Multiple sequence alignment - TraesCS1A01G003400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G003400 chr1A 100.000 3579 0 0 1 3579 2164452 2160874 0.000000e+00 6610.0
1 TraesCS1A01G003400 chr1A 91.704 1808 121 14 653 2440 23218663 23216865 0.000000e+00 2481.0
2 TraesCS1A01G003400 chr1A 91.704 1808 121 14 653 2440 467349458 467351256 0.000000e+00 2481.0
3 TraesCS1A01G003400 chr1A 85.542 166 20 1 137 302 2175631 2175470 1.710000e-38 171.0
4 TraesCS1A01G003400 chr1A 95.238 42 2 0 591 632 23218704 23218663 2.310000e-07 67.6
5 TraesCS1A01G003400 chr1A 95.238 42 2 0 591 632 467349417 467349458 2.310000e-07 67.6
6 TraesCS1A01G003400 chr7A 91.704 1808 121 14 653 2440 735101789 735103587 0.000000e+00 2481.0
7 TraesCS1A01G003400 chr7A 95.238 42 2 0 591 632 735101748 735101789 2.310000e-07 67.6
8 TraesCS1A01G003400 chr6A 91.704 1808 121 14 653 2440 51454988 51456786 0.000000e+00 2481.0
9 TraesCS1A01G003400 chr6A 95.238 42 2 0 591 632 51454947 51454988 2.310000e-07 67.6
10 TraesCS1A01G003400 chr5A 91.704 1808 121 14 653 2440 15029030 15030828 0.000000e+00 2481.0
11 TraesCS1A01G003400 chr5A 91.704 1808 121 14 653 2440 482813080 482811282 0.000000e+00 2481.0
12 TraesCS1A01G003400 chr5A 91.704 1808 121 14 653 2440 544200916 544202714 0.000000e+00 2481.0
13 TraesCS1A01G003400 chr5A 83.784 74 11 1 2900 2973 531485954 531486026 6.410000e-08 69.4
14 TraesCS1A01G003400 chr5A 95.238 42 2 0 591 632 15028989 15029030 2.310000e-07 67.6
15 TraesCS1A01G003400 chr5A 95.238 42 2 0 591 632 482813121 482813080 2.310000e-07 67.6
16 TraesCS1A01G003400 chr5A 95.238 42 2 0 591 632 544200875 544200916 2.310000e-07 67.6
17 TraesCS1A01G003400 chr4A 91.704 1808 121 14 653 2440 653961057 653959259 0.000000e+00 2481.0
18 TraesCS1A01G003400 chr4A 91.810 232 19 0 345 576 620580980 620581211 1.240000e-84 324.0
19 TraesCS1A01G003400 chr4A 95.238 42 2 0 591 632 653961098 653961057 2.310000e-07 67.6
20 TraesCS1A01G003400 chr6D 87.327 1302 163 2 1043 2343 26751770 26750470 0.000000e+00 1489.0
21 TraesCS1A01G003400 chr6D 92.308 234 17 1 345 577 333375796 333376029 7.410000e-87 331.0
22 TraesCS1A01G003400 chr6D 84.314 102 11 2 2866 2966 161108820 161108917 1.060000e-15 95.3
23 TraesCS1A01G003400 chr6D 88.732 71 8 0 748 818 26752130 26752060 1.770000e-13 87.9
24 TraesCS1A01G003400 chrUn 98.013 302 6 0 1 302 260338210 260338511 3.170000e-145 525.0
25 TraesCS1A01G003400 chrUn 95.025 201 9 1 103 302 42770 42570 7.460000e-82 315.0
26 TraesCS1A01G003400 chrUn 98.450 129 2 0 2436 2564 24072598 24072726 1.000000e-55 228.0
27 TraesCS1A01G003400 chrUn 98.450 129 2 0 2436 2564 30636681 30636809 1.000000e-55 228.0
28 TraesCS1A01G003400 chrUn 98.450 129 2 0 2436 2564 254470449 254470577 1.000000e-55 228.0
29 TraesCS1A01G003400 chr3D 93.886 229 12 1 348 576 256979455 256979229 9.510000e-91 344.0
30 TraesCS1A01G003400 chr3D 92.208 231 17 1 348 577 523410598 523410368 3.450000e-85 326.0
31 TraesCS1A01G003400 chr3D 90.678 236 20 2 345 578 286777945 286778180 2.680000e-81 313.0
32 TraesCS1A01G003400 chr3D 84.848 99 10 1 2870 2968 608913327 608913420 1.060000e-15 95.3
33 TraesCS1A01G003400 chr3D 90.196 51 5 0 2561 2611 352795449 352795499 2.310000e-07 67.6
34 TraesCS1A01G003400 chr4D 92.576 229 16 1 345 573 14895377 14895604 9.580000e-86 327.0
35 TraesCS1A01G003400 chr4D 98.450 129 2 0 2436 2564 144974227 144974099 1.000000e-55 228.0
36 TraesCS1A01G003400 chr4D 98.450 129 2 0 2436 2564 300720532 300720404 1.000000e-55 228.0
37 TraesCS1A01G003400 chr4D 98.450 129 2 0 2436 2564 354764103 354763975 1.000000e-55 228.0
38 TraesCS1A01G003400 chr4D 98.450 129 2 0 2436 2564 404261999 404262127 1.000000e-55 228.0
39 TraesCS1A01G003400 chr4D 98.450 129 2 0 2436 2564 491145849 491145721 1.000000e-55 228.0
40 TraesCS1A01G003400 chr4D 86.000 100 10 2 2869 2968 487348481 487348576 1.760000e-18 104.0
41 TraesCS1A01G003400 chr1D 91.489 235 19 1 345 578 17669424 17669658 4.460000e-84 322.0
42 TraesCS1A01G003400 chr1D 92.105 152 10 2 2419 2570 418260670 418260819 2.800000e-51 213.0
43 TraesCS1A01G003400 chr1D 87.097 62 7 1 2912 2973 493679030 493679090 6.410000e-08 69.4
44 TraesCS1A01G003400 chr1D 81.111 90 10 5 2871 2959 438832556 438832639 8.290000e-07 65.8
45 TraesCS1A01G003400 chr7D 91.379 232 19 1 345 575 514067186 514067417 2.070000e-82 316.0
46 TraesCS1A01G003400 chr5D 90.678 236 21 1 345 579 58507692 58507927 2.680000e-81 313.0
47 TraesCS1A01G003400 chr6B 84.768 302 35 3 1 302 25563755 25563465 3.490000e-75 292.0
48 TraesCS1A01G003400 chr7B 89.764 127 11 2 3092 3216 667156481 667156607 1.030000e-35 161.0
49 TraesCS1A01G003400 chr7B 87.200 125 15 1 3092 3215 645548055 645547931 1.340000e-29 141.0
50 TraesCS1A01G003400 chr1B 94.915 59 3 0 584 642 163856 163798 3.800000e-15 93.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G003400 chr1A 2160874 2164452 3578 True 6610.00 6610 100.0000 1 3579 1 chr1A.!!$R1 3578
1 TraesCS1A01G003400 chr1A 23216865 23218704 1839 True 1274.30 2481 93.4710 591 2440 2 chr1A.!!$R3 1849
2 TraesCS1A01G003400 chr1A 467349417 467351256 1839 False 1274.30 2481 93.4710 591 2440 2 chr1A.!!$F1 1849
3 TraesCS1A01G003400 chr7A 735101748 735103587 1839 False 1274.30 2481 93.4710 591 2440 2 chr7A.!!$F1 1849
4 TraesCS1A01G003400 chr6A 51454947 51456786 1839 False 1274.30 2481 93.4710 591 2440 2 chr6A.!!$F1 1849
5 TraesCS1A01G003400 chr5A 15028989 15030828 1839 False 1274.30 2481 93.4710 591 2440 2 chr5A.!!$F2 1849
6 TraesCS1A01G003400 chr5A 482811282 482813121 1839 True 1274.30 2481 93.4710 591 2440 2 chr5A.!!$R1 1849
7 TraesCS1A01G003400 chr5A 544200875 544202714 1839 False 1274.30 2481 93.4710 591 2440 2 chr5A.!!$F3 1849
8 TraesCS1A01G003400 chr4A 653959259 653961098 1839 True 1274.30 2481 93.4710 591 2440 2 chr4A.!!$R1 1849
9 TraesCS1A01G003400 chr6D 26750470 26752130 1660 True 788.45 1489 88.0295 748 2343 2 chr6D.!!$R1 1595


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
379 380 0.032952 GGCGGTCGCATAACAGGATA 59.967 55.0 17.21 0.0 44.11 2.59 F
1138 1245 0.107456 CGGGAGGGGACATCAATCTG 59.893 60.0 0.00 0.0 0.00 2.90 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1729 1836 0.313672 TGCTTTTGATGCGGTTGACC 59.686 50.0 0.0 0.0 0.00 4.02 R
2656 2764 0.095935 CGCTTGGTGCAGATTTCGAG 59.904 55.0 0.0 0.0 43.06 4.04 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 3.595691 ACTCGAACCACTCAAGCTG 57.404 52.632 0.00 0.00 0.00 4.24
19 20 0.601311 ACTCGAACCACTCAAGCTGC 60.601 55.000 0.00 0.00 0.00 5.25
20 21 0.601046 CTCGAACCACTCAAGCTGCA 60.601 55.000 1.02 0.00 0.00 4.41
21 22 0.880278 TCGAACCACTCAAGCTGCAC 60.880 55.000 1.02 0.00 0.00 4.57
22 23 0.882042 CGAACCACTCAAGCTGCACT 60.882 55.000 1.02 0.00 0.00 4.40
23 24 0.871057 GAACCACTCAAGCTGCACTC 59.129 55.000 1.02 0.00 0.00 3.51
24 25 0.536006 AACCACTCAAGCTGCACTCC 60.536 55.000 1.02 0.00 0.00 3.85
25 26 1.374190 CCACTCAAGCTGCACTCCT 59.626 57.895 1.02 0.00 0.00 3.69
26 27 0.610174 CCACTCAAGCTGCACTCCTA 59.390 55.000 1.02 0.00 0.00 2.94
27 28 1.002430 CCACTCAAGCTGCACTCCTAA 59.998 52.381 1.02 0.00 0.00 2.69
28 29 2.344950 CACTCAAGCTGCACTCCTAAG 58.655 52.381 1.02 0.00 0.00 2.18
29 30 1.338579 ACTCAAGCTGCACTCCTAAGC 60.339 52.381 1.02 0.00 37.20 3.09
31 32 1.085091 CAAGCTGCACTCCTAAGCTG 58.915 55.000 1.02 0.00 46.36 4.24
32 33 0.035630 AAGCTGCACTCCTAAGCTGG 60.036 55.000 1.02 0.00 46.36 4.85
33 34 1.197430 AGCTGCACTCCTAAGCTGGT 61.197 55.000 1.02 0.00 45.36 4.00
34 35 1.023513 GCTGCACTCCTAAGCTGGTG 61.024 60.000 0.00 0.00 34.05 4.17
35 36 0.322975 CTGCACTCCTAAGCTGGTGT 59.677 55.000 0.00 0.00 34.56 4.16
36 37 0.764890 TGCACTCCTAAGCTGGTGTT 59.235 50.000 0.00 0.00 32.23 3.32
37 38 1.160137 GCACTCCTAAGCTGGTGTTG 58.840 55.000 0.00 0.00 32.23 3.33
38 39 1.270839 GCACTCCTAAGCTGGTGTTGA 60.271 52.381 0.00 0.00 32.23 3.18
39 40 2.693069 CACTCCTAAGCTGGTGTTGAG 58.307 52.381 0.00 0.00 32.23 3.02
40 41 1.625818 ACTCCTAAGCTGGTGTTGAGG 59.374 52.381 0.00 0.00 30.60 3.86
41 42 0.984230 TCCTAAGCTGGTGTTGAGGG 59.016 55.000 0.00 0.00 0.00 4.30
42 43 0.035056 CCTAAGCTGGTGTTGAGGGG 60.035 60.000 0.00 0.00 0.00 4.79
43 44 0.035056 CTAAGCTGGTGTTGAGGGGG 60.035 60.000 0.00 0.00 0.00 5.40
44 45 0.474854 TAAGCTGGTGTTGAGGGGGA 60.475 55.000 0.00 0.00 0.00 4.81
45 46 1.360393 AAGCTGGTGTTGAGGGGGAA 61.360 55.000 0.00 0.00 0.00 3.97
46 47 1.603739 GCTGGTGTTGAGGGGGAAC 60.604 63.158 0.00 0.00 0.00 3.62
47 48 2.069165 GCTGGTGTTGAGGGGGAACT 62.069 60.000 0.00 0.00 0.00 3.01
48 49 0.478507 CTGGTGTTGAGGGGGAACTT 59.521 55.000 0.00 0.00 0.00 2.66
49 50 0.184933 TGGTGTTGAGGGGGAACTTG 59.815 55.000 0.00 0.00 0.00 3.16
50 51 1.179174 GGTGTTGAGGGGGAACTTGC 61.179 60.000 0.00 0.00 0.00 4.01
51 52 0.178990 GTGTTGAGGGGGAACTTGCT 60.179 55.000 0.00 0.00 0.00 3.91
52 53 0.178992 TGTTGAGGGGGAACTTGCTG 60.179 55.000 0.00 0.00 0.00 4.41
53 54 0.895559 GTTGAGGGGGAACTTGCTGG 60.896 60.000 0.00 0.00 0.00 4.85
54 55 2.080336 TTGAGGGGGAACTTGCTGGG 62.080 60.000 0.00 0.00 0.00 4.45
55 56 2.452491 AGGGGGAACTTGCTGGGT 60.452 61.111 0.00 0.00 0.00 4.51
56 57 2.283173 GGGGGAACTTGCTGGGTG 60.283 66.667 0.00 0.00 0.00 4.61
57 58 2.991540 GGGGAACTTGCTGGGTGC 60.992 66.667 0.00 0.00 43.25 5.01
67 68 2.986290 CTGGGTGCACCGGTGATA 59.014 61.111 38.30 22.50 44.64 2.15
68 69 1.526887 CTGGGTGCACCGGTGATAT 59.473 57.895 38.30 0.00 44.64 1.63
69 70 0.532862 CTGGGTGCACCGGTGATATC 60.533 60.000 38.30 24.25 44.64 1.63
70 71 1.227853 GGGTGCACCGGTGATATCC 60.228 63.158 38.30 28.71 36.71 2.59
71 72 1.227853 GGTGCACCGGTGATATCCC 60.228 63.158 38.30 22.75 0.00 3.85
72 73 1.696097 GGTGCACCGGTGATATCCCT 61.696 60.000 38.30 0.00 0.00 4.20
73 74 0.249911 GTGCACCGGTGATATCCCTC 60.250 60.000 38.30 17.61 0.00 4.30
74 75 0.398522 TGCACCGGTGATATCCCTCT 60.399 55.000 38.30 0.00 0.00 3.69
75 76 0.318762 GCACCGGTGATATCCCTCTC 59.681 60.000 38.30 12.26 0.00 3.20
76 77 0.598562 CACCGGTGATATCCCTCTCG 59.401 60.000 31.31 0.00 0.00 4.04
77 78 0.185416 ACCGGTGATATCCCTCTCGT 59.815 55.000 6.12 0.00 0.00 4.18
78 79 0.598562 CCGGTGATATCCCTCTCGTG 59.401 60.000 0.00 0.00 0.00 4.35
79 80 0.598562 CGGTGATATCCCTCTCGTGG 59.401 60.000 0.00 0.00 0.00 4.94
80 81 1.705873 GGTGATATCCCTCTCGTGGT 58.294 55.000 0.00 0.00 0.00 4.16
81 82 2.812983 CGGTGATATCCCTCTCGTGGTA 60.813 54.545 0.00 0.00 0.00 3.25
82 83 2.820787 GGTGATATCCCTCTCGTGGTAG 59.179 54.545 0.00 0.00 0.00 3.18
83 84 3.498121 GGTGATATCCCTCTCGTGGTAGA 60.498 52.174 0.00 0.00 0.00 2.59
84 85 4.142790 GTGATATCCCTCTCGTGGTAGAA 58.857 47.826 0.00 0.00 0.00 2.10
85 86 4.583489 GTGATATCCCTCTCGTGGTAGAAA 59.417 45.833 0.00 0.00 0.00 2.52
86 87 5.244178 GTGATATCCCTCTCGTGGTAGAAAT 59.756 44.000 0.00 0.00 0.00 2.17
87 88 5.477291 TGATATCCCTCTCGTGGTAGAAATC 59.523 44.000 0.00 0.00 0.00 2.17
88 89 2.022195 TCCCTCTCGTGGTAGAAATCG 58.978 52.381 0.00 0.00 0.00 3.34
89 90 1.067212 CCCTCTCGTGGTAGAAATCGG 59.933 57.143 0.00 0.00 0.00 4.18
90 91 2.022195 CCTCTCGTGGTAGAAATCGGA 58.978 52.381 0.00 0.00 0.00 4.55
91 92 2.033550 CCTCTCGTGGTAGAAATCGGAG 59.966 54.545 0.00 0.00 0.00 4.63
92 93 2.683867 CTCTCGTGGTAGAAATCGGAGT 59.316 50.000 0.00 0.00 0.00 3.85
93 94 2.681848 TCTCGTGGTAGAAATCGGAGTC 59.318 50.000 0.00 0.00 0.00 3.36
94 95 2.422479 CTCGTGGTAGAAATCGGAGTCA 59.578 50.000 0.00 0.00 0.00 3.41
95 96 2.821378 TCGTGGTAGAAATCGGAGTCAA 59.179 45.455 0.00 0.00 0.00 3.18
96 97 3.119602 TCGTGGTAGAAATCGGAGTCAAG 60.120 47.826 0.00 0.00 0.00 3.02
97 98 3.119602 CGTGGTAGAAATCGGAGTCAAGA 60.120 47.826 0.00 0.00 0.00 3.02
98 99 4.425520 GTGGTAGAAATCGGAGTCAAGAG 58.574 47.826 0.00 0.00 0.00 2.85
99 100 4.082136 GTGGTAGAAATCGGAGTCAAGAGT 60.082 45.833 0.00 0.00 0.00 3.24
100 101 4.082190 TGGTAGAAATCGGAGTCAAGAGTG 60.082 45.833 0.00 0.00 0.00 3.51
101 102 3.601443 AGAAATCGGAGTCAAGAGTGG 57.399 47.619 0.00 0.00 0.00 4.00
102 103 2.900546 AGAAATCGGAGTCAAGAGTGGT 59.099 45.455 0.00 0.00 0.00 4.16
103 104 2.751166 AATCGGAGTCAAGAGTGGTG 57.249 50.000 0.00 0.00 0.00 4.17
104 105 0.898320 ATCGGAGTCAAGAGTGGTGG 59.102 55.000 0.00 0.00 0.00 4.61
105 106 1.374758 CGGAGTCAAGAGTGGTGGC 60.375 63.158 0.00 0.00 0.00 5.01
106 107 1.374758 GGAGTCAAGAGTGGTGGCG 60.375 63.158 0.00 0.00 0.00 5.69
107 108 1.374758 GAGTCAAGAGTGGTGGCGG 60.375 63.158 0.00 0.00 0.00 6.13
108 109 3.050275 GTCAAGAGTGGTGGCGGC 61.050 66.667 0.00 0.00 0.00 6.53
109 110 4.680237 TCAAGAGTGGTGGCGGCG 62.680 66.667 0.51 0.51 0.00 6.46
126 127 2.809174 GGCAACGGCGAAATTGGC 60.809 61.111 16.62 16.84 43.11 4.52
127 128 2.049618 GCAACGGCGAAATTGGCA 60.050 55.556 16.62 0.00 0.00 4.92
128 129 2.371923 GCAACGGCGAAATTGGCAC 61.372 57.895 16.62 0.00 0.00 5.01
129 130 1.732683 CAACGGCGAAATTGGCACC 60.733 57.895 16.62 0.00 0.00 5.01
130 131 1.901464 AACGGCGAAATTGGCACCT 60.901 52.632 16.62 0.00 0.00 4.00
131 132 1.460273 AACGGCGAAATTGGCACCTT 61.460 50.000 16.62 0.00 0.00 3.50
132 133 1.444212 CGGCGAAATTGGCACCTTG 60.444 57.895 0.00 0.00 0.00 3.61
133 134 1.861542 CGGCGAAATTGGCACCTTGA 61.862 55.000 0.00 0.00 0.00 3.02
134 135 0.532115 GGCGAAATTGGCACCTTGAT 59.468 50.000 1.88 0.00 0.00 2.57
135 136 1.632422 GCGAAATTGGCACCTTGATG 58.368 50.000 0.00 0.00 0.00 3.07
136 137 1.736696 GCGAAATTGGCACCTTGATGG 60.737 52.381 0.00 0.00 42.93 3.51
137 138 1.818060 CGAAATTGGCACCTTGATGGA 59.182 47.619 0.00 0.00 39.71 3.41
138 139 2.230992 CGAAATTGGCACCTTGATGGAA 59.769 45.455 0.00 0.00 39.71 3.53
139 140 3.674138 CGAAATTGGCACCTTGATGGAAG 60.674 47.826 0.00 0.00 39.71 3.46
140 141 1.188863 ATTGGCACCTTGATGGAAGC 58.811 50.000 0.00 0.00 39.71 3.86
141 142 0.112995 TTGGCACCTTGATGGAAGCT 59.887 50.000 0.00 0.00 39.23 3.74
