACTCC 59.105 44.000 2.46 0.00 35.82 3.85
4349 4380 3.442076 TGACCTCCTTAAAGAGACTCCC 58.558 50.000 2.46 0.00 35.82 4.30
4350 4381 3.181410 TGACCTCCTTAAAGAGACTCCCA 60.181 47.826 2.46 0.00 35.82 4.37
4351 4382 4.034410 GACCTCCTTAAAGAGACTCCCAT 58.966 47.826 2.46 0.00 35.82 4.00
4352 4383 4.439860 ACCTCCTTAAAGAGACTCCCATT 58.560 43.478 2.46 0.00 35.82 3.16
4353 4384 4.471747 ACCTCCTTAAAGAGACTCCCATTC 59.528 45.833 2.46 0.00 35.82 2.67
4354 4385 4.442192 CCTCCTTAAAGAGACTCCCATTCG 60.442 50.000 2.46 0.00 35.82 3.34
4355 4386 3.118738 TCCTTAAAGAGACTCCCATTCGC 60.119 47.826 0.00 0.00 0.00 4.70
4356 4387 3.118592 CCTTAAAGAGACTCCCATTCGCT 60.119 47.826 0.00 0.00 0.00 4.93
4357 4388 2.393271 AAAGAGACTCCCATTCGCTG 57.607 50.000 0.00 0.00 0.00 5.18
4358 4389 0.539051 AAGAGACTCCCATTCGCTGG 59.461 55.000 0.00 0.00 45.51 4.85
4359 4390 0.616111 AGAGACTCCCATTCGCTGGT 60.616 55.000 0.00 0.00 44.30 4.00
4360 4391 0.250513 GAGACTCCCATTCGCTGGTT 59.749 55.000 0.00 0.00 44.30 3.67
4361 4392 0.693049 AGACTCCCATTCGCTGGTTT 59.307 50.000 3.57 0.00 44.30 3.27
4362 4393 1.906574 AGACTCCCATTCGCTGGTTTA 59.093 47.619 3.57 0.00 44.30 2.01
4363 4394 2.007608 GACTCCCATTCGCTGGTTTAC 58.992 52.381 3.57 0.00 44.30 2.01
4364 4395 1.628846 ACTCCCATTCGCTGGTTTACT 59.371 47.619 3.57 0.00 44.30 2.24
4365 4396 2.009774 CTCCCATTCGCTGGTTTACTG 58.990 52.381 3.57 0.00 44.30 2.74
4366 4397 0.451783 CCCATTCGCTGGTTTACTGC 59.548 55.000 3.57 0.00 44.30 4.40
4367 4398 0.451783 CCATTCGCTGGTTTACTGCC 59.548 55.000 0.00 0.00 40.49 4.85
4368 4399 0.451783 CATTCGCTGGTTTACTGCCC 59.548 55.000 0.00 0.00 40.57 5.36
4369 4400 0.679960 ATTCGCTGGTTTACTGCCCC 60.680 55.000 0.00 0.00 40.57 5.80
4370 4401 2.750237 CGCTGGTTTACTGCCCCC 60.750 66.667 0.00 0.00 40.57 5.40
4371 4402 2.438795 GCTGGTTTACTGCCCCCA 59.561 61.111 0.00 0.00 38.01 4.96
4372 4403 1.228737 GCTGGTTTACTGCCCCCAA 60.229 57.895 0.00 0.00 38.01 4.12
4373 4404 0.830023 GCTGGTTTACTGCCCCCAAA 60.830 55.000 0.00 0.00 38.01 3.28
4374 4405 1.710816 CTGGTTTACTGCCCCCAAAA 58.289 50.000 0.00 0.00 0.00 2.44
4375 4406 2.043227 CTGGTTTACTGCCCCCAAAAA 58.957 47.619 0.00 0.00 0.00 1.94
4397 4428 8.411991 AAAAATTTATTTTGTCCCCTAGTCGA 57.588 30.769 1.49 0.00 39.70 4.20
4398 4429 7.625828 AAATTTATTTTGTCCCCTAGTCGAG 57.374 36.000 0.00 0.00 0.00 4.04
4399 4430 6.555463 ATTTATTTTGTCCCCTAGTCGAGA 57.445 37.500 0.00 0.00 0.00 4.04
4400 4431 3.889520 ATTTTGTCCCCTAGTCGAGAC 57.110 47.619 0.00 0.00 0.00 3.36
4401 4432 2.297698 TTTGTCCCCTAGTCGAGACA 57.702 50.000 5.99 0.00 37.46 3.41
4402 4433 2.297698 TTGTCCCCTAGTCGAGACAA 57.702 50.000 10.56 10.56 44.61 3.18
4403 4434 1.835494 TGTCCCCTAGTCGAGACAAG 58.165 55.000 5.99 0.00 36.36 3.16
4404 4435 1.075050 TGTCCCCTAGTCGAGACAAGT 59.925 52.381 5.99 0.00 36.36 3.16
4405 4436 2.306805 TGTCCCCTAGTCGAGACAAGTA 59.693 50.000 5.99 0.00 36.36 2.24
4406 4437 2.944349 GTCCCCTAGTCGAGACAAGTAG 59.056 54.545 5.99 0.00 0.00 2.57
4407 4438 2.842496 TCCCCTAGTCGAGACAAGTAGA 59.158 50.000 5.99 0.00 0.00 2.59
4408 4439 3.458857 TCCCCTAGTCGAGACAAGTAGAT 59.541 47.826 5.99 0.00 0.00 1.98
4409 4440 3.566322 CCCCTAGTCGAGACAAGTAGATG 59.434 52.174 5.99 0.00 0.00 2.90
4410 4441 4.452825 CCCTAGTCGAGACAAGTAGATGA 58.547 47.826 5.99 0.00 0.00 2.92
4411 4442 4.273969 CCCTAGTCGAGACAAGTAGATGAC 59.726 50.000 5.99 0.00 0.00 3.06
4412 4443 4.273969 CCTAGTCGAGACAAGTAGATGACC 59.726 50.000 5.99 0.00 0.00 4.02
4413 4444 3.018149 AGTCGAGACAAGTAGATGACCC 58.982 50.000 5.99 0.00 0.00 4.46
4414 4445 3.018149 GTCGAGACAAGTAGATGACCCT 58.982 50.000 0.00 0.00 0.00 4.34
4415 4446 3.017442 TCGAGACAAGTAGATGACCCTG 58.983 50.000 0.00 0.00 0.00 4.45
4416 4447 2.099921 CGAGACAAGTAGATGACCCTGG 59.900 54.545 0.00 0.00 0.00 4.45
4417 4448 1.834263 AGACAAGTAGATGACCCTGGC 59.166 52.381 0.00 0.00 0.00 4.85
4418 4449 0.537188 ACAAGTAGATGACCCTGGCG 59.463 55.000 0.00 0.00 0.00 5.69
4419 4450 0.537188 CAAGTAGATGACCCTGGCGT 59.463 55.000 0.00 0.00 0.00 5.68
4420 4451 0.537188 AAGTAGATGACCCTGGCGTG 59.463 55.000 0.00 0.00 0.00 5.34
4421 4452 0.324368 AGTAGATGACCCTGGCGTGA 60.324 55.000 0.00 0.00 0.00 4.35
4422 4453 0.103208 GTAGATGACCCTGGCGTGAG 59.897 60.000 0.00 0.00 0.00 3.51
4423 4454 0.324368 TAGATGACCCTGGCGTGAGT 60.324 55.000 0.00 0.00 0.00 3.41
4424 4455 1.153549 GATGACCCTGGCGTGAGTC 60.154 63.158 0.00 0.00 0.00 3.36
4431 4462 4.260194 TGGCGTGAGTCATCAACG 57.740 55.556 0.00 0.00 43.37 4.10
4432 4463 1.663173 TGGCGTGAGTCATCAACGA 59.337 52.632 5.16 0.00 43.37 3.85
4433 4464 0.032815 TGGCGTGAGTCATCAACGAA 59.967 50.000 5.16 0.00 43.37 3.85
4434 4465 1.144969 GGCGTGAGTCATCAACGAAA 58.855 50.000 5.16 0.00 37.14 3.46
4435 4466 1.136336 GGCGTGAGTCATCAACGAAAC 60.136 52.381 5.16 0.00 37.14 2.78
4436 4467 1.525197 GCGTGAGTCATCAACGAAACA 59.475 47.619 5.16 0.00 37.14 2.83
4437 4468 2.157668 GCGTGAGTCATCAACGAAACAT 59.842 45.455 5.16 0.00 37.14 2.71
4438 4469 3.722082 GCGTGAGTCATCAACGAAACATC 60.722 47.826 5.16 0.00 37.14 3.06
4439 4470 3.428534 CGTGAGTCATCAACGAAACATCA 59.571 43.478 0.00 0.00 37.14 3.07
4440 4471 4.664139 CGTGAGTCATCAACGAAACATCAC 60.664 45.833 0.00 0.00 37.14 3.06
4441 4472 4.211164 GTGAGTCATCAACGAAACATCACA 59.789 41.667 0.00 0.00 37.14 3.58
4442 4473 4.996758 TGAGTCATCAACGAAACATCACAT 59.003 37.500 0.00 0.00 30.61 3.21
4443 4474 6.090763 GTGAGTCATCAACGAAACATCACATA 59.909 38.462 0.00 0.00 37.14 2.29
4444 4475 6.311200 TGAGTCATCAACGAAACATCACATAG 59.689 38.462 0.00 0.00 30.61 2.23
4445 4476 6.398095 AGTCATCAACGAAACATCACATAGA 58.602 36.000 0.00 0.00 0.00 1.98
4446 4477 6.311445 AGTCATCAACGAAACATCACATAGAC 59.689 38.462 0.00 0.00 0.00 2.59
4447 4478 5.288472 TCATCAACGAAACATCACATAGACG 59.712 40.000 0.00 0.00 0.00 4.18
4448 4479 4.800784 TCAACGAAACATCACATAGACGA 58.199 39.130 0.00 0.00 0.00 4.20
4449 4480 4.857037 TCAACGAAACATCACATAGACGAG 59.143 41.667 0.00 0.00 0.00 4.18
4450 4481 3.179830 ACGAAACATCACATAGACGAGC 58.820 45.455 0.00 0.00 0.00 5.03
4451 4482 3.179048 CGAAACATCACATAGACGAGCA 58.821 45.455 0.00 0.00 0.00 4.26
4452 4483 3.000674 CGAAACATCACATAGACGAGCAC 60.001 47.826 0.00 0.00 0.00 4.40
4453 4484 3.876274 AACATCACATAGACGAGCACT 57.124 42.857 0.00 0.00 0.00 4.40
4454 4485 3.876274 ACATCACATAGACGAGCACTT 57.124 42.857 0.00 0.00 0.00 3.16
4455 4486 3.515630 ACATCACATAGACGAGCACTTG 58.484 45.455 0.00 0.00 0.00 3.16
4456 4487 2.654749 TCACATAGACGAGCACTTGG 57.345 50.000 0.00 0.00 0.00 3.61
4457 4488 2.167662 TCACATAGACGAGCACTTGGA 58.832 47.619 0.00 0.00 0.00 3.53
4458 4489 2.094700 TCACATAGACGAGCACTTGGAC 60.095 50.000 0.00 0.00 0.00 4.02
4459 4490 1.893137 ACATAGACGAGCACTTGGACA 59.107 47.619 0.00 0.00 0.00 4.02
4460 4491 2.263077 CATAGACGAGCACTTGGACAC 58.737 52.381 0.00 0.00 0.00 3.67
4461 4492 0.240145 TAGACGAGCACTTGGACACG 59.760 55.000 0.00 0.00 0.00 4.49
4462 4493 1.007734 GACGAGCACTTGGACACGA 60.008 57.895 0.00 0.00 0.00 4.35
4463 4494 1.276145 GACGAGCACTTGGACACGAC 61.276 60.000 0.00 0.00 0.00 4.34
4464 4495 1.007271 CGAGCACTTGGACACGACT 60.007 57.895 0.00 0.00 0.00 4.18
4465 4496 0.240145 CGAGCACTTGGACACGACTA 59.760 55.000 0.00 0.00 0.00 2.59
4466 4497 1.699343 GAGCACTTGGACACGACTAC 58.301 55.000 0.00 0.00 0.00 2.73
4467 4498 1.269998 GAGCACTTGGACACGACTACT 59.730 52.381 0.00 0.00 0.00 2.57
4468 4499 1.000163 AGCACTTGGACACGACTACTG 60.000 52.381 0.00 0.00 0.00 2.74
4469 4500 1.000607 GCACTTGGACACGACTACTGA 60.001 52.381 0.00 0.00 0.00 3.41
4470 4501 2.922758 GCACTTGGACACGACTACTGAG 60.923 54.545 0.00 0.00 0.00 3.35
4471 4502 2.552743 CACTTGGACACGACTACTGAGA 59.447 50.000 0.00 0.00 0.00 3.27
4472 4503 2.553172 ACTTGGACACGACTACTGAGAC 59.447 50.000 0.00 0.00 0.00 3.36
4473 4504 2.265589 TGGACACGACTACTGAGACA 57.734 50.000 0.00 0.00 0.00 3.41
4474 4505 2.791655 TGGACACGACTACTGAGACAT 58.208 47.619 0.00 0.00 0.00 3.06
4475 4506 2.488153 TGGACACGACTACTGAGACATG 59.512 50.000 0.00 0.00 0.00 3.21
4476 4507 2.520979 GACACGACTACTGAGACATGC 58.479 52.381 0.00 0.00 0.00 4.06
4477 4508 2.162608 GACACGACTACTGAGACATGCT 59.837 50.000 0.00 0.00 0.00 3.79
4478 4509 3.344515 ACACGACTACTGAGACATGCTA 58.655 45.455 0.00 0.00 0.00 3.49
4479 4510 3.756963 ACACGACTACTGAGACATGCTAA 59.243 43.478 0.00 0.00 0.00 3.09
4480 4511 4.099120 CACGACTACTGAGACATGCTAAC 58.901 47.826 0.00 0.00 0.00 2.34
4481 4512 4.011023 ACGACTACTGAGACATGCTAACT 58.989 43.478 0.00 0.00 0.00 2.24
4482 4513 4.459685 ACGACTACTGAGACATGCTAACTT 59.540 41.667 0.00 0.00 0.00 2.66
4483 4514 4.795795 CGACTACTGAGACATGCTAACTTG 59.204 45.833 0.00 0.00 0.00 3.16
4484 4515 4.499183 ACTACTGAGACATGCTAACTTGC 58.501 43.478 0.00 0.00 0.00 4.01
4495 4526 4.754372 TGCTAACTTGCATGACTTCTTG 57.246 40.909 6.60 0.00 38.12 3.02
4496 4527 4.388485 TGCTAACTTGCATGACTTCTTGA 58.612 39.130 6.60 0.00 38.12 3.02
4497 4528 4.214119 TGCTAACTTGCATGACTTCTTGAC 59.786 41.667 6.60 0.00 38.12 3.18
4498 4529 4.453819 GCTAACTTGCATGACTTCTTGACT 59.546 41.667 6.60 0.00 0.00 3.41
4499 4530 5.390356 GCTAACTTGCATGACTTCTTGACTC 60.390 44.000 6.60 0.00 0.00 3.36
4500 4531 4.077300 ACTTGCATGACTTCTTGACTCA 57.923 40.909 6.60 0.00 0.00 3.41
4501 4532 4.649692 ACTTGCATGACTTCTTGACTCAT 58.350 39.130 6.60 0.00 0.00 2.90
4502 4533 4.694509 ACTTGCATGACTTCTTGACTCATC 59.305 41.667 6.60 0.00 0.00 2.92
4503 4534 4.548451 TGCATGACTTCTTGACTCATCT 57.452 40.909 0.00 0.00 0.00 2.90
4504 4535 4.251268 TGCATGACTTCTTGACTCATCTG 58.749 43.478 0.00 0.00 0.00 2.90
4505 4536 4.020839 TGCATGACTTCTTGACTCATCTGA 60.021 41.667 0.00 0.00 0.00 3.27
4506 4537 4.329528 GCATGACTTCTTGACTCATCTGAC 59.670 45.833 0.00 0.00 0.00 3.51
4507 4538 5.722263 CATGACTTCTTGACTCATCTGACT 58.278 41.667 0.00 0.00 0.00 3.41
4508 4539 5.798125 TGACTTCTTGACTCATCTGACTT 57.202 39.130 0.00 0.00 0.00 3.01
4509 4540 5.777802 TGACTTCTTGACTCATCTGACTTC 58.222 41.667 0.00 0.00 0.00 3.01
4510 4541 5.538053 TGACTTCTTGACTCATCTGACTTCT 59.462 40.000 0.00 0.00 0.00 2.85
4511 4542 6.024552 ACTTCTTGACTCATCTGACTTCTC 57.975 41.667 0.00 0.00 0.00 2.87
4512 4543 5.774690 ACTTCTTGACTCATCTGACTTCTCT 59.225 40.000 0.00 0.00 0.00 3.10
4513 4544 5.641783 TCTTGACTCATCTGACTTCTCTG 57.358 43.478 0.00 0.00 0.00 3.35
4514 4545 4.462132 TCTTGACTCATCTGACTTCTCTGG 59.538 45.833 0.00 0.00 0.00 3.86
4515 4546 4.039603 TGACTCATCTGACTTCTCTGGA 57.960 45.455 0.00 0.00 0.00 3.86
4516 4547 4.411013 TGACTCATCTGACTTCTCTGGAA 58.589 43.478 0.00 0.00 0.00 3.53
4529 4560 5.945144 TTCTCTGGAAGATGATCATGTGA 57.055 39.130 14.30 1.67 45.62 3.58
4530 4561 5.273674 TCTCTGGAAGATGATCATGTGAC 57.726 43.478 14.30 6.51 45.62 3.67
4531 4562 4.961099 TCTCTGGAAGATGATCATGTGACT 59.039 41.667 14.30 0.30 45.62 3.41
4532 4563 5.424573 TCTCTGGAAGATGATCATGTGACTT 59.575 40.000 14.30 9.96 45.62 3.01
4533 4564 6.058553 TCTGGAAGATGATCATGTGACTTT 57.941 37.500 14.30 0.00 38.67 2.66
4534 4565 6.111382 TCTGGAAGATGATCATGTGACTTTC 58.889 40.000 14.30 9.36 38.67 2.62
4535 4566 5.188434 TGGAAGATGATCATGTGACTTTCC 58.812 41.667 14.30 12.70 0.00 3.13
4536 4567 4.272018 GGAAGATGATCATGTGACTTTCCG 59.728 45.833 14.30 0.00 0.00 4.30
4537 4568 3.801698 AGATGATCATGTGACTTTCCGG 58.198 45.455 14.30 0.00 0.00 5.14
4538 4569 1.737838 TGATCATGTGACTTTCCGGC 58.262 50.000 0.00 0.00 0.00 6.13
4539 4570 1.003003 TGATCATGTGACTTTCCGGCA 59.997 47.619 0.00 0.00 0.00 5.69
4540 4571 1.398390 GATCATGTGACTTTCCGGCAC 59.602 52.381 0.00 0.00 0.00 5.01
4541 4572 0.605319 TCATGTGACTTTCCGGCACC 60.605 55.000 0.00 0.00 0.00 5.01
4542 4573 1.671054 ATGTGACTTTCCGGCACCG 60.671 57.895 1.02 1.02 39.44 4.94
4543 4574 3.723348 GTGACTTTCCGGCACCGC 61.723 66.667 2.83 0.00 38.24 5.68
4544 4575 4.243008 TGACTTTCCGGCACCGCA 62.243 61.111 2.83 0.00 38.24 5.69
4545 4576 3.723348 GACTTTCCGGCACCGCAC 61.723 66.667 2.83 0.00 38.24 5.34
4548 4579 4.572571 TTTCCGGCACCGCACCTT 62.573 61.111 2.83 0.00 38.24 3.50
4554 4585 4.120331 GCACCGCACCTTGGCATC 62.120 66.667 0.00 0.00 0.00 3.91
4555 4586 2.672651 CACCGCACCTTGGCATCA 60.673 61.111 0.00 0.00 0.00 3.07
4556 4587 2.672996 ACCGCACCTTGGCATCAC 60.673 61.111 0.00 0.00 0.00 3.06
4557 4588 3.443045 CCGCACCTTGGCATCACC 61.443 66.667 0.00 0.00 39.84 4.02
4565 4596 3.839589 TGGCATCACCACTCCCAT 58.160 55.556 0.00 0.00 46.36 4.00
4566 4597 1.609239 TGGCATCACCACTCCCATC 59.391 57.895 0.00 0.00 46.36 3.51
4567 4598 1.206811 TGGCATCACCACTCCCATCA 61.207 55.000 0.00 0.00 46.36 3.07
4568 4599 0.034186 GGCATCACCACTCCCATCAA 60.034 55.000 0.00 0.00 38.86 2.57
4569 4600 1.410648 GGCATCACCACTCCCATCAAT 60.411 52.381 0.00 0.00 38.86 2.57
4570 4601 1.679680 GCATCACCACTCCCATCAATG 59.320 52.381 0.00 0.00 0.00 2.82
4571 4602 2.684630 GCATCACCACTCCCATCAATGA 60.685 50.000 0.00 0.00 0.00 2.57
4572 4603 3.828921 CATCACCACTCCCATCAATGAT 58.171 45.455 0.00 0.00 0.00 2.45
4573 4604 3.565764 TCACCACTCCCATCAATGATC 57.434 47.619 0.00 0.00 0.00 2.92
4574 4605 2.845586 TCACCACTCCCATCAATGATCA 59.154 45.455 0.00 0.00 0.00 2.92
4575 4606 3.460712 TCACCACTCCCATCAATGATCAT 59.539 43.478 1.18 1.18 0.00 2.45
4576 4607 3.819337 CACCACTCCCATCAATGATCATC 59.181 47.826 9.06 0.00 0.00 2.92
4577 4608 3.720526 ACCACTCCCATCAATGATCATCT 59.279 43.478 9.06 0.00 0.00 2.90
4578 4609 4.167502 ACCACTCCCATCAATGATCATCTT 59.832 41.667 9.06 0.00 0.00 2.40
4579 4610 5.138276 CCACTCCCATCAATGATCATCTTT 58.862 41.667 9.06 0.00 0.00 2.52
4580 4611 5.241064 CCACTCCCATCAATGATCATCTTTC 59.759 44.000 9.06 0.00 0.00 2.62
4581 4612 5.826208 CACTCCCATCAATGATCATCTTTCA 59.174 40.000 9.06 0.00 0.00 2.69
4582 4613 5.826737 ACTCCCATCAATGATCATCTTTCAC 59.173 40.000 9.06 0.00 0.00 3.18
4583 4614 5.135383 TCCCATCAATGATCATCTTTCACC 58.865 41.667 9.06 0.00 0.00 4.02
4584 4615 4.891168 CCCATCAATGATCATCTTTCACCA 59.109 41.667 9.06 0.00 0.00 4.17
4585 4616 5.221185 CCCATCAATGATCATCTTTCACCAC 60.221 44.000 9.06 0.00 0.00 4.16
4586 4617 5.593095 CCATCAATGATCATCTTTCACCACT 59.407 40.000 9.06 0.00 0.00 4.00
4587 4618 6.096423 CCATCAATGATCATCTTTCACCACTT 59.904 38.462 9.06 0.00 0.00 3.16
4588 4619 6.748333 TCAATGATCATCTTTCACCACTTC 57.252 37.500 9.06 0.00 0.00 3.01
4589 4620 5.352293 TCAATGATCATCTTTCACCACTTCG 59.648 40.000 9.06 0.00 0.00 3.79
4590 4621 3.002791 TGATCATCTTTCACCACTTCGC 58.997 45.455 0.00 0.00 0.00 4.70
4591 4622 1.808411 TCATCTTTCACCACTTCGCC 58.192 50.000 0.00 0.00 0.00 5.54
4592 4623 0.443869 CATCTTTCACCACTTCGCCG 59.556 55.000 0.00 0.00 0.00 6.46
4593 4624 0.320374 ATCTTTCACCACTTCGCCGA 59.680 50.000 0.00 0.00 0.00 5.54
4594 4625 0.599204 TCTTTCACCACTTCGCCGAC 60.599 55.000 0.00 0.00 0.00 4.79
4595 4626 1.566018 CTTTCACCACTTCGCCGACC 61.566 60.000 0.00 0.00 0.00 4.79
4596 4627 2.999739 TTTCACCACTTCGCCGACCC 63.000 60.000 0.00 0.00 0.00 4.46
4597 4628 4.308458 CACCACTTCGCCGACCCA 62.308 66.667 0.00 0.00 0.00 4.51
4598 4629 4.309950 ACCACTTCGCCGACCCAC 62.310 66.667 0.00 0.00 0.00 4.61
4611 4642 4.675029 CCCACCGGACGAAGCGTT 62.675 66.667 9.46 0.00 41.37 4.84
4612 4643 2.259204 CCACCGGACGAAGCGTTA 59.741 61.111 9.46 0.00 41.37 3.18
4613 4644 1.804326 CCACCGGACGAAGCGTTAG 60.804 63.158 9.46 0.00 41.37 2.34
4614 4645 2.126189 ACCGGACGAAGCGTTAGC 60.126 61.111 9.46 0.00 41.37 3.09
4642 4673 2.400798 CGCTGCGCATTTGATCGT 59.599 55.556 12.24 0.00 0.00 3.73
4643 4674 1.226101 CGCTGCGCATTTGATCGTT 60.226 52.632 12.24 0.00 0.00 3.85
4644 4675 0.794229 CGCTGCGCATTTGATCGTTT 60.794 50.000 12.24 0.00 0.00 3.60
4645 4676 0.909843 GCTGCGCATTTGATCGTTTC 59.090 50.000 12.24 0.00 0.00 2.78
4646 4677 1.174352 CTGCGCATTTGATCGTTTCG 58.826 50.000 12.24 0.00 0.00 3.46
4647 4678 0.515127 TGCGCATTTGATCGTTTCGT 59.485 45.000 5.66 0.00 0.00 3.85
4648 4679 1.069568 TGCGCATTTGATCGTTTCGTT 60.070 42.857 5.66 0.00 0.00 3.85
4649 4680 1.573156 GCGCATTTGATCGTTTCGTTC 59.427 47.619 0.30 0.00 0.00 3.95
4650 4681 1.825945 CGCATTTGATCGTTTCGTTCG 59.174 47.619 0.00 0.00 0.00 3.95
4651 4682 2.471587 CGCATTTGATCGTTTCGTTCGA 60.472 45.455 0.00 0.00 41.45 3.71
4656 4687 3.708195 ATCGTTTCGTTCGATCCGT 57.292 47.368 11.47 1.36 43.12 4.69
4657 4688 1.542544 ATCGTTTCGTTCGATCCGTC 58.457 50.000 11.47 0.00 43.12 4.79
4658 4689 0.238025 TCGTTTCGTTCGATCCGTCA 59.762 50.000 11.47 0.00 32.30 4.35
4659 4690 1.135603 TCGTTTCGTTCGATCCGTCAT 60.136 47.619 11.47 0.00 32.30 3.06
4660 4691 2.095692 TCGTTTCGTTCGATCCGTCATA 59.904 45.455 11.47 0.00 32.30 2.15
4661 4692 2.847717 CGTTTCGTTCGATCCGTCATAA 59.152 45.455 5.12 0.00 0.00 1.90
4662 4693 3.484649 CGTTTCGTTCGATCCGTCATAAT 59.515 43.478 5.12 0.00 0.00 1.28
4663 4694 4.027132 CGTTTCGTTCGATCCGTCATAATT 60.027 41.667 5.12 0.00 0.00 1.40
4664 4695 5.421203 GTTTCGTTCGATCCGTCATAATTC 58.579 41.667 5.12 0.00 0.00 2.17
4665 4696 3.635331 TCGTTCGATCCGTCATAATTCC 58.365 45.455 5.12 0.00 0.00 3.01
4666 4697 3.067040 TCGTTCGATCCGTCATAATTCCA 59.933 43.478 5.12 0.00 0.00 3.53
4667 4698 3.181774 CGTTCGATCCGTCATAATTCCAC 59.818 47.826 0.00 0.00 0.00 4.02
4668 4699 4.116961 GTTCGATCCGTCATAATTCCACA 58.883 43.478 0.00 0.00 0.00 4.17
4669 4700 3.977427 TCGATCCGTCATAATTCCACAG 58.023 45.455 0.00 0.00 0.00 3.66
4670 4701 3.634910 TCGATCCGTCATAATTCCACAGA 59.365 43.478 0.00 0.00 0.00 3.41
4671 4702 3.736252 CGATCCGTCATAATTCCACAGAC 59.264 47.826 0.00 0.00 0.00 3.51
4672 4703 4.693283 GATCCGTCATAATTCCACAGACA 58.307 43.478 0.00 0.00 0.00 3.41
4673 4704 3.857052 TCCGTCATAATTCCACAGACAC 58.143 45.455 0.00 0.00 0.00 3.67
4674 4705 3.259625 TCCGTCATAATTCCACAGACACA 59.740 43.478 0.00 0.00 0.00 3.72
4675 4706 3.370978 CCGTCATAATTCCACAGACACAC 59.629 47.826 0.00 0.00 0.00 3.82
4676 4707 3.060761 CGTCATAATTCCACAGACACACG 59.939 47.826 0.00 0.00 0.00 4.49
4677 4708 3.994392 GTCATAATTCCACAGACACACGT 59.006 43.478 0.00 0.00 0.00 4.49
4678 4709 4.451096 GTCATAATTCCACAGACACACGTT 59.549 41.667 0.00 0.00 0.00 3.99
4679 4710 5.049680 GTCATAATTCCACAGACACACGTTT 60.050 40.000 0.00 0.00 0.00 3.60
4680 4711 3.963383 AATTCCACAGACACACGTTTC 57.037 42.857 0.00 0.00 0.00 2.78
4681 4712 1.658994 TTCCACAGACACACGTTTCC 58.341 50.000 0.00 0.00 0.00 3.13
4682 4713 0.828022 TCCACAGACACACGTTTCCT 59.172 50.000 0.00 0.00 0.00 3.36
4683 4714 0.937304 CCACAGACACACGTTTCCTG 59.063 55.000 0.00 0.00 0.00 3.86
4684 4715 0.937304 CACAGACACACGTTTCCTGG 59.063 55.000 8.31 0.00 0.00 4.45
4685 4716 0.539986 ACAGACACACGTTTCCTGGT 59.460 50.000 0.00 0.00 0.00 4.00
4686 4717 0.937304 CAGACACACGTTTCCTGGTG 59.063 55.000 0.35 0.35 39.98 4.17
4687 4718 0.179056 AGACACACGTTTCCTGGTGG 60.179 55.000 6.43 0.00 38.46 4.61
4688 4719 1.782028 GACACACGTTTCCTGGTGGC 61.782 60.000 6.43 0.00 38.46 5.01
4689 4720 2.203294 ACACGTTTCCTGGTGGCC 60.203 61.111 0.00 0.00 38.46 5.36
4690 4721 2.983592 CACGTTTCCTGGTGGCCC 60.984 66.667 0.00 0.00 0.00 5.80
4691 4722 4.280019 ACGTTTCCTGGTGGCCCC 62.280 66.667 0.00 0.85 0.00 5.80
4692 4723 4.278513 CGTTTCCTGGTGGCCCCA 62.279 66.667 11.91 11.91 42.51 4.96
4693 4724 2.600470 GTTTCCTGGTGGCCCCAC 60.600 66.667 8.95 8.95 45.49 4.61
4714 4745 3.315949 ACGCCCCTTTCCGCTGTA 61.316 61.111 0.00 0.00 0.00 2.74
4715 4746 2.818274 CGCCCCTTTCCGCTGTAC 60.818 66.667 0.00 0.00 0.00 2.90
4716 4747 2.437895 GCCCCTTTCCGCTGTACC 60.438 66.667 0.00 0.00 0.00 3.34
4717 4748 2.271173 CCCCTTTCCGCTGTACCC 59.729 66.667 0.00 0.00 0.00 3.69
4718 4749 2.298661 CCCCTTTCCGCTGTACCCT 61.299 63.158 0.00 0.00 0.00 4.34
4719 4750 1.221021 CCCTTTCCGCTGTACCCTC 59.779 63.158 0.00 0.00 0.00 4.30
4720 4751 1.221021 CCTTTCCGCTGTACCCTCC 59.779 63.158 0.00 0.00 0.00 4.30
4721 4752 1.550130 CCTTTCCGCTGTACCCTCCA 61.550 60.000 0.00 0.00 0.00 3.86
4722 4753 0.541863 CTTTCCGCTGTACCCTCCAT 59.458 55.000 0.00 0.00 0.00 3.41
4723 4754 0.539986 TTTCCGCTGTACCCTCCATC 59.460 55.000 0.00 0.00 0.00 3.51
4724 4755 1.672854 TTCCGCTGTACCCTCCATCG 61.673 60.000 0.00 0.00 0.00 3.84
4725 4756 2.423898 CCGCTGTACCCTCCATCGT 61.424 63.158 0.00 0.00 0.00 3.73
4726 4757 1.065928 CGCTGTACCCTCCATCGTC 59.934 63.158 0.00 0.00 0.00 4.20
4727 4758 1.384989 CGCTGTACCCTCCATCGTCT 61.385 60.000 0.00 0.00 0.00 4.18
4728 4759 0.824759 GCTGTACCCTCCATCGTCTT 59.175 55.000 0.00 0.00 0.00 3.01
4729 4760 1.202428 GCTGTACCCTCCATCGTCTTC 60.202 57.143 0.00 0.00 0.00 2.87
4730 4761 1.409427 CTGTACCCTCCATCGTCTTCC 59.591 57.143 0.00 0.00 0.00 3.46
4731 4762 1.006758 TGTACCCTCCATCGTCTTCCT 59.993 52.381 0.00 0.00 0.00 3.36
4732 4763 1.682323 GTACCCTCCATCGTCTTCCTC 59.318 57.143 0.00 0.00 0.00 3.71
4733 4764 0.336737 ACCCTCCATCGTCTTCCTCT 59.663 55.000 0.00 0.00 0.00 3.69
4734 4765 1.036707 CCCTCCATCGTCTTCCTCTC 58.963 60.000 0.00 0.00 0.00 3.20
4735 4766 1.410932 CCCTCCATCGTCTTCCTCTCT 60.411 57.143 0.00 0.00 0.00 3.10
4736 4767 2.383855 CCTCCATCGTCTTCCTCTCTT 58.616 52.381 0.00 0.00 0.00 2.85
4737 4768 2.763448 CCTCCATCGTCTTCCTCTCTTT 59.237 50.000 0.00 0.00 0.00 2.52
4738 4769 3.196685 CCTCCATCGTCTTCCTCTCTTTT 59.803 47.826 0.00 0.00 0.00 2.27
4739 4770 4.323104 CCTCCATCGTCTTCCTCTCTTTTT 60.323 45.833 0.00 0.00 0.00 1.94
4740 4771 5.105310 CCTCCATCGTCTTCCTCTCTTTTTA 60.105 44.000 0.00 0.00 0.00 1.52
4741 4772 6.407525 CCTCCATCGTCTTCCTCTCTTTTTAT 60.408 42.308 0.00 0.00 0.00 1.40
4742 4773 6.341316 TCCATCGTCTTCCTCTCTTTTTATG 58.659 40.000 0.00 0.00 0.00 1.90
4743 4774 6.070767 TCCATCGTCTTCCTCTCTTTTTATGT 60.071 38.462 0.00 0.00 0.00 2.29
4744 4775 6.256757 CCATCGTCTTCCTCTCTTTTTATGTC 59.743 42.308 0.00 0.00 0.00 3.06
4745 4776 5.721232 TCGTCTTCCTCTCTTTTTATGTCC 58.279 41.667 0.00 0.00 0.00 4.02
4746 4777 4.563184 CGTCTTCCTCTCTTTTTATGTCCG 59.437 45.833 0.00 0.00 0.00 4.79
4747 4778 5.480205 GTCTTCCTCTCTTTTTATGTCCGT 58.520 41.667 0.00 0.00 0.00 4.69
4748 4779 6.624423 CGTCTTCCTCTCTTTTTATGTCCGTA 60.624 42.308 0.00 0.00 0.00 4.02
4749 4780 6.530887 GTCTTCCTCTCTTTTTATGTCCGTAC 59.469 42.308 0.00 0.00 0.00 3.67
4750 4781 5.334724 TCCTCTCTTTTTATGTCCGTACC 57.665 43.478 0.00 0.00 0.00 3.34
4751 4782 4.110482 CCTCTCTTTTTATGTCCGTACCG 58.890 47.826 0.00 0.00 0.00 4.02
4752 4783 4.381292 CCTCTCTTTTTATGTCCGTACCGT 60.381 45.833 0.00 0.00 0.00 4.83
4753 4784 4.737054 TCTCTTTTTATGTCCGTACCGTC 58.263 43.478 0.00 0.00 0.00 4.79
4754 4785 4.460382 TCTCTTTTTATGTCCGTACCGTCT 59.540 41.667 0.00 0.00 0.00 4.18
4755 4786 4.487948 TCTTTTTATGTCCGTACCGTCTG 58.512 43.478 0.00 0.00 0.00 3.51
4756 4787 3.940209 TTTTATGTCCGTACCGTCTGT 57.060 42.857 0.00 0.00 0.00 3.41
4757 4788 2.925578 TTATGTCCGTACCGTCTGTG 57.074 50.000 0.00 0.00 0.00 3.66
4758 4789 0.452987 TATGTCCGTACCGTCTGTGC 59.547 55.000 0.00 0.00 0.00 4.57
4759 4790 1.529152 ATGTCCGTACCGTCTGTGCA 61.529 55.000 0.00 0.00 0.00 4.57
4760 4791 1.214589 GTCCGTACCGTCTGTGCAT 59.785 57.895 0.00 0.00 0.00 3.96
4761 4792 0.452987 GTCCGTACCGTCTGTGCATA 59.547 55.000 0.00 0.00 0.00 3.14
4767 4798 0.321671 ACCGTCTGTGCATACTGCTT 59.678 50.000 0.00 0.00 45.31 3.91
4768 4799 1.270839 ACCGTCTGTGCATACTGCTTT 60.271 47.619 0.00 0.00 45.31 3.51
4784 4815 1.878656 CTTTCTCGTGCTCCTCCCGT 61.879 60.000 0.00 0.00 0.00 5.28
4809 4842 3.520862 CGCAGCCGCCATGGAATT 61.521 61.111 18.40 0.00 42.00 2.17
4842 4875 0.671251 CATCTAGCTCCACTCCGACC 59.329 60.000 0.00 0.00 0.00 4.79
4844 4877 0.394488 TCTAGCTCCACTCCGACCAG 60.394 60.000 0.00 0.00 0.00 4.00
4868 4901 1.074167 ATCCACCCCTGGGAGCTAG 60.074 63.158 16.20 0.00 37.96 3.42
4872 4905 0.618968 CACCCCTGGGAGCTAGAACT 60.619 60.000 16.20 0.00 38.96 3.01
4888 4921 0.251634 AACTAGCTGAGCCAGAAGCC 59.748 55.000 6.94 0.00 45.47 4.35
4908 4941 3.598299 CCGCAACCATCCATGAATTTTT 58.402 40.909 0.00 0.00 0.00 1.94
4919 4952 7.557719 CCATCCATGAATTTTTCTACTACTGGT 59.442 37.037 0.00 0.00 0.00 4.00
4945 4978 2.779755 TTTGCTACATCCATCACGGT 57.220 45.000 0.00 0.00 35.57 4.83
4967 5000 2.412112 CTGCGACCTACTACGGCC 59.588 66.667 0.00 0.00 0.00 6.13
4971 5004 2.401766 CGACCTACTACGGCCGTGT 61.402 63.158 40.02 32.83 0.00 4.49
4997 5033 1.444119 TTGTTGCAACCGTCCTCAGC 61.444 55.000 26.14 0.00 0.00 4.26
5042 5078 1.882912 TGCTACAACCAACAGAGCAG 58.117 50.000 0.00 0.00 38.20 4.24
5048 5084 4.110036 ACAACCAACAGAGCAGTTTTTC 57.890 40.909 0.00 0.00 0.00 2.29
5072 5108 2.047655 CGCCCGACACCAAAGCTA 60.048 61.111 0.00 0.00 0.00 3.32
5075 5111 1.019805 GCCCGACACCAAAGCTAGAC 61.020 60.000 0.00 0.00 0.00 2.59
5080 5116 0.036875 ACACCAAAGCTAGACCTGGC 59.963 55.000 0.00 0.00 37.33 4.85
5103 5139 3.634910 AGATTGTTTTGCTACAACCCGTT 59.365 39.130 0.00 0.00 40.53 4.44
5152 5188 0.820226 TTGCTGCATCGACTAGAGCT 59.180 50.000 1.84 0.00 0.00 4.09