142 143 0.609957 TGGCACCTTGATGGAAGCTG 60.610 55.000 0.00 0.00 39.23 4.24
143 144 1.509923 GCACCTTGATGGAAGCTGC 59.490 57.895 0.00 0.00 36.37 5.25
144 145 1.941999 GCACCTTGATGGAAGCTGCC 61.942 60.000 2.64 2.64 37.31 4.85
145 146 1.377725 ACCTTGATGGAAGCTGCCG 60.378 57.895 6.16 0.00 39.71 5.69
146 147 1.377725 CCTTGATGGAAGCTGCCGT 60.378 57.895 4.61 4.61 38.35 5.68
147 148 0.962356 CCTTGATGGAAGCTGCCGTT 60.962 55.000 6.98 0.00 38.35 4.44
148 149 1.678728 CCTTGATGGAAGCTGCCGTTA 60.679 52.381 6.98 0.00 38.35 3.18
149 150 2.292267 CTTGATGGAAGCTGCCGTTAT 58.708 47.619 6.98 0.00 0.00 1.89
150 151 1.667236 TGATGGAAGCTGCCGTTATG 58.333 50.000 6.98 0.00 0.00 1.90
151 152 0.308993 GATGGAAGCTGCCGTTATGC 59.691 55.000 6.98 0.00 0.00 3.14
152 153 0.394216 ATGGAAGCTGCCGTTATGCA 60.394 50.000 6.16 0.00 39.37 3.96
153 154 1.305219 TGGAAGCTGCCGTTATGCAC 61.305 55.000 6.16 0.00 36.04 4.57
154 155 1.429423 GAAGCTGCCGTTATGCACC 59.571 57.895 0.00 0.00 36.04 5.01
155 156 1.002134 AAGCTGCCGTTATGCACCT 60.002 52.632 0.00 0.00 36.04 4.00
156 157 1.308069 AAGCTGCCGTTATGCACCTG 61.308 55.000 0.00 0.00 36.04 4.00
157 158 2.764314 GCTGCCGTTATGCACCTGG 61.764 63.158 0.00 0.00 36.04 4.45
158 159 2.045438 TGCCGTTATGCACCTGGG 60.045 61.111 0.00 0.00 36.04 4.45
159 160 2.045340 GCCGTTATGCACCTGGGT 60.045 61.111 0.00 0.00 0.00 4.51
161 162 1.748879 CCGTTATGCACCTGGGTGG 60.749 63.158 19.69 3.67 45.49 4.61
162 163 2.406616 CGTTATGCACCTGGGTGGC 61.407 63.158 19.69 12.82 45.49 5.01
163 164 2.045438 TTATGCACCTGGGTGGCG 60.045 61.111 19.69 0.00 45.49 5.69
164 165 3.636929 TTATGCACCTGGGTGGCGG 62.637 63.158 19.69 0.00 45.49 6.13
171 172 4.108299 CTGGGTGGCGGGCACATA 62.108 66.667 31.77 20.05 0.00 2.29
172 173 3.415983 TGGGTGGCGGGCACATAT 61.416 61.111 31.77 0.00 0.00 1.78
173 174 2.906897 GGGTGGCGGGCACATATG 60.907 66.667 31.77 0.00 0.00 1.78
174 175 2.906897 GGTGGCGGGCACATATGG 60.907 66.667 31.77 0.00 0.00 2.74
190 191 2.831859 TGGCAAGCCCATGTTTTCA 58.168 47.368 8.89 0.00 39.18 2.69
191 192 0.680618 TGGCAAGCCCATGTTTTCAG 59.319 50.000 8.89 0.00 39.18 3.02
192 193 0.671472 GGCAAGCCCATGTTTTCAGC 60.671 55.000 0.00 0.00 0.00 4.26
193 194 0.319405 GCAAGCCCATGTTTTCAGCT 59.681 50.000 0.00 0.00 31.62 4.24
194 195 1.545582 GCAAGCCCATGTTTTCAGCTA 59.454 47.619 0.00 0.00 30.45 3.32
195 196 2.672195 GCAAGCCCATGTTTTCAGCTAC 60.672 50.000 0.00 0.00 30.45 3.58
196 197 2.557924 CAAGCCCATGTTTTCAGCTACA 59.442 45.455 0.00 0.00 30.45 2.74
197 198 2.875296 AGCCCATGTTTTCAGCTACAA 58.125 42.857 0.00 0.00 29.15 2.41
198 199 2.558359 AGCCCATGTTTTCAGCTACAAC 59.442 45.455 0.00 0.00 29.15 3.32
199 200 2.352715 GCCCATGTTTTCAGCTACAACC 60.353 50.000 0.00 0.00 0.00 3.77
200 201 2.890311 CCCATGTTTTCAGCTACAACCA 59.110 45.455 0.00 0.00 0.00 3.67
201 202 3.320541 CCCATGTTTTCAGCTACAACCAA 59.679 43.478 0.00 0.00 0.00 3.67
202 203 4.021192 CCCATGTTTTCAGCTACAACCAAT 60.021 41.667 0.00 0.00 0.00 3.16
203 204 4.925054 CCATGTTTTCAGCTACAACCAATG 59.075 41.667 0.00 0.00 0.00 2.82
204 205 5.509501 CCATGTTTTCAGCTACAACCAATGT 60.510 40.000 0.00 0.00 46.36 2.71
205 206 5.181690 TGTTTTCAGCTACAACCAATGTC 57.818 39.130 0.00 0.00 42.70 3.06
206 207 4.037446 TGTTTTCAGCTACAACCAATGTCC 59.963 41.667 0.00 0.00 42.70 4.02
207 208 2.489938 TCAGCTACAACCAATGTCCC 57.510 50.000 0.00 0.00 42.70 4.46
208 209 1.702401 TCAGCTACAACCAATGTCCCA 59.298 47.619 0.00 0.00 42.70 4.37
209 210 2.107378 TCAGCTACAACCAATGTCCCAA 59.893 45.455 0.00 0.00 42.70 4.12
210 211 2.890311 CAGCTACAACCAATGTCCCAAA 59.110 45.455 0.00 0.00 42.70 3.28
211 212 3.320541 CAGCTACAACCAATGTCCCAAAA 59.679 43.478 0.00 0.00 42.70 2.44
212 213 3.964031 AGCTACAACCAATGTCCCAAAAA 59.036 39.130 0.00 0.00 42.70 1.94
213 214 4.592778 AGCTACAACCAATGTCCCAAAAAT 59.407 37.500 0.00 0.00 42.70 1.82
214 215 5.777732 AGCTACAACCAATGTCCCAAAAATA 59.222 36.000 0.00 0.00 42.70 1.40
215 216 5.867174 GCTACAACCAATGTCCCAAAAATAC 59.133 40.000 0.00 0.00 42.70 1.89
216 217 5.878406 ACAACCAATGTCCCAAAAATACA 57.122 34.783 0.00 0.00 37.96 2.29
217 218 6.432403 ACAACCAATGTCCCAAAAATACAT 57.568 33.333 0.00 0.00 37.96 2.29
218 219 6.836242 ACAACCAATGTCCCAAAAATACATT 58.164 32.000 0.00 0.00 42.91 2.71
219 220 7.967908 ACAACCAATGTCCCAAAAATACATTA 58.032 30.769 0.00 0.00 40.83 1.90
220 221 8.432805 ACAACCAATGTCCCAAAAATACATTAA 58.567 29.630 0.00 0.00 40.83 1.40
221 222 9.277783 CAACCAATGTCCCAAAAATACATTAAA 57.722 29.630 0.00 0.00 40.83 1.52
222 223 8.840833 ACCAATGTCCCAAAAATACATTAAAC 57.159 30.769 0.00 0.00 40.83 2.01
223 224 8.432805 ACCAATGTCCCAAAAATACATTAAACA 58.567 29.630 0.00 0.00 40.83 2.83
224 225 8.716909 CCAATGTCCCAAAAATACATTAAACAC 58.283 33.333 0.00 0.00 40.83 3.32
225 226 9.265901 CAATGTCCCAAAAATACATTAAACACA 57.734 29.630 0.00 0.00 40.83 3.72
228 229 9.265901 TGTCCCAAAAATACATTAAACACATTG 57.734 29.630 0.00 0.00 0.00 2.82
229 230 9.482627 GTCCCAAAAATACATTAAACACATTGA 57.517 29.630 0.00 0.00 0.00 2.57
230 231 9.482627 TCCCAAAAATACATTAAACACATTGAC 57.517 29.630 0.00 0.00 0.00 3.18
231 232 9.265901 CCCAAAAATACATTAAACACATTGACA 57.734 29.630 0.00 0.00 0.00 3.58
246 247 9.846248 AACACATTGACAAATTAATCTAGCTTC 57.154 29.630 0.00 0.00 0.00 3.86
247 248 9.236006 ACACATTGACAAATTAATCTAGCTTCT 57.764 29.630 0.00 0.00 0.00 2.85
248 249 9.499585 CACATTGACAAATTAATCTAGCTTCTG 57.500 33.333 0.00 0.00 0.00 3.02
249 250 8.680903 ACATTGACAAATTAATCTAGCTTCTGG 58.319 33.333 0.00 0.00 0.00 3.86
250 251 6.683974 TGACAAATTAATCTAGCTTCTGGC 57.316 37.500 0.00 0.00 42.19 4.85
268 269 1.633774 GCTAGGACTAGGCCTATGCA 58.366 55.000 27.84 11.76 39.68 3.96
269 270 1.971357 GCTAGGACTAGGCCTATGCAA 59.029 52.381 27.84 11.44 39.68 4.08
270 271 2.569404 GCTAGGACTAGGCCTATGCAAT 59.431 50.000 27.84 8.07 39.68 3.56
271 272 3.008485 GCTAGGACTAGGCCTATGCAATT 59.992 47.826 27.84 7.43 39.68 2.32
272 273 4.223032 GCTAGGACTAGGCCTATGCAATTA 59.777 45.833 27.84 9.56 39.68 1.40
273 274 4.899352 AGGACTAGGCCTATGCAATTAG 57.101 45.455 18.31 2.74 40.13 1.73
274 275 4.235372 AGGACTAGGCCTATGCAATTAGT 58.765 43.478 18.31 6.59 40.13 2.24
275 276 5.403512 AGGACTAGGCCTATGCAATTAGTA 58.596 41.667 18.31 0.00 40.13 1.82
276 277 5.246429 AGGACTAGGCCTATGCAATTAGTAC 59.754 44.000 18.31 7.60 40.13 2.73
277 278 5.246429 GGACTAGGCCTATGCAATTAGTACT 59.754 44.000 14.30 0.00 40.13 2.73
278 279 6.436532 GGACTAGGCCTATGCAATTAGTACTA 59.563 42.308 14.30 0.00 40.13 1.82
279 280 7.124448 GGACTAGGCCTATGCAATTAGTACTAT 59.876 40.741 14.30 0.00 40.13 2.12
280 281 7.841956 ACTAGGCCTATGCAATTAGTACTATG 58.158 38.462 14.30 1.15 40.13 2.23
281 282 6.688073 AGGCCTATGCAATTAGTACTATGT 57.312 37.500 1.29 0.00 40.13 2.29
282 283 7.792364 AGGCCTATGCAATTAGTACTATGTA 57.208 36.000 1.29 0.00 40.13 2.29
283 284 7.612677 AGGCCTATGCAATTAGTACTATGTAC 58.387 38.462 1.29 0.05 40.13 2.90
284 285 6.530534 GGCCTATGCAATTAGTACTATGTACG 59.469 42.308 2.79 0.00 40.13 3.67
285 286 7.088905 GCCTATGCAATTAGTACTATGTACGT 58.911 38.462 2.79 0.00 37.47 3.57
286 287 8.239314 GCCTATGCAATTAGTACTATGTACGTA 58.761 37.037 2.79 0.00 37.47 3.57
287 288 9.552114 CCTATGCAATTAGTACTATGTACGTAC 57.448 37.037 18.90 18.90 37.96 3.67
288 289 9.552114 CTATGCAATTAGTACTATGTACGTACC 57.448 37.037 22.43 6.29 38.34 3.34
289 290 7.332213 TGCAATTAGTACTATGTACGTACCA 57.668 36.000 22.43 11.24 38.34 3.25
290 291 7.770201 TGCAATTAGTACTATGTACGTACCAA 58.230 34.615 22.43 9.77 38.34 3.67
291 292 8.415553 TGCAATTAGTACTATGTACGTACCAAT 58.584 33.333 22.43 12.78 38.34 3.16
292 293 8.697067 GCAATTAGTACTATGTACGTACCAATG 58.303 37.037 22.43 12.23 38.34 2.82
293 294 9.955208 CAATTAGTACTATGTACGTACCAATGA 57.045 33.333 22.43 4.16 38.34 2.57
296 297 7.636150 AGTACTATGTACGTACCAATGAAGT 57.364 36.000 22.43 16.58 38.34 3.01
297 298 7.701445 AGTACTATGTACGTACCAATGAAGTC 58.299 38.462 22.43 10.16 38.34 3.01
298 299 5.575957 ACTATGTACGTACCAATGAAGTCG 58.424 41.667 22.43 2.76 0.00 4.18
299 300 4.707030 ATGTACGTACCAATGAAGTCGA 57.293 40.909 22.43 0.00 0.00 4.20
300 301 4.707030 TGTACGTACCAATGAAGTCGAT 57.293 40.909 22.43 0.00 0.00 3.59
301 302 4.417506 TGTACGTACCAATGAAGTCGATG 58.582 43.478 22.43 0.00 0.00 3.84
302 303 2.268298 ACGTACCAATGAAGTCGATGC 58.732 47.619 0.00 0.00 0.00 3.91
303 304 2.094182 ACGTACCAATGAAGTCGATGCT 60.094 45.455 0.00 0.00 0.00 3.79
304 305 2.930040 CGTACCAATGAAGTCGATGCTT 59.070 45.455 0.00 0.00 0.00 3.91
305 306 3.370978 CGTACCAATGAAGTCGATGCTTT 59.629 43.478 0.00 0.00 0.00 3.51
306 307 4.565166 CGTACCAATGAAGTCGATGCTTTA 59.435 41.667 0.00 0.00 0.00 1.85
307 308 5.062934 CGTACCAATGAAGTCGATGCTTTAA 59.937 40.000 0.00 0.00 0.00 1.52
308 309 6.238103 CGTACCAATGAAGTCGATGCTTTAAT 60.238 38.462 0.00 0.00 0.00 1.40
309 310 6.515272 ACCAATGAAGTCGATGCTTTAATT 57.485 33.333 0.00 0.00 0.00 1.40
310 311 7.624360 ACCAATGAAGTCGATGCTTTAATTA 57.376 32.000 0.00 0.00 0.00 1.40
311 312 8.050778 ACCAATGAAGTCGATGCTTTAATTAA 57.949 30.769 0.00 0.00 0.00 1.40
312 313 8.519526 ACCAATGAAGTCGATGCTTTAATTAAA 58.480 29.630 10.16 10.16 0.00 1.52
313 314 9.352784 CCAATGAAGTCGATGCTTTAATTAAAA 57.647 29.630 11.62 0.00 0.00 1.52
316 317 8.429739 TGAAGTCGATGCTTTAATTAAAAACG 57.570 30.769 11.62 13.08 0.00 3.60
317 318 8.283992 TGAAGTCGATGCTTTAATTAAAAACGA 58.716 29.630 11.62 14.71 0.00 3.85
318 319 8.431020 AAGTCGATGCTTTAATTAAAAACGAC 57.569 30.769 27.53 27.53 43.85 4.34
319 320 7.803724 AGTCGATGCTTTAATTAAAAACGACT 58.196 30.769 29.37 29.37 46.91 4.18
321 322 9.698617 GTCGATGCTTTAATTAAAAACGACTAT 57.301 29.630 27.51 13.04 41.55 2.12
322 323 9.910511 TCGATGCTTTAATTAAAAACGACTATC 57.089 29.630 11.62 7.13 0.00 2.08
323 324 9.155053 CGATGCTTTAATTAAAAACGACTATCC 57.845 33.333 11.62 0.00 0.00 2.59
324 325 9.997482 GATGCTTTAATTAAAAACGACTATCCA 57.003 29.630 11.62 0.00 0.00 3.41
326 327 9.005777 TGCTTTAATTAAAAACGACTATCCAGT 57.994 29.630 11.62 0.00 37.87 4.00
327 328 9.274065 GCTTTAATTAAAAACGACTATCCAGTG 57.726 33.333 11.62 0.00 34.21 3.66
340 341 8.728833 ACGACTATCCAGTGTATACTAATTAGC 58.271 37.037 12.54 0.00 34.74 3.09
341 342 8.727910 CGACTATCCAGTGTATACTAATTAGCA 58.272 37.037 12.54 0.00 34.74 3.49
343 344 8.524487 ACTATCCAGTGTATACTAATTAGCAGC 58.476 37.037 12.54 1.81 34.74 5.25
344 345 6.978674 TCCAGTGTATACTAATTAGCAGCT 57.021 37.500 12.54 0.00 34.74 4.24
345 346 7.361457 TCCAGTGTATACTAATTAGCAGCTT 57.639 36.000 12.54 0.00 34.74 3.74
346 347 8.473358 TCCAGTGTATACTAATTAGCAGCTTA 57.527 34.615 12.54 0.00 34.74 3.09
347 348 8.920174 TCCAGTGTATACTAATTAGCAGCTTAA 58.080 33.333 12.54 0.00 34.74 1.85
348 349 9.542462 CCAGTGTATACTAATTAGCAGCTTAAA 57.458 33.333 12.54 0.00 34.74 1.52
350 351 9.543783 AGTGTATACTAATTAGCAGCTTAAACC 57.456 33.333 12.54 0.00 34.74 3.27
351 352 8.485591 GTGTATACTAATTAGCAGCTTAAACCG 58.514 37.037 12.54 0.00 0.00 4.44
352 353 7.654520 TGTATACTAATTAGCAGCTTAAACCGG 59.345 37.037 12.54 0.00 0.00 5.28
353 354 4.840271 ACTAATTAGCAGCTTAAACCGGT 58.160 39.130 12.54 0.00 0.00 5.28
354 355 5.250982 ACTAATTAGCAGCTTAAACCGGTT 58.749 37.500 15.86 15.86 0.00 4.44
355 356 4.696899 AATTAGCAGCTTAAACCGGTTC 57.303 40.909 22.53 8.09 0.00 3.62
356 357 1.717194 TAGCAGCTTAAACCGGTTCG 58.283 50.000 22.53 13.23 0.00 3.95
370 371 4.155733 TTCGGATGGCGGTCGCAT 62.156 61.111 17.21 8.55 44.11 4.73
371 372 2.787567 TTCGGATGGCGGTCGCATA 61.788 57.895 17.21 5.89 44.11 3.14
372 373 2.279851 CGGATGGCGGTCGCATAA 60.280 61.111 17.21 2.61 44.11 1.90
373 374 2.594962 CGGATGGCGGTCGCATAAC 61.595 63.158 17.21 4.44 44.11 1.89
374 375 1.522806 GGATGGCGGTCGCATAACA 60.523 57.895 17.21 6.12 44.11 2.41
375 376 1.498865 GGATGGCGGTCGCATAACAG 61.499 60.000 17.21 0.00 44.11 3.16
376 377 1.498865 GATGGCGGTCGCATAACAGG 61.499 60.000 17.21 0.00 44.11 4.00
377 378 1.966901 ATGGCGGTCGCATAACAGGA 61.967 55.000 17.21 0.00 44.11 3.86
378 379 1.227556 GGCGGTCGCATAACAGGAT 60.228 57.895 17.21 0.00 44.11 3.24
379 380 0.032952 GGCGGTCGCATAACAGGATA 59.967 55.000 17.21 0.00 44.11 2.59
380 381 1.419374 GCGGTCGCATAACAGGATAG 58.581 55.000 10.67 0.00 41.49 2.08
381 382 1.935300 GCGGTCGCATAACAGGATAGG 60.935 57.143 10.67 0.00 41.49 2.57
382 383 1.340248 CGGTCGCATAACAGGATAGGT 59.660 52.381 0.00 0.00 0.00 3.08
383 384 2.755650 GGTCGCATAACAGGATAGGTG 58.244 52.381 0.00 0.00 0.00 4.00
384 385 2.102588 GGTCGCATAACAGGATAGGTGT 59.897 50.000 0.00 0.00 0.00 4.16
385 386 3.431766 GGTCGCATAACAGGATAGGTGTT 60.432 47.826 0.00 0.00 41.11 3.32
386 387 4.189231 GTCGCATAACAGGATAGGTGTTT 58.811 43.478 0.00 0.00 38.98 2.83
387 388 5.353938 GTCGCATAACAGGATAGGTGTTTA 58.646 41.667 0.00 0.00 38.98 2.01
388 389 5.462398 GTCGCATAACAGGATAGGTGTTTAG 59.538 44.000 0.00 0.00 38.98 1.85
389 390 4.750098 CGCATAACAGGATAGGTGTTTAGG 59.250 45.833 0.00 0.00 38.98 2.69
390 391 5.063880 GCATAACAGGATAGGTGTTTAGGG 58.936 45.833 0.00 0.00 38.98 3.53
391 392 5.163237 GCATAACAGGATAGGTGTTTAGGGA 60.163 44.000 0.00 0.00 38.98 4.20
392 393 6.525629 CATAACAGGATAGGTGTTTAGGGAG 58.474 44.000 0.00 0.00 38.98 4.30
393 394 2.772515 ACAGGATAGGTGTTTAGGGAGC 59.227 50.000 0.00 0.00 0.00 4.70
394 395 3.041946 CAGGATAGGTGTTTAGGGAGCT 58.958 50.000 0.00 0.00 0.00 4.09
395 396 3.456277 CAGGATAGGTGTTTAGGGAGCTT 59.544 47.826 0.00 0.00 0.00 3.74
396 397 4.654262 CAGGATAGGTGTTTAGGGAGCTTA 59.346 45.833 0.00 0.00 0.00 3.09
397 398 5.308237 CAGGATAGGTGTTTAGGGAGCTTAT 59.692 44.000 0.00 0.00 0.00 1.73
398 399 5.544562 AGGATAGGTGTTTAGGGAGCTTATC 59.455 44.000 0.00 0.00 0.00 1.75
422 423 2.873133 TTTTTGCCTTACCGGTTGTG 57.127 45.000 15.04 1.87 34.25 3.33
423 424 2.054232 TTTTGCCTTACCGGTTGTGA 57.946 45.000 15.04 0.00 34.25 3.58
424 425 2.279935 TTTGCCTTACCGGTTGTGAT 57.720 45.000 15.04 0.00 34.25 3.06