5162 5198 3.203716 TCGACTAGAGCTATTTCTGCGA 58.796 45.455 0.00 0.00 35.28 5.10
5214 5250 1.081442 GGCAACCGGAAAAGCTTCG 60.081 57.895 9.46 0.00 31.77 3.79
5215 5251 1.081442 GCAACCGGAAAAGCTTCGG 60.081 57.895 20.16 20.16 33.84 4.30
5224 5260 1.128692 GAAAAGCTTCGGTCGACATGG 59.871 52.381 18.91 6.02 0.00 3.66
5264 5301 0.621571 CCATCCAGGGAGAGGTGGAA 60.622 60.000 0.23 0.00 46.01 3.53
5272 5309 1.239347 GGAGAGGTGGAAGTTGCAAC 58.761 55.000 22.17 22.17 0.00 4.17
5273 5310 1.476833 GGAGAGGTGGAAGTTGCAACA 60.477 52.381 30.11 7.90 0.00 3.33
5344 5382 2.184322 CTGCGACGGCCTGTGTAT 59.816 61.111 0.00 0.00 38.85 2.29
5370 5408 1.112315 TTGCAACCAAGGACGGCAAT 61.112 50.000 0.00 0.00 39.33 3.56
5383 5421 3.053291 GCAATGGCCACGAACGGA 61.053 61.111 8.16 0.00 0.00 4.69
5385 5423 2.046314 AATGGCCACGAACGGAGG 60.046 61.111 8.16 1.71 0.00 4.30
5389 5427 3.047877 GCCACGAACGGAGGGTTG 61.048 66.667 0.00 0.00 39.50 3.77
5390 5428 2.424302 CCACGAACGGAGGGTTGT 59.576 61.111 0.00 0.00 39.50 3.32
5391 5429 1.666872 CCACGAACGGAGGGTTGTC 60.667 63.158 0.00 0.00 39.50 3.18
5392 5430 1.366366 CACGAACGGAGGGTTGTCT 59.634 57.895 0.00 0.00 39.50 3.41
5393 5431 0.666577 CACGAACGGAGGGTTGTCTC 60.667 60.000 0.00 0.00 39.50 3.36
5403 5441 1.819903 AGGGTTGTCTCTTCTCGCTAC 59.180 52.381 0.00 0.00 0.00 3.58
5405 5443 2.166664 GGGTTGTCTCTTCTCGCTACAT 59.833 50.000 0.00 0.00 0.00 2.29
5408 5446 4.691216 GGTTGTCTCTTCTCGCTACATTTT 59.309 41.667 0.00 0.00 0.00 1.82
5410 5448 5.134202 TGTCTCTTCTCGCTACATTTTCA 57.866 39.130 0.00 0.00 0.00 2.69
5418 5456 4.093408 TCTCGCTACATTTTCATGTGCTTC 59.907 41.667 0.00 0.00 43.92 3.86
5425 5463 4.395854 ACATTTTCATGTGCTTCGCTCATA 59.604 37.500 3.46 0.00 42.46 2.15
5444 5484 6.971184 GCTCATAATTGTTTTCTCATGACAGG 59.029 38.462 0.00 0.00 0.00 4.00
5465 5505 3.500680 GGTTTAGGAGTCGCATTTTCACA 59.499 43.478 0.00 0.00 0.00 3.58
5473 5513 6.428159 AGGAGTCGCATTTTCACATTATATCC 59.572 38.462 0.00 0.00 0.00 2.59
5474 5514 6.348540 GGAGTCGCATTTTCACATTATATCCC 60.349 42.308 0.00 0.00 0.00 3.85
5481 5521 7.177216 GCATTTTCACATTATATCCCCATGAGA 59.823 37.037 0.00 0.00 0.00 3.27
5493 5533 1.293924 CCATGAGATCTGGCGTCAAC 58.706 55.000 0.00 0.00 0.00 3.18
5496 5536 0.317160 TGAGATCTGGCGTCAACGTT 59.683 50.000 0.00 0.00 42.22 3.99
5499 5539 2.334838 AGATCTGGCGTCAACGTTTAC 58.665 47.619 0.00 0.00 42.22 2.01
5502 5542 1.862201 TCTGGCGTCAACGTTTACAAG 59.138 47.619 12.72 6.94 42.22 3.16
5506 5546 2.412325 GGCGTCAACGTTTACAAGATGG 60.412 50.000 12.72 0.00 42.22 3.51
5514 5554 4.016444 ACGTTTACAAGATGGCATGGAAT 58.984 39.130 3.81 0.00 0.00 3.01
5539 5579 5.971763 CTCCCGGGAGATCTCTATATTTTG 58.028 45.833 42.70 12.84 44.53 2.44
5540 5580 5.403512 TCCCGGGAGATCTCTATATTTTGT 58.596 41.667 22.63 0.00 0.00 2.83
5543 5583 6.159988 CCGGGAGATCTCTATATTTTGTGTC 58.840 44.000 21.81 0.79 0.00 3.67
5544 5584 6.159988 CGGGAGATCTCTATATTTTGTGTCC 58.840 44.000 21.81 8.87 0.00 4.02
5549 5589 3.131577 TCTCTATATTTTGTGTCCGCCGT 59.868 43.478 0.00 0.00 0.00 5.68
5551 5591 4.613944 TCTATATTTTGTGTCCGCCGTAG 58.386 43.478 0.00 0.00 0.00 3.51
5562 5602 1.820519 TCCGCCGTAGTAAACATCACT 59.179 47.619 0.00 0.00 0.00 3.41
5564 5604 1.924524 CGCCGTAGTAAACATCACTGG 59.075 52.381 0.00 0.00 0.00 4.00
5568 5608 2.348666 CGTAGTAAACATCACTGGCTGC 59.651 50.000 0.00 0.00 0.00 5.25
5572 5612 0.250467 AAACATCACTGGCTGCGACT 60.250 50.000 0.00 0.00 0.00 4.18
5582 5622 1.760029 TGGCTGCGACTTGGATGTATA 59.240 47.619 0.00 0.00 0.00 1.47
5591 5631 4.513442 GACTTGGATGTATACCAGTTGCA 58.487 43.478 0.00 0.00 38.70 4.08
5596 5636 3.741344 GGATGTATACCAGTTGCACGATC 59.259 47.826 0.00 0.00 0.00 3.69
5612 5652 3.184379 CACGATCGAACTGACACAAATGT 59.816 43.478 24.34 0.00 43.71 2.71
5628 5668 3.569916 TGTCGCTCAAGACACAGAC 57.430 52.632 0.00 0.00 45.18 3.51
5635 5675 3.120752 CGCTCAAGACACAGACTCAAATG 60.121 47.826 0.00 0.00 0.00 2.32
5645 5685 0.099436 GACTCAAATGCGATGGTGCC 59.901 55.000 0.00 0.00 0.00 5.01
5658 5698 0.464735 TGGTGCCGCTTTGTACAGTT 60.465 50.000 0.00 0.00 0.00 3.16
5659 5699 0.040425 GGTGCCGCTTTGTACAGTTG 60.040 55.000 0.00 0.00 0.00 3.16
5667 5707 1.169661 TTTGTACAGTTGCCTGCCCG 61.170 55.000 0.00 0.00 42.81 6.13
5672 5712 2.192861 CAGTTGCCTGCCCGAACAA 61.193 57.895 0.00 0.00 0.00 2.83
5679 5719 0.811281 CCTGCCCGAACAAGGAAATC 59.189 55.000 0.00 0.00 0.00 2.17
5680 5720 1.533625 CTGCCCGAACAAGGAAATCA 58.466 50.000 0.00 0.00 0.00 2.57
5682 5722 1.243902 GCCCGAACAAGGAAATCACA 58.756 50.000 0.00 0.00 0.00 3.58
5691 5731 3.008485 ACAAGGAAATCACAGAGACCTCC 59.992 47.826 0.00 0.00 32.74 4.30
5695 5735 3.254892 GAAATCACAGAGACCTCCGTTC 58.745 50.000 0.00 0.00 0.00 3.95
5703 5743 0.252103 AGACCTCCGTTCCTAGGCAA 60.252 55.000 2.96 0.00 36.24 4.52
5732 5772 0.743345 GGTACCGGATGTTGCTCCAC 60.743 60.000 9.46 0.00 34.78 4.02
5733 5773 0.249398 GTACCGGATGTTGCTCCACT 59.751 55.000 9.46 0.00 34.78 4.00
5737 5777 0.389817 CGGATGTTGCTCCACTTCGA 60.390 55.000 0.00 0.00 34.78 3.71
5740 5780 2.143122 GATGTTGCTCCACTTCGAACA 58.857 47.619 0.00 0.00 0.00 3.18
5742 5782 2.143122 TGTTGCTCCACTTCGAACATC 58.857 47.619 0.00 0.00 0.00 3.06
5743 5783 1.126846 GTTGCTCCACTTCGAACATCG 59.873 52.381 0.00 0.00 42.10 3.84
5750 5790 5.068234 TCCACTTCGAACATCGTTATTCT 57.932 39.130 0.00 0.00 41.35 2.40
5756 5796 3.863424 TCGAACATCGTTATTCTTGCTCC 59.137 43.478 0.00 0.00 41.35 4.70
5778 5818 1.234821 CCTTGCAGCTTCGGTTTGTA 58.765 50.000 0.00 0.00 0.00 2.41
5788 5828 2.328856 CGGTTTGTACGCCATGGCA 61.329 57.895 34.93 15.49 42.06 4.92
5789 5829 1.857318 CGGTTTGTACGCCATGGCAA 61.857 55.000 34.93 20.48 42.06 4.52
5792 5832 1.247419 TTTGTACGCCATGGCAAGGG 61.247 55.000 34.93 21.34 42.06 3.95
5845 5885 6.755206 TGGGACGGAATCAATATAACTACTG 58.245 40.000 0.00 0.00 0.00 2.74
5855 5895 8.948631 ATCAATATAACTACTGATTATGCCGG 57.051 34.615 0.00 0.00 0.00 6.13
5871 5911 7.779754 TTATGCCGGTATTACTTGGAGTATA 57.220 36.000 11.31 0.00 29.64 1.47
5886 5926 5.056480 TGGAGTATAATGGATCAAGCAACG 58.944 41.667 0.00 0.00 0.00 4.10
5900 5940 4.941309 AACGGGCGACACCAACCC 62.941 66.667 0.00 0.00 42.05 4.11
5909 5949 0.953960 GACACCAACCCGGCTAACAG 60.954 60.000 0.00 0.00 39.03 3.16
5917 5957 1.677552 CCGGCTAACAGGACCAACT 59.322 57.895 0.00 0.00 0.00 3.16
5921 5961 1.405121 GGCTAACAGGACCAACTACGG 60.405 57.143 0.00 0.00 0.00 4.02
5922 5962 1.547372 GCTAACAGGACCAACTACGGA 59.453 52.381 0.00 0.00 0.00 4.69
5944 5984 1.605710 GTGTCAGCAATCACAGCAAGT 59.394 47.619 0.00 0.00 35.04 3.16
5956 5996 2.126346 GCAAGTGGGTGCGCAATC 60.126 61.111 14.00 8.14 34.21 2.67
5959 5999 0.676466 CAAGTGGGTGCGCAATCCTA 60.676 55.000 25.21 14.49 0.00 2.94
5961 6001 0.179045 AGTGGGTGCGCAATCCTATC 60.179 55.000 25.21 17.24 0.00 2.08
5962 6002 0.463654 GTGGGTGCGCAATCCTATCA 60.464 55.000 25.21 10.46 0.00 2.15
5965 6005 0.940126 GGTGCGCAATCCTATCACAG 59.060 55.000 14.00 0.00 0.00 3.66
5973 6013 2.160721 ATCCTATCACAGGTGGTCGT 57.839 50.000 0.00 0.00 45.71 4.34
5974 6014 1.182667 TCCTATCACAGGTGGTCGTG 58.817 55.000 0.00 0.00 45.71 4.35
6013 6053 5.772672 TGCGATAATGGGTATAAAGGCAATT 59.227 36.000 0.00 0.00 0.00 2.32
6043 6083 1.068434 TCGATGGATGCTTGCGTGATA 59.932 47.619 0.00 0.00 0.00 2.15
6068 6108 3.117663 GGTAATTTACCTGCTCCATCCCA 60.118 47.826 16.83 0.00 45.52 4.37
6069 6109 2.736670 ATTTACCTGCTCCATCCCAC 57.263 50.000 0.00 0.00 0.00 4.61
6070 6110 1.367346 TTTACCTGCTCCATCCCACA 58.633 50.000 0.00 0.00 0.00 4.17
6071 6111 0.911769 TTACCTGCTCCATCCCACAG 59.088 55.000 0.00 0.00 0.00 3.66
6072 6112 0.042581 TACCTGCTCCATCCCACAGA 59.957 55.000 0.00 0.00 31.67 3.41
6073 6113 1.270414 ACCTGCTCCATCCCACAGAG 61.270 60.000 0.00 0.00 31.67 3.35
6077 6117 2.913463 CTCCATCCCACAGAGCTCT 58.087 57.895 11.45 11.45 0.00 4.09
6094 6136 8.484641 CAGAGCTCTGTCTTTCATTTATGTTA 57.515 34.615 31.71 0.00 39.09 2.41
6098 6140 9.035607 AGCTCTGTCTTTCATTTATGTTATACG 57.964 33.333 0.00 0.00 0.00 3.06
6123 6165 7.754924 CGATTAAGATGGCATTAGTTTGTGTTT 59.245 33.333 0.00 0.00 0.00 2.83
6160 6202 8.561738 TGTAGAAAAACTTTGTGAGAAGACTT 57.438 30.769 0.00 0.00 0.00 3.01
6161 6203 8.450964 TGTAGAAAAACTTTGTGAGAAGACTTG 58.549 33.333 0.00 0.00 0.00 3.16
6167 6209 7.814264 AACTTTGTGAGAAGACTTGATCAAT 57.186 32.000 8.96 0.00 0.00 2.57
6172 6214 7.672983 TGTGAGAAGACTTGATCAATTAACC 57.327 36.000 8.96 0.00 0.00 2.85
6179 6221 5.415701 AGACTTGATCAATTAACCGCAACAT 59.584 36.000 8.96 0.00 0.00 2.71
6180 6222 5.401550 ACTTGATCAATTAACCGCAACATG 58.598 37.500 8.96 0.00 0.00 3.21
6186 6228 3.658757 ATTAACCGCAACATGCACTTT 57.341 38.095 2.99 0.00 45.36 2.66
6190 6232 0.877071 CCGCAACATGCACTTTCTCT 59.123 50.000 2.99 0.00 45.36 3.10
6194 6236 2.490903 GCAACATGCACTTTCTCTCCAT 59.509 45.455 0.00 0.00 44.26 3.41
6201 6243 4.214310 TGCACTTTCTCTCCATTGGAAAA 58.786 39.130 6.88 4.05 0.00 2.29
6214 6256 1.412079 TGGAAAACCAACTGCATGCT 58.588 45.000 20.33 0.00 0.00 3.79
6221 6263 6.090763 GGAAAACCAACTGCATGCTTAATTAC 59.909 38.462 20.33 0.63 0.00 1.89
6234 6276 6.375945 TGCTTAATTACACCTGCATACATG 57.624 37.500 0.00 0.00 0.00 3.21
6261 6303 5.199723 ACCCAAATGAAGCCAAACAAATTT 58.800 33.333 0.00 0.00 0.00 1.82
6288 6330 9.623000 GATTTGGGGTGTATAAATAACTGTACT 57.377 33.333 0.00 0.00 0.00 2.73
6304 6346 7.913674 AACTGTACTTTTCTGATGAATCTCC 57.086 36.000 0.00 0.00 31.56 3.71
6306 6348 8.367660 ACTGTACTTTTCTGATGAATCTCCTA 57.632 34.615 0.00 0.00 31.56 2.94
6316 6358 8.599055 TCTGATGAATCTCCTAATTTCATTCG 57.401 34.615 0.00 0.00 39.52 3.34
6349 6391 0.688487 AATCCGGTCCAACGAAAGGA 59.312 50.000 0.00 0.00 35.47 3.36
6353 6395 1.002142 CCGGTCCAACGAAAGGAAAAC 60.002 52.381 0.00 0.00 36.80 2.43
6363 6405 2.800544 CGAAAGGAAAACTGCTCTCGAA 59.199 45.455 0.00 0.00 0.00 3.71
6364 6406 3.247648 CGAAAGGAAAACTGCTCTCGAAA 59.752 43.478 0.00 0.00 0.00 3.46
6368 6410 2.349912 GGAAAACTGCTCTCGAAAGTGC 60.350 50.000 0.00 0.00 41.38 4.40
6371 6413 2.048222 TGCTCTCGAAAGTGCGGG 60.048 61.111 0.00 0.00 43.40 6.13
6395 6437 5.649782 ACATCAGTGTTCCATTTCCATTC 57.350 39.130 0.00 0.00 34.01 2.67
6451 6493 0.029834 CAGCTCAACTGCACCAACAC 59.970 55.000 0.00 0.00 40.19 3.32
6476 6518 1.002087 ACGTCCAGCCTCCAACTAAAG 59.998 52.381 0.00 0.00 0.00 1.85
6483 6525 4.530875 CAGCCTCCAACTAAAGGATCATT 58.469 43.478 0.00 0.00 34.35 2.57
6487 6529 5.409826 GCCTCCAACTAAAGGATCATTATCG 59.590 44.000 0.00 0.00 34.35 2.92
6491 6533 6.761242 TCCAACTAAAGGATCATTATCGTGTG 59.239 38.462 0.00 0.00 32.44 3.82
6497 6539 9.212641 CTAAAGGATCATTATCGTGTGATGAAT 57.787 33.333 0.00 0.00 36.54 2.57
6511 6553 8.544597 TCGTGTGATGAATATAAATGTAAACGG 58.455 33.333 0.00 0.00 0.00 4.44
6512 6554 7.320324 CGTGTGATGAATATAAATGTAAACGGC 59.680 37.037 0.00 0.00 0.00 5.68
6515 6557 5.676532 TGAATATAAATGTAAACGGCGGG 57.323 39.130 13.24 0.00 0.00 6.13
6518 6560 2.687700 TAAATGTAAACGGCGGGCTA 57.312 45.000 13.24 0.00 0.00 3.93
6536 6578 2.735762 GCTAGTGGACATCGAAGACACC 60.736 54.545 13.54 6.52 42.51 4.16
6549 6591 3.665190 GAAGACACCTCAAGTTACCAGG 58.335 50.000 0.00 0.00 0.00 4.45
6554 6596 1.697982 ACCTCAAGTTACCAGGGTGAC 59.302 52.381 5.30 5.30 35.24 3.67
6559 6601 3.904965 TCAAGTTACCAGGGTGACATGTA 59.095 43.478 14.79 2.56 41.51 2.29
6562 6604 3.199946 AGTTACCAGGGTGACATGTATGG 59.800 47.826 14.79 5.20 41.51 2.74
6576 6618 4.591929 CATGTATGGGATGCATGTATCCA 58.408 43.478 34.80 24.14 46.89 3.41
6613 6655 2.319025 ATTGGTTTTGGGGAATCGGT 57.681 45.000 0.00 0.00 0.00 4.69
6667 6709 1.800805 CGAGAGGCACAACAGAACAT 58.199 50.000 0.00 0.00 0.00 2.71
6691 6733 0.871722 GGTTACGCATGTGTCAGCAA 59.128 50.000 16.65 1.26 0.00 3.91
6714 6756 3.966215 GCACTTGCTTAGGCGTCA 58.034 55.556 0.00 0.00 42.25 4.35
6721 6763 1.508632 TGCTTAGGCGTCAACTCAAC 58.491 50.000 0.00 0.00 42.25 3.18
6722 6764 1.070134 TGCTTAGGCGTCAACTCAACT 59.930 47.619 0.00 0.00 42.25 3.16
6765 6807 1.295792 CAAATGCATGCATGGCTTCC 58.704 50.000 32.79 11.23 36.68 3.46
6767 6809 0.906066 AATGCATGCATGGCTTCCAA 59.094 45.000 32.79 1.15 36.95 3.53
6776 6818 1.758862 CATGGCTTCCAAGGAAATCCC 59.241 52.381 13.84 10.06 36.95 3.85
6794 6836 2.027192 TCCCTATATCGGAAATGGCTGC 60.027 50.000 0.00 0.00 0.00 5.25
6795 6837 2.359900 CCTATATCGGAAATGGCTGCC 58.640 52.381 12.87 12.87 0.00 4.85
6808 6850 0.392327 GGCTGCCAAGGTTCTCTCTC 60.392 60.000 15.17 0.00 0.00 3.20
6809 6851 0.612744 GCTGCCAAGGTTCTCTCTCT 59.387 55.000 0.00 0.00 0.00 3.10
6810 6852 1.405391 GCTGCCAAGGTTCTCTCTCTC 60.405 57.143 0.00 0.00 0.00 3.20
6811 6853 2.178580 CTGCCAAGGTTCTCTCTCTCT 58.821 52.381 0.00 0.00 0.00 3.10
6812 6854 2.166254 CTGCCAAGGTTCTCTCTCTCTC 59.834 54.545 0.00 0.00 0.00 3.20
6813 6855 2.225242 TGCCAAGGTTCTCTCTCTCTCT 60.225 50.000 0.00 0.00 0.00 3.10
6814 6856 2.427095 GCCAAGGTTCTCTCTCTCTCTC 59.573 54.545 0.00 0.00 0.00 3.20
6815 6857 3.877735 GCCAAGGTTCTCTCTCTCTCTCT 60.878 52.174 0.00 0.00 0.00 3.10
6824 6866 5.136828 TCTCTCTCTCTCTCTCTCTCTCTC 58.863 50.000 0.00 0.00 0.00 3.20
6826 6868 5.136828 TCTCTCTCTCTCTCTCTCTCTCTC 58.863 50.000 0.00 0.00 0.00 3.20
6828 6870 5.136828 TCTCTCTCTCTCTCTCTCTCTCTC 58.863 50.000 0.00 0.00 0.00 3.20
6830 6872 5.136828 TCTCTCTCTCTCTCTCTCTCTCTC 58.863 50.000 0.00 0.00 0.00 3.20
6856 6898 6.718912 TCTCTCTCTCTCTCTCTCTCTCTATG 59.281 46.154 0.00 0.00 0.00 2.23
6858 6900 6.266330 TCTCTCTCTCTCTCTCTCTCTATGTG 59.734 46.154 0.00 0.00 0.00 3.21
6860 6902 5.917462 TCTCTCTCTCTCTCTCTATGTGTG 58.083 45.833 0.00 0.00 0.00 3.82
6862 6904 5.427378 TCTCTCTCTCTCTCTATGTGTGTG 58.573 45.833 0.00 0.00 0.00 3.82
6864 6906 4.940654 TCTCTCTCTCTCTATGTGTGTGTG 59.059 45.833 0.00 0.00 0.00 3.82
6866 6908 4.457257 TCTCTCTCTCTATGTGTGTGTGTG 59.543 45.833 0.00 0.00 0.00 3.82
6868 6910 4.022849 TCTCTCTCTATGTGTGTGTGTGTG 60.023 45.833 0.00 0.00 0.00 3.82
6870 6912 3.716601 TCTCTATGTGTGTGTGTGTGTG 58.283 45.455 0.00 0.00 0.00 3.82
6871 6913 3.132111 TCTCTATGTGTGTGTGTGTGTGT 59.868 43.478 0.00 0.00 0.00 3.72
6872 6914 3.194062 TCTATGTGTGTGTGTGTGTGTG 58.806 45.455 0.00 0.00 0.00 3.82
6873 6915 1.819928 ATGTGTGTGTGTGTGTGTGT 58.180 45.000 0.00 0.00 0.00 3.72
6874 6916 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
6875 6917 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
6876 6918 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
6877 6919 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
6878 6920 1.136085 GTGTGTGTGTGTGTGTGTGTC 60.136 52.381 0.00 0.00 0.00 3.67
6879 6921 1.270571 TGTGTGTGTGTGTGTGTGTCT 60.271 47.619 0.00 0.00 0.00 3.41
6880 6922 1.804151 GTGTGTGTGTGTGTGTGTCTT 59.196 47.619 0.00 0.00 0.00 3.01
6881 6923 2.225491 GTGTGTGTGTGTGTGTGTCTTT 59.775 45.455 0.00 0.00 0.00 2.52
6882 6924 2.225255 TGTGTGTGTGTGTGTGTCTTTG 59.775 45.455 0.00 0.00 0.00 2.77
6883 6925 2.225491 GTGTGTGTGTGTGTGTCTTTGT 59.775 45.455 0.00 0.00 0.00 2.83
6884 6926 2.225255 TGTGTGTGTGTGTGTCTTTGTG 59.775 45.455 0.00 0.00 0.00 3.33
6885 6927 2.225491 GTGTGTGTGTGTGTCTTTGTGT 59.775 45.455 0.00 0.00 0.00 3.72
6886 6928 2.225255 TGTGTGTGTGTGTCTTTGTGTG 59.775 45.455 0.00 0.00 0.00 3.82
6887 6929 2.225491 GTGTGTGTGTGTCTTTGTGTGT 59.775 45.455 0.00 0.00 0.00 3.72
6888 6930 2.225255 TGTGTGTGTGTCTTTGTGTGTG 59.775 45.455 0.00 0.00 0.00 3.82
6889 6931 2.225491 GTGTGTGTGTCTTTGTGTGTGT 59.775 45.455 0.00 0.00 0.00 3.72
6890 6932 2.225255 TGTGTGTGTCTTTGTGTGTGTG 59.775 45.455 0.00 0.00 0.00 3.82
6891 6933 2.225491 GTGTGTGTCTTTGTGTGTGTGT 59.775 45.455 0.00 0.00 0.00 3.72
6892 6934 2.225255 TGTGTGTCTTTGTGTGTGTGTG 59.775 45.455 0.00 0.00 0.00 3.82
6893 6935 2.225491 GTGTGTCTTTGTGTGTGTGTGT 59.775 45.455 0.00 0.00 0.00 3.72
6894 6936 2.225255 TGTGTCTTTGTGTGTGTGTGTG 59.775 45.455 0.00 0.00 0.00 3.82
6895 6937 2.225491 GTGTCTTTGTGTGTGTGTGTGT 59.775 45.455 0.00 0.00 0.00 3.72
6896 6938 2.225255 TGTCTTTGTGTGTGTGTGTGTG 59.775 45.455 0.00 0.00 0.00 3.82
6897 6939 2.225491 GTCTTTGTGTGTGTGTGTGTGT 59.775 45.455 0.00 0.00 0.00 3.72
6898 6940 2.225255 TCTTTGTGTGTGTGTGTGTGTG 59.775 45.455 0.00 0.00 0.00 3.82
6899 6941 1.598882 TTGTGTGTGTGTGTGTGTGT 58.401 45.000 0.00 0.00 0.00 3.72
6900 6942 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
6901 6943 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
6902 6944 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
6903 6945 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
6904 6946 0.871057 TGTGTGTGTGTGTGTGTGTG 59.129 50.000 0.00 0.00 0.00 3.82
6905 6947 0.871722 GTGTGTGTGTGTGTGTGTGT 59.128 50.000 0.00 0.00 0.00 3.72
6906 6948 1.136085 GTGTGTGTGTGTGTGTGTGTC 60.136 52.381 0.00 0.00 0.00 3.67
6907 6949 1.270571 TGTGTGTGTGTGTGTGTGTCT 60.271 47.619 0.00 0.00 0.00 3.41
6908 6950 1.128507 GTGTGTGTGTGTGTGTGTCTG 59.871 52.381 0.00 0.00 0.00 3.51
6909 6951 1.270571 TGTGTGTGTGTGTGTGTCTGT 60.271 47.619 0.00 0.00 0.00 3.41
6910 6952 1.393539 GTGTGTGTGTGTGTGTCTGTC 59.606 52.381 0.00 0.00 0.00 3.51
6911 6953 1.275010 TGTGTGTGTGTGTGTCTGTCT 59.725 47.619 0.00 0.00 0.00 3.41
6912 6954 2.289382 TGTGTGTGTGTGTGTCTGTCTT 60.289 45.455 0.00 0.00 0.00 3.01
6913 6955 2.742053 GTGTGTGTGTGTGTCTGTCTTT 59.258 45.455 0.00 0.00 0.00 2.52
6914 6956 2.741517 TGTGTGTGTGTGTCTGTCTTTG 59.258 45.455 0.00 0.00 0.00 2.77
6915 6957 2.742053 GTGTGTGTGTGTCTGTCTTTGT 59.258 45.455 0.00 0.00 0.00 2.83
6916 6958 3.000041 TGTGTGTGTGTCTGTCTTTGTC 59.000 45.455 0.00 0.00 0.00 3.18
6917 6959 3.262420 GTGTGTGTGTCTGTCTTTGTCT 58.738 45.455 0.00 0.00 0.00 3.41
6918 6960 3.307242 GTGTGTGTGTCTGTCTTTGTCTC 59.693 47.826 0.00 0.00 0.00 3.36
6919 6961 3.195610 TGTGTGTGTCTGTCTTTGTCTCT 59.804 43.478 0.00 0.00 0.00 3.10
6920 6962 3.799420 GTGTGTGTCTGTCTTTGTCTCTC 59.201 47.826 0.00 0.00 0.00 3.20
6921 6963 3.701542 TGTGTGTCTGTCTTTGTCTCTCT 59.298 43.478 0.00 0.00 0.00 3.10
6922 6964 4.202060 TGTGTGTCTGTCTTTGTCTCTCTC 60.202 45.833 0.00 0.00 0.00 3.20
6923 6965 4.037446 GTGTGTCTGTCTTTGTCTCTCTCT 59.963 45.833 0.00 0.00 0.00 3.10
6924 6966 4.646945 TGTGTCTGTCTTTGTCTCTCTCTT 59.353 41.667 0.00 0.00 0.00 2.85
6925 6967 5.828328 TGTGTCTGTCTTTGTCTCTCTCTTA 59.172 40.000 0.00 0.00 0.00 2.10
6926 6968 6.146898 GTGTCTGTCTTTGTCTCTCTCTTAC 58.853 44.000 0.00 0.00 0.00 2.34
6927 6969 5.828328 TGTCTGTCTTTGTCTCTCTCTTACA 59.172 40.000 0.00 0.00 0.00 2.41
6928 6970 6.146898 GTCTGTCTTTGTCTCTCTCTTACAC 58.853 44.000 0.00 0.00 0.00 2.90
6929 6971 5.828328 TCTGTCTTTGTCTCTCTCTTACACA 59.172 40.000 0.00 0.00 0.00 3.72
6930 6972 5.833082 TGTCTTTGTCTCTCTCTTACACAC 58.167 41.667 0.00 0.00 0.00 3.82
6932 6974 5.688176 GTCTTTGTCTCTCTCTTACACACAC 59.312 44.000 0.00 0.00 0.00 3.82
6934 6976 4.837896 TGTCTCTCTCTTACACACACAG 57.162 45.455 0.00 0.00 0.00 3.66
6940 6982 8.339714 GTCTCTCTCTTACACACACAGATATAC 58.660 40.741 0.00 0.00 0.00 1.47
6941 6983 8.268605 TCTCTCTCTTACACACACAGATATACT 58.731 37.037 0.00 0.00 0.00 2.12
6942 6984 9.549078 CTCTCTCTTACACACACAGATATACTA 57.451 37.037 0.00 0.00 0.00 1.82
7012 7060 3.950397 AGTACGGGAAAGCAATCATGAA 58.050 40.909 0.00 0.00 0.00 2.57
7015 7063 4.376340 ACGGGAAAGCAATCATGAATTC 57.624 40.909 0.00 0.00 0.00 2.17
7028 7076 7.256286 CAATCATGAATTCCTCTTTGAAGGAC 58.744 38.462 0.00 0.00 45.20 3.85
7086 7135 7.429374 TCAAAGTAGTCATGATCTCCATTCT 57.571 36.000 0.00 0.00 31.94 2.40
7096 7145 7.546316 GTCATGATCTCCATTCTCAGTATCATG 59.454 40.741 13.56 13.56 45.30 3.07
7100 7149 7.289549 TGATCTCCATTCTCAGTATCATGTTCT 59.710 37.037 0.00 0.00 0.00 3.01
7106 7155 8.607459 CCATTCTCAGTATCATGTTCTGTAAAC 58.393 37.037 11.72 0.00 0.00 2.01
7108 7157 8.988064 TTCTCAGTATCATGTTCTGTAAACTC 57.012 34.615 11.72 0.00 0.00 3.01
7109 7158 7.548097 TCTCAGTATCATGTTCTGTAAACTCC 58.452 38.462 11.72 0.00 0.00 3.85
7111 7160 7.323420 TCAGTATCATGTTCTGTAAACTCCTG 58.677 38.462 11.72 0.00 0.00 3.86
7122 7178 8.521176 GTTCTGTAAACTCCTGTCATCTTACTA 58.479 37.037 0.00 0.00 0.00 1.82
7124 7180 8.740906 TCTGTAAACTCCTGTCATCTTACTAAG 58.259 37.037 0.00 0.00 0.00 2.18
7153 7209 2.672874 TGCAGATATTGACGAGTGCAAC 59.327 45.455 0.00 0.00 37.95 4.17
7155 7211 3.242220 GCAGATATTGACGAGTGCAACAG 60.242 47.826 0.00 0.00 41.43 3.16
7158 7214 1.512926 ATTGACGAGTGCAACAGACC 58.487 50.000 0.00 0.00 41.43 3.85
7161 7217 0.946221 GACGAGTGCAACAGACCAGG 60.946 60.000 0.00 0.00 41.43 4.45
7169 7225 0.387622 CAACAGACCAGGCATTTGCG 60.388 55.000 0.00 0.00 43.26 4.85
7181 7237 1.268743 GCATTTGCGAAGGAGTATGCC 60.269 52.381 1.65 0.00 40.05 4.40
7187 7243 4.085357 TGCGAAGGAGTATGCCATAATT 57.915 40.909 0.00 0.00 0.00 1.40
7197 7253 8.986991 AGGAGTATGCCATAATTCTATAGGAAG 58.013 37.037 0.00 0.00 37.36 3.46
7198 7254 8.207545 GGAGTATGCCATAATTCTATAGGAAGG 58.792 40.741 0.00 0.00 37.36 3.46
7202 7258 7.865530 TGCCATAATTCTATAGGAAGGTACA 57.134 36.000 0.00 0.00 37.36 2.90
7210 7266 9.760077 AATTCTATAGGAAGGTACAATTGTACG 57.240 33.333 32.07 19.75 42.15 3.67
7211 7267 9.139734 ATTCTATAGGAAGGTACAATTGTACGA 57.860 33.333 32.07 21.25 42.15 3.43
7222 7278 3.190535 ACAATTGTACGAATTGTCCTGGC 59.809 43.478 20.93 0.00 44.83 4.85
7225 7281 2.852449 TGTACGAATTGTCCTGGCAAA 58.148 42.857 7.46 0.00 31.63 3.68
7238 7294 3.758023 TCCTGGCAAAACACAGTATGATG 59.242 43.478 0.00 0.00 39.69 3.07
7242 7298 4.764308 TGGCAAAACACAGTATGATGCTAA 59.236 37.500 0.00 0.00 39.69 3.09
7247 7303 7.168972 GCAAAACACAGTATGATGCTAAAACAA 59.831 33.333 0.00 0.00 39.69 2.83
7261 7317 2.228138 AAACAATGCAGTGCACCTTG 57.772 45.000 22.44 23.14 43.04 3.61
7264 7320 0.669619 CAATGCAGTGCACCTTGACA 59.330 50.000 22.44 9.13 43.04 3.58
7267 7323 1.180907 TGCAGTGCACCTTGACAAAA 58.819 45.000 15.37 0.00 31.71 2.44
7289 7345 5.712152 AAAGCAAAATCTTCTACTGGGTG 57.288 39.130 0.00 0.00 0.00 4.61
7292 7348 3.127721 GCAAAATCTTCTACTGGGTGAGC 59.872 47.826 0.00 0.00 0.00 4.26
7294 7350 4.479786 AAATCTTCTACTGGGTGAGCTC 57.520 45.455 6.82 6.82 0.00 4.09
7298 7354 5.648330 TCTTCTACTGGGTGAGCTCTATA 57.352 43.478 16.19 0.00 0.00 1.31
7302 7358 5.817784 TCTACTGGGTGAGCTCTATATACC 58.182 45.833 16.19 13.24 0.00 2.73
7307 7363 4.833380 TGGGTGAGCTCTATATACCAGTTC 59.167 45.833 18.84 5.25 33.10 3.01
7340 7397 8.909708 TTACAGTGAACATGAACAAGAAAAAG 57.090 30.769 0.00 0.00 0.00 2.27
7350 7407 3.169355 ACAAGAAAAAGGCAGCACAAG 57.831 42.857 0.00 0.00 0.00 3.16
7357 7414 1.528129 AAGGCAGCACAAGACTAAGC 58.472 50.000 0.00 0.00 0.00 3.09
7398 7455 1.256812 GTGTTGGCATTGGGCTTAGT 58.743 50.000 0.00 0.00 44.01 2.24
7410 7467 0.822164 GGCTTAGTAGTGGCTTCGGA 59.178 55.000 0.00 0.00 0.00 4.55
7445 7502 7.065085 TCTCAGCTCAATTACAATAGTTCTTGC 59.935 37.037 0.00 0.00 0.00 4.01
7548 7605 7.692705 CAGCTAATATCATCAGATGAAAATGCG 59.307 37.037 17.24 9.35 43.50 4.73
7566 7623 4.251543 TGCGAGTGACAAGACAAAGATA 57.748 40.909 0.00 0.00 0.00 1.98
7609 7666 7.955918 AGAGAAGGCAACAAATAACTTTGATT 58.044 30.769 5.17 0.00 43.71 2.57
7663 7720 2.513753 TGGTGTACAAAGGCATCTTGG 58.486 47.619 0.00 0.00 32.75 3.61
7705 7762 7.825270 TGGCGATAAAAAGGTCTAAGAACATTA 59.175 33.333 0.00 0.00 0.00 1.90
7744 7801 9.330063 TCAGTCAATTTATTAATGAGGTAGCAG 57.670 33.333 0.00 0.00 0.00 4.24
7986 8043 1.859080 GTGTCAGTCTTTCACCGTGAC 59.141 52.381 0.00 0.00 38.41 3.67
8007 8064 8.682895 CGTGACGTGAAATCTTCTAATATACTG 58.317 37.037 0.00 0.00 0.00 2.74
8085 8142 4.082245 CCTATTGACCAAACCCATGTTGTC 60.082 45.833 0.00 0.00 34.13 3.18
8157 8214 1.003108 GGCAGCTAAACGAGAAGAGC 58.997 55.000 0.00 0.00 35.07 4.09
8223 8280 5.262009 AGAAGGGAGCCTATTTTTACAACC 58.738 41.667 0.00 0.00 31.13 3.77
8293 8350 2.503895 AGTGAGGCCAATCAAAGAGG 57.496 50.000 5.01 0.00 0.00 3.69
8297 8354 1.203287 GAGGCCAATCAAAGAGGTTGC 59.797 52.381 5.01 0.00 37.13 4.17
8409 8466 8.658840 AAGAGAGACCTACTATGAAAGAAGTT 57.341 34.615 0.00 0.00 0.00 2.66
8427 8484 6.291377 AGAAGTTGAGATGACTTTGCAGTTA 58.709 36.000 0.00 0.00 37.46 2.24
8451 8508 3.562557 TGCGAACTAAAAGGTCAAACTCC 59.437 43.478 0.00 0.00 29.18 3.85
8452 8509 3.562557 GCGAACTAAAAGGTCAAACTCCA 59.437 43.478 0.00 0.00 29.18 3.86
8460 8517 1.598701 GGTCAAACTCCAGCCATGCC 61.599 60.000 0.00 0.00 0.00 4.40
8462 8519 0.895100 TCAAACTCCAGCCATGCCAC 60.895 55.000 0.00 0.00 0.00 5.01
8466 8523 4.100084 TCCAGCCATGCCACTCCG 62.100 66.667 0.00 0.00 0.00 4.63
8479 8536 2.491693 GCCACTCCGGAAAATGATGAAA 59.508 45.455 5.23 0.00 36.56 2.69
8506 8563 3.199677 CAACCACTCCAACGTACAAGAA 58.800 45.455 0.00 0.00 0.00 2.52
8510 8567 2.800544 CACTCCAACGTACAAGAACTGG 59.199 50.000 0.00 0.00 0.00 4.00
8552 8609 2.491693 CCATTAACTTGGGCAACGATGT 59.508 45.455 0.00 0.00 34.09 3.06