425 426 2.279935 TTGCCTTACCGGTTGTGATT 57.720 45.000 15.04 0.00 34.25 2.57
426 427 1.816074 TGCCTTACCGGTTGTGATTC 58.184 50.000 15.04 0.00 34.25 2.52
427 428 1.349688 TGCCTTACCGGTTGTGATTCT 59.650 47.619 15.04 0.00 34.25 2.40
428 429 1.737793 GCCTTACCGGTTGTGATTCTG 59.262 52.381 15.04 0.00 34.25 3.02
429 430 2.614481 GCCTTACCGGTTGTGATTCTGA 60.614 50.000 15.04 0.00 34.25 3.27
430 431 3.262420 CCTTACCGGTTGTGATTCTGAG 58.738 50.000 15.04 0.00 0.00 3.35
431 432 2.380084 TACCGGTTGTGATTCTGAGC 57.620 50.000 15.04 0.00 0.00 4.26
432 433 0.396435 ACCGGTTGTGATTCTGAGCA 59.604 50.000 0.00 0.00 0.00 4.26
433 434 1.003580 ACCGGTTGTGATTCTGAGCAT 59.996 47.619 0.00 0.00 0.00 3.79
434 435 1.399440 CCGGTTGTGATTCTGAGCATG 59.601 52.381 0.00 0.00 0.00 4.06
435 436 2.079158 CGGTTGTGATTCTGAGCATGT 58.921 47.619 0.00 0.00 0.00 3.21
436 437 3.261580 CGGTTGTGATTCTGAGCATGTA 58.738 45.455 0.00 0.00 0.00 2.29
437 438 3.062639 CGGTTGTGATTCTGAGCATGTAC 59.937 47.826 0.00 0.00 0.00 2.90
438 439 4.256920 GGTTGTGATTCTGAGCATGTACT 58.743 43.478 0.00 0.00 0.00 2.73
439 440 4.697352 GGTTGTGATTCTGAGCATGTACTT 59.303 41.667 0.00 0.00 0.00 2.24
440 441 5.182001 GGTTGTGATTCTGAGCATGTACTTT 59.818 40.000 0.00 0.00 0.00 2.66
441 442 6.294176 GGTTGTGATTCTGAGCATGTACTTTT 60.294 38.462 0.00 0.00 0.00 2.27
442 443 7.094805 GGTTGTGATTCTGAGCATGTACTTTTA 60.095 37.037 0.00 0.00 0.00 1.52
443 444 8.454106 GTTGTGATTCTGAGCATGTACTTTTAT 58.546 33.333 0.00 0.00 0.00 1.40
444 445 8.565896 TGTGATTCTGAGCATGTACTTTTATT 57.434 30.769 0.00 0.00 0.00 1.40
445 446 9.013229 TGTGATTCTGAGCATGTACTTTTATTT 57.987 29.630 0.00 0.00 0.00 1.40
446 447 9.846248 GTGATTCTGAGCATGTACTTTTATTTT 57.154 29.630 0.00 0.00 0.00 1.82
462 463 9.366216 ACTTTTATTTTCTTTTCTTTGCTTCGT 57.634 25.926 0.00 0.00 0.00 3.85
465 466 9.965748 TTTATTTTCTTTTCTTTGCTTCGTTTG 57.034 25.926 0.00 0.00 0.00 2.93
466 467 5.448926 TTTCTTTTCTTTGCTTCGTTTGC 57.551 34.783 0.00 0.00 0.00 3.68
467 468 3.105203 TCTTTTCTTTGCTTCGTTTGCG 58.895 40.909 0.00 0.00 39.92 4.85
468 469 2.834574 TTTCTTTGCTTCGTTTGCGA 57.165 40.000 0.00 0.00 46.36 5.10
479 480 2.264813 TCGTTTGCGAGCTGTAATACC 58.735 47.619 0.00 0.00 42.81 2.73
480 481 2.094390 TCGTTTGCGAGCTGTAATACCT 60.094 45.455 0.00 0.00 42.81 3.08
481 482 2.671396 CGTTTGCGAGCTGTAATACCTT 59.329 45.455 0.00 0.00 41.33 3.50
482 483 3.124636 CGTTTGCGAGCTGTAATACCTTT 59.875 43.478 0.00 0.00 41.33 3.11
483 484 4.327898 CGTTTGCGAGCTGTAATACCTTTA 59.672 41.667 0.00 0.00 41.33 1.85
484 485 5.006358 CGTTTGCGAGCTGTAATACCTTTAT 59.994 40.000 0.00 0.00 41.33 1.40
485 486 6.456449 CGTTTGCGAGCTGTAATACCTTTATT 60.456 38.462 0.00 0.00 41.33 1.40
486 487 7.254185 CGTTTGCGAGCTGTAATACCTTTATTA 60.254 37.037 0.00 0.00 41.33 0.98
487 488 7.473027 TTGCGAGCTGTAATACCTTTATTAC 57.527 36.000 0.00 7.37 45.73 1.89
488 489 6.812998 TGCGAGCTGTAATACCTTTATTACT 58.187 36.000 13.19 0.00 45.72 2.24
489 490 7.270047 TGCGAGCTGTAATACCTTTATTACTT 58.730 34.615 13.19 3.00 45.72 2.24
490 491 7.767198 TGCGAGCTGTAATACCTTTATTACTTT 59.233 33.333 13.19 2.74 45.72 2.66
491 492 8.062448 GCGAGCTGTAATACCTTTATTACTTTG 58.938 37.037 13.19 7.02 45.72 2.77
492 493 9.095065 CGAGCTGTAATACCTTTATTACTTTGT 57.905 33.333 13.19 0.00 45.72 2.83
494 495 8.674607 AGCTGTAATACCTTTATTACTTTGTGC 58.325 33.333 13.19 10.11 45.72 4.57
495 496 8.674607 GCTGTAATACCTTTATTACTTTGTGCT 58.325 33.333 13.19 0.00 45.72 4.40
502 503 8.556213 ACCTTTATTACTTTGTGCTATTTCGA 57.444 30.769 0.00 0.00 0.00 3.71
503 504 8.665685 ACCTTTATTACTTTGTGCTATTTCGAG 58.334 33.333 0.00 0.00 0.00 4.04
504 505 8.879759 CCTTTATTACTTTGTGCTATTTCGAGA 58.120 33.333 0.00 0.00 0.00 4.04
505 506 9.690434 CTTTATTACTTTGTGCTATTTCGAGAC 57.310 33.333 0.00 0.00 0.00 3.36
506 507 8.997621 TTATTACTTTGTGCTATTTCGAGACT 57.002 30.769 0.00 0.00 0.00 3.24
507 508 7.907214 ATTACTTTGTGCTATTTCGAGACTT 57.093 32.000 0.00 0.00 0.00 3.01
508 509 7.724305 TTACTTTGTGCTATTTCGAGACTTT 57.276 32.000 0.00 0.00 0.00 2.66
509 510 6.619801 ACTTTGTGCTATTTCGAGACTTTT 57.380 33.333 0.00 0.00 0.00 2.27
510 511 7.027778 ACTTTGTGCTATTTCGAGACTTTTT 57.972 32.000 0.00 0.00 0.00 1.94
511 512 8.149973 ACTTTGTGCTATTTCGAGACTTTTTA 57.850 30.769 0.00 0.00 0.00 1.52
512 513 8.617809 ACTTTGTGCTATTTCGAGACTTTTTAA 58.382 29.630 0.00 0.00 0.00 1.52
513 514 9.612620 CTTTGTGCTATTTCGAGACTTTTTAAT 57.387 29.630 0.00 0.00 0.00 1.40
525 526 9.594478 TCGAGACTTTTTAATAATATGACTGCA 57.406 29.630 0.00 0.00 0.00 4.41
528 529 9.956720 AGACTTTTTAATAATATGACTGCATGC 57.043 29.630 11.82 11.82 35.94 4.06
529 530 9.734620 GACTTTTTAATAATATGACTGCATGCA 57.265 29.630 21.29 21.29 35.94 3.96
538 539 7.696992 AATATGACTGCATGCATCATTATGA 57.303 32.000 31.85 22.01 34.86 2.15
539 540 7.881775 ATATGACTGCATGCATCATTATGAT 57.118 32.000 31.85 22.78 35.22 2.45
540 541 7.083875 TATGACTGCATGCATCATTATGATG 57.916 36.000 31.85 25.86 44.39 3.07
549 550 2.174363 TCATTATGATGCAGAGGCCG 57.826 50.000 0.00 0.00 40.13 6.13
550 551 1.693606 TCATTATGATGCAGAGGCCGA 59.306 47.619 0.00 0.00 40.13 5.54
551 552 2.104622 TCATTATGATGCAGAGGCCGAA 59.895 45.455 0.00 0.00 40.13 4.30
552 553 2.245159 TTATGATGCAGAGGCCGAAG 57.755 50.000 0.00 0.00 40.13 3.79
553 554 6.843047 TCATTATGATGCAGAGGCCGAAGG 62.843 50.000 0.00 0.00 41.61 3.46
568 569 2.044946 AGGCACGCCTCCATTTCC 60.045 61.111 4.27 0.00 44.43 3.13
569 570 2.361104 GGCACGCCTCCATTTCCA 60.361 61.111 0.00 0.00 0.00 3.53
570 571 1.976474 GGCACGCCTCCATTTCCAA 60.976 57.895 0.00 0.00 0.00 3.53
571 572 1.531739 GGCACGCCTCCATTTCCAAA 61.532 55.000 0.00 0.00 0.00 3.28
572 573 0.316841 GCACGCCTCCATTTCCAAAA 59.683 50.000 0.00 0.00 0.00 2.44
573 574 1.270041 GCACGCCTCCATTTCCAAAAA 60.270 47.619 0.00 0.00 0.00 1.94
600 601 1.004277 AGCAGCTTAAACGGGAATCCA 59.996 47.619 0.09 0.00 0.00 3.41
603 604 0.738975 GCTTAAACGGGAATCCAGGC 59.261 55.000 4.16 0.00 0.00 4.85
633 634 3.775661 CATGTGCACATGTGACATGAT 57.224 42.857 36.63 24.14 46.40 2.45
634 635 3.691498 CATGTGCACATGTGACATGATC 58.309 45.455 36.63 20.07 46.40 2.92
635 636 1.733360 TGTGCACATGTGACATGATCG 59.267 47.619 30.26 18.38 0.00 3.69
636 637 2.001872 GTGCACATGTGACATGATCGA 58.998 47.619 30.26 9.46 0.00 3.59
637 638 2.610833 GTGCACATGTGACATGATCGAT 59.389 45.455 30.26 6.19 0.00 3.59
638 639 3.803778 GTGCACATGTGACATGATCGATA 59.196 43.478 30.26 8.67 0.00 2.92
639 640 4.053295 TGCACATGTGACATGATCGATAG 58.947 43.478 30.26 12.01 0.00 2.08
640 641 9.768435 ATGTGCACATGTGACATGATCGATAGA 62.768 40.741 30.92 10.04 42.36 1.98
680 681 0.889186 AACGTGCCCAAGTCCACATC 60.889 55.000 0.00 0.00 32.37 3.06
682 683 2.040544 GTGCCCAAGTCCACATCGG 61.041 63.158 0.00 0.00 32.37 4.18
683 684 3.134127 GCCCAAGTCCACATCGGC 61.134 66.667 0.00 0.00 33.14 5.54
703 704 2.072298 CAGGAGAAGACTTGGCTTTCG 58.928 52.381 0.00 0.00 0.00 3.46
713 714 3.600388 ACTTGGCTTTCGATTAGACCAG 58.400 45.455 0.00 0.00 0.00 4.00
714 715 2.024176 TGGCTTTCGATTAGACCAGC 57.976 50.000 0.00 0.00 35.59 4.85
733 734 9.553064 AGACCAGCATATAAAGATAAAGACTTG 57.447 33.333 0.00 0.00 0.00 3.16
734 735 8.682936 ACCAGCATATAAAGATAAAGACTTGG 57.317 34.615 0.00 0.00 0.00 3.61
751 752 7.807977 AGACTTGGTGGTTTTATATATGCAG 57.192 36.000 0.00 0.00 0.00 4.41
801 802 6.196353 GCATGTTCGTCGTTGCATTAATTTAT 59.804 34.615 0.00 0.00 0.00 1.40
802 803 7.253618 GCATGTTCGTCGTTGCATTAATTTATT 60.254 33.333 0.00 0.00 0.00 1.40
829 830 1.737236 TGGCATGTTCTATGCACGTTC 59.263 47.619 13.18 0.00 46.21 3.95
885 891 3.750130 GCGAGCATAATTGATCTGTGGAT 59.250 43.478 0.00 0.00 36.10 3.41
916 922 2.740506 TTCCCCTCGTTTTTGTTCCT 57.259 45.000 0.00 0.00 0.00 3.36
954 1048 3.314635 GCCATGAAGGTAGAGCATCTTTG 59.685 47.826 0.00 0.00 41.42 2.77
1011 1118 2.251040 CTACAGGACACGATCAACACG 58.749 52.381 0.00 0.00 0.00 4.49
1036 1143 5.353394 TTCAACTGTCAACTCTACACCTT 57.647 39.130 0.00 0.00 0.00 3.50
1084 1191 1.133181 TGGTGATCAGCAAGTCCCCA 61.133 55.000 24.64 9.16 35.69 4.96
1119 1226 1.448540 CATGGGAGGCGACAGTCAC 60.449 63.158 0.41 0.00 0.00 3.67
1120 1227 3.006756 ATGGGAGGCGACAGTCACG 62.007 63.158 0.41 0.00 0.00 4.35
1123 1230 3.371063 GAGGCGACAGTCACGGGA 61.371 66.667 0.41 0.00 0.00 5.14
1138 1245 0.107456 CGGGAGGGGACATCAATCTG 59.893 60.000 0.00 0.00 0.00 2.90
1162 1269 4.391830 TCGTCTTATGACAAGATGTTTGGC 59.608 41.667 9.22 0.00 43.06 4.52
1181 1288 1.002366 CGGCAGATCAGTTACAGTGC 58.998 55.000 0.00 0.00 0.00 4.40
1192 1299 5.858381 TCAGTTACAGTGCTCTTCATCTTT 58.142 37.500 0.00 0.00 0.00 2.52
1194 1301 4.453819 AGTTACAGTGCTCTTCATCTTTGC 59.546 41.667 0.00 0.00 0.00 3.68
1197 1304 1.802960 AGTGCTCTTCATCTTTGCGTG 59.197 47.619 0.00 0.00 0.00 5.34
1199 1306 2.031682 GTGCTCTTCATCTTTGCGTGTT 60.032 45.455 0.00 0.00 0.00 3.32
1206 1313 4.159377 TCATCTTTGCGTGTTCAATTCC 57.841 40.909 0.00 0.00 0.00 3.01
1214 1321 1.665679 CGTGTTCAATTCCAGATCCCG 59.334 52.381 0.00 0.00 0.00 5.14
1263 1370 4.579869 CAAGCACTTGTCCATTACTACCT 58.420 43.478 2.12 0.00 35.92 3.08
1270 1377 4.595762 TGTCCATTACTACCTTATCGCC 57.404 45.455 0.00 0.00 0.00 5.54
1339 1446 3.009714 GGCGAGGGGGTCTCCTTT 61.010 66.667 0.00 0.00 39.30 3.11
1369 1476 1.940883 CTGCCAACTGCGCCATCAAT 61.941 55.000 4.18 0.00 45.60 2.57
1415 1522 1.375140 CTGCAAGAAGAGCTCGCCA 60.375 57.895 8.37 0.00 34.07 5.69
1677 1784 6.152492 ACAAACTTTGTTCAATTTTTGGGCAT 59.848 30.769 16.46 2.26 42.22 4.40
1678 1785 5.754543 ACTTTGTTCAATTTTTGGGCATG 57.245 34.783 0.00 0.00 0.00 4.06
1705 1812 0.676782 CGTCCCCAATGGTGTTCCTC 60.677 60.000 0.00 0.00 34.77 3.71
1729 1836 4.012374 ACATTACTGTCCCATCAAGCTTG 58.988 43.478 20.81 20.81 0.00 4.01
1766 1873 3.267483 AGCACGTACACCATGAATTACC 58.733 45.455 0.00 0.00 0.00 2.85
1768 1875 3.181514 GCACGTACACCATGAATTACCAC 60.182 47.826 0.00 0.00 0.00 4.16
1778 1885 1.000270 AATTACCACCGGCCATGCA 60.000 52.632 0.00 0.00 0.00 3.96
1780 1887 2.210144 ATTACCACCGGCCATGCACT 62.210 55.000 0.00 0.00 0.00 4.40
1876 1983 2.171003 GTGCTTACCTTCCCAGCAAAT 58.829 47.619 0.00 0.00 44.99 2.32
2083 2190 4.787598 ACAATCTTTTCTTCATGTCGTGC 58.212 39.130 0.00 0.00 0.00 5.34
2157 2264 4.104086 AGATTGATGGAGTACACCAAGGA 58.896 43.478 16.34 5.37 43.47 3.36
2260 2367 2.813908 GCCGACGCTTTCATCCGT 60.814 61.111 0.00 0.00 40.85 4.69
2325 2432 5.649782 TCATCCAAGCTTTGATTTTCTCC 57.350 39.130 10.22 0.00 0.00 3.71
2351 2458 9.959585 CCAGATGCATGGAAGGATATGTATCCC 62.960 48.148 2.46 2.04 46.58 3.85
2369 2476 6.855061 TGTATCCCTACTTTTATTCCCTCCAT 59.145 38.462 0.00 0.00 0.00 3.41
2372 2479 7.774694 TCCCTACTTTTATTCCCTCCATTTA 57.225 36.000 0.00 0.00 0.00 1.40
2443 2551 9.241919 AGAAAGTAGTAGAACTTTAGTACTCCC 57.758 37.037 0.00 0.00 46.92 4.30
2444 2552 9.241919 GAAAGTAGTAGAACTTTAGTACTCCCT 57.758 37.037 0.00 0.00 46.92 4.20
2445 2553 8.806429 AAGTAGTAGAACTTTAGTACTCCCTC 57.194 38.462 0.00 0.00 38.32 4.30
2446 2554 7.345691 AGTAGTAGAACTTTAGTACTCCCTCC 58.654 42.308 0.00 0.00 35.77 4.30
2447 2555 5.192176 AGTAGAACTTTAGTACTCCCTCCG 58.808 45.833 0.00 0.00 0.00 4.63
2448 2556 4.044946 AGAACTTTAGTACTCCCTCCGT 57.955 45.455 0.00 0.00 0.00 4.69
2449 2557 4.015764 AGAACTTTAGTACTCCCTCCGTC 58.984 47.826 0.00 0.00 0.00 4.79
2450 2558 2.732763 ACTTTAGTACTCCCTCCGTCC 58.267 52.381 0.00 0.00 0.00 4.79
2451 2559 2.030371 CTTTAGTACTCCCTCCGTCCC 58.970 57.143 0.00 0.00 0.00 4.46
2452 2560 1.002069 TTAGTACTCCCTCCGTCCCA 58.998 55.000 0.00 0.00 0.00 4.37
2453 2561 1.002069 TAGTACTCCCTCCGTCCCAA 58.998 55.000 0.00 0.00 0.00 4.12
2454 2562 0.115745 AGTACTCCCTCCGTCCCAAA 59.884 55.000 0.00 0.00 0.00 3.28
2455 2563 0.978907 GTACTCCCTCCGTCCCAAAA 59.021 55.000 0.00 0.00 0.00 2.44
2456 2564 1.558294 GTACTCCCTCCGTCCCAAAAT 59.442 52.381 0.00 0.00 0.00 1.82
2457 2565 1.073098 ACTCCCTCCGTCCCAAAATT 58.927 50.000 0.00 0.00 0.00 1.82
2458 2566 1.004394 ACTCCCTCCGTCCCAAAATTC 59.996 52.381 0.00 0.00 0.00 2.17
2459 2567 1.282157 CTCCCTCCGTCCCAAAATTCT 59.718 52.381 0.00 0.00 0.00 2.40
2460 2568 1.708551 TCCCTCCGTCCCAAAATTCTT 59.291 47.619 0.00 0.00 0.00 2.52
2461 2569 1.818674 CCCTCCGTCCCAAAATTCTTG 59.181 52.381 0.00 0.00 0.00 3.02
2462 2570 2.514803 CCTCCGTCCCAAAATTCTTGT 58.485 47.619 0.00 0.00 0.00 3.16
2463 2571 2.488153 CCTCCGTCCCAAAATTCTTGTC 59.512 50.000 0.00 0.00 0.00 3.18
2464 2572 3.412386 CTCCGTCCCAAAATTCTTGTCT 58.588 45.455 0.00 0.00 0.00 3.41
2465 2573 3.821033 CTCCGTCCCAAAATTCTTGTCTT 59.179 43.478 0.00 0.00 0.00 3.01
2466 2574 4.975631 TCCGTCCCAAAATTCTTGTCTTA 58.024 39.130 0.00 0.00 0.00 2.10
2467 2575 5.001232 TCCGTCCCAAAATTCTTGTCTTAG 58.999 41.667 0.00 0.00 0.00 2.18
2468 2576 5.001232 CCGTCCCAAAATTCTTGTCTTAGA 58.999 41.667 0.00 0.00 0.00 2.10
2469 2577 5.648092 CCGTCCCAAAATTCTTGTCTTAGAT 59.352 40.000 0.00 0.00 0.00 1.98
2470 2578 6.151144 CCGTCCCAAAATTCTTGTCTTAGATT 59.849 38.462 0.00 0.00 0.00 2.40
2471 2579 7.309194 CCGTCCCAAAATTCTTGTCTTAGATTT 60.309 37.037 0.00 0.00 0.00 2.17
2472 2580 7.538678 CGTCCCAAAATTCTTGTCTTAGATTTG 59.461 37.037 0.00 0.00 29.84 2.32
2473 2581 8.360390 GTCCCAAAATTCTTGTCTTAGATTTGT 58.640 33.333 0.00 0.00 28.79 2.83
2474 2582 8.576442 TCCCAAAATTCTTGTCTTAGATTTGTC 58.424 33.333 0.00 0.00 28.79 3.18
2475 2583 8.579863 CCCAAAATTCTTGTCTTAGATTTGTCT 58.420 33.333 0.00 0.00 28.79 3.41
2534 2642 8.466617 AGTTACATCCGTATCTAGACAAATCT 57.533 34.615 0.00 0.00 39.15 2.40
2535 2643 9.570468 AGTTACATCCGTATCTAGACAAATCTA 57.430 33.333 0.00 0.00 36.29 1.98
2538 2646 8.693120 ACATCCGTATCTAGACAAATCTAAGA 57.307 34.615 0.00 0.00 36.98 2.10
2539 2647 8.569641 ACATCCGTATCTAGACAAATCTAAGAC 58.430 37.037 0.00 0.00 36.98 3.01
2540 2648 8.568794 CATCCGTATCTAGACAAATCTAAGACA 58.431 37.037 0.00 0.00 36.98 3.41
2541 2649 8.515695 TCCGTATCTAGACAAATCTAAGACAA 57.484 34.615 0.00 0.00 36.98 3.18