8578 8635 5.818136 TTCTGAGTCTCAAAACAACCAAG 57.182 39.130 3.67 0.00 0.00 3.61
8586 8643 5.754890 GTCTCAAAACAACCAAGAATGCAAT 59.245 36.000 0.00 0.00 0.00 3.56
8591 8648 4.445452 ACAACCAAGAATGCAATAGCTG 57.555 40.909 0.00 0.00 42.74 4.24
8602 8659 2.009042 GCAATAGCTGCGAACAGGAGT 61.009 52.381 0.00 0.00 44.63 3.85
8603 8660 2.350522 CAATAGCTGCGAACAGGAGTT 58.649 47.619 0.00 0.00 44.63 3.01
8604 8661 3.521560 CAATAGCTGCGAACAGGAGTTA 58.478 45.455 0.00 0.00 44.63 2.24
8608 8665 3.522553 AGCTGCGAACAGGAGTTATTAC 58.477 45.455 0.00 0.00 44.63 1.89
8613 8670 3.428589 GCGAACAGGAGTTATTACGGTCT 60.429 47.826 0.00 0.00 38.30 3.85
8643 8700 2.158385 ACCACAGTAAGGGCCAATTTGA 60.158 45.455 6.18 0.00 0.00 2.69
8692 8749 6.293680 GGAGGAAAAGTTGCTTTCACTTAGAG 60.294 42.308 0.00 0.00 37.09 2.43
8771 8876 6.877611 AGGACTTAAATGTGTGTACCTTTG 57.122 37.500 0.00 0.00 0.00 2.77
8792 8897 9.846248 CCTTTGATTTATCTTTCTTACCAAGTG 57.154 33.333 0.00 0.00 0.00 3.16
8820 8925 7.004555 TGTACACTAGATCACTTGTTTCCAT 57.995 36.000 0.00 0.00 30.52 3.41
8878 8984 7.671495 TCAATTTTGATGAAGAAGATGACGA 57.329 32.000 0.00 0.00 31.01 4.20
8879 8985 8.272545 TCAATTTTGATGAAGAAGATGACGAT 57.727 30.769 0.00 0.00 31.01 3.73
8880 8986 9.382275 TCAATTTTGATGAAGAAGATGACGATA 57.618 29.630 0.00 0.00 31.01 2.92
8881 8987 9.430838 CAATTTTGATGAAGAAGATGACGATAC 57.569 33.333 0.00 0.00 0.00 2.24
8882 8988 8.722480 ATTTTGATGAAGAAGATGACGATACA 57.278 30.769 0.00 0.00 0.00 2.29
8883 8989 8.546597 TTTTGATGAAGAAGATGACGATACAA 57.453 30.769 0.00 0.00 0.00 2.41
8884 8990 8.546597 TTTGATGAAGAAGATGACGATACAAA 57.453 30.769 0.00 0.00 0.00 2.83
8885 8991 7.525688 TGATGAAGAAGATGACGATACAAAC 57.474 36.000 0.00 0.00 0.00 2.93
8886 8992 7.323420 TGATGAAGAAGATGACGATACAAACT 58.677 34.615 0.00 0.00 0.00 2.66
8887 8993 6.951256 TGAAGAAGATGACGATACAAACTG 57.049 37.500 0.00 0.00 0.00 3.16
8888 8994 5.348724 TGAAGAAGATGACGATACAAACTGC 59.651 40.000 0.00 0.00 0.00 4.40
8889 8995 4.820897 AGAAGATGACGATACAAACTGCA 58.179 39.130 0.00 0.00 0.00 4.41
8890 8996 5.423015 AGAAGATGACGATACAAACTGCAT 58.577 37.500 0.00 0.00 0.00 3.96
8891 8997 5.292834 AGAAGATGACGATACAAACTGCATG 59.707 40.000 0.00 0.00 0.00 4.06
8892 8998 4.507710 AGATGACGATACAAACTGCATGT 58.492 39.130 0.00 0.00 34.81 3.21
8893 8999 5.660460 AGATGACGATACAAACTGCATGTA 58.340 37.500 1.32 1.32 37.64 2.29
8894 9000 5.750547 AGATGACGATACAAACTGCATGTAG 59.249 40.000 9.50 9.50 36.75 2.74
8895 9001 4.816392 TGACGATACAAACTGCATGTAGT 58.184 39.130 11.03 11.03 36.75 2.73
8896 9002 4.625311 TGACGATACAAACTGCATGTAGTG 59.375 41.667 17.67 8.45 36.75 2.74
8907 9013 1.086696 CATGTAGTGCCCAAACCTCG 58.913 55.000 0.00 0.00 0.00 4.63
8908 9014 0.690762 ATGTAGTGCCCAAACCTCGT 59.309 50.000 0.00 0.00 0.00 4.18
8909 9015 1.340088 TGTAGTGCCCAAACCTCGTA 58.660 50.000 0.00 0.00 0.00 3.43
8910 9016 1.903860 TGTAGTGCCCAAACCTCGTAT 59.096 47.619 0.00 0.00 0.00 3.06
8911 9017 2.277084 GTAGTGCCCAAACCTCGTATG 58.723 52.381 0.00 0.00 0.00 2.39
8912 9018 0.690762 AGTGCCCAAACCTCGTATGT 59.309 50.000 0.00 0.00 0.00 2.29
8913 9019 0.802494 GTGCCCAAACCTCGTATGTG 59.198 55.000 0.00 0.00 0.00 3.21
8914 9020 0.958382 TGCCCAAACCTCGTATGTGC 60.958 55.000 0.00 0.00 0.00 4.57
8915 9021 0.676782 GCCCAAACCTCGTATGTGCT 60.677 55.000 0.00 0.00 0.00 4.40
8916 9022 1.369625 CCCAAACCTCGTATGTGCTC 58.630 55.000 0.00 0.00 0.00 4.26
8917 9023 0.999406 CCAAACCTCGTATGTGCTCG 59.001 55.000 0.00 0.00 0.00 5.03
8918 9024 1.671850 CCAAACCTCGTATGTGCTCGT 60.672 52.381 0.00 0.00 0.00 4.18
8919 9025 2.416296 CCAAACCTCGTATGTGCTCGTA 60.416 50.000 0.00 0.00 0.00 3.43
8920 9026 2.846039 AACCTCGTATGTGCTCGTAG 57.154 50.000 0.00 0.00 0.00 3.51
8921 9027 2.034104 ACCTCGTATGTGCTCGTAGA 57.966 50.000 0.00 0.00 0.00 2.59
8922 9028 1.669779 ACCTCGTATGTGCTCGTAGAC 59.330 52.381 0.00 0.00 0.00 2.59
8923 9029 1.332993 CCTCGTATGTGCTCGTAGACG 60.333 57.143 0.00 0.00 41.45 4.18
8942 9048 4.905412 ACGATTACTTTTCGTCAAGAGC 57.095 40.909 0.00 0.00 46.13 4.09
8943 9049 4.557205 ACGATTACTTTTCGTCAAGAGCT 58.443 39.130 0.00 0.00 46.13 4.09
8944 9050 5.706916 ACGATTACTTTTCGTCAAGAGCTA 58.293 37.500 0.00 0.00 46.13 3.32
8945 9051 6.331061 ACGATTACTTTTCGTCAAGAGCTAT 58.669 36.000 0.00 0.00 46.13 2.97
8946 9052 6.812160 ACGATTACTTTTCGTCAAGAGCTATT 59.188 34.615 0.00 0.00 46.13 1.73
8947 9053 7.972277 ACGATTACTTTTCGTCAAGAGCTATTA 59.028 33.333 0.00 0.00 46.13 0.98
8948 9054 8.260550 CGATTACTTTTCGTCAAGAGCTATTAC 58.739 37.037 0.00 0.00 32.08 1.89
8949 9055 7.502177 TTACTTTTCGTCAAGAGCTATTACG 57.498 36.000 13.38 13.38 34.99 3.18
8950 9056 4.326548 ACTTTTCGTCAAGAGCTATTACGC 59.673 41.667 14.24 0.35 33.75 4.42
8951 9057 3.497297 TTCGTCAAGAGCTATTACGCA 57.503 42.857 14.24 5.31 33.75 5.24
8952 9058 3.066369 TCGTCAAGAGCTATTACGCAG 57.934 47.619 14.24 0.00 33.75 5.18
8954 9060 2.784380 CGTCAAGAGCTATTACGCAGTC 59.216 50.000 0.00 0.00 43.93 3.51
8955 9061 2.784380 GTCAAGAGCTATTACGCAGTCG 59.216 50.000 0.00 0.00 43.93 4.18
8971 9077 3.803082 CGTCGAACCGGCCGAGTA 61.803 66.667 30.73 5.11 36.66 2.59
8972 9078 2.202531 GTCGAACCGGCCGAGTAC 60.203 66.667 30.73 13.92 36.66 2.73
8973 9079 2.360350 TCGAACCGGCCGAGTACT 60.360 61.111 30.73 8.77 0.00 2.73
8974 9080 1.973281 TCGAACCGGCCGAGTACTT 60.973 57.895 30.73 9.26 0.00 2.24
8975 9081 1.080298 CGAACCGGCCGAGTACTTT 60.080 57.895 30.73 9.28 0.00 2.66
8976 9082 1.074872 CGAACCGGCCGAGTACTTTC 61.075 60.000 30.73 16.53 0.00 2.62
8977 9083 0.738762 GAACCGGCCGAGTACTTTCC 60.739 60.000 30.73 5.31 0.00 3.13
8978 9084 1.474332 AACCGGCCGAGTACTTTCCA 61.474 55.000 30.73 0.00 0.00 3.53
8979 9085 1.294138 CCGGCCGAGTACTTTCCAA 59.706 57.895 30.73 0.00 0.00 3.53
8980 9086 1.017701 CCGGCCGAGTACTTTCCAAC 61.018 60.000 30.73 0.00 0.00 3.77
8981 9087 1.017701 CGGCCGAGTACTTTCCAACC 61.018 60.000 24.07 0.00 0.00 3.77
8982 9088 1.017701 GGCCGAGTACTTTCCAACCG 61.018 60.000 0.00 0.00 0.00 4.44
8983 9089 0.320160 GCCGAGTACTTTCCAACCGT 60.320 55.000 0.00 0.00 0.00 4.83
8984 9090 1.067635 GCCGAGTACTTTCCAACCGTA 60.068 52.381 0.00 0.00 0.00 4.02
8985 9091 2.599659 CCGAGTACTTTCCAACCGTAC 58.400 52.381 0.00 0.00 35.05 3.67
8986 9092 2.030007 CCGAGTACTTTCCAACCGTACA 60.030 50.000 0.00 0.00 36.77 2.90
8987 9093 3.367703 CCGAGTACTTTCCAACCGTACAT 60.368 47.826 0.00 0.00 36.77 2.29
8988 9094 4.142403 CCGAGTACTTTCCAACCGTACATA 60.142 45.833 0.00 0.00 36.77 2.29
8989 9095 5.450965 CCGAGTACTTTCCAACCGTACATAT 60.451 44.000 0.00 0.00 36.77 1.78
8990 9096 6.238731 CCGAGTACTTTCCAACCGTACATATA 60.239 42.308 0.00 0.00 36.77 0.86
8991 9097 6.854892 CGAGTACTTTCCAACCGTACATATAG 59.145 42.308 0.00 0.00 36.77 1.31
8992 9098 7.254898 CGAGTACTTTCCAACCGTACATATAGA 60.255 40.741 0.00 0.00 36.77 1.98
8993 9099 7.710896 AGTACTTTCCAACCGTACATATAGAC 58.289 38.462 0.00 0.00 36.77 2.59
8994 9100 6.786967 ACTTTCCAACCGTACATATAGACT 57.213 37.500 0.00 0.00 0.00 3.24
8995 9101 6.570692 ACTTTCCAACCGTACATATAGACTG 58.429 40.000 0.00 0.00 0.00 3.51
8996 9102 4.579454 TCCAACCGTACATATAGACTGC 57.421 45.455 0.00 0.00 0.00 4.40
8997 9103 3.955551 TCCAACCGTACATATAGACTGCA 59.044 43.478 0.00 0.00 0.00 4.41
8998 9104 4.049186 CCAACCGTACATATAGACTGCAC 58.951 47.826 0.00 0.00 0.00 4.57
9002 9108 4.024556 ACCGTACATATAGACTGCACGTAC 60.025 45.833 0.00 0.00 0.00 3.67
9023 9129 6.976925 CGTACGACCATAGAAGGTTTTATTCT 59.023 38.462 10.44 0.00 43.38 2.40
9122 9228 5.724328 TGCTCAACACAAACACCAAATAAA 58.276 33.333 0.00 0.00 0.00 1.40
9149 9255 7.507616 ACTTATTTAGGTTCAACACAAATCCCA 59.492 33.333 2.70 0.00 0.00 4.37
9167 9273 4.172807 TCCCAAAAGTATAGGGAGTGTGT 58.827 43.478 0.00 0.00 46.42 3.72
9225 9331 1.800586 CACATCGTCACTTCACCCTTG 59.199 52.381 0.00 0.00 0.00 3.61
9297 9403 7.757097 AGCAACTGAACTAGTATCAAATACG 57.243 36.000 0.00 0.00 39.18 3.06
9378 9484 3.731652 TTGTTCACTTTGCCATCCTTG 57.268 42.857 0.00 0.00 0.00 3.61
9425 9531 1.374758 GCTTCCAGTGACCAGTCCG 60.375 63.158 0.00 0.00 0.00 4.79
9438 9544 2.158871 ACCAGTCCGTTTGCAGTAGAAA 60.159 45.455 0.00 0.00 0.00 2.52
9533 9640 1.158007 TTCCCCTTCTTCCCTTTGCT 58.842 50.000 0.00 0.00 0.00 3.91
9603 9710 3.973206 TCTTGATTTCTACCTTCGCCA 57.027 42.857 0.00 0.00 0.00 5.69
9608 9715 5.309323 TGATTTCTACCTTCGCCAATTTG 57.691 39.130 0.00 0.00 0.00 2.32
9614 9721 1.895131 ACCTTCGCCAATTTGAGCATT 59.105 42.857 0.00 0.00 0.00 3.56
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
30 31 5.067805 CCATAGTTTAGGGCTCAAAATGGAC 59.932 44.000 6.45 0.00 0.00 4.02
64 67 2.161012 TCCTAGTACAGCGTTCAAGTCG 59.839 50.000 0.00 0.00 0.00 4.18
75 78 5.979288 ATATAGCCGGTTTCCTAGTACAG 57.021 43.478 1.90 0.00 0.00 2.74
82 85 7.514721 TCAGAATTTAATATAGCCGGTTTCCT 58.485 34.615 1.90 0.00 0.00 3.36
167 170 8.484214 AGTTGATGATACTTCTAAGCTATCCA 57.516 34.615 0.00 0.00 0.00 3.41
203 206 8.740123 TTTACTGTTCCTTCAATACTGTTCAA 57.260 30.769 0.00 0.00 0.00 2.69
204 207 8.740123 TTTTACTGTTCCTTCAATACTGTTCA 57.260 30.769 0.00 0.00 0.00 3.18
325 339 8.792830 TTGAAGGATAGAAAGGTTGACTTATG 57.207 34.615 0.00 0.00 38.85 1.90
326 340 9.807921 TTTTGAAGGATAGAAAGGTTGACTTAT 57.192 29.630 0.00 0.00 38.85 1.73
375 389 5.479306 ACGTCAAGACTATAGCAATGTTGT 58.521 37.500 0.00 0.00 0.00 3.32
444 458 2.093711 CCCCGCAAAATAAAAGGAAGGG 60.094 50.000 0.00 0.00 36.22 3.95
454 468 0.885196 GCTGTGTTCCCCGCAAAATA 59.115 50.000 0.00 0.00 32.02 1.40
462 476 2.213499 CTCGATTATGCTGTGTTCCCC 58.787 52.381 0.00 0.00 0.00 4.81
482 496 2.567169 GCTATTTGGATATTTGGCCCCC 59.433 50.000 0.00 0.00 0.00 5.40
621 635 5.359756 CGGGAGACTGTGAAATGATGAATA 58.640 41.667 0.00 0.00 0.00 1.75
679 693 8.299570 CAACAGCACCTTAACTAAATCTTTCAT 58.700 33.333 0.00 0.00 0.00 2.57
742 756 7.866898 CACATGAATAACTGGACAAACATGAAA 59.133 33.333 0.00 0.00 37.74 2.69
747 761 6.150976 GGATCACATGAATAACTGGACAAACA 59.849 38.462 0.00 0.00 0.00 2.83
846 860 2.116125 GGTGGAACTGCCTTGCCT 59.884 61.111 0.00 0.00 36.74 4.75
863 877 3.129502 CAGGAGTGCCCACATGCG 61.130 66.667 0.82 0.00 37.41 4.73
872 886 0.801251 GCAGATGTTGTCAGGAGTGC 59.199 55.000 0.00 0.00 0.00 4.40
986 1000 8.969260 ATGAACAATCATCTCTAATACTGCAA 57.031 30.769 0.00 0.00 42.75 4.08
1011 1027 2.553028 GCTCATCTCCACCTTCCACAAA 60.553 50.000 0.00 0.00 0.00 2.83
1048 1064 5.471456 CACAAACAAGTAAGAGCAGAGGAAT 59.529 40.000 0.00 0.00 0.00 3.01
1060 1076 2.490328 GCTGCAGCACAAACAAGTAA 57.510 45.000 33.36 0.00 41.59 2.24
1083 1099 1.210155 GTTGGAAGCATGCACCGTC 59.790 57.895 21.98 14.49 0.00 4.79
1135 1151 4.056125 GCTCCTTTGGCAACCGGC 62.056 66.667 0.00 0.00 43.74 6.13
1149 1165 0.179062 ATGTCAGATTCCCGCAGCTC 60.179 55.000 0.00 0.00 0.00 4.09
1152 1168 0.933097 CGAATGTCAGATTCCCGCAG 59.067 55.000 0.00 0.00 0.00 5.18
1164 1180 2.872858 GCCAAAGGGATAGTCGAATGTC 59.127 50.000 0.53 0.53 35.59 3.06
1167 1183 3.744660 GATGCCAAAGGGATAGTCGAAT 58.255 45.455 0.00 0.00 32.75 3.34
1215 1231 3.413846 TTGCAGATGAGCTCAAAGTCT 57.586 42.857 22.50 16.38 34.99 3.24
1221 1237 2.931969 CGTGTTATTGCAGATGAGCTCA 59.068 45.455 20.79 20.79 34.99 4.26
1222 1238 3.000724 GTCGTGTTATTGCAGATGAGCTC 59.999 47.826 6.82 6.82 34.99 4.09
1236 1252 1.801771 CTTGGGATTTGCGTCGTGTTA 59.198 47.619 0.00 0.00 0.00 2.41
1240 1256 2.332654 GCCTTGGGATTTGCGTCGT 61.333 57.895 0.00 0.00 0.00 4.34
1242 1258 0.678048 AGAGCCTTGGGATTTGCGTC 60.678 55.000 0.00 0.00 0.00 5.19
1289 1305 5.107837 GCAGAATTAATGTCGATGTCGTAGG 60.108 44.000 2.04 0.00 40.80 3.18
1290 1306 5.687730 AGCAGAATTAATGTCGATGTCGTAG 59.312 40.000 2.04 0.00 40.80 3.51
1291 1307 5.588240 AGCAGAATTAATGTCGATGTCGTA 58.412 37.500 2.04 0.00 40.80 3.43
1306 1322 2.378547 TGTTACCTGGGGAAGCAGAATT 59.621 45.455 0.00 0.00 0.00 2.17
1313 1329 1.338769 CGGAAGTGTTACCTGGGGAAG 60.339 57.143 0.00 0.00 0.00 3.46
1316 1332 1.298667 CCGGAAGTGTTACCTGGGG 59.701 63.158 0.00 0.00 0.00 4.96
1318 1334 2.419574 CCATACCGGAAGTGTTACCTGG 60.420 54.545 9.46 0.00 36.56 4.45
1326 1342 0.464373 AGCATGCCATACCGGAAGTG 60.464 55.000 15.66 3.17 36.56 3.16
1327 1343 1.128200 TAGCATGCCATACCGGAAGT 58.872 50.000 15.66 0.00 36.56 3.01
1330 1346 1.977854 AGATTAGCATGCCATACCGGA 59.022 47.619 15.66 0.00 36.56 5.14
1365 1381 4.072131 ACACCAATGCCCGCTTATAATAG 58.928 43.478 0.00 0.00 0.00 1.73