2542 2650 8.622157 TCCGTATCTAGACAAATCTAAGACAAG 58.378 37.037 0.00 0.00 36.98 3.16
2543 2651 8.622157 CCGTATCTAGACAAATCTAAGACAAGA 58.378 37.037 0.00 0.00 36.98 3.02
2551 2659 9.354673 AGACAAATCTAAGACAAGAAATTTGGA 57.645 29.630 0.00 0.00 33.04 3.53
2552 2660 9.965824 GACAAATCTAAGACAAGAAATTTGGAA 57.034 29.630 0.00 0.00 33.04 3.53
2553 2661 9.750125 ACAAATCTAAGACAAGAAATTTGGAAC 57.250 29.630 0.00 0.00 33.04 3.62
2554 2662 9.748708 CAAATCTAAGACAAGAAATTTGGAACA 57.251 29.630 0.00 0.00 28.49 3.18
2555 2663 9.971922 AAATCTAAGACAAGAAATTTGGAACAG 57.028 29.630 0.00 0.00 42.39 3.16
2556 2664 8.924511 ATCTAAGACAAGAAATTTGGAACAGA 57.075 30.769 0.00 0.00 42.39 3.41
2557 2665 8.383318 TCTAAGACAAGAAATTTGGAACAGAG 57.617 34.615 0.00 0.00 42.39 3.35
2558 2666 6.396829 AAGACAAGAAATTTGGAACAGAGG 57.603 37.500 0.00 0.00 42.39 3.69
2559 2667 4.829492 AGACAAGAAATTTGGAACAGAGGG 59.171 41.667 0.00 0.00 42.39 4.30
2560 2668 4.803452 ACAAGAAATTTGGAACAGAGGGA 58.197 39.130 0.00 0.00 42.39 4.20
2561 2669 4.829492 ACAAGAAATTTGGAACAGAGGGAG 59.171 41.667 0.00 0.00 42.39 4.30
2562 2670 4.731313 AGAAATTTGGAACAGAGGGAGT 57.269 40.909 0.00 0.00 42.39 3.85
2563 2671 5.843019 AGAAATTTGGAACAGAGGGAGTA 57.157 39.130 0.00 0.00 42.39 2.59
2564 2672 5.561679 AGAAATTTGGAACAGAGGGAGTAC 58.438 41.667 0.00 0.00 42.39 2.73
2565 2673 4.993705 AATTTGGAACAGAGGGAGTACA 57.006 40.909 0.00 0.00 42.39 2.90
2566 2674 5.520748 AATTTGGAACAGAGGGAGTACAT 57.479 39.130 0.00 0.00 42.39 2.29
2567 2675 6.636454 AATTTGGAACAGAGGGAGTACATA 57.364 37.500 0.00 0.00 42.39 2.29
2568 2676 6.636454 ATTTGGAACAGAGGGAGTACATAA 57.364 37.500 0.00 0.00 42.39 1.90
2569 2677 6.636454 TTTGGAACAGAGGGAGTACATAAT 57.364 37.500 0.00 0.00 42.39 1.28
2570 2678 6.636454 TTGGAACAGAGGGAGTACATAATT 57.364 37.500 0.00 0.00 42.39 1.40
2571 2679 5.989477 TGGAACAGAGGGAGTACATAATTG 58.011 41.667 0.00 0.00 0.00 2.32
2572 2680 5.487488 TGGAACAGAGGGAGTACATAATTGT 59.513 40.000 0.00 0.00 39.98 2.71
2573 2681 6.670464 TGGAACAGAGGGAGTACATAATTGTA 59.330 38.462 0.00 0.00 37.28 2.41
2574 2682 7.347222 TGGAACAGAGGGAGTACATAATTGTAT 59.653 37.037 0.00 0.00 40.35 2.29
2575 2683 8.211629 GGAACAGAGGGAGTACATAATTGTATT 58.788 37.037 0.00 0.00 40.35 1.89
2580 2688 9.780186 AGAGGGAGTACATAATTGTATTAAAGC 57.220 33.333 0.00 0.00 40.35 3.51
2581 2689 9.555727 GAGGGAGTACATAATTGTATTAAAGCA 57.444 33.333 0.00 0.00 40.35 3.91
2582 2690 9.561069 AGGGAGTACATAATTGTATTAAAGCAG 57.439 33.333 0.00 0.00 40.35 4.24
2583 2691 8.290325 GGGAGTACATAATTGTATTAAAGCAGC 58.710 37.037 0.00 0.00 40.35 5.25
2584 2692 8.009974 GGAGTACATAATTGTATTAAAGCAGCG 58.990 37.037 0.00 0.00 40.35 5.18
2585 2693 8.657074 AGTACATAATTGTATTAAAGCAGCGA 57.343 30.769 0.00 0.00 40.35 4.93
2586 2694 8.548721 AGTACATAATTGTATTAAAGCAGCGAC 58.451 33.333 0.00 0.00 40.35 5.19
2587 2695 7.315247 ACATAATTGTATTAAAGCAGCGACA 57.685 32.000 0.00 0.00 33.16 4.35
2588 2696 7.757526 ACATAATTGTATTAAAGCAGCGACAA 58.242 30.769 0.00 0.00 33.16 3.18
2589 2697 8.405531 ACATAATTGTATTAAAGCAGCGACAAT 58.594 29.630 0.00 0.00 38.74 2.71
2590 2698 9.236691 CATAATTGTATTAAAGCAGCGACAATT 57.763 29.630 17.57 17.57 44.98 2.32
2592 2700 8.841444 AATTGTATTAAAGCAGCGACAATTAG 57.159 30.769 14.45 0.00 42.60 1.73
2593 2701 6.978343 TGTATTAAAGCAGCGACAATTAGT 57.022 33.333 0.00 0.00 0.00 2.24
2594 2702 8.481974 TTGTATTAAAGCAGCGACAATTAGTA 57.518 30.769 0.00 0.00 0.00 1.82
2595 2703 8.657074 TGTATTAAAGCAGCGACAATTAGTAT 57.343 30.769 0.00 0.00 0.00 2.12
2596 2704 8.547894 TGTATTAAAGCAGCGACAATTAGTATG 58.452 33.333 0.00 0.00 0.00 2.39
2597 2705 4.882671 AAAGCAGCGACAATTAGTATGG 57.117 40.909 0.00 0.00 0.00 2.74
2598 2706 3.819564 AGCAGCGACAATTAGTATGGA 57.180 42.857 0.00 0.00 0.00 3.41
2599 2707 4.342862 AGCAGCGACAATTAGTATGGAT 57.657 40.909 0.00 0.00 0.00 3.41
2600 2708 4.310769 AGCAGCGACAATTAGTATGGATC 58.689 43.478 0.00 0.00 0.00 3.36
2601 2709 3.121944 GCAGCGACAATTAGTATGGATCG 59.878 47.826 0.00 0.00 0.00 3.69
2602 2710 3.675225 CAGCGACAATTAGTATGGATCGG 59.325 47.826 0.00 0.00 0.00 4.18
2603 2711 3.572682 AGCGACAATTAGTATGGATCGGA 59.427 43.478 0.00 0.00 0.00 4.55
2604 2712 3.921021 GCGACAATTAGTATGGATCGGAG 59.079 47.826 0.00 0.00 0.00 4.63
2605 2713 4.558898 GCGACAATTAGTATGGATCGGAGT 60.559 45.833 0.00 0.00 0.00 3.85
2606 2714 4.917998 CGACAATTAGTATGGATCGGAGTG 59.082 45.833 0.00 0.00 0.00 3.51
2607 2715 5.278315 CGACAATTAGTATGGATCGGAGTGA 60.278 44.000 0.00 0.00 0.00 3.41
2608 2716 6.090483 ACAATTAGTATGGATCGGAGTGAG 57.910 41.667 0.00 0.00 0.00 3.51
2609 2717 5.598830 ACAATTAGTATGGATCGGAGTGAGT 59.401 40.000 0.00 0.00 0.00 3.41
2610 2718 6.776116 ACAATTAGTATGGATCGGAGTGAGTA 59.224 38.462 0.00 0.00 0.00 2.59
2611 2719 7.287005 ACAATTAGTATGGATCGGAGTGAGTAA 59.713 37.037 0.00 0.00 0.00 2.24
2612 2720 8.307483 CAATTAGTATGGATCGGAGTGAGTAAT 58.693 37.037 0.00 0.00 0.00 1.89
2613 2721 9.529823 AATTAGTATGGATCGGAGTGAGTAATA 57.470 33.333 0.00 0.00 0.00 0.98
2614 2722 9.702253 ATTAGTATGGATCGGAGTGAGTAATAT 57.298 33.333 0.00 0.00 0.00 1.28
2615 2723 7.397892 AGTATGGATCGGAGTGAGTAATATG 57.602 40.000 0.00 0.00 0.00 1.78
2616 2724 6.948886 AGTATGGATCGGAGTGAGTAATATGT 59.051 38.462 0.00 0.00 0.00 2.29
2617 2725 8.107729 AGTATGGATCGGAGTGAGTAATATGTA 58.892 37.037 0.00 0.00 0.00 2.29
2618 2726 6.570672 TGGATCGGAGTGAGTAATATGTAC 57.429 41.667 0.00 0.00 0.00 2.90
2619 2727 6.304624 TGGATCGGAGTGAGTAATATGTACT 58.695 40.000 0.00 0.00 0.00 2.73
2620 2728 6.430308 TGGATCGGAGTGAGTAATATGTACTC 59.570 42.308 13.68 13.68 43.06 2.59
2626 2734 7.768807 GAGTGAGTAATATGTACTCCTGGAT 57.231 40.000 16.08 0.00 42.32 3.41
2627 2735 8.865420 GAGTGAGTAATATGTACTCCTGGATA 57.135 38.462 16.08 0.00 42.32 2.59
2628 2736 9.469097 GAGTGAGTAATATGTACTCCTGGATAT 57.531 37.037 16.08 0.00 42.32 1.63
2629 2737 9.830186 AGTGAGTAATATGTACTCCTGGATATT 57.170 33.333 16.08 0.81 42.32 1.28
2631 2739 8.957466 TGAGTAATATGTACTCCTGGATATTCG 58.043 37.037 16.08 0.00 42.32 3.34
2632 2740 8.880991 AGTAATATGTACTCCTGGATATTCGT 57.119 34.615 0.00 0.00 0.00 3.85
2633 2741 9.310449 AGTAATATGTACTCCTGGATATTCGTT 57.690 33.333 0.00 0.00 0.00 3.85
2634 2742 9.924650 GTAATATGTACTCCTGGATATTCGTTT 57.075 33.333 0.00 0.00 0.00 3.60
2636 2744 8.833231 ATATGTACTCCTGGATATTCGTTTTG 57.167 34.615 0.00 0.00 0.00 2.44
2637 2745 5.424757 TGTACTCCTGGATATTCGTTTTGG 58.575 41.667 0.00 0.00 0.00 3.28
2638 2746 3.279434 ACTCCTGGATATTCGTTTTGGC 58.721 45.455 0.00 0.00 0.00 4.52
2639 2747 3.278574 CTCCTGGATATTCGTTTTGGCA 58.721 45.455 0.00 0.00 0.00 4.92
2640 2748 3.691575 TCCTGGATATTCGTTTTGGCAA 58.308 40.909 0.00 0.00 0.00 4.52
2641 2749 3.442273 TCCTGGATATTCGTTTTGGCAAC 59.558 43.478 0.00 0.00 0.00 4.17
2642 2750 3.443681 CCTGGATATTCGTTTTGGCAACT 59.556 43.478 0.00 0.00 37.61 3.16
2643 2751 4.638421 CCTGGATATTCGTTTTGGCAACTA 59.362 41.667 0.00 0.00 37.61 2.24
2644 2752 5.220854 CCTGGATATTCGTTTTGGCAACTAG 60.221 44.000 0.00 0.00 37.61 2.57
2645 2753 4.638421 TGGATATTCGTTTTGGCAACTAGG 59.362 41.667 0.00 0.00 37.61 3.02
2646 2754 4.638865 GGATATTCGTTTTGGCAACTAGGT 59.361 41.667 0.00 0.00 37.61 3.08
2647 2755 5.220796 GGATATTCGTTTTGGCAACTAGGTC 60.221 44.000 0.00 0.00 37.61 3.85
2648 2756 1.886886 TCGTTTTGGCAACTAGGTCC 58.113 50.000 0.00 0.00 37.61 4.46
2649 2757 1.141254 TCGTTTTGGCAACTAGGTCCA 59.859 47.619 0.00 0.00 37.61 4.02
2650 2758 1.535462 CGTTTTGGCAACTAGGTCCAG 59.465 52.381 0.00 0.00 37.61 3.86
2651 2759 1.886542 GTTTTGGCAACTAGGTCCAGG 59.113 52.381 0.00 0.00 37.61 4.45
2652 2760 1.145571 TTTGGCAACTAGGTCCAGGT 58.854 50.000 0.00 0.00 37.61 4.00
2653 2761 0.400213 TTGGCAACTAGGTCCAGGTG 59.600 55.000 0.00 0.00 36.26 4.00
2654 2762 0.472925 TGGCAACTAGGTCCAGGTGA 60.473 55.000 9.73 0.00 35.06 4.02
2655 2763 0.912486 GGCAACTAGGTCCAGGTGAT 59.088 55.000 9.73 0.00 35.06 3.06
2656 2764 1.134371 GGCAACTAGGTCCAGGTGATC 60.134 57.143 9.73 0.00 35.06 2.92
2657 2765 1.834263 GCAACTAGGTCCAGGTGATCT 59.166 52.381 9.73 0.00 35.06 2.75
2658 2766 2.159028 GCAACTAGGTCCAGGTGATCTC 60.159 54.545 9.73 0.00 35.06 2.75
2659 2767 2.060050 ACTAGGTCCAGGTGATCTCG 57.940 55.000 0.00 0.00 35.52 4.04
2660 2768 1.564818 ACTAGGTCCAGGTGATCTCGA 59.435 52.381 0.00 0.00 35.52 4.04
2661 2769 2.025226 ACTAGGTCCAGGTGATCTCGAA 60.025 50.000 0.00 0.00 35.52 3.71
2662 2770 1.938585 AGGTCCAGGTGATCTCGAAA 58.061 50.000 0.00 0.00 22.32 3.46
2663 2771 2.472029 AGGTCCAGGTGATCTCGAAAT 58.528 47.619 0.00 0.00 22.32 2.17
2664 2772 2.432510 AGGTCCAGGTGATCTCGAAATC 59.567 50.000 0.00 0.00 22.32 2.17
2665 2773 2.432510 GGTCCAGGTGATCTCGAAATCT 59.567 50.000 0.00 0.00 0.00 2.40
2666 2774 3.452474 GTCCAGGTGATCTCGAAATCTG 58.548 50.000 0.00 0.00 0.00 2.90
2667 2775 2.159043 TCCAGGTGATCTCGAAATCTGC 60.159 50.000 0.00 0.00 0.00 4.26
2668 2776 2.419159 CCAGGTGATCTCGAAATCTGCA 60.419 50.000 0.00 0.00 0.00 4.41
2669 2777 2.606725 CAGGTGATCTCGAAATCTGCAC 59.393 50.000 0.00 0.00 0.00 4.57
2670 2778 1.936547 GGTGATCTCGAAATCTGCACC 59.063 52.381 0.00 0.00 37.72 5.01
2671 2779 2.621338 GTGATCTCGAAATCTGCACCA 58.379 47.619 0.00 0.00 0.00 4.17
2672 2780 3.002791 GTGATCTCGAAATCTGCACCAA 58.997 45.455 0.00 0.00 0.00 3.67
2673 2781 3.063180 GTGATCTCGAAATCTGCACCAAG 59.937 47.826 0.00 0.00 0.00 3.61
2674 2782 1.442769 TCTCGAAATCTGCACCAAGC 58.557 50.000 0.00 0.00 45.96 4.01
2683 2791 3.782244 GCACCAAGCGCTCTCACG 61.782 66.667 12.06 0.00 0.00 4.35
2684 2792 3.114616 CACCAAGCGCTCTCACGG 61.115 66.667 12.06 9.34 0.00 4.94
2685 2793 3.303135 ACCAAGCGCTCTCACGGA 61.303 61.111 12.06 0.00 0.00 4.69
2686 2794 2.507992 CCAAGCGCTCTCACGGAG 60.508 66.667 12.06 0.00 44.49 4.63
2687 2795 2.568612 CAAGCGCTCTCACGGAGA 59.431 61.111 12.06 3.97 44.45 3.71
2688 2796 1.140589 CAAGCGCTCTCACGGAGAT 59.859 57.895 12.06 0.00 44.45 2.75
2689 2797 1.140589 AAGCGCTCTCACGGAGATG 59.859 57.895 12.06 2.74 44.45 2.90
2690 2798 2.897641 AAGCGCTCTCACGGAGATGC 62.898 60.000 12.06 14.69 44.45 3.91
2691 2799 2.491621 CGCTCTCACGGAGATGCA 59.508 61.111 16.92 0.00 44.45 3.96
2692 2800 1.875813 CGCTCTCACGGAGATGCAC 60.876 63.158 16.92 0.00 44.45 4.57
2693 2801 1.216444 GCTCTCACGGAGATGCACA 59.784 57.895 0.00 0.00 44.45 4.57
2694 2802 1.080995 GCTCTCACGGAGATGCACAC 61.081 60.000 0.00 0.00 44.45 3.82
2695 2803 0.529833 CTCTCACGGAGATGCACACT 59.470 55.000 0.00 0.00 44.45 3.55
2696 2804 0.244721 TCTCACGGAGATGCACACTG 59.755 55.000 0.00 0.00 33.35 3.66
2697 2805 1.357258 CTCACGGAGATGCACACTGC 61.357 60.000 0.00 0.00 45.29 4.40
2698 2806 2.046892 ACGGAGATGCACACTGCC 60.047 61.111 8.24 5.41 44.23 4.85
2699 2807 2.267006 CGGAGATGCACACTGCCT 59.733 61.111 8.24 0.00 44.23 4.75
2700 2808 1.376424 CGGAGATGCACACTGCCTT 60.376 57.895 8.24 0.00 44.23 4.35
2701 2809 0.957395 CGGAGATGCACACTGCCTTT 60.957 55.000 8.24 0.00 44.23 3.11
2702 2810 1.675714 CGGAGATGCACACTGCCTTTA 60.676 52.381 8.24 0.00 44.23 1.85
2703 2811 2.436417 GGAGATGCACACTGCCTTTAA 58.564 47.619 0.00 0.00 44.23 1.52
2704 2812 3.019564 GGAGATGCACACTGCCTTTAAT 58.980 45.455 0.00 0.00 44.23 1.40
2705 2813 3.445096 GGAGATGCACACTGCCTTTAATT 59.555 43.478 0.00 0.00 44.23 1.40
2706 2814 4.640201 GGAGATGCACACTGCCTTTAATTA 59.360 41.667 0.00 0.00 44.23 1.40
2707 2815 5.300286 GGAGATGCACACTGCCTTTAATTAT 59.700 40.000 0.00 0.00 44.23 1.28
2708 2816 6.140303 AGATGCACACTGCCTTTAATTATG 57.860 37.500 0.00 0.00 44.23 1.90
2709 2817 5.887598 AGATGCACACTGCCTTTAATTATGA 59.112 36.000 0.00 0.00 44.23 2.15
2710 2818 5.973899 TGCACACTGCCTTTAATTATGAA 57.026 34.783 0.00 0.00 44.23 2.57
2711 2819 5.708948 TGCACACTGCCTTTAATTATGAAC 58.291 37.500 0.00 0.00 44.23 3.18
2712 2820 5.242615 TGCACACTGCCTTTAATTATGAACA 59.757 36.000 0.00 0.00 44.23 3.18
2713 2821 6.155827 GCACACTGCCTTTAATTATGAACAA 58.844 36.000 0.00 0.00 37.42 2.83
2714 2822 6.813152 GCACACTGCCTTTAATTATGAACAAT 59.187 34.615 0.00 0.00 37.42 2.71
2715 2823 7.201461 GCACACTGCCTTTAATTATGAACAATG 60.201 37.037 0.00 0.00 37.42 2.82
2716 2824 7.814107 CACACTGCCTTTAATTATGAACAATGT 59.186 33.333 0.00 0.00 0.00 2.71
2717 2825 8.367156 ACACTGCCTTTAATTATGAACAATGTT 58.633 29.630 0.00 0.00 0.00 2.71
2718 2826 8.863049 CACTGCCTTTAATTATGAACAATGTTC 58.137 33.333 18.42 18.42 0.00 3.18
2719 2827 8.806146 ACTGCCTTTAATTATGAACAATGTTCT 58.194 29.630 24.30 13.60 0.00 3.01
2720 2828 9.294030 CTGCCTTTAATTATGAACAATGTTCTC 57.706 33.333 24.30 2.95 0.00 2.87
2721 2829 9.023962 TGCCTTTAATTATGAACAATGTTCTCT 57.976 29.630 24.30 15.04 0.00 3.10
2733 2841 8.239314 TGAACAATGTTCTCTATTCTTCAATGC 58.761 33.333 24.30 0.00 0.00 3.56
2734 2842 7.934855 ACAATGTTCTCTATTCTTCAATGCT 57.065 32.000 0.00 0.00 0.00 3.79
2735 2843 7.983307 ACAATGTTCTCTATTCTTCAATGCTC 58.017 34.615 0.00 0.00 0.00 4.26
2736 2844 7.828223 ACAATGTTCTCTATTCTTCAATGCTCT 59.172 33.333 0.00 0.00 0.00 4.09
2737 2845 7.789273 ATGTTCTCTATTCTTCAATGCTCTG 57.211 36.000 0.00 0.00 0.00 3.35
2738 2846 6.705302 TGTTCTCTATTCTTCAATGCTCTGT 58.295 36.000 0.00 0.00 0.00 3.41
2739 2847 6.815641 TGTTCTCTATTCTTCAATGCTCTGTC 59.184 38.462 0.00 0.00 0.00 3.51
2740 2848 5.911752 TCTCTATTCTTCAATGCTCTGTCC 58.088 41.667 0.00 0.00 0.00 4.02
2741 2849 5.660417 TCTCTATTCTTCAATGCTCTGTCCT 59.340 40.000 0.00 0.00 0.00 3.85
2742 2850 6.155910 TCTCTATTCTTCAATGCTCTGTCCTT 59.844 38.462 0.00 0.00 0.00 3.36
2743 2851 6.715280 TCTATTCTTCAATGCTCTGTCCTTT 58.285 36.000 0.00 0.00 0.00 3.11
2744 2852 7.851228 TCTATTCTTCAATGCTCTGTCCTTTA 58.149 34.615 0.00 0.00 0.00 1.85
2745 2853 6.749923 ATTCTTCAATGCTCTGTCCTTTAC 57.250 37.500 0.00 0.00 0.00 2.01
2746 2854 4.245660 TCTTCAATGCTCTGTCCTTTACG 58.754 43.478 0.00 0.00 0.00 3.18
2747 2855 3.953712 TCAATGCTCTGTCCTTTACGA 57.046 42.857 0.00 0.00 0.00 3.43
2748 2856 4.265904 TCAATGCTCTGTCCTTTACGAA 57.734 40.909 0.00 0.00 0.00 3.85
2749 2857 3.994392 TCAATGCTCTGTCCTTTACGAAC 59.006 43.478 0.00 0.00 0.00 3.95
2750 2858 3.678056 ATGCTCTGTCCTTTACGAACA 57.322 42.857 0.00 0.00 0.00 3.18
2751 2859 3.678056 TGCTCTGTCCTTTACGAACAT 57.322 42.857 0.00 0.00 0.00 2.71
2752 2860 4.002906 TGCTCTGTCCTTTACGAACATT 57.997 40.909 0.00 0.00 0.00 2.71
2753 2861 4.385825 TGCTCTGTCCTTTACGAACATTT 58.614 39.130 0.00 0.00 0.00 2.32
2754 2862 4.819630 TGCTCTGTCCTTTACGAACATTTT 59.180 37.500 0.00 0.00 0.00 1.82
2755 2863 5.298276 TGCTCTGTCCTTTACGAACATTTTT 59.702 36.000 0.00 0.00 0.00 1.94
2773 2881 2.734276 TTTTTAATGTTCCTGGCGCC 57.266 45.000 22.73 22.73 0.00 6.53
2774 2882 1.621992 TTTTAATGTTCCTGGCGCCA 58.378 45.000 30.59 30.59 0.00 5.69
2775 2883 1.846007 TTTAATGTTCCTGGCGCCAT 58.154 45.000 32.87 16.34 0.00 4.40
2776 2884 1.102154 TTAATGTTCCTGGCGCCATG 58.898 50.000 32.87 28.09 0.00 3.66
2777 2885 0.254462 TAATGTTCCTGGCGCCATGA 59.746 50.000 32.87 30.11 0.00 3.07
2778 2886 0.396139 AATGTTCCTGGCGCCATGAT 60.396 50.000 31.15 16.61 0.00 2.45
2779 2887 0.473755 ATGTTCCTGGCGCCATGATA 59.526 50.000 31.15 23.48 0.00 2.15
2780 2888 0.463654 TGTTCCTGGCGCCATGATAC 60.464 55.000 31.15 27.65 0.00 2.24
2781 2889 1.148273 TTCCTGGCGCCATGATACC 59.852 57.895 31.15 1.94 0.00 2.73
2782 2890 1.631071 TTCCTGGCGCCATGATACCA 61.631 55.000 31.15 16.26 0.00 3.25
2783 2891 4.054085 CTGGCGCCATGATACCAG 57.946 61.111 32.87 12.15 43.45 4.00
2784 2892 1.146930 CTGGCGCCATGATACCAGT 59.853 57.895 32.87 0.00 43.86 4.00
2785 2893 0.392706 CTGGCGCCATGATACCAGTA 59.607 55.000 32.87 1.17 43.86 2.74
2786 2894 0.833949 TGGCGCCATGATACCAGTAA 59.166 50.000 29.03 0.00 0.00 2.24
2787 2895 1.419762 TGGCGCCATGATACCAGTAAT 59.580 47.619 29.03 0.00 0.00 1.89
2788 2896 2.158682 TGGCGCCATGATACCAGTAATT 60.159 45.455 29.03 0.00 0.00 1.40
2789 2897 2.884639 GGCGCCATGATACCAGTAATTT 59.115 45.455 24.80 0.00 0.00 1.82
2790 2898 3.317993 GGCGCCATGATACCAGTAATTTT 59.682 43.478 24.80 0.00 0.00 1.82
2791 2899 4.517453 GGCGCCATGATACCAGTAATTTTA 59.483 41.667 24.80 0.00 0.00 1.52
2792 2900 5.009210 GGCGCCATGATACCAGTAATTTTAA 59.991 40.000 24.80 0.00 0.00 1.52
2793 2901 6.294508 GGCGCCATGATACCAGTAATTTTAAT 60.295 38.462 24.80 0.00 0.00 1.40
2794 2902 6.582295 GCGCCATGATACCAGTAATTTTAATG 59.418 38.462 0.00 0.00 0.00 1.90
2795 2903 7.648142 CGCCATGATACCAGTAATTTTAATGT 58.352 34.615 0.00 0.00 0.00 2.71
2796 2904 8.134895 CGCCATGATACCAGTAATTTTAATGTT 58.865 33.333 0.00 0.00 0.00 2.71
2797 2905 9.816354 GCCATGATACCAGTAATTTTAATGTTT 57.184 29.630 0.00 0.00 0.00 2.83
2811 2919 6.561945 TTTAATGTTTTTGTTCAGTGTCGC 57.438 33.333 0.00 0.00 0.00 5.19
2812 2920 2.553079 TGTTTTTGTTCAGTGTCGCC 57.447 45.000 0.00 0.00 0.00 5.54
2813 2921 1.813178 TGTTTTTGTTCAGTGTCGCCA 59.187 42.857 0.00 0.00 0.00 5.69
2814 2922 2.425312 TGTTTTTGTTCAGTGTCGCCAT 59.575 40.909 0.00 0.00 0.00 4.40
2815 2923 2.772568 TTTTGTTCAGTGTCGCCATG 57.227 45.000 0.00 0.00 0.00 3.66
2816 2924 1.674359 TTTGTTCAGTGTCGCCATGT 58.326 45.000 0.00 0.00 0.00 3.21
2817 2925 2.535012 TTGTTCAGTGTCGCCATGTA 57.465 45.000 0.00 0.00 0.00 2.29
2818 2926 2.760634 TGTTCAGTGTCGCCATGTAT 57.239 45.000 0.00 0.00 0.00 2.29
2819 2927 2.616960 TGTTCAGTGTCGCCATGTATC 58.383 47.619 0.00 0.00 0.00 2.24
2820 2928 2.233676 TGTTCAGTGTCGCCATGTATCT 59.766 45.455 0.00 0.00 0.00 1.98
2821 2929 3.445805 TGTTCAGTGTCGCCATGTATCTA 59.554 43.478 0.00 0.00 0.00 1.98
2822 2930 4.099419 TGTTCAGTGTCGCCATGTATCTAT 59.901 41.667 0.00 0.00 0.00 1.98
2823 2931 5.300792 TGTTCAGTGTCGCCATGTATCTATA 59.699 40.000 0.00 0.00 0.00 1.31
2824 2932 5.372547 TCAGTGTCGCCATGTATCTATAC 57.627 43.478 0.00 0.00 0.00 1.47
2825 2933 4.825085 TCAGTGTCGCCATGTATCTATACA 59.175 41.667 5.33 5.33 46.21 2.29
2826 2934 5.300792 TCAGTGTCGCCATGTATCTATACAA 59.699 40.000 6.89 0.00 45.40 2.41
2827 2935 5.402568 CAGTGTCGCCATGTATCTATACAAC 59.597 44.000 6.89 1.84 45.40 3.32
2828 2936 4.684703 GTGTCGCCATGTATCTATACAACC 59.315 45.833 6.89 0.00 45.40 3.77
2829 2937 4.587262 TGTCGCCATGTATCTATACAACCT 59.413 41.667 6.89 0.00 45.40 3.50
2830 2938 5.069914 TGTCGCCATGTATCTATACAACCTT 59.930 40.000 6.89 0.00 45.40 3.50
2831 2939 5.405571 GTCGCCATGTATCTATACAACCTTG 59.594 44.000 6.89 1.62 45.40 3.61
2832 2940 5.069914 TCGCCATGTATCTATACAACCTTGT 59.930 40.000 6.89 0.00 45.40 3.16
2833 2941 6.265876 TCGCCATGTATCTATACAACCTTGTA 59.734 38.462 6.89 0.43 45.40 2.41
2834 2942 6.586463 CGCCATGTATCTATACAACCTTGTAG 59.414 42.308 6.89 0.00 45.80 2.74
2835 2943 7.523216 CGCCATGTATCTATACAACCTTGTAGA 60.523 40.741 6.89 0.00 45.80 2.59
2836 2944 8.148351 GCCATGTATCTATACAACCTTGTAGAA 58.852 37.037 6.89 0.00 45.80 2.10
2849 2957 8.088365 ACAACCTTGTAGAATTATTTTCCTTGC 58.912 33.333 0.00 0.00 40.16 4.01
2850 2958 7.775053 ACCTTGTAGAATTATTTTCCTTGCA 57.225 32.000 0.00 0.00 0.00 4.08
2851 2959 8.189119 ACCTTGTAGAATTATTTTCCTTGCAA 57.811 30.769 0.00 0.00 0.00 4.08
2852 2960 8.646900 ACCTTGTAGAATTATTTTCCTTGCAAA 58.353 29.630 0.00 0.00 0.00 3.68
2853 2961 8.925700 CCTTGTAGAATTATTTTCCTTGCAAAC 58.074 33.333 0.00 0.00 0.00 2.93
2854 2962 8.825667 TTGTAGAATTATTTTCCTTGCAAACC 57.174 30.769 0.00 0.00 0.00 3.27
2855 2963 7.957002 TGTAGAATTATTTTCCTTGCAAACCA 58.043 30.769 0.00 0.00 0.00 3.67
2856 2964 8.592809 TGTAGAATTATTTTCCTTGCAAACCAT 58.407 29.630 0.00 0.00 0.00 3.55
2862 2970 9.956640 ATTATTTTCCTTGCAAACCATAAATGA 57.043 25.926 0.00 0.75 0.00 2.57
2863 2971 9.956640 TTATTTTCCTTGCAAACCATAAATGAT 57.043 25.926 0.00 0.00 0.00 2.45
2868 2976 9.639563 TTCCTTGCAAACCATAAATGATATAGA 57.360 29.630 0.00 0.00 0.00 1.98
2869 2977 9.066892 TCCTTGCAAACCATAAATGATATAGAC 57.933 33.333 0.00 0.00 0.00 2.59
2870 2978 8.849168 CCTTGCAAACCATAAATGATATAGACA 58.151 33.333 0.00 0.00 0.00 3.41
2873 2981 9.183368 TGCAAACCATAAATGATATAGACAACA 57.817 29.630 0.00 0.00 0.00 3.33
2874 2982 9.450807 GCAAACCATAAATGATATAGACAACAC 57.549 33.333 0.00 0.00 0.00 3.32
2882 2990 8.798859 AAATGATATAGACAACACTTCTGCTT 57.201 30.769 0.00 0.00 0.00 3.91
2883 2991 8.430801 AATGATATAGACAACACTTCTGCTTC 57.569 34.615 0.00 0.00 0.00 3.86
2884 2992 6.036470 TGATATAGACAACACTTCTGCTTCG 58.964 40.000 0.00 0.00 0.00 3.79
2885 2993 1.871080 AGACAACACTTCTGCTTCGG 58.129 50.000 0.00 0.00 0.00 4.30
2886 2994 1.139058 AGACAACACTTCTGCTTCGGT 59.861 47.619 0.00 0.00 0.00 4.69
2887 2995 2.364324 AGACAACACTTCTGCTTCGGTA 59.636 45.455 0.00 0.00 0.00 4.02
2888 2996 2.731976 GACAACACTTCTGCTTCGGTAG 59.268 50.000 0.00 0.00 0.00 3.18
2889 2997 2.364324 ACAACACTTCTGCTTCGGTAGA 59.636 45.455 0.00 0.00 34.97 2.59
2890 2998 2.726832 ACACTTCTGCTTCGGTAGAC 57.273 50.000 0.00 0.00 36.46 2.59
2891 2999 1.272769 ACACTTCTGCTTCGGTAGACC 59.727 52.381 0.00 0.00 36.46 3.85
2892 3000 0.896226 ACTTCTGCTTCGGTAGACCC 59.104 55.000 0.00 0.00 36.46 4.46
2893 3001 0.175989 CTTCTGCTTCGGTAGACCCC 59.824 60.000 0.00 0.00 36.46 4.95
2894 3002 1.262640 TTCTGCTTCGGTAGACCCCC 61.263 60.000 0.00 0.00 36.46 5.40
2911 3019 1.771255 CCCCCTCTCCTGAATACAAGG 59.229 57.143 0.00 0.00 0.00 3.61
2912 3020 2.629639 CCCCCTCTCCTGAATACAAGGA 60.630 54.545 0.00 0.00 0.00 3.36
2913 3021 3.321950 CCCCTCTCCTGAATACAAGGAT 58.678 50.000 0.00 0.00 0.00 3.24
2914 3022 3.072184 CCCCTCTCCTGAATACAAGGATG 59.928 52.174 0.00 0.00 0.00 3.51
2915 3023 3.072184 CCCTCTCCTGAATACAAGGATGG 59.928 52.174 0.00 0.00 0.00 3.51
2916 3024 3.495806 CCTCTCCTGAATACAAGGATGGC 60.496 52.174 0.00 0.00 0.00 4.40
2917 3025 3.387962 TCTCCTGAATACAAGGATGGCT 58.612 45.455 0.00 0.00 0.00 4.75
2918 3026 3.135348 TCTCCTGAATACAAGGATGGCTG 59.865 47.826 0.00 0.00 0.00 4.85
2919 3027 3.114606 TCCTGAATACAAGGATGGCTGA 58.885 45.455 0.00 0.00 0.00 4.26
2920 3028 3.135348 TCCTGAATACAAGGATGGCTGAG 59.865 47.826 0.00 0.00 0.00 3.35
2921 3029 3.135348 CCTGAATACAAGGATGGCTGAGA 59.865 47.826 0.00 0.00 0.00 3.27
2922 3030 4.202440 CCTGAATACAAGGATGGCTGAGAT 60.202 45.833 0.00 0.00 0.00 2.75
2923 3031 5.374921 CTGAATACAAGGATGGCTGAGATT 58.625 41.667 0.00 0.00 0.00 2.40
2924 3032 5.128205 TGAATACAAGGATGGCTGAGATTG 58.872 41.667 0.00 0.00 0.00 2.67
2925 3033 2.431954 ACAAGGATGGCTGAGATTGG 57.568 50.000 0.00 0.00 0.00 3.16
2926 3034 1.637553 ACAAGGATGGCTGAGATTGGT 59.362 47.619 0.00 0.00 0.00 3.67
2927 3035 2.295885 CAAGGATGGCTGAGATTGGTC 58.704 52.381 0.00 0.00 0.00 4.02
2928 3036 0.467384 AGGATGGCTGAGATTGGTCG 59.533 55.000 0.00 0.00 0.00 4.79
2929 3037 0.465705 GGATGGCTGAGATTGGTCGA 59.534 55.000 0.00 0.00 0.00 4.20
2930 3038 1.071385 GGATGGCTGAGATTGGTCGAT 59.929 52.381 0.00 0.00 0.00 3.59
2931 3039 2.300152 GGATGGCTGAGATTGGTCGATA 59.700 50.000 0.00 0.00 0.00 2.92
2932 3040 2.890808 TGGCTGAGATTGGTCGATAC 57.109 50.000 0.00 0.00 0.00 2.24
2933 3041 1.412710 TGGCTGAGATTGGTCGATACC 59.587 52.381 0.00 0.00 46.98 2.73
2934 3042 1.689273 GGCTGAGATTGGTCGATACCT 59.311 52.381 0.00 0.00 46.91 3.08
2935 3043 2.288518 GGCTGAGATTGGTCGATACCTC 60.289 54.545 0.00 0.00 46.91 3.85
2936 3044 2.625790 GCTGAGATTGGTCGATACCTCT 59.374 50.000 0.00 0.00 46.91 3.69
2937 3045 3.068873 GCTGAGATTGGTCGATACCTCTT 59.931 47.826 0.00 0.00 46.91 2.85
2938 3046 4.794655 GCTGAGATTGGTCGATACCTCTTC 60.795 50.000 0.00 0.00 46.91 2.87
2939 3047 4.278310 TGAGATTGGTCGATACCTCTTCA 58.722 43.478 0.00 0.00 46.91 3.02
2940 3048 4.895889 TGAGATTGGTCGATACCTCTTCAT 59.104 41.667 0.00 0.00 46.91 2.57
2941 3049 6.068670 TGAGATTGGTCGATACCTCTTCATA 58.931 40.000 0.00 0.00 46.91 2.15
2942 3050 6.549736 TGAGATTGGTCGATACCTCTTCATAA 59.450 38.462 0.00 0.00 46.91 1.90
2943 3051 6.750148 AGATTGGTCGATACCTCTTCATAAC 58.250 40.000 0.00 0.00 46.91 1.89
2944 3052 5.925506 TTGGTCGATACCTCTTCATAACA 57.074 39.130 0.00 0.00 46.91 2.41
2945 3053 5.925506 TGGTCGATACCTCTTCATAACAA 57.074 39.130 0.00 0.00 46.91 2.83
2946 3054 6.288941 TGGTCGATACCTCTTCATAACAAA 57.711 37.500 0.00 0.00 46.91 2.83
2947 3055 6.338146 TGGTCGATACCTCTTCATAACAAAG 58.662 40.000 0.00 0.00 46.91 2.77
2948 3056 5.753921 GGTCGATACCTCTTCATAACAAAGG 59.246 44.000 0.00 0.00 43.08 3.11
2949 3057 5.753921 GTCGATACCTCTTCATAACAAAGGG 59.246 44.000 0.00 0.00 0.00 3.95
2950 3058 4.511826 CGATACCTCTTCATAACAAAGGGC 59.488 45.833 0.00 0.00 0.00 5.19
2951 3059 3.806949 ACCTCTTCATAACAAAGGGCA 57.193 42.857 0.00 0.00 0.00 5.36
2952 3060 4.322057 ACCTCTTCATAACAAAGGGCAT 57.678 40.909 0.00 0.00 0.00 4.40
2953 3061 4.019174 ACCTCTTCATAACAAAGGGCATG 58.981 43.478 0.00 0.00 0.00 4.06
2954 3062 4.263905 ACCTCTTCATAACAAAGGGCATGA 60.264 41.667 0.00 0.00 0.00 3.07
2955 3063 4.891756 CCTCTTCATAACAAAGGGCATGAT 59.108 41.667 0.00 0.00 0.00 2.45
2956 3064 5.221185 CCTCTTCATAACAAAGGGCATGATG 60.221 44.000 0.00 0.00 0.00 3.07
2957 3065 4.646040 TCTTCATAACAAAGGGCATGATGG 59.354 41.667 0.00 0.00 0.00 3.51
2958 3066 3.979911 TCATAACAAAGGGCATGATGGT 58.020 40.909 0.00 0.00 0.00 3.55
2959 3067 3.953612 TCATAACAAAGGGCATGATGGTC 59.046 43.478 0.00 0.00 0.00 4.02
2960 3068 2.307496 AACAAAGGGCATGATGGTCA 57.693 45.000 0.00 0.00 0.00 4.02
2961 3069 2.537633 ACAAAGGGCATGATGGTCAT 57.462 45.000 0.00 0.00 37.65 3.06
2962 3070 3.668141 ACAAAGGGCATGATGGTCATA 57.332 42.857 0.00 0.00 34.28 2.15
2963 3071 4.188937 ACAAAGGGCATGATGGTCATAT 57.811 40.909 0.00 0.00 34.28 1.78
2964 3072 4.549668 ACAAAGGGCATGATGGTCATATT 58.450 39.130 0.00 0.00 34.28 1.28
2965 3073 4.964262 ACAAAGGGCATGATGGTCATATTT 59.036 37.500 0.00 0.00 34.28 1.40
2966 3074 5.426185 ACAAAGGGCATGATGGTCATATTTT 59.574 36.000 0.00 0.00 34.28 1.82
2967 3075 5.540400 AAGGGCATGATGGTCATATTTTG 57.460 39.130 0.00 0.00 34.28 2.44
2968 3076 4.806892 AGGGCATGATGGTCATATTTTGA 58.193 39.130 0.00 0.00 34.28 2.69
2969 3077 5.210430 AGGGCATGATGGTCATATTTTGAA 58.790 37.500 0.00 0.00 34.28 2.69
2970 3078 5.662208 AGGGCATGATGGTCATATTTTGAAA 59.338 36.000 0.00 0.00 34.28 2.69
2971 3079 6.156602 AGGGCATGATGGTCATATTTTGAAAA 59.843 34.615 0.00 0.00 34.28 2.29
2972 3080 6.822676 GGGCATGATGGTCATATTTTGAAAAA 59.177 34.615 0.00 0.00 34.28 1.94
2973 3081 7.011669 GGGCATGATGGTCATATTTTGAAAAAG 59.988 37.037 0.00 0.00 34.28 2.27
2974 3082 7.550196 GGCATGATGGTCATATTTTGAAAAAGT 59.450 33.333 0.00 0.00 34.28 2.66
2975 3083 8.385111 GCATGATGGTCATATTTTGAAAAAGTG 58.615 33.333 0.00 0.00 34.28 3.16
2976 3084 9.642327 CATGATGGTCATATTTTGAAAAAGTGA 57.358 29.630 0.00 0.00 34.28 3.41
2977 3085 9.643693 ATGATGGTCATATTTTGAAAAAGTGAC 57.356 29.630 20.84 20.84 41.60 3.67
2979 3087 6.927933 GGTCATATTTTGAAAAAGTGACCG 57.072 37.500 26.96 4.19 46.12 4.79
2980 3088 5.344933 GGTCATATTTTGAAAAAGTGACCGC 59.655 40.000 26.96 14.90 46.12 5.68
2981 3089 5.344933 GTCATATTTTGAAAAAGTGACCGCC 59.655 40.000 19.43 4.15 39.26 6.13
2982 3090 2.588027 TTTTGAAAAAGTGACCGCCC 57.412 45.000 0.00 0.00 0.00 6.13
2983 3091 0.382515 TTTGAAAAAGTGACCGCCCG 59.617 50.000 0.00 0.00 0.00 6.13
2984 3092 1.448922 TTGAAAAAGTGACCGCCCGG 61.449 55.000 4.96 4.96 42.03 5.73
2985 3093 3.263503 GAAAAAGTGACCGCCCGGC 62.264 63.158 6.63 0.00 39.32 6.13
3011 3119 5.593679 CCGACGGGGATATGTATAGAAAT 57.406 43.478 5.81 0.00 38.47 2.17
3012 3120 6.704289 CCGACGGGGATATGTATAGAAATA 57.296 41.667 5.81 0.00 38.47 1.40
3013 3121 6.501781 CCGACGGGGATATGTATAGAAATAC 58.498 44.000 5.81 0.00 38.47 1.89
3014 3122 6.197276 CGACGGGGATATGTATAGAAATACG 58.803 44.000 0.00 0.00 40.84 3.06
3015 3123 6.183360 CGACGGGGATATGTATAGAAATACGT 60.183 42.308 0.00 0.00 40.84 3.57
3016 3124 6.860080 ACGGGGATATGTATAGAAATACGTG 58.140 40.000 0.00 0.00 40.84 4.49
3017 3125 6.435277 ACGGGGATATGTATAGAAATACGTGT 59.565 38.462 0.00 0.00 40.84 4.49
3018 3126 7.039504 ACGGGGATATGTATAGAAATACGTGTT 60.040 37.037 0.00 0.00 40.84 3.32
3019 3127 7.274904 CGGGGATATGTATAGAAATACGTGTTG 59.725 40.741 0.00 0.00 40.84 3.33