1366 1382 4.093472 ACACCAATGCCCGCTTATAATA 57.907 40.909 0.00 0.00 0.00 0.98
1367 1383 2.944129 ACACCAATGCCCGCTTATAAT 58.056 42.857 0.00 0.00 0.00 1.28
1368 1384 2.428544 ACACCAATGCCCGCTTATAA 57.571 45.000 0.00 0.00 0.00 0.98
1369 1385 2.294074 GAACACCAATGCCCGCTTATA 58.706 47.619 0.00 0.00 0.00 0.98
1370 1386 1.102978 GAACACCAATGCCCGCTTAT 58.897 50.000 0.00 0.00 0.00 1.73
1371 1387 0.250945 TGAACACCAATGCCCGCTTA 60.251 50.000 0.00 0.00 0.00 3.09
1372 1388 1.526575 CTGAACACCAATGCCCGCTT 61.527 55.000 0.00 0.00 0.00 4.68
1373 1389 1.973281 CTGAACACCAATGCCCGCT 60.973 57.895 0.00 0.00 0.00 5.52
1374 1390 2.568090 CTGAACACCAATGCCCGC 59.432 61.111 0.00 0.00 0.00 6.13
1375 1391 1.526575 AAGCTGAACACCAATGCCCG 61.527 55.000 0.00 0.00 0.00 6.13
1376 1392 0.037975 CAAGCTGAACACCAATGCCC 60.038 55.000 0.00 0.00 0.00 5.36
1377 1393 0.675633 ACAAGCTGAACACCAATGCC 59.324 50.000 0.00 0.00 0.00 4.40
1378 1394 2.129607 CAACAAGCTGAACACCAATGC 58.870 47.619 0.00 0.00 0.00 3.56
1379 1395 2.746269 CCAACAAGCTGAACACCAATG 58.254 47.619 0.00 0.00 0.00 2.82
1380 1396 1.069049 GCCAACAAGCTGAACACCAAT 59.931 47.619 0.00 0.00 0.00 3.16
1381 1397 0.459489 GCCAACAAGCTGAACACCAA 59.541 50.000 0.00 0.00 0.00 3.67
1382 1398 1.391157 GGCCAACAAGCTGAACACCA 61.391 55.000 0.00 0.00 0.00 4.17
1383 1399 1.363807 GGCCAACAAGCTGAACACC 59.636 57.895 0.00 0.00 0.00 4.16
1384 1400 1.363807 GGGCCAACAAGCTGAACAC 59.636 57.895 4.39 0.00 0.00 3.32
1385 1401 1.076412 TGGGCCAACAAGCTGAACA 60.076 52.632 2.13 0.00 0.00 3.18
1386 1402 1.109323 ACTGGGCCAACAAGCTGAAC 61.109 55.000 8.04 0.00 0.00 3.18
1387 1403 0.823356 GACTGGGCCAACAAGCTGAA 60.823 55.000 8.04 0.00 0.00 3.02
1388 1404 1.228245 GACTGGGCCAACAAGCTGA 60.228 57.895 8.04 0.00 0.00 4.26
1389 1405 1.108727 TTGACTGGGCCAACAAGCTG 61.109 55.000 17.84 3.75 0.00 4.24
1390 1406 1.109323 GTTGACTGGGCCAACAAGCT 61.109 55.000 20.88 0.00 42.40 3.74
1391 1407 1.363807 GTTGACTGGGCCAACAAGC 59.636 57.895 20.88 14.03 42.40 4.01
1395 1411 2.551912 CGGTGTTGACTGGGCCAAC 61.552 63.158 8.04 2.89 42.96 3.77
1396 1412 2.203280 CGGTGTTGACTGGGCCAA 60.203 61.111 8.04 0.00 0.00 4.52
1397 1413 3.469863 GACGGTGTTGACTGGGCCA 62.470 63.158 5.85 5.85 32.03 5.36
1398 1414 2.668550 GACGGTGTTGACTGGGCC 60.669 66.667 0.00 0.00 32.03 5.80
1399 1415 3.041940 CGACGGTGTTGACTGGGC 61.042 66.667 0.00 0.00 32.03 5.36
1400 1416 1.372997 CTCGACGGTGTTGACTGGG 60.373 63.158 0.00 0.00 32.03 4.45
1401 1417 0.594602 TACTCGACGGTGTTGACTGG 59.405 55.000 0.00 0.00 32.03 4.00
1402 1418 2.631418 ATACTCGACGGTGTTGACTG 57.369 50.000 0.00 0.00 34.25 3.51
1403 1419 2.295349 ACAATACTCGACGGTGTTGACT 59.705 45.455 22.69 7.58 39.53 3.41
1404 1420 2.660236 GACAATACTCGACGGTGTTGAC 59.340 50.000 22.69 16.52 39.53 3.18
1405 1421 2.555325 AGACAATACTCGACGGTGTTGA 59.445 45.455 22.69 1.61 39.53 3.18
1406 1422 2.661675 CAGACAATACTCGACGGTGTTG 59.338 50.000 17.70 17.70 41.73 3.33
1407 1423 2.555325 TCAGACAATACTCGACGGTGTT 59.445 45.455 0.00 0.00 0.00 3.32
1408 1424 2.095364 GTCAGACAATACTCGACGGTGT 60.095 50.000 0.00 0.00 0.00 4.16
1409 1425 2.516923 GTCAGACAATACTCGACGGTG 58.483 52.381 0.00 0.00 0.00 4.94
1410 1426 1.129998 CGTCAGACAATACTCGACGGT 59.870 52.381 0.41 0.00 44.21 4.83
1411 1427 1.395954 TCGTCAGACAATACTCGACGG 59.604 52.381 9.98 0.00 47.00 4.79
1413 1429 4.510711 TCCTATCGTCAGACAATACTCGAC 59.489 45.833 0.41 0.00 0.00 4.20
1414 1430 4.700700 TCCTATCGTCAGACAATACTCGA 58.299 43.478 0.41 0.00 0.00 4.04
1415 1431 5.206299 GTTCCTATCGTCAGACAATACTCG 58.794 45.833 0.41 0.00 0.00 4.18
1416 1432 5.007430 TCGTTCCTATCGTCAGACAATACTC 59.993 44.000 0.41 0.00 0.00 2.59
1417 1433 4.880120 TCGTTCCTATCGTCAGACAATACT 59.120 41.667 0.41 0.00 0.00 2.12
1418 1434 4.968788 GTCGTTCCTATCGTCAGACAATAC 59.031 45.833 0.41 0.00 0.00 1.89
1419 1435 4.260497 CGTCGTTCCTATCGTCAGACAATA 60.260 45.833 0.41 0.00 0.00 1.90
1420 1436 3.487042 CGTCGTTCCTATCGTCAGACAAT 60.487 47.826 0.41 0.00 0.00 2.71
1421 1437 2.159612 CGTCGTTCCTATCGTCAGACAA 60.160 50.000 0.41 0.00 0.00 3.18
1422 1438 1.395954 CGTCGTTCCTATCGTCAGACA 59.604 52.381 0.41 0.00 0.00 3.41
1423 1439 1.662629 TCGTCGTTCCTATCGTCAGAC 59.337 52.381 0.00 0.00 0.00 3.51
1424 1440 2.014335 TCGTCGTTCCTATCGTCAGA 57.986 50.000 0.00 0.00 0.00 3.27
1425 1441 4.463515 TTATCGTCGTTCCTATCGTCAG 57.536 45.455 0.00 0.00 0.00 3.51
1426 1442 4.787563 GCTTTATCGTCGTTCCTATCGTCA 60.788 45.833 0.00 0.00 0.00 4.35
1427 1443 3.663105 GCTTTATCGTCGTTCCTATCGTC 59.337 47.826 0.00 0.00 0.00 4.20
1428 1444 3.625938 GCTTTATCGTCGTTCCTATCGT 58.374 45.455 0.00 0.00 0.00 3.73
1429 1445 2.650765 CGCTTTATCGTCGTTCCTATCG 59.349 50.000 0.00 0.00 0.00 2.92
1430 1446 3.881795 TCGCTTTATCGTCGTTCCTATC 58.118 45.455 0.00 0.00 0.00 2.08
1431 1447 3.976793 TCGCTTTATCGTCGTTCCTAT 57.023 42.857 0.00 0.00 0.00 2.57
1432 1448 3.688272 CTTCGCTTTATCGTCGTTCCTA 58.312 45.455 0.00 0.00 0.00 2.94
1433 1449 2.527100 CTTCGCTTTATCGTCGTTCCT 58.473 47.619 0.00 0.00 0.00 3.36
1434 1450 1.006287 GCTTCGCTTTATCGTCGTTCC 60.006 52.381 0.00 0.00 0.00 3.62
1435 1451 1.330050 CGCTTCGCTTTATCGTCGTTC 60.330 52.381 0.00 0.00 0.00 3.95
1436 1452 0.638746 CGCTTCGCTTTATCGTCGTT 59.361 50.000 0.00 0.00 0.00 3.85
1437 1453 0.179181 TCGCTTCGCTTTATCGTCGT 60.179 50.000 0.00 0.00 0.00 4.34
1438 1454 0.224005 GTCGCTTCGCTTTATCGTCG 59.776 55.000 0.00 0.00 0.00 5.12
1439 1455 0.224005 CGTCGCTTCGCTTTATCGTC 59.776 55.000 0.00 0.00 0.00 4.20
1440 1456 2.275703 CGTCGCTTCGCTTTATCGT 58.724 52.632 0.00 0.00 0.00 3.73
1449 1465 2.340246 GATTGCTCAGCGTCGCTTCG 62.340 60.000 19.06 12.46 36.40 3.79
1450 1466 1.080995 AGATTGCTCAGCGTCGCTTC 61.081 55.000 19.06 11.67 36.40 3.86
1451 1467 0.173481 TAGATTGCTCAGCGTCGCTT 59.827 50.000 19.06 0.78 36.40 4.68
1452 1468 0.248825 CTAGATTGCTCAGCGTCGCT 60.249 55.000 15.47 15.47 40.77 4.93
1453 1469 0.248661 TCTAGATTGCTCAGCGTCGC 60.249 55.000 9.80 9.80 0.00 5.19
1454 1470 1.471964 GTCTAGATTGCTCAGCGTCG 58.528 55.000 0.00 0.00 0.00 5.12
1455 1471 1.064208 TCGTCTAGATTGCTCAGCGTC 59.936 52.381 0.00 0.00 0.00 5.19
1456 1472 1.095600 TCGTCTAGATTGCTCAGCGT 58.904 50.000 0.00 0.00 0.00 5.07
1457 1473 2.115595 CTTCGTCTAGATTGCTCAGCG 58.884 52.381 0.00 0.00 0.00 5.18
1458 1474 3.157932 ACTTCGTCTAGATTGCTCAGC 57.842 47.619 0.00 0.00 0.00 4.26
1459 1475 4.992688 AGAACTTCGTCTAGATTGCTCAG 58.007 43.478 0.00 0.00 0.00 3.35
1460 1476 5.392767 AAGAACTTCGTCTAGATTGCTCA 57.607 39.130 0.00 0.00 0.00 4.26
1461 1477 6.713792 AAAAGAACTTCGTCTAGATTGCTC 57.286 37.500 0.00 0.00 0.00 4.26
1462 1478 7.201565 GCATAAAAGAACTTCGTCTAGATTGCT 60.202 37.037 0.00 0.00 0.00 3.91
1463 1479 6.902417 GCATAAAAGAACTTCGTCTAGATTGC 59.098 38.462 0.00 0.00 0.00 3.56
1464 1480 7.402640 GGCATAAAAGAACTTCGTCTAGATTG 58.597 38.462 0.00 0.00 0.00 2.67
1465 1481 6.255887 CGGCATAAAAGAACTTCGTCTAGATT 59.744 38.462 0.00 0.00 0.00 2.40
1466 1482 5.749109 CGGCATAAAAGAACTTCGTCTAGAT 59.251 40.000 0.00 0.00 0.00 1.98
1467 1483 5.100259 CGGCATAAAAGAACTTCGTCTAGA 58.900 41.667 0.00 0.00 0.00 2.43
1468 1484 5.100259 TCGGCATAAAAGAACTTCGTCTAG 58.900 41.667 0.00 0.00 0.00 2.43
1469 1485 5.063180 TCGGCATAAAAGAACTTCGTCTA 57.937 39.130 0.00 0.00 0.00 2.59
1470 1486 3.921677 TCGGCATAAAAGAACTTCGTCT 58.078 40.909 0.00 0.00 0.00 4.18
1471 1487 3.924686 TCTCGGCATAAAAGAACTTCGTC 59.075 43.478 0.00 0.00 0.00 4.20
1472 1488 3.921677 TCTCGGCATAAAAGAACTTCGT 58.078 40.909 0.00 0.00 0.00 3.85
1473 1489 4.330074 ACATCTCGGCATAAAAGAACTTCG 59.670 41.667 0.00 0.00 0.00 3.79
1474 1490 5.803020 ACATCTCGGCATAAAAGAACTTC 57.197 39.130 0.00 0.00 0.00 3.01
1475 1491 6.170506 TGTACATCTCGGCATAAAAGAACTT 58.829 36.000 0.00 0.00 0.00 2.66
1476 1492 5.730550 TGTACATCTCGGCATAAAAGAACT 58.269 37.500 0.00 0.00 0.00 3.01
1477 1493 6.417191 TTGTACATCTCGGCATAAAAGAAC 57.583 37.500 0.00 0.00 0.00 3.01
1478 1494 7.624360 ATTTGTACATCTCGGCATAAAAGAA 57.376 32.000 0.00 0.00 0.00 2.52
1479 1495 7.415095 CCAATTTGTACATCTCGGCATAAAAGA 60.415 37.037 0.00 0.00 0.00 2.52
1480 1496 6.692681 CCAATTTGTACATCTCGGCATAAAAG 59.307 38.462 0.00 0.00 0.00 2.27
1481 1497 6.375736 TCCAATTTGTACATCTCGGCATAAAA 59.624 34.615 0.00 0.00 0.00 1.52
1482 1498 5.883115 TCCAATTTGTACATCTCGGCATAAA 59.117 36.000 0.00 0.00 0.00 1.40
1483 1499 5.432645 TCCAATTTGTACATCTCGGCATAA 58.567 37.500 0.00 0.00 0.00 1.90
1484 1500 5.029807 TCCAATTTGTACATCTCGGCATA 57.970 39.130 0.00 0.00 0.00 3.14
1485 1501 3.884895 TCCAATTTGTACATCTCGGCAT 58.115 40.909 0.00 0.00 0.00 4.40
1486 1502 3.342377 TCCAATTTGTACATCTCGGCA 57.658 42.857 0.00 0.00 0.00 5.69
1487 1503 3.487544 GCTTCCAATTTGTACATCTCGGC 60.488 47.826 0.00 0.00 0.00 5.54
1488 1504 3.941483 AGCTTCCAATTTGTACATCTCGG 59.059 43.478 0.00 0.00 0.00 4.63
1489 1505 5.277058 GCTAGCTTCCAATTTGTACATCTCG 60.277 44.000 7.70 0.00 0.00 4.04
1490 1506 5.819901 AGCTAGCTTCCAATTTGTACATCTC 59.180 40.000 12.68 0.00 0.00 2.75
1491 1507 5.749462 AGCTAGCTTCCAATTTGTACATCT 58.251 37.500 12.68 0.00 0.00 2.90
1492 1508 6.442513 AAGCTAGCTTCCAATTTGTACATC 57.557 37.500 24.42 0.00 0.00 3.06
1493 1509 6.442513 GAAGCTAGCTTCCAATTTGTACAT 57.557 37.500 37.06 10.61 44.76 2.29
1494 1510 5.880054 GAAGCTAGCTTCCAATTTGTACA 57.120 39.130 37.06 0.00 44.76 2.90
1506 1522 4.946478 ATTGATCGTAGGAAGCTAGCTT 57.054 40.909 29.71 29.71 39.23 3.74
1507 1523 4.342378 TGAATTGATCGTAGGAAGCTAGCT 59.658 41.667 12.68 12.68 0.00 3.32
1508 1524 4.446051 GTGAATTGATCGTAGGAAGCTAGC 59.554 45.833 6.62 6.62 0.00 3.42
1509 1525 4.985409 GGTGAATTGATCGTAGGAAGCTAG 59.015 45.833 0.00 0.00 0.00 3.42
1510 1526 4.202223 GGGTGAATTGATCGTAGGAAGCTA 60.202 45.833 0.00 0.00 0.00 3.32
1511 1527 3.432326 GGGTGAATTGATCGTAGGAAGCT 60.432 47.826 0.00 0.00 0.00 3.74
1512 1528 2.872858 GGGTGAATTGATCGTAGGAAGC 59.127 50.000 0.00 0.00 0.00 3.86
1513 1529 4.122776 CTGGGTGAATTGATCGTAGGAAG 58.877 47.826 0.00 0.00 0.00 3.46
1514 1530 3.681594 GCTGGGTGAATTGATCGTAGGAA 60.682 47.826 0.00 0.00 0.00 3.36
1515 1531 2.158957 GCTGGGTGAATTGATCGTAGGA 60.159 50.000 0.00 0.00 0.00 2.94
1516 1532 2.213499 GCTGGGTGAATTGATCGTAGG 58.787 52.381 0.00 0.00 0.00 3.18
1517 1533 2.609459 GTGCTGGGTGAATTGATCGTAG 59.391 50.000 0.00 0.00 0.00 3.51
1518 1534 2.027653 TGTGCTGGGTGAATTGATCGTA 60.028 45.455 0.00 0.00 0.00 3.43
1519 1535 1.271325 TGTGCTGGGTGAATTGATCGT 60.271 47.619 0.00 0.00 0.00 3.73
1520 1536 1.452110 TGTGCTGGGTGAATTGATCG 58.548 50.000 0.00 0.00 0.00 3.69
1521 1537 3.841643 CTTTGTGCTGGGTGAATTGATC 58.158 45.455 0.00 0.00 0.00 2.92
1522 1538 2.028748 GCTTTGTGCTGGGTGAATTGAT 60.029 45.455 0.00 0.00 38.95 2.57
1523 1539 1.340889 GCTTTGTGCTGGGTGAATTGA 59.659 47.619 0.00 0.00 38.95 2.57
1524 1540 1.787012 GCTTTGTGCTGGGTGAATTG 58.213 50.000 0.00 0.00 38.95 2.32
1535 1551 1.163554 AGAGCAAGCTAGCTTTGTGC 58.836 50.000 27.34 26.40 46.75 4.57
1551 1567 1.329906 CAATCAGGCGCTTTGCTAGAG 59.670 52.381 7.64 0.00 45.43 2.43
1552 1568 1.066215 TCAATCAGGCGCTTTGCTAGA 60.066 47.619 7.64 0.00 45.43 2.43
1553 1569 1.372582 TCAATCAGGCGCTTTGCTAG 58.627 50.000 7.64 0.06 45.43 3.42
1554 1570 1.942657 GATCAATCAGGCGCTTTGCTA 59.057 47.619 7.64 0.00 45.43 3.49
1555 1571 0.737219 GATCAATCAGGCGCTTTGCT 59.263 50.000 7.64 0.00 45.43 3.91
1556 1572 0.248784 GGATCAATCAGGCGCTTTGC 60.249 55.000 7.64 0.00 45.38 3.68
1557 1573 1.386533 AGGATCAATCAGGCGCTTTG 58.613 50.000 7.64 6.75 0.00 2.77
1558 1574 2.019984 GAAGGATCAATCAGGCGCTTT 58.980 47.619 7.64 0.00 0.00 3.51
1559 1575 1.673168 GAAGGATCAATCAGGCGCTT 58.327 50.000 7.64 0.00 0.00 4.68
1560 1576 0.179034 GGAAGGATCAATCAGGCGCT 60.179 55.000 7.64 0.00 0.00 5.92
1561 1577 1.502163 CGGAAGGATCAATCAGGCGC 61.502 60.000 0.00 0.00 0.00 6.53
1562 1578 0.179073 ACGGAAGGATCAATCAGGCG 60.179 55.000 0.00 0.00 0.00 5.52
1563 1579 2.910688 TACGGAAGGATCAATCAGGC 57.089 50.000 0.00 0.00 0.00 4.85
1564 1580 4.770795 ACTTTACGGAAGGATCAATCAGG 58.229 43.478 0.00 0.00 39.79 3.86
1565 1581 5.463724 GCTACTTTACGGAAGGATCAATCAG 59.536 44.000 0.00 0.00 39.79 2.90
1566 1582 5.128827 AGCTACTTTACGGAAGGATCAATCA 59.871 40.000 0.00 0.00 39.79 2.57
1567 1583 5.463724 CAGCTACTTTACGGAAGGATCAATC 59.536 44.000 0.00 0.00 39.79 2.67