3020 3128 7.548075 GGGGATATGTATAGAAATACGTGTTGG 59.452 40.741 0.00 0.00 40.84 3.77
3021 3129 8.092687 GGGATATGTATAGAAATACGTGTTGGT 58.907 37.037 0.00 0.00 40.84 3.67
3026 3134 9.880157 ATGTATAGAAATACGTGTTGGTAGTTT 57.120 29.630 0.00 0.00 40.84 2.66
3027 3135 9.709495 TGTATAGAAATACGTGTTGGTAGTTTT 57.291 29.630 0.00 0.00 40.84 2.43
3079 3187 4.476752 GCCGCGGGTATGTGGGAA 62.477 66.667 29.38 0.00 39.96 3.97
3080 3188 2.269562 CCGCGGGTATGTGGGAAA 59.730 61.111 20.10 0.00 35.83 3.13
3081 3189 1.377463 CCGCGGGTATGTGGGAAAA 60.377 57.895 20.10 0.00 35.83 2.29
3082 3190 0.961358 CCGCGGGTATGTGGGAAAAA 60.961 55.000 20.10 0.00 35.83 1.94
3110 3218 2.641197 AAAAATGCCCGACTTCGCT 58.359 47.368 0.00 0.00 38.18 4.93
3111 3219 0.521735 AAAAATGCCCGACTTCGCTC 59.478 50.000 0.00 0.00 38.18 5.03
3112 3220 1.305930 AAAATGCCCGACTTCGCTCC 61.306 55.000 0.00 0.00 38.18 4.70
3113 3221 2.185310 AAATGCCCGACTTCGCTCCT 62.185 55.000 0.00 0.00 38.18 3.69
3114 3222 2.859273 AATGCCCGACTTCGCTCCTG 62.859 60.000 0.00 0.00 38.18 3.86
3115 3223 4.821589 GCCCGACTTCGCTCCTGG 62.822 72.222 0.00 0.00 38.18 4.45
3116 3224 4.148825 CCCGACTTCGCTCCTGGG 62.149 72.222 0.00 0.00 38.18 4.45
3117 3225 4.821589 CCGACTTCGCTCCTGGGC 62.822 72.222 0.00 0.00 38.18 5.36
3118 3226 4.821589 CGACTTCGCTCCTGGGCC 62.822 72.222 0.00 0.00 0.00 5.80
3119 3227 4.475135 GACTTCGCTCCTGGGCCC 62.475 72.222 17.59 17.59 0.00 5.80
3121 3229 3.801997 CTTCGCTCCTGGGCCCAT 61.802 66.667 28.82 0.00 0.00 4.00
3122 3230 2.366301 TTCGCTCCTGGGCCCATA 60.366 61.111 28.82 16.28 0.00 2.74
3123 3231 2.388890 CTTCGCTCCTGGGCCCATAG 62.389 65.000 28.82 25.84 0.00 2.23
3124 3232 3.164269 CGCTCCTGGGCCCATAGT 61.164 66.667 28.82 0.00 0.00 2.12
3125 3233 1.837051 CGCTCCTGGGCCCATAGTA 60.837 63.158 28.82 10.21 0.00 1.82
3126 3234 1.407656 CGCTCCTGGGCCCATAGTAA 61.408 60.000 28.82 8.25 0.00 2.24
3127 3235 0.843984 GCTCCTGGGCCCATAGTAAA 59.156 55.000 28.82 6.32 0.00 2.01
3128 3236 1.477014 GCTCCTGGGCCCATAGTAAAC 60.477 57.143 28.82 9.22 0.00 2.01
3129 3237 2.127708 CTCCTGGGCCCATAGTAAACT 58.872 52.381 28.82 0.00 0.00 2.66
3130 3238 3.314693 CTCCTGGGCCCATAGTAAACTA 58.685 50.000 28.82 0.00 0.00 2.24
3131 3239 3.910627 CTCCTGGGCCCATAGTAAACTAT 59.089 47.826 28.82 0.00 39.61 2.12
3132 3240 5.091552 CTCCTGGGCCCATAGTAAACTATA 58.908 45.833 28.82 0.00 37.07 1.31
3133 3241 4.842380 TCCTGGGCCCATAGTAAACTATAC 59.158 45.833 28.82 0.00 37.07 1.47
3134 3242 4.595781 CCTGGGCCCATAGTAAACTATACA 59.404 45.833 28.82 0.00 37.07 2.29
3135 3243 5.072600 CCTGGGCCCATAGTAAACTATACAA 59.927 44.000 28.82 0.00 37.07 2.41
3136 3244 6.240176 CCTGGGCCCATAGTAAACTATACAAT 60.240 42.308 28.82 0.00 37.07 2.71
3137 3245 6.775708 TGGGCCCATAGTAAACTATACAATC 58.224 40.000 24.45 0.00 37.07 2.67
3138 3246 6.330514 TGGGCCCATAGTAAACTATACAATCA 59.669 38.462 24.45 0.00 37.07 2.57
3139 3247 7.147284 TGGGCCCATAGTAAACTATACAATCAA 60.147 37.037 24.45 0.00 37.07 2.57
3140 3248 7.174426 GGGCCCATAGTAAACTATACAATCAAC 59.826 40.741 19.95 0.00 37.07 3.18
3141 3249 7.174426 GGCCCATAGTAAACTATACAATCAACC 59.826 40.741 2.39 0.00 37.07 3.77
3142 3250 7.174426 GCCCATAGTAAACTATACAATCAACCC 59.826 40.741 2.39 0.00 37.07 4.11
3143 3251 8.215050 CCCATAGTAAACTATACAATCAACCCA 58.785 37.037 2.39 0.00 37.07 4.51
3144 3252 9.621629 CCATAGTAAACTATACAATCAACCCAA 57.378 33.333 2.39 0.00 37.07 4.12
3148 3256 9.747898 AGTAAACTATACAATCAACCCAAATCA 57.252 29.630 0.00 0.00 0.00 2.57
3151 3259 7.100458 ACTATACAATCAACCCAAATCAAGC 57.900 36.000 0.00 0.00 0.00 4.01
3152 3260 3.683365 ACAATCAACCCAAATCAAGCC 57.317 42.857 0.00 0.00 0.00 4.35
3153 3261 2.302733 ACAATCAACCCAAATCAAGCCC 59.697 45.455 0.00 0.00 0.00 5.19
3154 3262 1.185315 ATCAACCCAAATCAAGCCCG 58.815 50.000 0.00 0.00 0.00 6.13
3155 3263 0.111446 TCAACCCAAATCAAGCCCGA 59.889 50.000 0.00 0.00 0.00 5.14
3156 3264 0.965439 CAACCCAAATCAAGCCCGAA 59.035 50.000 0.00 0.00 0.00 4.30
3157 3265 1.067635 CAACCCAAATCAAGCCCGAAG 60.068 52.381 0.00 0.00 0.00 3.79
3158 3266 0.404040 ACCCAAATCAAGCCCGAAGA 59.596 50.000 0.00 0.00 0.00 2.87
3159 3267 0.811281 CCCAAATCAAGCCCGAAGAC 59.189 55.000 0.00 0.00 0.00 3.01
3160 3268 0.447801 CCAAATCAAGCCCGAAGACG 59.552 55.000 0.00 0.00 39.43 4.18
3161 3269 1.438651 CAAATCAAGCCCGAAGACGA 58.561 50.000 0.00 0.00 42.66 4.20
3162 3270 1.128692 CAAATCAAGCCCGAAGACGAC 59.871 52.381 0.00 0.00 42.66 4.34
3163 3271 0.608640 AATCAAGCCCGAAGACGACT 59.391 50.000 0.00 0.00 42.66 4.18
3164 3272 0.173708 ATCAAGCCCGAAGACGACTC 59.826 55.000 0.00 0.00 42.66 3.36
3165 3273 1.801913 CAAGCCCGAAGACGACTCG 60.802 63.158 0.00 0.00 42.66 4.18
3166 3274 2.991076 AAGCCCGAAGACGACTCGG 61.991 63.158 14.74 14.74 45.65 4.63
3169 3277 4.831307 CCGAAGACGACTCGGGCG 62.831 72.222 14.13 0.00 42.70 6.13
3170 3278 4.831307 CGAAGACGACTCGGGCGG 62.831 72.222 2.98 0.00 42.66 6.13
3171 3279 3.745803 GAAGACGACTCGGGCGGT 61.746 66.667 2.98 0.00 0.00 5.68
3172 3280 3.680338 GAAGACGACTCGGGCGGTC 62.680 68.421 2.98 1.26 0.00 4.79
3177 3285 2.278661 GACTCGGGCGGTCGATTC 60.279 66.667 0.00 0.00 38.55 2.52
3178 3286 4.189188 ACTCGGGCGGTCGATTCG 62.189 66.667 0.00 0.00 38.55 3.34
3179 3287 4.925576 CTCGGGCGGTCGATTCGG 62.926 72.222 6.18 0.00 38.55 4.30
3187 3295 3.122323 GTCGATTCGGCCCGCAAA 61.122 61.111 6.18 0.00 0.00 3.68
3188 3296 2.124901 TCGATTCGGCCCGCAAAT 60.125 55.556 6.18 0.00 0.00 2.32
3189 3297 2.024588 CGATTCGGCCCGCAAATG 59.975 61.111 0.00 0.00 0.00 2.32
3190 3298 2.412937 GATTCGGCCCGCAAATGG 59.587 61.111 0.00 0.00 0.00 3.16
3197 3305 4.757355 CCCGCAAATGGGCCCAGA 62.757 66.667 31.97 7.65 43.70 3.86
3198 3306 2.679642 CCGCAAATGGGCCCAGAA 60.680 61.111 31.97 6.71 0.00 3.02
3199 3307 2.713967 CCGCAAATGGGCCCAGAAG 61.714 63.158 31.97 21.95 0.00 2.85
3200 3308 2.713967 CGCAAATGGGCCCAGAAGG 61.714 63.158 31.97 19.79 39.47 3.46
3211 3319 1.296715 CCAGAAGGGAGGTCCAACG 59.703 63.158 0.00 0.00 40.01 4.10
3212 3320 1.296715 CAGAAGGGAGGTCCAACGG 59.703 63.158 0.00 0.00 38.24 4.44
3213 3321 1.918800 AGAAGGGAGGTCCAACGGG 60.919 63.158 0.00 0.00 38.24 5.28
3214 3322 2.933834 AAGGGAGGTCCAACGGGG 60.934 66.667 0.00 0.00 38.24 5.73
3227 3335 4.394712 CGGGGCGGCAGAGACTTT 62.395 66.667 12.47 0.00 0.00 2.66
3228 3336 2.034221 GGGGCGGCAGAGACTTTT 59.966 61.111 12.47 0.00 0.00 2.27
3229 3337 2.335712 GGGGCGGCAGAGACTTTTG 61.336 63.158 12.47 0.00 0.00 2.44
3230 3338 1.302511 GGGCGGCAGAGACTTTTGA 60.303 57.895 12.47 0.00 0.00 2.69
3231 3339 1.578206 GGGCGGCAGAGACTTTTGAC 61.578 60.000 12.47 0.00 0.00 3.18
3232 3340 1.578206 GGCGGCAGAGACTTTTGACC 61.578 60.000 3.07 0.00 0.00 4.02
3233 3341 1.901650 GCGGCAGAGACTTTTGACCG 61.902 60.000 0.00 13.91 37.19 4.79
3234 3342 1.869690 GGCAGAGACTTTTGACCGC 59.130 57.895 0.00 0.00 0.00 5.68
3235 3343 1.578206 GGCAGAGACTTTTGACCGCC 61.578 60.000 0.00 0.00 0.00 6.13
3236 3344 1.578206 GCAGAGACTTTTGACCGCCC 61.578 60.000 0.00 0.00 0.00 6.13
3237 3345 0.250295 CAGAGACTTTTGACCGCCCA 60.250 55.000 0.00 0.00 0.00 5.36
3238 3346 0.250338 AGAGACTTTTGACCGCCCAC 60.250 55.000 0.00 0.00 0.00 4.61
3239 3347 0.534203 GAGACTTTTGACCGCCCACA 60.534 55.000 0.00 0.00 0.00 4.17
3240 3348 0.535102 AGACTTTTGACCGCCCACAG 60.535 55.000 0.00 0.00 0.00 3.66
3241 3349 0.534203 GACTTTTGACCGCCCACAGA 60.534 55.000 0.00 0.00 0.00 3.41
3242 3350 0.818040 ACTTTTGACCGCCCACAGAC 60.818 55.000 0.00 0.00 0.00 3.51
3243 3351 0.535102 CTTTTGACCGCCCACAGACT 60.535 55.000 0.00 0.00 0.00 3.24
3244 3352 0.759959 TTTTGACCGCCCACAGACTA 59.240 50.000 0.00 0.00 0.00 2.59
3245 3353 0.034337 TTTGACCGCCCACAGACTAC 59.966 55.000 0.00 0.00 0.00 2.73
3246 3354 1.116536 TTGACCGCCCACAGACTACA 61.117 55.000 0.00 0.00 0.00 2.74
3247 3355 0.902984 TGACCGCCCACAGACTACAT 60.903 55.000 0.00 0.00 0.00 2.29
3248 3356 1.108776 GACCGCCCACAGACTACATA 58.891 55.000 0.00 0.00 0.00 2.29
3249 3357 1.479323 GACCGCCCACAGACTACATAA 59.521 52.381 0.00 0.00 0.00 1.90
3250 3358 1.903860 ACCGCCCACAGACTACATAAA 59.096 47.619 0.00 0.00 0.00 1.40
3251 3359 2.504175 ACCGCCCACAGACTACATAAAT 59.496 45.455 0.00 0.00 0.00 1.40
3252 3360 2.872245 CCGCCCACAGACTACATAAATG 59.128 50.000 0.00 0.00 0.00 2.32
3253 3361 3.531538 CGCCCACAGACTACATAAATGT 58.468 45.455 0.63 0.63 44.48 2.71
3254 3362 4.442332 CCGCCCACAGACTACATAAATGTA 60.442 45.833 2.98 2.98 41.97 2.29
3255 3363 5.113383 CGCCCACAGACTACATAAATGTAA 58.887 41.667 4.49 0.00 42.20 2.41
3256 3364 5.006358 CGCCCACAGACTACATAAATGTAAC 59.994 44.000 4.49 2.66 42.20 2.50
3257 3365 5.878116 GCCCACAGACTACATAAATGTAACA 59.122 40.000 4.49 0.00 42.20 2.41
3258 3366 6.183360 GCCCACAGACTACATAAATGTAACAC 60.183 42.308 4.49 0.32 42.20 3.32
3259 3367 7.103641 CCCACAGACTACATAAATGTAACACT 58.896 38.462 4.49 2.25 42.20 3.55
3260 3368 8.255206 CCCACAGACTACATAAATGTAACACTA 58.745 37.037 4.49 0.00 42.20 2.74
3261 3369 9.817809 CCACAGACTACATAAATGTAACACTAT 57.182 33.333 4.49 0.00 42.20 2.12
3280 3388 9.899226 AACACTATTTATCACAAAGCTTTCTTC 57.101 29.630 9.23 0.00 0.00 2.87
3281 3389 9.066892 ACACTATTTATCACAAAGCTTTCTTCA 57.933 29.630 9.23 0.00 0.00 3.02
3282 3390 9.552114 CACTATTTATCACAAAGCTTTCTTCAG 57.448 33.333 9.23 0.00 0.00 3.02
3283 3391 9.507329 ACTATTTATCACAAAGCTTTCTTCAGA 57.493 29.630 9.23 3.56 0.00 3.27
3284 3392 9.766277 CTATTTATCACAAAGCTTTCTTCAGAC 57.234 33.333 9.23 0.00 0.00 3.51
3285 3393 7.566760 TTTATCACAAAGCTTTCTTCAGACA 57.433 32.000 9.23 0.00 0.00 3.41
3286 3394 5.686159 ATCACAAAGCTTTCTTCAGACAG 57.314 39.130 9.23 0.00 0.00 3.51
3287 3395 4.769688 TCACAAAGCTTTCTTCAGACAGA 58.230 39.130 9.23 0.00 0.00 3.41
3288 3396 5.185454 TCACAAAGCTTTCTTCAGACAGAA 58.815 37.500 9.23 0.00 34.41 3.02
3289 3397 5.647658 TCACAAAGCTTTCTTCAGACAGAAA 59.352 36.000 9.23 7.26 39.91 2.52
3290 3398 6.319658 TCACAAAGCTTTCTTCAGACAGAAAT 59.680 34.615 9.23 0.00 41.06 2.17
3291 3399 7.498900 TCACAAAGCTTTCTTCAGACAGAAATA 59.501 33.333 9.23 0.00 41.06 1.40
3292 3400 7.802251 CACAAAGCTTTCTTCAGACAGAAATAG 59.198 37.037 9.23 0.00 41.06 1.73
3293 3401 7.716998 ACAAAGCTTTCTTCAGACAGAAATAGA 59.283 33.333 9.23 0.00 41.06 1.98
3294 3402 8.562892 CAAAGCTTTCTTCAGACAGAAATAGAA 58.437 33.333 9.23 0.00 41.06 2.10
3295 3403 8.682936 AAGCTTTCTTCAGACAGAAATAGAAA 57.317 30.769 0.00 0.00 41.06 2.52
3296 3404 8.321650 AGCTTTCTTCAGACAGAAATAGAAAG 57.678 34.615 14.73 14.73 42.75 2.62
3297 3405 8.153550 AGCTTTCTTCAGACAGAAATAGAAAGA 58.846 33.333 20.48 0.00 42.63 2.52
3298 3406 8.778358 GCTTTCTTCAGACAGAAATAGAAAGAA 58.222 33.333 20.48 4.23 42.63 2.52
3325 3433 7.809546 AAAACTCCTTAAAAAGAGAGTCAGG 57.190 36.000 9.65 0.00 37.76 3.86
3326 3434 6.749036 AACTCCTTAAAAAGAGAGTCAGGA 57.251 37.500 9.65 0.00 37.76 3.86
3327 3435 6.749036 ACTCCTTAAAAAGAGAGTCAGGAA 57.251 37.500 0.00 0.00 35.51 3.36
3328 3436 6.764379 ACTCCTTAAAAAGAGAGTCAGGAAG 58.236 40.000 0.00 0.00 35.51 3.46
3329 3437 5.552178 TCCTTAAAAAGAGAGTCAGGAAGC 58.448 41.667 0.00 0.00 0.00 3.86
3330 3438 5.071788 TCCTTAAAAAGAGAGTCAGGAAGCA 59.928 40.000 0.00 0.00 0.00 3.91
3331 3439 5.765182 CCTTAAAAAGAGAGTCAGGAAGCAA 59.235 40.000 0.00 0.00 0.00 3.91
3332 3440 6.293680 CCTTAAAAAGAGAGTCAGGAAGCAAC 60.294 42.308 0.00 0.00 0.00 4.17
3333 3441 3.845781 AAAGAGAGTCAGGAAGCAACA 57.154 42.857 0.00 0.00 0.00 3.33
3334 3442 4.363991 AAAGAGAGTCAGGAAGCAACAT 57.636 40.909 0.00 0.00 0.00 2.71
3335 3443 3.608316 AGAGAGTCAGGAAGCAACATC 57.392 47.619 0.00 0.00 0.00 3.06
3336 3444 2.235898 AGAGAGTCAGGAAGCAACATCC 59.764 50.000 0.00 0.00 37.22 3.51
3337 3445 1.980765 AGAGTCAGGAAGCAACATCCA 59.019 47.619 0.00 0.00 39.55 3.41
3338 3446 2.373169 AGAGTCAGGAAGCAACATCCAA 59.627 45.455 0.00 0.00 39.55 3.53
3339 3447 2.746362 GAGTCAGGAAGCAACATCCAAG 59.254 50.000 0.00 0.00 39.55 3.61
3340 3448 1.200948 GTCAGGAAGCAACATCCAAGC 59.799 52.381 0.00 0.00 39.55 4.01
3341 3449 1.074405 TCAGGAAGCAACATCCAAGCT 59.926 47.619 0.00 0.00 39.55 3.74
3342 3450 1.471684 CAGGAAGCAACATCCAAGCTC 59.528 52.381 0.00 0.00 39.55 4.09
3343 3451 1.353694 AGGAAGCAACATCCAAGCTCT 59.646 47.619 0.00 0.00 39.55 4.09
3344 3452 2.573462 AGGAAGCAACATCCAAGCTCTA 59.427 45.455 0.00 0.00 39.55 2.43
3345 3453 2.680339 GGAAGCAACATCCAAGCTCTAC 59.320 50.000 0.00 0.00 37.70 2.59
3346 3454 2.409948 AGCAACATCCAAGCTCTACC 57.590 50.000 0.00 0.00 32.05 3.18
3347 3455 1.630369 AGCAACATCCAAGCTCTACCA 59.370 47.619 0.00 0.00 32.05 3.25
3348 3456 2.240667 AGCAACATCCAAGCTCTACCAT 59.759 45.455 0.00 0.00 32.05 3.55
3349 3457 3.455910 AGCAACATCCAAGCTCTACCATA 59.544 43.478 0.00 0.00 32.05 2.74
3350 3458 3.812053 GCAACATCCAAGCTCTACCATAG 59.188 47.826 0.00 0.00 0.00 2.23
3351 3459 4.443457 GCAACATCCAAGCTCTACCATAGA 60.443 45.833 0.00 0.00 0.00 1.98
3352 3460 5.674525 CAACATCCAAGCTCTACCATAGAA 58.325 41.667 0.00 0.00 33.75 2.10
3353 3461 5.957771 ACATCCAAGCTCTACCATAGAAA 57.042 39.130 0.00 0.00 33.75 2.52
3354 3462 5.675538 ACATCCAAGCTCTACCATAGAAAC 58.324 41.667 0.00 0.00 33.75 2.78
3355 3463 4.386867 TCCAAGCTCTACCATAGAAACG 57.613 45.455 0.00 0.00 33.75 3.60
3356 3464 2.866762 CCAAGCTCTACCATAGAAACGC 59.133 50.000 0.00 0.00 33.75 4.84
3357 3465 3.521560 CAAGCTCTACCATAGAAACGCA 58.478 45.455 0.00 0.00 33.75 5.24
3358 3466 3.166489 AGCTCTACCATAGAAACGCAC 57.834 47.619 0.00 0.00 33.75 5.34
3359 3467 2.496070 AGCTCTACCATAGAAACGCACA 59.504 45.455 0.00 0.00 33.75 4.57
3360 3468 3.133003 AGCTCTACCATAGAAACGCACAT 59.867 43.478 0.00 0.00 33.75 3.21
3361 3469 3.871594 GCTCTACCATAGAAACGCACATT 59.128 43.478 0.00 0.00 33.75 2.71
3362 3470 4.025647 GCTCTACCATAGAAACGCACATTC 60.026 45.833 0.00 0.00 33.75 2.67
3363 3471 5.079689 TCTACCATAGAAACGCACATTCA 57.920 39.130 0.00 0.00 0.00 2.57
3364 3472 5.483811 TCTACCATAGAAACGCACATTCAA 58.516 37.500 0.00 0.00 0.00 2.69
3365 3473 5.935206 TCTACCATAGAAACGCACATTCAAA 59.065 36.000 0.00 0.00 0.00 2.69
3366 3474 5.046910 ACCATAGAAACGCACATTCAAAG 57.953 39.130 0.00 0.00 0.00 2.77
3367 3475 4.082787 ACCATAGAAACGCACATTCAAAGG 60.083 41.667 0.00 0.00 0.00 3.11
3368 3476 4.155826 CCATAGAAACGCACATTCAAAGGA 59.844 41.667 0.00 0.00 0.00 3.36
3369 3477 5.335583 CCATAGAAACGCACATTCAAAGGAA 60.336 40.000 0.00 0.00 37.45 3.36
3370 3478 4.228912 AGAAACGCACATTCAAAGGAAG 57.771 40.909 0.00 0.00 36.25 3.46
3371 3479 2.422276 AACGCACATTCAAAGGAAGC 57.578 45.000 0.00 0.00 36.25 3.86
3372 3480 0.598065 ACGCACATTCAAAGGAAGCC 59.402 50.000 0.00 0.00 36.25 4.35
3373 3481 0.597568 CGCACATTCAAAGGAAGCCA 59.402 50.000 0.00 0.00 36.25 4.75
3374 3482 1.000385 CGCACATTCAAAGGAAGCCAA 60.000 47.619 0.00 0.00 36.25 4.52
3375 3483 2.407090 GCACATTCAAAGGAAGCCAAC 58.593 47.619 0.00 0.00 36.25 3.77
3376 3484 2.036346 GCACATTCAAAGGAAGCCAACT 59.964 45.455 0.00 0.00 36.25 3.16
3377 3485 3.645884 CACATTCAAAGGAAGCCAACTG 58.354 45.455 0.00 0.00 36.25 3.16
3378 3486 2.036346 ACATTCAAAGGAAGCCAACTGC 59.964 45.455 0.00 0.00 36.25 4.40
3379 3487 1.039856 TTCAAAGGAAGCCAACTGCC 58.960 50.000 0.00 0.00 42.99 4.85
3380 3488 0.827507 TCAAAGGAAGCCAACTGCCC 60.828 55.000 0.00 0.00 43.88 5.36
3381 3489 1.114722 CAAAGGAAGCCAACTGCCCA 61.115 55.000 0.00 0.00 43.88 5.36
3382 3490 1.115326 AAAGGAAGCCAACTGCCCAC 61.115 55.000 0.00 0.00 43.88 4.61
3383 3491 2.011617 AAGGAAGCCAACTGCCCACT 62.012 55.000 0.00 0.00 43.88 4.00
3384 3492 1.531602 GGAAGCCAACTGCCCACTT 60.532 57.895 0.00 0.00 42.71 3.16
3385 3493 1.662044 GAAGCCAACTGCCCACTTG 59.338 57.895 0.00 0.00 42.71 3.16
3386 3494 1.809567 GAAGCCAACTGCCCACTTGG 61.810 60.000 3.27 3.27 42.71 3.61
3387 3495 2.521708 GCCAACTGCCCACTTGGT 60.522 61.111 8.01 0.00 39.42 3.67
3388 3496 1.228429 GCCAACTGCCCACTTGGTA 60.228 57.895 8.01 0.00 39.42 3.25
3389 3497 0.611896 GCCAACTGCCCACTTGGTAT 60.612 55.000 8.01 0.00 39.42 2.73
3390 3498 1.340600 GCCAACTGCCCACTTGGTATA 60.341 52.381 8.01 0.00 39.42 1.47
3391 3499 2.365582 CCAACTGCCCACTTGGTATAC 58.634 52.381 0.00 0.00 33.46 1.47
3392 3500 2.006888 CAACTGCCCACTTGGTATACG 58.993 52.381 0.00 0.00 36.04 3.06
3393 3501 0.539986 ACTGCCCACTTGGTATACGG 59.460 55.000 0.00 0.00 36.04 4.02
3394 3502 0.814010 CTGCCCACTTGGTATACGGC 60.814 60.000 9.53 9.53 36.04 5.68
3395 3503 1.222387 GCCCACTTGGTATACGGCA 59.778 57.895 11.10 0.00 36.38 5.69
3396 3504 0.814010 GCCCACTTGGTATACGGCAG 60.814 60.000 11.10 3.43 36.38 4.85
3397 3505 0.814010 CCCACTTGGTATACGGCAGC 60.814 60.000 0.00 0.00 0.00 5.25
3398 3506 0.107897 CCACTTGGTATACGGCAGCA 60.108 55.000 0.00 0.00 0.00 4.41
3399 3507 1.290203 CACTTGGTATACGGCAGCAG 58.710 55.000 0.00 0.00 0.00 4.24
3400 3508 0.462047 ACTTGGTATACGGCAGCAGC 60.462 55.000 0.00 0.00 41.10 5.25
3401 3509 0.179073 CTTGGTATACGGCAGCAGCT 60.179 55.000 0.00 0.00 41.70 4.24
3408 3516 2.124983 CGGCAGCAGCTGTGGTAT 60.125 61.111 23.60 0.00 42.33 2.73
3409 3517 2.176273 CGGCAGCAGCTGTGGTATC 61.176 63.158 23.60 5.61 42.33 2.24
3410 3518 2.176273 GGCAGCAGCTGTGGTATCG 61.176 63.158 23.60 0.00 41.70 2.92
3411 3519 1.448540 GCAGCAGCTGTGGTATCGT 60.449 57.895 23.60 0.00 37.91 3.73
3412 3520 1.021390 GCAGCAGCTGTGGTATCGTT 61.021 55.000 23.60 0.00 37.91 3.85
3413 3521 1.442769 CAGCAGCTGTGGTATCGTTT 58.557 50.000 16.64 0.00 31.49 3.60
3414 3522 1.394917 CAGCAGCTGTGGTATCGTTTC 59.605 52.381 16.64 0.00 31.49 2.78
3415 3523 1.001974 AGCAGCTGTGGTATCGTTTCA 59.998 47.619 16.64 0.00 30.68 2.69
3416 3524 1.804151 GCAGCTGTGGTATCGTTTCAA 59.196 47.619 16.64 0.00 0.00 2.69
3417 3525 2.225491 GCAGCTGTGGTATCGTTTCAAA 59.775 45.455 16.64 0.00 0.00 2.69
3418 3526 3.304391 GCAGCTGTGGTATCGTTTCAAAA 60.304 43.478 16.64 0.00 0.00 2.44
3419 3527 4.219033 CAGCTGTGGTATCGTTTCAAAAC 58.781 43.478 5.25 0.00 35.59 2.43
3420 3528 4.024048 CAGCTGTGGTATCGTTTCAAAACT 60.024 41.667 5.25 0.00 36.77 2.66
3421 3529 5.178623 CAGCTGTGGTATCGTTTCAAAACTA 59.821 40.000 5.25 0.00 36.77 2.24
3422 3530 5.938125 AGCTGTGGTATCGTTTCAAAACTAT 59.062 36.000 4.28 1.72 36.77 2.12
3423 3531 6.430000 AGCTGTGGTATCGTTTCAAAACTATT 59.570 34.615 4.28 0.00 36.77 1.73
3424 3532 7.040686 AGCTGTGGTATCGTTTCAAAACTATTT 60.041 33.333 4.28 0.00 36.77 1.40
3425 3533 7.593644 GCTGTGGTATCGTTTCAAAACTATTTT 59.406 33.333 4.28 0.00 36.77 1.82
3426 3534 9.458374 CTGTGGTATCGTTTCAAAACTATTTTT 57.542 29.630 4.28 0.00 36.77 1.94
3441 3549 9.489084 AAAACTATTTTTATTTCCAGGAAGTGC 57.511 29.630 7.47 0.00 32.90 4.40
3442 3550 6.852664 ACTATTTTTATTTCCAGGAAGTGCG 58.147 36.000 7.47 0.00 0.00 5.34
3443 3551 5.975693 ATTTTTATTTCCAGGAAGTGCGA 57.024 34.783 7.47 0.00 0.00 5.10
3444 3552 5.371115 TTTTTATTTCCAGGAAGTGCGAG 57.629 39.130 7.47 0.00 0.00 5.03
3445 3553 2.024176 TATTTCCAGGAAGTGCGAGC 57.976 50.000 7.47 0.00 0.00 5.03
3446 3554 0.326264 ATTTCCAGGAAGTGCGAGCT 59.674 50.000 1.07 0.00 0.00 4.09
3447 3555 0.320771 TTTCCAGGAAGTGCGAGCTC 60.321 55.000 2.73 2.73 0.00 4.09
3448 3556 2.125350 CCAGGAAGTGCGAGCTCC 60.125 66.667 8.47 1.40 0.00 4.70
3449 3557 2.125350 CAGGAAGTGCGAGCTCCC 60.125 66.667 8.47 0.00 0.00 4.30
3450 3558 3.394836 AGGAAGTGCGAGCTCCCC 61.395 66.667 8.47 0.00 0.00 4.81
3451 3559 3.706373 GGAAGTGCGAGCTCCCCA 61.706 66.667 8.47 2.60 0.00 4.96
3452 3560 2.347490 GAAGTGCGAGCTCCCCAA 59.653 61.111 8.47 0.00 0.00 4.12
3453 3561 2.032681 AAGTGCGAGCTCCCCAAC 59.967 61.111 8.47 1.38 0.00 3.77
3454 3562 3.553095 AAGTGCGAGCTCCCCAACC 62.553 63.158 8.47 0.00 0.00 3.77
3455 3563 4.021925 GTGCGAGCTCCCCAACCT 62.022 66.667 8.47 0.00 0.00 3.50
3456 3564 2.284331 TGCGAGCTCCCCAACCTA 60.284 61.111 8.47 0.00 0.00 3.08
3457 3565 1.689233 TGCGAGCTCCCCAACCTAT 60.689 57.895 8.47 0.00 0.00 2.57
3458 3566 1.271840 TGCGAGCTCCCCAACCTATT 61.272 55.000 8.47 0.00 0.00 1.73
3459 3567 0.533085 GCGAGCTCCCCAACCTATTC 60.533 60.000 8.47 0.00 0.00 1.75
3460 3568 0.830648 CGAGCTCCCCAACCTATTCA 59.169 55.000 8.47 0.00 0.00 2.57
3461 3569 1.209504 CGAGCTCCCCAACCTATTCAA 59.790 52.381 8.47 0.00 0.00 2.69
3462 3570 2.743183 CGAGCTCCCCAACCTATTCAAG 60.743 54.545 8.47 0.00 0.00 3.02
3463 3571 2.239907 GAGCTCCCCAACCTATTCAAGT 59.760 50.000 0.87 0.00 0.00 3.16
3464 3572 2.649816 AGCTCCCCAACCTATTCAAGTT 59.350 45.455 0.00 0.00 0.00 2.66
3465 3573 3.076032 AGCTCCCCAACCTATTCAAGTTT 59.924 43.478 0.00 0.00 0.00 2.66
3466 3574 3.832490 GCTCCCCAACCTATTCAAGTTTT 59.168 43.478 0.00 0.00 0.00 2.43
3467 3575 5.014202 GCTCCCCAACCTATTCAAGTTTTA 58.986 41.667 0.00 0.00 0.00 1.52
3468 3576 5.656859 GCTCCCCAACCTATTCAAGTTTTAT 59.343 40.000 0.00 0.00 0.00 1.40
3469 3577 6.405842 GCTCCCCAACCTATTCAAGTTTTATG 60.406 42.308 0.00 0.00 0.00 1.90
3470 3578 6.557568 TCCCCAACCTATTCAAGTTTTATGT 58.442 36.000 0.00 0.00 0.00 2.29
3471 3579 6.661805 TCCCCAACCTATTCAAGTTTTATGTC 59.338 38.462 0.00 0.00 0.00 3.06
3472 3580 6.663523 CCCCAACCTATTCAAGTTTTATGTCT 59.336 38.462 0.00 0.00 0.00 3.41
3473 3581 7.148069 CCCCAACCTATTCAAGTTTTATGTCTC 60.148 40.741 0.00 0.00 0.00 3.36
3474 3582 7.393234 CCCAACCTATTCAAGTTTTATGTCTCA 59.607 37.037 0.00 0.00 0.00 3.27
3475 3583 8.792633 CCAACCTATTCAAGTTTTATGTCTCAA 58.207 33.333 0.00 0.00 0.00 3.02
3482 3590 8.801715 TTCAAGTTTTATGTCTCAATTCAAGC 57.198 30.769 0.00 0.00 0.00 4.01
3483 3591 8.169977 TCAAGTTTTATGTCTCAATTCAAGCT 57.830 30.769 0.00 0.00 0.00 3.74
3484 3592 8.292448 TCAAGTTTTATGTCTCAATTCAAGCTC 58.708 33.333 0.00 0.00 0.00 4.09
3485 3593 7.750229 AGTTTTATGTCTCAATTCAAGCTCA 57.250 32.000 0.00 0.00 0.00 4.26
3486 3594 7.814642 AGTTTTATGTCTCAATTCAAGCTCAG 58.185 34.615 0.00 0.00 0.00 3.35
3487 3595 5.808042 TTATGTCTCAATTCAAGCTCAGC 57.192 39.130 0.00 0.00 0.00 4.26
3488 3596 3.413846 TGTCTCAATTCAAGCTCAGCT 57.586 42.857 0.00 0.00 42.56 4.24
3489 3597 3.332919 TGTCTCAATTCAAGCTCAGCTC 58.667 45.455 0.00 0.00 38.25 4.09
3490 3598 2.348059 GTCTCAATTCAAGCTCAGCTCG 59.652 50.000 0.00 0.00 38.25 5.03
3491 3599 2.232208 TCTCAATTCAAGCTCAGCTCGA 59.768 45.455 0.00 0.00 38.25 4.04
3492 3600 2.604011 CTCAATTCAAGCTCAGCTCGAG 59.396 50.000 8.45 8.45 45.37 4.04
3493 3601 2.028658 TCAATTCAAGCTCAGCTCGAGT 60.029 45.455 15.13 0.00 44.33 4.18
3494 3602 2.292103 ATTCAAGCTCAGCTCGAGTC 57.708 50.000 15.13 6.52 44.33 3.36
3495 3603 0.244994 TTCAAGCTCAGCTCGAGTCC 59.755 55.000 15.13 0.00 44.33 3.85
3496 3604 0.610509 TCAAGCTCAGCTCGAGTCCT 60.611 55.000 15.13 0.00 44.33 3.85
3497 3605 1.098869 CAAGCTCAGCTCGAGTCCTA 58.901 55.000 15.13 0.00 44.33 2.94
3498 3606 1.065401 CAAGCTCAGCTCGAGTCCTAG 59.935 57.143 15.13 7.94 44.33 3.02
3499 3607 0.254747 AGCTCAGCTCGAGTCCTAGT 59.745 55.000 15.13 0.00 44.33 2.57
3500 3608 0.661020 GCTCAGCTCGAGTCCTAGTC 59.339 60.000 15.13 0.00 44.33 2.59
3501 3609 1.745827 GCTCAGCTCGAGTCCTAGTCT 60.746 57.143 15.13 0.00 44.33 3.24
3502 3610 2.484065 GCTCAGCTCGAGTCCTAGTCTA 60.484 54.545 15.13 0.00 44.33 2.59
3503 3611 3.390135 CTCAGCTCGAGTCCTAGTCTAG 58.610 54.545 15.13 0.00 36.94 2.43
3504 3612 1.871039 CAGCTCGAGTCCTAGTCTAGC 59.129 57.143 15.13 0.00 36.82 3.42
3505 3613 1.202722 AGCTCGAGTCCTAGTCTAGCC 60.203 57.143 15.13 0.00 37.14 3.93
3506 3614 1.504359 CTCGAGTCCTAGTCTAGCCG 58.496 60.000 3.62 2.85 0.00 5.52
3507 3615 1.068895 CTCGAGTCCTAGTCTAGCCGA 59.931 57.143 3.62 6.56 0.00 5.54
3508 3616 1.068895 TCGAGTCCTAGTCTAGCCGAG 59.931 57.143 0.86 0.00 0.00 4.63
3509 3617 1.232119 GAGTCCTAGTCTAGCCGAGC 58.768 60.000 0.86 0.00 0.00 5.03
3510 3618 0.547075 AGTCCTAGTCTAGCCGAGCA 59.453 55.000 0.86 0.00 0.00 4.26
3511 3619 1.144093 AGTCCTAGTCTAGCCGAGCAT 59.856 52.381 0.86 0.00 0.00 3.79
3512 3620 1.538075 GTCCTAGTCTAGCCGAGCATC 59.462 57.143 0.86 0.00 0.00 3.91
3513 3621 1.143073 TCCTAGTCTAGCCGAGCATCA 59.857 52.381 0.86 0.00 33.17 3.07
3514 3622 1.957177 CCTAGTCTAGCCGAGCATCAA 59.043 52.381 0.86 0.00 33.17 2.57
3515 3623 2.287909 CCTAGTCTAGCCGAGCATCAAC 60.288 54.545 0.86 0.00 33.17 3.18
3516 3624 0.461961 AGTCTAGCCGAGCATCAACC 59.538 55.000 0.00 0.00 33.17 3.77
3517 3625 0.461961 GTCTAGCCGAGCATCAACCT 59.538 55.000 0.00 0.00 33.17 3.50
3518 3626 1.681793 GTCTAGCCGAGCATCAACCTA 59.318 52.381 0.00 0.00 33.17 3.08
3519 3627 2.100916 GTCTAGCCGAGCATCAACCTAA 59.899 50.000 0.00 0.00 33.17 2.69
3520 3628 2.764010 TCTAGCCGAGCATCAACCTAAA 59.236 45.455 0.00 0.00 33.17 1.85
3521 3629 2.489938 AGCCGAGCATCAACCTAAAA 57.510 45.000 0.00 0.00 33.17 1.52
3522 3630 3.004752 AGCCGAGCATCAACCTAAAAT 57.995 42.857 0.00 0.00 33.17 1.82
3523 3631 3.356290 AGCCGAGCATCAACCTAAAATT 58.644 40.909 0.00 0.00 33.17 1.82
3524 3632 3.129287 AGCCGAGCATCAACCTAAAATTG 59.871 43.478 0.00 0.00 33.17 2.32
3525 3633 3.128589 GCCGAGCATCAACCTAAAATTGA 59.871 43.478 0.00 0.00 40.25 2.57
3526 3634 4.731773 GCCGAGCATCAACCTAAAATTGAG 60.732 45.833 0.00 0.00 39.36 3.02
3527 3635 4.346129 CGAGCATCAACCTAAAATTGAGC 58.654 43.478 0.00 0.00 39.36 4.26
3528 3636 4.095483 CGAGCATCAACCTAAAATTGAGCT 59.905 41.667 9.76 9.76 40.28 4.09
3529 3637 5.573337 AGCATCAACCTAAAATTGAGCTC 57.427 39.130 6.82 6.82 39.36 4.09
3530 3638 4.095483 AGCATCAACCTAAAATTGAGCTCG 59.905 41.667 9.64 0.00 39.36 5.03
3531 3639 4.094887 GCATCAACCTAAAATTGAGCTCGA 59.905 41.667 6.01 6.01 39.36 4.04
3532 3640 5.391950 GCATCAACCTAAAATTGAGCTCGAA 60.392 40.000 7.99 4.39 39.36 3.71
3533 3641 6.611381 CATCAACCTAAAATTGAGCTCGAAA 58.389 36.000 7.99 0.00 39.36 3.46
3534 3642 6.627395 TCAACCTAAAATTGAGCTCGAAAA 57.373 33.333 7.99 0.00 32.34 2.29
3535 3643 6.668323 TCAACCTAAAATTGAGCTCGAAAAG 58.332 36.000 7.99 3.31 32.34 2.27
3536 3644 6.262273 TCAACCTAAAATTGAGCTCGAAAAGT 59.738 34.615 7.99 0.00 32.34 2.66
3537 3645 6.635030 ACCTAAAATTGAGCTCGAAAAGTT 57.365 33.333 7.99 0.00 0.00 2.66
3538 3646 7.039313 ACCTAAAATTGAGCTCGAAAAGTTT 57.961 32.000 7.99 11.25 0.00 2.66
3539 3647 6.918022 ACCTAAAATTGAGCTCGAAAAGTTTG 59.082 34.615 16.44 7.19 0.00 2.93
3540 3648 7.138736 CCTAAAATTGAGCTCGAAAAGTTTGA 58.861 34.615 16.44 3.71 0.00 2.69
3541 3649 7.809806 CCTAAAATTGAGCTCGAAAAGTTTGAT 59.190 33.333 16.44 1.06 0.00 2.57
3542 3650 9.825972 CTAAAATTGAGCTCGAAAAGTTTGATA 57.174 29.630 16.44 1.87 0.00 2.15
3544 3652 8.733857 AAATTGAGCTCGAAAAGTTTGATAAG 57.266 30.769 7.99 0.00 0.00 1.73
3545 3653 6.861065 TTGAGCTCGAAAAGTTTGATAAGT 57.139 33.333 9.64 0.00 0.00 2.24
3546 3654 7.956420 TTGAGCTCGAAAAGTTTGATAAGTA 57.044 32.000 9.64 0.00 0.00 2.24
3547 3655 8.547967 TTGAGCTCGAAAAGTTTGATAAGTAT 57.452 30.769 9.64 0.00 0.00 2.12
3548 3656 8.547967 TGAGCTCGAAAAGTTTGATAAGTATT 57.452 30.769 9.64 0.00 0.00 1.89
3549 3657 9.647797 TGAGCTCGAAAAGTTTGATAAGTATTA 57.352 29.630 9.64 0.00 33.48 0.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 0.601311 GCAGCTTGAGTGGTTCGAGT 60.601 55.000 0.00 0.00 39.23 4.18
1 2 0.601046 TGCAGCTTGAGTGGTTCGAG 60.601 55.000 0.00 0.00 39.91 4.04
2 3 0.880278 GTGCAGCTTGAGTGGTTCGA 60.880 55.000 0.00 0.00 0.00 3.71
3 4 0.882042 AGTGCAGCTTGAGTGGTTCG 60.882 55.000 0.00 0.00 0.00 3.95
4 5 0.871057 GAGTGCAGCTTGAGTGGTTC 59.129 55.000 0.00 0.00 0.00 3.62
5 6 0.536006 GGAGTGCAGCTTGAGTGGTT 60.536 55.000 0.00 0.00 0.00 3.67
6 7 1.072159 GGAGTGCAGCTTGAGTGGT 59.928 57.895 0.00 0.00 0.00 4.16
7 8 0.610174 TAGGAGTGCAGCTTGAGTGG 59.390 55.000 0.00 0.00 0.00 4.00
8 9 2.344950 CTTAGGAGTGCAGCTTGAGTG 58.655 52.381 0.00 0.00 0.00 3.51
9 10 1.338579 GCTTAGGAGTGCAGCTTGAGT 60.339 52.381 0.00 0.00 0.00 3.41
10 11 1.066286 AGCTTAGGAGTGCAGCTTGAG 60.066 52.381 0.00 0.00 41.24 3.02
11 12 0.979665 AGCTTAGGAGTGCAGCTTGA 59.020 50.000 0.00 0.00 41.24 3.02
12 13 1.085091 CAGCTTAGGAGTGCAGCTTG 58.915 55.000 0.00 0.00 41.24 4.01
13 14 0.035630 CCAGCTTAGGAGTGCAGCTT 60.036 55.000 0.00 0.00 41.24 3.74
14 15 1.197430 ACCAGCTTAGGAGTGCAGCT 61.197 55.000 0.00 0.00 45.02 4.24