1568 1584 5.360591 CAGCTACTTTACGGAAGGATCAAT 58.639 41.667 0.00 0.00 39.79 2.57
1569 1585 4.755411 CAGCTACTTTACGGAAGGATCAA 58.245 43.478 0.00 0.00 39.79 2.57
1570 1586 3.430374 GCAGCTACTTTACGGAAGGATCA 60.430 47.826 0.00 0.00 39.79 2.92
1571 1587 3.124560 GCAGCTACTTTACGGAAGGATC 58.875 50.000 0.00 0.00 39.79 3.36
1572 1588 2.500098 TGCAGCTACTTTACGGAAGGAT 59.500 45.455 0.00 0.00 39.79 3.24
1573 1589 1.897133 TGCAGCTACTTTACGGAAGGA 59.103 47.619 0.00 0.00 39.79 3.36
1574 1590 2.380084 TGCAGCTACTTTACGGAAGG 57.620 50.000 0.00 0.00 39.79 3.46
1575 1591 2.415512 GGTTGCAGCTACTTTACGGAAG 59.584 50.000 6.94 0.00 41.32 3.46
1576 1592 2.038033 AGGTTGCAGCTACTTTACGGAA 59.962 45.455 6.94 0.00 0.00 4.30
1577 1593 1.621814 AGGTTGCAGCTACTTTACGGA 59.378 47.619 6.94 0.00 0.00 4.69
1578 1594 1.732259 CAGGTTGCAGCTACTTTACGG 59.268 52.381 6.94 0.00 0.00 4.02
1579 1595 1.128692 GCAGGTTGCAGCTACTTTACG 59.871 52.381 6.94 0.00 44.26 3.18
1580 1596 2.902065 GCAGGTTGCAGCTACTTTAC 57.098 50.000 6.94 0.00 44.26 2.01
1591 1607 1.028905 TGGTGTTACTTGCAGGTTGC 58.971 50.000 6.84 0.98 45.29 4.17
1592 1608 3.380004 TCTTTGGTGTTACTTGCAGGTTG 59.620 43.478 6.84 0.00 0.00 3.77
1593 1609 3.626930 TCTTTGGTGTTACTTGCAGGTT 58.373 40.909 6.84 0.00 0.00 3.50
1594 1610 3.290948 TCTTTGGTGTTACTTGCAGGT 57.709 42.857 6.72 6.72 0.00 4.00
1595 1611 4.759693 TGTATCTTTGGTGTTACTTGCAGG 59.240 41.667 0.00 0.00 0.00 4.85
1596 1612 5.614668 CGTGTATCTTTGGTGTTACTTGCAG 60.615 44.000 0.00 0.00 0.00 4.41
1597 1613 4.212425 CGTGTATCTTTGGTGTTACTTGCA 59.788 41.667 0.00 0.00 0.00 4.08
1598 1614 4.708601 CGTGTATCTTTGGTGTTACTTGC 58.291 43.478 0.00 0.00 0.00 4.01
1599 1615 4.665645 CGCGTGTATCTTTGGTGTTACTTG 60.666 45.833 0.00 0.00 0.00 3.16
1600 1616 3.430895 CGCGTGTATCTTTGGTGTTACTT 59.569 43.478 0.00 0.00 0.00 2.24
1601 1617 2.991190 CGCGTGTATCTTTGGTGTTACT 59.009 45.455 0.00 0.00 0.00 2.24
1602 1618 2.473376 GCGCGTGTATCTTTGGTGTTAC 60.473 50.000 8.43 0.00 0.00 2.50
1603 1619 1.727880 GCGCGTGTATCTTTGGTGTTA 59.272 47.619 8.43 0.00 0.00 2.41
1604 1620 0.515564 GCGCGTGTATCTTTGGTGTT 59.484 50.000 8.43 0.00 0.00 3.32
1605 1621 1.623081 CGCGCGTGTATCTTTGGTGT 61.623 55.000 24.19 0.00 0.00 4.16
1606 1622 1.058748 CGCGCGTGTATCTTTGGTG 59.941 57.895 24.19 0.00 0.00 4.17
1607 1623 0.109179 TACGCGCGTGTATCTTTGGT 60.109 50.000 42.78 16.02 0.00 3.67
1608 1624 0.296642 GTACGCGCGTGTATCTTTGG 59.703 55.000 42.78 7.39 0.00 3.28
1609 1625 0.045336 CGTACGCGCGTGTATCTTTG 60.045 55.000 42.78 19.52 0.00 2.77
1610 1626 0.179192 TCGTACGCGCGTGTATCTTT 60.179 50.000 42.78 18.17 38.14 2.52
1611 1627 0.179192 TTCGTACGCGCGTGTATCTT 60.179 50.000 42.78 18.98 38.14 2.40
1612 1628 0.179192 TTTCGTACGCGCGTGTATCT 60.179 50.000 42.78 19.78 38.14 1.98
1613 1629 0.045585 GTTTCGTACGCGCGTGTATC 60.046 55.000 42.78 27.04 38.14 2.24
1614 1630 0.454957 AGTTTCGTACGCGCGTGTAT 60.455 50.000 42.78 21.00 38.14 2.29
1615 1631 0.164863 TAGTTTCGTACGCGCGTGTA 59.835 50.000 42.78 27.35 38.14 2.90
1616 1632 0.660005 TTAGTTTCGTACGCGCGTGT 60.660 50.000 42.78 29.73 38.14 4.49
1617 1633 0.430484 TTTAGTTTCGTACGCGCGTG 59.570 50.000 42.78 28.31 38.14 5.34
1618 1634 0.430858 GTTTAGTTTCGTACGCGCGT 59.569 50.000 39.05 39.05 38.14 6.01
1619 1635 0.246489 GGTTTAGTTTCGTACGCGCG 60.246 55.000 30.96 30.96 38.14 6.86
1620 1636 0.783579 TGGTTTAGTTTCGTACGCGC 59.216 50.000 11.24 0.00 38.14 6.86
1621 1637 1.786004 TGTGGTTTAGTTTCGTACGCG 59.214 47.619 11.24 3.53 39.92 6.01
1622 1638 2.408865 CGTGTGGTTTAGTTTCGTACGC 60.409 50.000 11.24 0.00 0.00 4.42
1623 1639 2.408865 GCGTGTGGTTTAGTTTCGTACG 60.409 50.000 9.53 9.53 0.00 3.67
1624 1640 2.539274 TGCGTGTGGTTTAGTTTCGTAC 59.461 45.455 0.00 0.00 0.00 3.67
1625 1641 2.539274 GTGCGTGTGGTTTAGTTTCGTA 59.461 45.455 0.00 0.00 0.00 3.43
1626 1642 1.328374 GTGCGTGTGGTTTAGTTTCGT 59.672 47.619 0.00 0.00 0.00 3.85
1627 1643 1.655325 CGTGCGTGTGGTTTAGTTTCG 60.655 52.381 0.00 0.00 0.00 3.46
1628 1644 1.918543 GCGTGCGTGTGGTTTAGTTTC 60.919 52.381 0.00 0.00 0.00 2.78
1629 1645 0.028374 GCGTGCGTGTGGTTTAGTTT 59.972 50.000 0.00 0.00 0.00 2.66
1630 1646 1.090625 TGCGTGCGTGTGGTTTAGTT 61.091 50.000 0.00 0.00 0.00 2.24
1631 1647 1.090625 TTGCGTGCGTGTGGTTTAGT 61.091 50.000 0.00 0.00 0.00 2.24
1632 1648 0.028242 TTTGCGTGCGTGTGGTTTAG 59.972 50.000 0.00 0.00 0.00 1.85
1633 1649 0.450583 TTTTGCGTGCGTGTGGTTTA 59.549 45.000 0.00 0.00 0.00 2.01
1634 1650 0.800300 CTTTTGCGTGCGTGTGGTTT 60.800 50.000 0.00 0.00 0.00 3.27
1635 1651 1.226547 CTTTTGCGTGCGTGTGGTT 60.227 52.632 0.00 0.00 0.00 3.67
1636 1652 1.444119 ATCTTTTGCGTGCGTGTGGT 61.444 50.000 0.00 0.00 0.00 4.16
1637 1653 0.317770 AATCTTTTGCGTGCGTGTGG 60.318 50.000 0.00 0.00 0.00 4.17
1638 1654 0.771756 CAATCTTTTGCGTGCGTGTG 59.228 50.000 0.00 0.00 0.00 3.82
1639 1655 0.317770 CCAATCTTTTGCGTGCGTGT 60.318 50.000 0.00 0.00 0.00 4.49
1640 1656 0.317770 ACCAATCTTTTGCGTGCGTG 60.318 50.000 0.00 0.00 0.00 5.34
1641 1657 0.383949 AACCAATCTTTTGCGTGCGT 59.616 45.000 0.00 0.00 0.00 5.24
1642 1658 1.189884 CAAACCAATCTTTTGCGTGCG 59.810 47.619 0.00 0.00 0.00 5.34
1643 1659 2.468831 TCAAACCAATCTTTTGCGTGC 58.531 42.857 0.00 0.00 34.50 5.34
1644 1660 4.608890 GCAATCAAACCAATCTTTTGCGTG 60.609 41.667 0.00 0.00 34.50 5.34
1645 1661 3.494251 GCAATCAAACCAATCTTTTGCGT 59.506 39.130 0.00 0.00 34.50 5.24
1646 1662 3.120580 GGCAATCAAACCAATCTTTTGCG 60.121 43.478 0.00 0.00 39.00 4.85
1647 1663 3.814283 TGGCAATCAAACCAATCTTTTGC 59.186 39.130 0.00 0.00 37.76 3.68
1648 1664 6.374565 TTTGGCAATCAAACCAATCTTTTG 57.625 33.333 0.00 0.00 45.08 2.44
1649 1665 5.532032 CCTTTGGCAATCAAACCAATCTTTT 59.468 36.000 0.00 0.00 45.08 2.27
1650 1666 5.065235 CCTTTGGCAATCAAACCAATCTTT 58.935 37.500 0.00 0.00 45.08 2.52
1651 1667 4.102996 ACCTTTGGCAATCAAACCAATCTT 59.897 37.500 0.00 0.00 45.08 2.40
1652 1668 3.647590 ACCTTTGGCAATCAAACCAATCT 59.352 39.130 0.00 0.00 45.08 2.40
1653 1669 4.006780 ACCTTTGGCAATCAAACCAATC 57.993 40.909 0.00 0.00 45.08 2.67
1654 1670 4.388485 GAACCTTTGGCAATCAAACCAAT 58.612 39.130 0.00 0.00 45.08 3.16
1655 1671 3.739519 CGAACCTTTGGCAATCAAACCAA 60.740 43.478 0.00 0.00 44.11 3.67
1656 1672 2.223923 CGAACCTTTGGCAATCAAACCA 60.224 45.455 0.00 0.00 40.14 3.67
1657 1673 2.223947 ACGAACCTTTGGCAATCAAACC 60.224 45.455 0.00 0.00 40.14 3.27
1658 1674 3.092334 ACGAACCTTTGGCAATCAAAC 57.908 42.857 0.00 0.00 40.14 2.93
1659 1675 4.378978 CGATACGAACCTTTGGCAATCAAA 60.379 41.667 0.00 0.00 42.50 2.69
1660 1676 3.126171 CGATACGAACCTTTGGCAATCAA 59.874 43.478 0.00 0.00 0.00 2.57
1661 1677 2.675844 CGATACGAACCTTTGGCAATCA 59.324 45.455 0.00 0.00 0.00 2.57
1662 1678 2.933906 TCGATACGAACCTTTGGCAATC 59.066 45.455 0.00 0.00 31.06 2.67
1663 1679 2.936498 CTCGATACGAACCTTTGGCAAT 59.064 45.455 0.00 0.00 34.74 3.56
1664 1680 2.343101 CTCGATACGAACCTTTGGCAA 58.657 47.619 0.00 0.00 34.74 4.52
1665 1681 2.004583 CTCGATACGAACCTTTGGCA 57.995 50.000 0.00 0.00 34.74 4.92
1666 1682 0.651031 GCTCGATACGAACCTTTGGC 59.349 55.000 0.00 0.00 34.74 4.52
1667 1683 1.287425 GGCTCGATACGAACCTTTGG 58.713 55.000 6.38 0.00 38.83 3.28
1672 1688 1.557651 GACAAGGCTCGATACGAACC 58.442 55.000 5.60 5.60 41.74 3.62
1673 1689 1.134560 AGGACAAGGCTCGATACGAAC 59.865 52.381 0.00 0.00 34.74 3.95
1674 1690 1.471119 AGGACAAGGCTCGATACGAA 58.529 50.000 0.00 0.00 34.74 3.85
1675 1691 1.471119 AAGGACAAGGCTCGATACGA 58.529 50.000 0.00 0.00 0.00 3.43
1676 1692 2.358267 AGTAAGGACAAGGCTCGATACG 59.642 50.000 0.00 0.00 0.00 3.06
1677 1693 4.388378 AAGTAAGGACAAGGCTCGATAC 57.612 45.455 0.00 0.00 0.00 2.24
1678 1694 6.726490 ATAAAGTAAGGACAAGGCTCGATA 57.274 37.500 0.00 0.00 0.00 2.92
1679 1695 3.983044 AAAGTAAGGACAAGGCTCGAT 57.017 42.857 0.00 0.00 0.00 3.59
1680 1696 5.175859 CAATAAAGTAAGGACAAGGCTCGA 58.824 41.667 0.00 0.00 0.00 4.04
1681 1697 4.201822 GCAATAAAGTAAGGACAAGGCTCG 60.202 45.833 0.00 0.00 0.00 5.03
1682 1698 4.944317 AGCAATAAAGTAAGGACAAGGCTC 59.056 41.667 0.00 0.00 0.00 4.70
1683 1699 4.923415 AGCAATAAAGTAAGGACAAGGCT 58.077 39.130 0.00 0.00 0.00 4.58
1684 1700 5.048013 ACAAGCAATAAAGTAAGGACAAGGC 60.048 40.000 0.00 0.00 0.00 4.35
1685 1701 6.575162 ACAAGCAATAAAGTAAGGACAAGG 57.425 37.500 0.00 0.00 0.00 3.61
1686 1702 9.394477 GTTAACAAGCAATAAAGTAAGGACAAG 57.606 33.333 0.00 0.00 0.00 3.16
1687 1703 8.071368 CGTTAACAAGCAATAAAGTAAGGACAA 58.929 33.333 6.39 0.00 0.00 3.18
1688 1704 7.308109 CCGTTAACAAGCAATAAAGTAAGGACA 60.308 37.037 6.39 0.00 0.00 4.02
1689 1705 7.019418 CCGTTAACAAGCAATAAAGTAAGGAC 58.981 38.462 6.39 0.00 0.00 3.85
1690 1706 6.711645 ACCGTTAACAAGCAATAAAGTAAGGA 59.288 34.615 6.39 0.00 0.00 3.36
1691 1707 6.905578 ACCGTTAACAAGCAATAAAGTAAGG 58.094 36.000 6.39 0.00 0.00 2.69
1692 1708 8.497554 TGTACCGTTAACAAGCAATAAAGTAAG 58.502 33.333 6.39 0.00 0.00 2.34
1693 1709 8.375608 TGTACCGTTAACAAGCAATAAAGTAA 57.624 30.769 6.39 0.00 0.00 2.24
1694 1710 7.959689 TGTACCGTTAACAAGCAATAAAGTA 57.040 32.000 6.39 0.00 0.00 2.24
1695 1711 6.864360 TGTACCGTTAACAAGCAATAAAGT 57.136 33.333 6.39 0.00 0.00 2.66
1696 1712 7.748847 AGATGTACCGTTAACAAGCAATAAAG 58.251 34.615 6.39 0.00 0.00 1.85
1697 1713 7.675962 AGATGTACCGTTAACAAGCAATAAA 57.324 32.000 6.39 0.00 0.00 1.40
1698 1714 7.675962 AAGATGTACCGTTAACAAGCAATAA 57.324 32.000 6.39 0.00 0.00 1.40
1699 1715 7.818446 TGTAAGATGTACCGTTAACAAGCAATA 59.182 33.333 6.39 0.00 0.00 1.90
1700 1716 6.651643 TGTAAGATGTACCGTTAACAAGCAAT 59.348 34.615 6.39 0.00 0.00 3.56
1701 1717 5.990386 TGTAAGATGTACCGTTAACAAGCAA 59.010 36.000 6.39 0.00 0.00 3.91
1702 1718 5.539979 TGTAAGATGTACCGTTAACAAGCA 58.460 37.500 6.39 0.00 0.00 3.91
1703 1719 6.146673 ACTTGTAAGATGTACCGTTAACAAGC 59.853 38.462 19.27 0.00 35.60 4.01
1704 1720 7.359765 CCACTTGTAAGATGTACCGTTAACAAG 60.360 40.741 18.39 18.39 37.46 3.16
1705 1721 6.424509 CCACTTGTAAGATGTACCGTTAACAA 59.575 38.462 6.39 0.00 0.00 2.83
1706 1722 5.927689 CCACTTGTAAGATGTACCGTTAACA 59.072 40.000 6.39 0.00 0.00 2.41
1707 1723 5.349543 CCCACTTGTAAGATGTACCGTTAAC 59.650 44.000 0.00 0.00 0.00 2.01
1708 1724 5.481105 CCCACTTGTAAGATGTACCGTTAA 58.519 41.667 0.00 0.00 0.00 2.01
1709 1725 4.081531 CCCCACTTGTAAGATGTACCGTTA 60.082 45.833 0.00 0.00 0.00 3.18
1710 1726 3.307199 CCCCACTTGTAAGATGTACCGTT 60.307 47.826 0.00 0.00 0.00 4.44
1711 1727 2.235402 CCCCACTTGTAAGATGTACCGT 59.765 50.000 0.00 0.00 0.00 4.83
1712 1728 2.235402 ACCCCACTTGTAAGATGTACCG 59.765 50.000 0.00 0.00 0.00 4.02
1713 1729 3.994931 ACCCCACTTGTAAGATGTACC 57.005 47.619 0.00 0.00 0.00 3.34
1714 1730 6.232692 TGTAAACCCCACTTGTAAGATGTAC 58.767 40.000 0.00 0.00 0.00 2.90
1715 1731 6.270463 TCTGTAAACCCCACTTGTAAGATGTA 59.730 38.462 0.00 0.00 0.00 2.29
1716 1732 5.072600 TCTGTAAACCCCACTTGTAAGATGT 59.927 40.000 0.00 0.00 0.00 3.06
1717 1733 5.411669 GTCTGTAAACCCCACTTGTAAGATG 59.588 44.000 0.00 0.00 0.00 2.90
1718 1734 5.557866 GTCTGTAAACCCCACTTGTAAGAT 58.442 41.667 0.00 0.00 0.00 2.40
1719 1735 4.501915 CGTCTGTAAACCCCACTTGTAAGA 60.502 45.833 0.00 0.00 0.00 2.10
1720 1736 3.744426 CGTCTGTAAACCCCACTTGTAAG 59.256 47.826 0.00 0.00 0.00 2.34
1721 1737 3.134442 ACGTCTGTAAACCCCACTTGTAA 59.866 43.478 0.00 0.00 0.00 2.41
1722 1738 2.699846 ACGTCTGTAAACCCCACTTGTA 59.300 45.455 0.00 0.00 0.00 2.41
1723 1739 1.487558 ACGTCTGTAAACCCCACTTGT 59.512 47.619 0.00 0.00 0.00 3.16
1724 1740 2.249844 ACGTCTGTAAACCCCACTTG 57.750 50.000 0.00 0.00 0.00 3.16
1725 1741 5.743636 TTATACGTCTGTAAACCCCACTT 57.256 39.130 0.00 0.00 33.44 3.16
1726 1742 5.743636 TTTATACGTCTGTAAACCCCACT 57.256 39.130 0.00 0.00 33.44 4.00
1727 1743 6.201615 GCTATTTATACGTCTGTAAACCCCAC 59.798 42.308 0.00 0.00 33.44 4.61
1728 1744 6.127111 TGCTATTTATACGTCTGTAAACCCCA 60.127 38.462 0.00 0.00 33.44 4.96
1729 1745 6.282930 TGCTATTTATACGTCTGTAAACCCC 58.717 40.000 0.00 0.00 33.44 4.95
1730 1746 6.073927 GCTGCTATTTATACGTCTGTAAACCC 60.074 42.308 0.00 0.00 33.44 4.11
1731 1747 6.700520 AGCTGCTATTTATACGTCTGTAAACC 59.299 38.462 0.00 0.00 33.44 3.27
1732 1748 7.695869 AGCTGCTATTTATACGTCTGTAAAC 57.304 36.000 0.00 0.00 33.44 2.01
1733 1749 8.080417 CCTAGCTGCTATTTATACGTCTGTAAA 58.920 37.037 10.23 0.00 33.44 2.01
1734 1750 7.591165 CCTAGCTGCTATTTATACGTCTGTAA 58.409 38.462 10.23 0.00 33.44 2.41
1735 1751 6.349115 GCCTAGCTGCTATTTATACGTCTGTA 60.349 42.308 10.23 0.00 34.45 2.74
1736 1752 5.565045 GCCTAGCTGCTATTTATACGTCTGT 60.565 44.000 10.23 0.00 0.00 3.41
1737 1753 4.859798 GCCTAGCTGCTATTTATACGTCTG 59.140 45.833 10.23 0.00 0.00 3.51
1738 1754 4.767928 AGCCTAGCTGCTATTTATACGTCT 59.232 41.667 10.23 0.00 40.56 4.18
1739 1755 5.061920 AGCCTAGCTGCTATTTATACGTC 57.938 43.478 10.23 0.00 40.56 4.34
1753 1769 1.799933 AGTAATCAGGCAGCCTAGCT 58.200 50.000 15.64 5.13 40.77 3.32
1754 1770 2.158900 TCAAGTAATCAGGCAGCCTAGC 60.159 50.000 15.64 2.69 29.64 3.42
1755 1771 3.462021 GTCAAGTAATCAGGCAGCCTAG 58.538 50.000 15.64 9.14 29.64 3.02
1756 1772 2.159099 CGTCAAGTAATCAGGCAGCCTA 60.159 50.000 15.64 3.12 29.64 3.93
1757 1773 1.406069 CGTCAAGTAATCAGGCAGCCT 60.406 52.381 8.70 8.70 0.00 4.58
1758 1774 1.009829 CGTCAAGTAATCAGGCAGCC 58.990 55.000 1.84 1.84 0.00 4.85
1759 1775 1.009829 CCGTCAAGTAATCAGGCAGC 58.990 55.000 0.00 0.00 0.00 5.25
1760 1776 2.672961 TCCGTCAAGTAATCAGGCAG 57.327 50.000 0.00 0.00 0.00 4.85
1761 1777 3.055458 TGATTCCGTCAAGTAATCAGGCA 60.055 43.478 0.00 0.00 35.32 4.75
1762 1778 3.531538 TGATTCCGTCAAGTAATCAGGC 58.468 45.455 0.00 0.00 35.32 4.85
1765 1781 6.152154 TCTGTACTGATTCCGTCAAGTAATCA 59.848 38.462 0.00 0.00 37.30 2.57
1766 1782 6.561614 TCTGTACTGATTCCGTCAAGTAATC 58.438 40.000 0.00 0.00 36.14 1.75
1767 1783 6.525578 TCTGTACTGATTCCGTCAAGTAAT 57.474 37.500 0.00 0.00 36.14 1.89
1768 1784 5.970317 TCTGTACTGATTCCGTCAAGTAA 57.030 39.130 0.00 0.00 36.14 2.24
1769 1785 5.708697 TCTTCTGTACTGATTCCGTCAAGTA 59.291 40.000 3.03 0.00 36.14 2.24
1770 1786 4.523173 TCTTCTGTACTGATTCCGTCAAGT 59.477 41.667 3.03 0.00 36.14 3.16
1771 1787 4.859798 GTCTTCTGTACTGATTCCGTCAAG 59.140 45.833 3.03 0.00 36.14 3.02
1772 1788 4.523173 AGTCTTCTGTACTGATTCCGTCAA 59.477 41.667 3.03 0.00 36.14 3.18
1773 1789 4.079970 AGTCTTCTGTACTGATTCCGTCA 58.920 43.478 3.03 0.00 35.05 4.35
1774 1790 4.705337 AGTCTTCTGTACTGATTCCGTC 57.295 45.455 3.03 0.00 0.00 4.79
1775 1791 6.183360 GGATTAGTCTTCTGTACTGATTCCGT 60.183 42.308 3.03 0.00 0.00 4.69
1776 1792 6.039941 AGGATTAGTCTTCTGTACTGATTCCG 59.960 42.308 3.03 0.00 31.32 4.30
1777 1793 7.354751 AGGATTAGTCTTCTGTACTGATTCC 57.645 40.000 3.03 2.98 0.00 3.01
1778 1794 8.904834 TGTAGGATTAGTCTTCTGTACTGATTC 58.095 37.037 3.03 0.00 0.00 2.52
1779 1795 8.688151 GTGTAGGATTAGTCTTCTGTACTGATT 58.312 37.037 3.03 0.00 0.00 2.57
1780 1796 7.012515 CGTGTAGGATTAGTCTTCTGTACTGAT 59.987 40.741 3.03 0.00 0.00 2.90
1781 1797 6.315642 CGTGTAGGATTAGTCTTCTGTACTGA 59.684 42.308 0.00 0.00 0.00 3.41
1782 1798 6.458478 CCGTGTAGGATTAGTCTTCTGTACTG 60.458 46.154 0.00 0.00 45.00 2.74
1783 1799 5.589452 CCGTGTAGGATTAGTCTTCTGTACT 59.411 44.000 0.00 0.00 45.00 2.73
1784 1800 5.356470 ACCGTGTAGGATTAGTCTTCTGTAC 59.644 44.000 0.00 0.00 45.00 2.90
1785 1801 5.503927 ACCGTGTAGGATTAGTCTTCTGTA 58.496 41.667 0.00 0.00 45.00 2.74
1786 1802 4.342359 ACCGTGTAGGATTAGTCTTCTGT 58.658 43.478 0.00 0.00 45.00 3.41
1787 1803 4.985538 ACCGTGTAGGATTAGTCTTCTG 57.014 45.455 0.00 0.00 45.00 3.02
1788 1804 6.186234 AGTTACCGTGTAGGATTAGTCTTCT 58.814 40.000 0.00 0.00 45.00 2.85
1789 1805 6.448207 AGTTACCGTGTAGGATTAGTCTTC 57.552 41.667 0.00 0.00 45.00 2.87
1790 1806 7.944729 TTAGTTACCGTGTAGGATTAGTCTT 57.055 36.000 0.00 0.00 45.00 3.01
1791 1807 8.411683 CAATTAGTTACCGTGTAGGATTAGTCT 58.588 37.037 0.00 0.00 45.00 3.24
1792 1808 7.650903 CCAATTAGTTACCGTGTAGGATTAGTC 59.349 40.741 0.00 0.00 45.00 2.59
1793 1809 7.342799 TCCAATTAGTTACCGTGTAGGATTAGT 59.657 37.037 0.00 0.00 45.00 2.24
1794 1810 7.719483 TCCAATTAGTTACCGTGTAGGATTAG 58.281 38.462 0.00 0.00 45.00 1.73
1795 1811 7.658525 TCCAATTAGTTACCGTGTAGGATTA 57.341 36.000 0.00 0.00 45.00 1.75
1796 1812 6.549433 TCCAATTAGTTACCGTGTAGGATT 57.451 37.500 0.00 0.00 45.00 3.01
1797 1813 6.742559 ATCCAATTAGTTACCGTGTAGGAT 57.257 37.500 0.00 0.00 45.00 3.24
1798 1814 6.040842 GGTATCCAATTAGTTACCGTGTAGGA 59.959 42.308 0.00 0.00 45.00 2.94
1800 1816 7.047460 AGGTATCCAATTAGTTACCGTGTAG 57.953 40.000 5.75 0.00 39.27 2.74
1801 1817 8.710749 ATAGGTATCCAATTAGTTACCGTGTA 57.289 34.615 5.75 0.00 39.27 2.90
1802 1818 5.945144 AGGTATCCAATTAGTTACCGTGT 57.055 39.130 5.75 0.00 39.27 4.49
1803 1819 7.752239 CGTATAGGTATCCAATTAGTTACCGTG 59.248 40.741 5.75 0.00 39.27 4.94
1804 1820 7.448469 ACGTATAGGTATCCAATTAGTTACCGT 59.552 37.037 0.00 2.96 39.27 4.83
1805 1821 7.820648 ACGTATAGGTATCCAATTAGTTACCG 58.179 38.462 0.00 0.00 39.27 4.02
1807 1823 9.760660 CGTACGTATAGGTATCCAATTAGTTAC 57.239 37.037 7.22 0.00 0.00 2.50
1808 1824 9.502091 ACGTACGTATAGGTATCCAATTAGTTA 57.498 33.333 21.41 0.00 0.00 2.24
1809 1825 8.292448 CACGTACGTATAGGTATCCAATTAGTT 58.708 37.037 22.34 0.00 0.00 2.24
1810 1826 7.445402 ACACGTACGTATAGGTATCCAATTAGT 59.555 37.037 22.34 5.42 0.00 2.24
1811 1827 7.810658 ACACGTACGTATAGGTATCCAATTAG 58.189 38.462 22.34 4.75 0.00 1.73
1812 1828 7.744087 ACACGTACGTATAGGTATCCAATTA 57.256 36.000 22.34 0.00 0.00 1.40
1813 1829 6.639632 ACACGTACGTATAGGTATCCAATT 57.360 37.500 22.34 0.00 0.00 2.32
1814 1830 7.744087 TTACACGTACGTATAGGTATCCAAT 57.256 36.000 22.34 0.00 0.00 3.16
1815 1831 7.094805 GGATTACACGTACGTATAGGTATCCAA 60.095 40.741 22.29 10.04 34.63 3.53
1816 1832 6.371548 GGATTACACGTACGTATAGGTATCCA 59.628 42.308 22.29 8.98 34.63 3.41
1817 1833 6.455646 CGGATTACACGTACGTATAGGTATCC 60.456 46.154 22.34 20.40 32.86 2.59
1818 1834 6.310467 TCGGATTACACGTACGTATAGGTATC 59.690 42.308 22.34 13.66 0.00 2.24
1819 1835 6.163476 TCGGATTACACGTACGTATAGGTAT 58.837 40.000 22.34 4.73 0.00 2.73
1820 1836 5.534407 TCGGATTACACGTACGTATAGGTA 58.466 41.667 22.34 15.75 0.00 3.08
1821 1837 4.377021 TCGGATTACACGTACGTATAGGT 58.623 43.478 22.34 16.82 0.00 3.08
1822 1838 4.990543 TCGGATTACACGTACGTATAGG 57.009 45.455 22.34 11.34 0.00 2.57
1823 1839 5.349817 AGGATCGGATTACACGTACGTATAG 59.650 44.000 22.34 11.73 0.00 1.31
1824 1840 5.120674 CAGGATCGGATTACACGTACGTATA 59.879 44.000 22.34 12.21 0.00 1.47
1825 1841 4.067896 AGGATCGGATTACACGTACGTAT 58.932 43.478 22.34 13.50 0.00 3.06
1826 1842 3.248363 CAGGATCGGATTACACGTACGTA 59.752 47.826 22.34 6.15 0.00 3.57
1827 1843 2.032550 CAGGATCGGATTACACGTACGT 59.967 50.000 16.72 16.72 0.00 3.57
1828 1844 2.288729 TCAGGATCGGATTACACGTACG 59.711 50.000 15.01 15.01 0.00 3.67
1829 1845 3.625938 GTCAGGATCGGATTACACGTAC 58.374 50.000 0.00 0.00 0.00 3.67
1830 1846 2.288729 CGTCAGGATCGGATTACACGTA 59.711 50.000 0.00 0.00 0.00 3.57
1831 1847 1.065102 CGTCAGGATCGGATTACACGT 59.935 52.381 0.00 0.00 0.00 4.49
1832 1848 1.065102 ACGTCAGGATCGGATTACACG 59.935 52.381 9.66 9.66 0.00 4.49
1833 1849 2.858344 CAACGTCAGGATCGGATTACAC 59.142 50.000 0.00 0.00 0.00 2.90
1834 1850 2.159156 CCAACGTCAGGATCGGATTACA 60.159 50.000 0.86 0.00 0.00 2.41
1835 1851 2.470821 CCAACGTCAGGATCGGATTAC 58.529 52.381 0.86 0.00 0.00 1.89
1836 1852 1.411246 CCCAACGTCAGGATCGGATTA 59.589 52.381 8.47 0.00 0.00 1.75
1837 1853 0.178068 CCCAACGTCAGGATCGGATT 59.822 55.000 8.47 0.00 0.00 3.01
1838 1854 0.976073 ACCCAACGTCAGGATCGGAT 60.976 55.000 10.59 0.00 0.00 4.18
1839 1855 1.189524 AACCCAACGTCAGGATCGGA 61.190 55.000 10.59 0.00 0.00 4.55
1840 1856 0.321298 AAACCCAACGTCAGGATCGG 60.321 55.000 10.59 0.00 0.00 4.18
1841 1857 1.997606 GTAAACCCAACGTCAGGATCG 59.002 52.381 10.59 0.00 0.00 3.69
1842 1858 3.329929 AGTAAACCCAACGTCAGGATC 57.670 47.619 10.59 0.00 0.00 3.36
1843 1859 3.782656 AAGTAAACCCAACGTCAGGAT 57.217 42.857 10.59 0.00 0.00 3.24
1844 1860 3.118334 TGAAAGTAAACCCAACGTCAGGA 60.118 43.478 10.59 0.00 0.00 3.86
1845 1861 3.207778 TGAAAGTAAACCCAACGTCAGG 58.792 45.455 2.37 2.37 0.00 3.86
1846 1862 4.095185 TGTTGAAAGTAAACCCAACGTCAG 59.905 41.667 0.00 0.00 41.08 3.51
1847 1863 4.008330 TGTTGAAAGTAAACCCAACGTCA 58.992 39.130 0.00 0.00 41.08 4.35
1848 1864 4.142643 TGTGTTGAAAGTAAACCCAACGTC 60.143 41.667 0.00 0.00 41.08 4.34
1849 1865 3.757493 TGTGTTGAAAGTAAACCCAACGT 59.243 39.130 0.00 0.00 41.08 3.99
1850 1866 4.347813 CTGTGTTGAAAGTAAACCCAACG 58.652 43.478 0.00 0.00 41.08 4.10
1851 1867 4.109766 GCTGTGTTGAAAGTAAACCCAAC 58.890 43.478 0.00 0.00 39.29 3.77
1852 1868 4.020543 AGCTGTGTTGAAAGTAAACCCAA 58.979 39.130 0.00 0.00 0.00 4.12
1853 1869 3.626930 AGCTGTGTTGAAAGTAAACCCA 58.373 40.909 0.00 0.00 0.00 4.51
1854 1870 3.630312 TGAGCTGTGTTGAAAGTAAACCC 59.370 43.478 0.00 0.00 0.00 4.11
1855 1871 4.497507 GGTGAGCTGTGTTGAAAGTAAACC 60.498 45.833 0.00 0.00 0.00 3.27
1856 1872 4.335594 AGGTGAGCTGTGTTGAAAGTAAAC 59.664 41.667 0.00 0.00 0.00 2.01
1857 1873 4.523083 AGGTGAGCTGTGTTGAAAGTAAA 58.477 39.130 0.00 0.00 0.00 2.01
1858 1874 4.127171 GAGGTGAGCTGTGTTGAAAGTAA 58.873 43.478 0.00 0.00 0.00 2.24
1859 1875 3.494398 GGAGGTGAGCTGTGTTGAAAGTA 60.494 47.826 0.00 0.00 0.00 2.24
1860 1876 2.565841 GAGGTGAGCTGTGTTGAAAGT 58.434 47.619 0.00 0.00 0.00 2.66
1861 1877 1.876156 GGAGGTGAGCTGTGTTGAAAG 59.124 52.381 0.00 0.00 0.00 2.62
1862 1878 1.476833 GGGAGGTGAGCTGTGTTGAAA 60.477 52.381 0.00 0.00 0.00 2.69
1863 1879 0.108585 GGGAGGTGAGCTGTGTTGAA 59.891 55.000 0.00 0.00 0.00 2.69
1864 1880 1.053835 TGGGAGGTGAGCTGTGTTGA 61.054 55.000 0.00 0.00 0.00 3.18
1865 1881 0.179020 TTGGGAGGTGAGCTGTGTTG 60.179 55.000 0.00 0.00 0.00 3.33
1866 1882 0.550914 TTTGGGAGGTGAGCTGTGTT 59.449 50.000 0.00 0.00 0.00 3.32
1867 1883 0.773644 ATTTGGGAGGTGAGCTGTGT 59.226 50.000 0.00 0.00 0.00 3.72
1868 1884 1.815003 GAATTTGGGAGGTGAGCTGTG 59.185 52.381 0.00 0.00 0.00 3.66
1869 1885 1.272147 GGAATTTGGGAGGTGAGCTGT 60.272 52.381 0.00 0.00 0.00 4.40
1870 1886 1.005215 AGGAATTTGGGAGGTGAGCTG 59.995 52.381 0.00 0.00 0.00 4.24
1871 1887 1.283321 GAGGAATTTGGGAGGTGAGCT 59.717 52.381 0.00 0.00 0.00 4.09
1872 1888 1.283321 AGAGGAATTTGGGAGGTGAGC 59.717 52.381 0.00 0.00 0.00 4.26
1873 1889 3.728385 AAGAGGAATTTGGGAGGTGAG 57.272 47.619 0.00 0.00 0.00 3.51
1874 1890 4.018415 CCTTAAGAGGAATTTGGGAGGTGA 60.018 45.833 3.36 0.00 46.74 4.02
1875 1891 4.273318 CCTTAAGAGGAATTTGGGAGGTG 58.727 47.826 3.36 0.00 46.74 4.00
1876 1892 3.269643 CCCTTAAGAGGAATTTGGGAGGT 59.730 47.826 3.36 0.00 46.74 3.85
1877 1893 3.903467 CCCTTAAGAGGAATTTGGGAGG 58.097 50.000 3.36 0.00 46.74 4.30
1878 1894 3.291584 GCCCTTAAGAGGAATTTGGGAG 58.708 50.000 3.36 0.00 46.74 4.30
1879 1895 2.652348 TGCCCTTAAGAGGAATTTGGGA 59.348 45.455 3.36 0.00 46.74 4.37
1880 1896 3.100207 TGCCCTTAAGAGGAATTTGGG 57.900 47.619 3.36 0.00 46.74 4.12
1881 1897 4.540715 AGATGCCCTTAAGAGGAATTTGG 58.459 43.478 3.36 0.00 46.74 3.28
1882 1898 4.582240 GGAGATGCCCTTAAGAGGAATTTG 59.418 45.833 3.36 0.00 46.74 2.32
1883 1899 4.230502 TGGAGATGCCCTTAAGAGGAATTT 59.769 41.667 3.36 0.00 46.74 1.82
1884 1900 3.788142 TGGAGATGCCCTTAAGAGGAATT 59.212 43.478 3.36 0.00 46.74 2.17
1885 1901 3.393941 CTGGAGATGCCCTTAAGAGGAAT 59.606 47.826 3.36 3.58 46.74 3.01
1886 1902 2.774234 CTGGAGATGCCCTTAAGAGGAA 59.226 50.000 3.36 0.00 46.74 3.36
1887 1903 2.402564 CTGGAGATGCCCTTAAGAGGA 58.597 52.381 3.36 0.00 46.74 3.71
1888 1904 1.202746 GCTGGAGATGCCCTTAAGAGG 60.203 57.143 3.36 4.85 43.15 3.69
1889 1905 1.202746 GGCTGGAGATGCCCTTAAGAG 60.203 57.143 3.36 0.00 44.32 2.85
1890 1906 0.839946 GGCTGGAGATGCCCTTAAGA 59.160 55.000 3.36 0.00 44.32 2.10
1891 1907 3.410960 GGCTGGAGATGCCCTTAAG 57.589 57.895 0.00 0.00 44.32 1.85
1955 1971 0.246086 CAGGCCTAATTTTTGCGCCA 59.754 50.000 3.98 0.00 42.28 5.69
2055 2074 4.333372 GGCCGAAATTTATCGTGTTTAGGA 59.667 41.667 0.00 0.00 41.16 2.94
2057 2076 5.224562 TGGCCGAAATTTATCGTGTTTAG 57.775 39.130 0.00 0.00 41.16 1.85
2106 2125 1.504359 TGAAAATCCGCGAACTTCGT 58.496 45.000 8.23 0.00 42.81 3.85
2200 2219 1.990614 AAGGAGGAGAAGGCCGACC 60.991 63.158 0.00 0.00 0.00 4.79
2303 2325 0.587285 GCGGAGTCGTCGTCATCTAT 59.413 55.000 0.00 0.00 38.89 1.98
2446 2468 3.008240 GAGCTCGACGACGACGACA 62.008 63.158 17.84 0.00 43.81 4.35
2478 2500 4.083862 GAAGAAGGAGCCGGCCGT 62.084 66.667 26.15 13.73 0.00 5.68
2663 2689 1.949847 CTTCATCGCACTCCTCCGGT 61.950 60.000 0.00 0.00 0.00 5.28
3068 3095 0.322546