15 16 1.023513 CACCAGCTTAGGAGTGCAGC 61.024 60.000 0.00 0.00 0.00 5.25
16 17 0.322975 ACACCAGCTTAGGAGTGCAG 59.677 55.000 0.00 0.00 33.46 4.41
17 18 0.764890 AACACCAGCTTAGGAGTGCA 59.235 50.000 0.00 0.00 32.59 4.57
18 19 1.160137 CAACACCAGCTTAGGAGTGC 58.840 55.000 0.00 0.00 32.59 4.40
19 20 2.613977 CCTCAACACCAGCTTAGGAGTG 60.614 54.545 0.00 0.00 32.59 3.51
20 21 1.625818 CCTCAACACCAGCTTAGGAGT 59.374 52.381 0.00 0.00 33.70 3.85
21 22 1.065854 CCCTCAACACCAGCTTAGGAG 60.066 57.143 0.00 0.00 0.00 3.69
22 23 0.984230 CCCTCAACACCAGCTTAGGA 59.016 55.000 0.00 0.00 0.00 2.94
23 24 0.035056 CCCCTCAACACCAGCTTAGG 60.035 60.000 0.00 0.00 0.00 2.69
24 25 0.035056 CCCCCTCAACACCAGCTTAG 60.035 60.000 0.00 0.00 0.00 2.18
25 26 0.474854 TCCCCCTCAACACCAGCTTA 60.475 55.000 0.00 0.00 0.00 3.09
26 27 1.360393 TTCCCCCTCAACACCAGCTT 61.360 55.000 0.00 0.00 0.00 3.74
27 28 1.774217 TTCCCCCTCAACACCAGCT 60.774 57.895 0.00 0.00 0.00 4.24
28 29 1.603739 GTTCCCCCTCAACACCAGC 60.604 63.158 0.00 0.00 0.00 4.85
29 30 0.478507 AAGTTCCCCCTCAACACCAG 59.521 55.000 0.00 0.00 0.00 4.00
30 31 0.184933 CAAGTTCCCCCTCAACACCA 59.815 55.000 0.00 0.00 0.00 4.17
31 32 1.179174 GCAAGTTCCCCCTCAACACC 61.179 60.000 0.00 0.00 0.00 4.16
32 33 0.178990 AGCAAGTTCCCCCTCAACAC 60.179 55.000 0.00 0.00 0.00 3.32
33 34 0.178992 CAGCAAGTTCCCCCTCAACA 60.179 55.000 0.00 0.00 0.00 3.33
34 35 0.895559 CCAGCAAGTTCCCCCTCAAC 60.896 60.000 0.00 0.00 0.00 3.18
35 36 1.460255 CCAGCAAGTTCCCCCTCAA 59.540 57.895 0.00 0.00 0.00 3.02
36 37 2.538141 CCCAGCAAGTTCCCCCTCA 61.538 63.158 0.00 0.00 0.00 3.86
37 38 2.356667 CCCAGCAAGTTCCCCCTC 59.643 66.667 0.00 0.00 0.00 4.30
38 39 2.452491 ACCCAGCAAGTTCCCCCT 60.452 61.111 0.00 0.00 0.00 4.79
39 40 2.283173 CACCCAGCAAGTTCCCCC 60.283 66.667 0.00 0.00 0.00 5.40
40 41 2.991540 GCACCCAGCAAGTTCCCC 60.992 66.667 0.00 0.00 44.79 4.81
49 50 2.608970 ATATCACCGGTGCACCCAGC 62.609 60.000 30.25 5.46 45.96 4.85
50 51 0.532862 GATATCACCGGTGCACCCAG 60.533 60.000 30.25 22.97 0.00 4.45
51 52 1.524961 GATATCACCGGTGCACCCA 59.475 57.895 30.25 12.91 0.00 4.51
52 53 1.227853 GGATATCACCGGTGCACCC 60.228 63.158 30.25 21.65 0.00 4.61
53 54 1.227853 GGGATATCACCGGTGCACC 60.228 63.158 30.25 26.78 0.00 5.01
54 55 0.249911 GAGGGATATCACCGGTGCAC 60.250 60.000 30.25 16.81 0.00 4.57
55 56 0.398522 AGAGGGATATCACCGGTGCA 60.399 55.000 30.25 19.71 0.00 4.57
56 57 0.318762 GAGAGGGATATCACCGGTGC 59.681 60.000 30.25 15.44 0.00 5.01
57 58 0.598562 CGAGAGGGATATCACCGGTG 59.401 60.000 29.26 29.26 0.00 4.94
58 59 0.185416 ACGAGAGGGATATCACCGGT 59.815 55.000 0.00 0.00 0.00 5.28
59 60 0.598562 CACGAGAGGGATATCACCGG 59.401 60.000 0.00 0.00 35.60 5.28
60 61 0.598562 CCACGAGAGGGATATCACCG 59.401 60.000 0.00 0.66 35.60 4.94
61 62 1.705873 ACCACGAGAGGGATATCACC 58.294 55.000 0.00 1.67 35.60 4.02
62 63 3.752665 TCTACCACGAGAGGGATATCAC 58.247 50.000 4.83 0.00 35.60 3.06
63 64 4.448720 TTCTACCACGAGAGGGATATCA 57.551 45.455 4.83 0.00 35.60 2.15
64 65 5.392165 CGATTTCTACCACGAGAGGGATATC 60.392 48.000 0.00 0.00 35.60 1.63
65 66 4.459685 CGATTTCTACCACGAGAGGGATAT 59.540 45.833 0.00 0.00 35.60 1.63
66 67 3.819337 CGATTTCTACCACGAGAGGGATA 59.181 47.826 0.00 0.00 35.60 2.59
67 68 2.623889 CGATTTCTACCACGAGAGGGAT 59.376 50.000 0.00 0.00 35.60 3.85
68 69 2.022195 CGATTTCTACCACGAGAGGGA 58.978 52.381 0.00 0.00 35.60 4.20
69 70 1.067212 CCGATTTCTACCACGAGAGGG 59.933 57.143 0.00 0.00 0.00 4.30
70 71 2.022195 TCCGATTTCTACCACGAGAGG 58.978 52.381 0.00 0.00 0.00 3.69
71 72 2.683867 ACTCCGATTTCTACCACGAGAG 59.316 50.000 0.00 0.00 33.21 3.20
72 73 2.681848 GACTCCGATTTCTACCACGAGA 59.318 50.000 0.00 0.00 0.00 4.04
73 74 2.422479 TGACTCCGATTTCTACCACGAG 59.578 50.000 0.00 0.00 0.00 4.18
74 75 2.439409 TGACTCCGATTTCTACCACGA 58.561 47.619 0.00 0.00 0.00 4.35
75 76 2.933495 TGACTCCGATTTCTACCACG 57.067 50.000 0.00 0.00 0.00 4.94
76 77 4.082136 ACTCTTGACTCCGATTTCTACCAC 60.082 45.833 0.00 0.00 0.00 4.16
77 78 4.082190 CACTCTTGACTCCGATTTCTACCA 60.082 45.833 0.00 0.00 0.00 3.25
78 79 4.425520 CACTCTTGACTCCGATTTCTACC 58.574 47.826 0.00 0.00 0.00 3.18
79 80 4.082136 ACCACTCTTGACTCCGATTTCTAC 60.082 45.833 0.00 0.00 0.00 2.59
80 81 4.082190 CACCACTCTTGACTCCGATTTCTA 60.082 45.833 0.00 0.00 0.00 2.10
81 82 2.900546 ACCACTCTTGACTCCGATTTCT 59.099 45.455 0.00 0.00 0.00 2.52
82 83 2.996621 CACCACTCTTGACTCCGATTTC 59.003 50.000 0.00 0.00 0.00 2.17
83 84 2.289694 CCACCACTCTTGACTCCGATTT 60.290 50.000 0.00 0.00 0.00 2.17
84 85 1.276421 CCACCACTCTTGACTCCGATT 59.724 52.381 0.00 0.00 0.00 3.34
85 86 0.898320 CCACCACTCTTGACTCCGAT 59.102 55.000 0.00 0.00 0.00 4.18
86 87 1.816863 GCCACCACTCTTGACTCCGA 61.817 60.000 0.00 0.00 0.00 4.55
87 88 1.374758 GCCACCACTCTTGACTCCG 60.375 63.158 0.00 0.00 0.00 4.63
88 89 1.374758 CGCCACCACTCTTGACTCC 60.375 63.158 0.00 0.00 0.00 3.85
89 90 1.374758 CCGCCACCACTCTTGACTC 60.375 63.158 0.00 0.00 0.00 3.36
90 91 2.743718 CCGCCACCACTCTTGACT 59.256 61.111 0.00 0.00 0.00 3.41
91 92 3.050275 GCCGCCACCACTCTTGAC 61.050 66.667 0.00 0.00 0.00 3.18
92 93 4.680237 CGCCGCCACCACTCTTGA 62.680 66.667 0.00 0.00 0.00 3.02
106 107 4.413800 AATTTCGCCGTTGCCGCC 62.414 61.111 0.00 0.00 0.00 6.13
107 108 3.171911 CAATTTCGCCGTTGCCGC 61.172 61.111 0.00 0.00 0.00 6.53
108 109 2.503809 CCAATTTCGCCGTTGCCG 60.504 61.111 0.00 0.00 0.00 5.69
109 110 2.809174 GCCAATTTCGCCGTTGCC 60.809 61.111 0.00 0.00 0.00 4.52
110 111 2.049618 TGCCAATTTCGCCGTTGC 60.050 55.556 0.00 0.00 0.00 4.17
111 112 1.732683 GGTGCCAATTTCGCCGTTG 60.733 57.895 0.00 0.00 0.00 4.10
112 113 1.460273 AAGGTGCCAATTTCGCCGTT 61.460 50.000 2.42 0.00 39.02 4.44
113 114 1.901464 AAGGTGCCAATTTCGCCGT 60.901 52.632 2.42 0.00 39.02 5.68
114 115 1.444212 CAAGGTGCCAATTTCGCCG 60.444 57.895 2.42 0.00 39.02 6.46
115 116 0.532115 ATCAAGGTGCCAATTTCGCC 59.468 50.000 0.00 0.00 0.00 5.54
116 117 1.632422 CATCAAGGTGCCAATTTCGC 58.368 50.000 0.00 0.00 0.00 4.70
117 118 1.818060 TCCATCAAGGTGCCAATTTCG 59.182 47.619 0.00 0.00 39.02 3.46
118 119 3.853475 CTTCCATCAAGGTGCCAATTTC 58.147 45.455 0.00 0.00 39.02 2.17
119 120 2.027837 GCTTCCATCAAGGTGCCAATTT 60.028 45.455 0.00 0.00 39.02 1.82
120 121 1.551883 GCTTCCATCAAGGTGCCAATT 59.448 47.619 0.00 0.00 39.02 2.32
121 122 1.188863 GCTTCCATCAAGGTGCCAAT 58.811 50.000 0.00 0.00 39.02 3.16
122 123 0.112995 AGCTTCCATCAAGGTGCCAA 59.887 50.000 0.00 0.00 41.49 4.52
123 124 1.769665 AGCTTCCATCAAGGTGCCA 59.230 52.632 0.00 0.00 41.49 4.92
124 125 4.751431 AGCTTCCATCAAGGTGCC 57.249 55.556 0.00 0.00 41.49 5.01
127 128 1.377725 CGGCAGCTTCCATCAAGGT 60.378 57.895 2.54 0.00 44.02 3.50
128 129 0.962356 AACGGCAGCTTCCATCAAGG 60.962 55.000 2.54 0.00 39.47 3.61
129 130 1.737838 TAACGGCAGCTTCCATCAAG 58.262 50.000 2.54 0.00 34.85 3.02
130 131 2.016318 CATAACGGCAGCTTCCATCAA 58.984 47.619 2.54 0.00 0.00 2.57
131 132 1.667236 CATAACGGCAGCTTCCATCA 58.333 50.000 2.54 0.00 0.00 3.07
132 133 0.308993 GCATAACGGCAGCTTCCATC 59.691 55.000 2.54 0.00 0.00 3.51
133 134 0.394216 TGCATAACGGCAGCTTCCAT 60.394 50.000 2.54 0.00 39.25 3.41
134 135 1.002746 TGCATAACGGCAGCTTCCA 60.003 52.632 2.54 0.00 39.25 3.53
135 136 1.429423 GTGCATAACGGCAGCTTCC 59.571 57.895 0.00 0.00 45.96 3.46
140 141 2.114670 CCCAGGTGCATAACGGCAG 61.115 63.158 0.00 0.00 45.96 4.85
141 142 2.045438 CCCAGGTGCATAACGGCA 60.045 61.111 0.00 0.00 42.53 5.69
142 143 2.045340 ACCCAGGTGCATAACGGC 60.045 61.111 0.00 0.00 0.00 5.68
143 144 1.748879 CCACCCAGGTGCATAACGG 60.749 63.158 11.52 0.00 44.16 4.44
144 145 2.406616 GCCACCCAGGTGCATAACG 61.407 63.158 11.52 0.00 44.16 3.18
145 146 2.406616 CGCCACCCAGGTGCATAAC 61.407 63.158 11.52 0.00 44.16 1.89
146 147 2.045438 CGCCACCCAGGTGCATAA 60.045 61.111 11.52 0.00 44.16 1.90
147 148 4.108299 CCGCCACCCAGGTGCATA 62.108 66.667 11.52 0.00 46.92 3.14
154 155 3.420206 ATATGTGCCCGCCACCCAG 62.420 63.158 2.58 0.00 44.01 4.45
155 156 3.415983 ATATGTGCCCGCCACCCA 61.416 61.111 2.58 0.00 44.01 4.51
156 157 2.906897 CATATGTGCCCGCCACCC 60.907 66.667 0.00 0.00 44.01 4.61
157 158 2.906897 CCATATGTGCCCGCCACC 60.907 66.667 1.24 0.00 44.01 4.61
158 159 3.595758 GCCATATGTGCCCGCCAC 61.596 66.667 1.24 0.00 44.90 5.01
159 160 3.651980 TTGCCATATGTGCCCGCCA 62.652 57.895 11.98 0.00 0.00 5.69
160 161 2.832661 TTGCCATATGTGCCCGCC 60.833 61.111 11.98 0.00 0.00 6.13
161 162 2.723746 CTTGCCATATGTGCCCGC 59.276 61.111 11.98 4.29 0.00 6.13
162 163 2.723746 GCTTGCCATATGTGCCCG 59.276 61.111 11.98 5.89 0.00 6.13
163 164 3.132084 GGCTTGCCATATGTGCCC 58.868 61.111 6.79 4.67 37.81 5.36
164 165 1.117142 ATGGGCTTGCCATATGTGCC 61.117 55.000 14.04 14.15 42.56 5.01
165 166 0.032952 CATGGGCTTGCCATATGTGC 59.967 55.000 14.04 5.66 0.00 4.57
166 167 1.405872 ACATGGGCTTGCCATATGTG 58.594 50.000 23.35 13.01 31.34 3.21
167 168 2.163810 AACATGGGCTTGCCATATGT 57.836 45.000 20.43 20.43 33.73 2.29
168 169 3.118702 TGAAAACATGGGCTTGCCATATG 60.119 43.478 19.48 19.48 0.00 1.78
169 170 3.106054 TGAAAACATGGGCTTGCCATAT 58.894 40.909 14.04 4.54 0.00 1.78
170 171 2.496871 CTGAAAACATGGGCTTGCCATA 59.503 45.455 14.04 2.20 0.00 2.74
171 172 1.276989 CTGAAAACATGGGCTTGCCAT 59.723 47.619 14.04 2.71 0.00 4.40
172 173 0.680618 CTGAAAACATGGGCTTGCCA 59.319 50.000 14.04 0.31 0.00 4.92
173 174 0.671472 GCTGAAAACATGGGCTTGCC 60.671 55.000 2.49 2.49 0.00 4.52
174 175 0.319405 AGCTGAAAACATGGGCTTGC 59.681 50.000 0.00 0.00 0.00 4.01
175 176 2.557924 TGTAGCTGAAAACATGGGCTTG 59.442 45.455 0.00 0.00 34.88 4.01
176 177 2.875296 TGTAGCTGAAAACATGGGCTT 58.125 42.857 0.00 0.00 34.88 4.35
177 178 2.558359 GTTGTAGCTGAAAACATGGGCT 59.442 45.455 0.00 0.00 37.08 5.19
178 179 2.352715 GGTTGTAGCTGAAAACATGGGC 60.353 50.000 0.00 0.00 0.00 5.36
179 180 2.890311 TGGTTGTAGCTGAAAACATGGG 59.110 45.455 0.00 0.00 0.00 4.00
180 181 4.582701 TTGGTTGTAGCTGAAAACATGG 57.417 40.909 0.00 0.00 0.00 3.66
181 182 5.531634 ACATTGGTTGTAGCTGAAAACATG 58.468 37.500 0.00 0.00 36.57 3.21
182 183 5.278957 GGACATTGGTTGTAGCTGAAAACAT 60.279 40.000 0.00 0.00 39.18 2.71
183 184 4.037446 GGACATTGGTTGTAGCTGAAAACA 59.963 41.667 0.00 0.00 39.18 2.83
184 185 4.546570 GGACATTGGTTGTAGCTGAAAAC 58.453 43.478 0.00 0.00 39.18 2.43
185 186 3.572255 GGGACATTGGTTGTAGCTGAAAA 59.428 43.478 0.00 0.00 39.18 2.29
186 187 3.153919 GGGACATTGGTTGTAGCTGAAA 58.846 45.455 0.00 0.00 39.18 2.69
187 188 2.107378 TGGGACATTGGTTGTAGCTGAA 59.893 45.455 0.00 0.00 39.18 3.02
188 189 1.702401 TGGGACATTGGTTGTAGCTGA 59.298 47.619 0.00 0.00 39.18 4.26
189 190 2.198827 TGGGACATTGGTTGTAGCTG 57.801 50.000 0.00 0.00 39.18 4.24
190 191 2.969821 TTGGGACATTGGTTGTAGCT 57.030 45.000 0.00 0.00 39.18 3.32
191 192 4.329462 TTTTTGGGACATTGGTTGTAGC 57.671 40.909 0.00 0.00 39.18 3.58
192 193 6.987386 TGTATTTTTGGGACATTGGTTGTAG 58.013 36.000 0.00 0.00 39.18 2.74
193 194 6.978674 TGTATTTTTGGGACATTGGTTGTA 57.021 33.333 0.00 0.00 39.18 2.41
194 195 5.878406 TGTATTTTTGGGACATTGGTTGT 57.122 34.783 0.00 0.00 42.79 3.32
195 196 8.839310 TTAATGTATTTTTGGGACATTGGTTG 57.161 30.769 9.20 0.00 39.30 3.77
196 197 9.278978 GTTTAATGTATTTTTGGGACATTGGTT 57.721 29.630 9.20 0.00 39.30 3.67
197 198 8.432805 TGTTTAATGTATTTTTGGGACATTGGT 58.567 29.630 9.20 0.00 39.30 3.67
198 199 8.716909 GTGTTTAATGTATTTTTGGGACATTGG 58.283 33.333 9.20 0.00 39.30 3.16
199 200 9.265901 TGTGTTTAATGTATTTTTGGGACATTG 57.734 29.630 9.20 0.00 39.30 2.82
202 203 9.265901 CAATGTGTTTAATGTATTTTTGGGACA 57.734 29.630 0.00 0.00 0.00 4.02
203 204 9.482627 TCAATGTGTTTAATGTATTTTTGGGAC 57.517 29.630 0.00 0.00 0.00 4.46
204 205 9.482627 GTCAATGTGTTTAATGTATTTTTGGGA 57.517 29.630 0.00 0.00 0.00 4.37
205 206 9.265901 TGTCAATGTGTTTAATGTATTTTTGGG 57.734 29.630 0.00 0.00 0.00 4.12
220 221 9.846248 GAAGCTAGATTAATTTGTCAATGTGTT 57.154 29.630 0.00 0.00 0.00 3.32
221 222 9.236006 AGAAGCTAGATTAATTTGTCAATGTGT 57.764 29.630 0.00 0.00 0.00 3.72
222 223 9.499585 CAGAAGCTAGATTAATTTGTCAATGTG 57.500 33.333 0.00 0.00 0.00 3.21
223 224 8.680903 CCAGAAGCTAGATTAATTTGTCAATGT 58.319 33.333 0.00 0.00 0.00 2.71
224 225 7.646922 GCCAGAAGCTAGATTAATTTGTCAATG 59.353 37.037 0.00 0.00 38.99 2.82
225 226 7.710896 GCCAGAAGCTAGATTAATTTGTCAAT 58.289 34.615 0.00 0.00 38.99 2.57
226 227 7.088589 GCCAGAAGCTAGATTAATTTGTCAA 57.911 36.000 0.00 0.00 38.99 3.18
227 228 6.683974 GCCAGAAGCTAGATTAATTTGTCA 57.316 37.500 0.00 0.00 38.99 3.58
242 243 0.391228 GCCTAGTCCTAGCCAGAAGC 59.609 60.000 0.00 0.00 44.25 3.86
243 244 1.044611 GGCCTAGTCCTAGCCAGAAG 58.955 60.000 0.00 0.00 32.95 2.85
244 245 0.637195 AGGCCTAGTCCTAGCCAGAA 59.363 55.000 1.29 0.00 33.95 3.02
245 246 1.530891 TAGGCCTAGTCCTAGCCAGA 58.469 55.000 8.91 0.00 37.66 3.86
246 247 2.175202 CATAGGCCTAGTCCTAGCCAG 58.825 57.143 19.33 0.00 41.63 4.85
247 248 1.827647 GCATAGGCCTAGTCCTAGCCA 60.828 57.143 19.33 0.00 41.63 4.75
248 249 0.899019 GCATAGGCCTAGTCCTAGCC 59.101 60.000 19.33 2.23 41.63 3.93
249 250 1.633774 TGCATAGGCCTAGTCCTAGC 58.366 55.000 19.33 14.30 41.63 3.42
250 251 4.899352 AATTGCATAGGCCTAGTCCTAG 57.101 45.455 19.33 4.87 41.63 3.02
251 252 5.403512 ACTAATTGCATAGGCCTAGTCCTA 58.596 41.667 19.33 1.19 42.45 2.94
252 253 4.235372 ACTAATTGCATAGGCCTAGTCCT 58.765 43.478 19.33 0.00 40.13 3.85
253 254 4.625607 ACTAATTGCATAGGCCTAGTCC 57.374 45.455 19.33 9.19 40.13 3.85
254 255 6.347859 AGTACTAATTGCATAGGCCTAGTC 57.652 41.667 19.33 12.41 40.13 2.59
255 256 7.455008 ACATAGTACTAATTGCATAGGCCTAGT 59.545 37.037 19.33 12.01 40.13 2.57
256 257 7.841956 ACATAGTACTAATTGCATAGGCCTAG 58.158 38.462 19.33 11.31 40.13 3.02
257 258 7.792364 ACATAGTACTAATTGCATAGGCCTA 57.208 36.000 16.60 16.60 40.13 3.93
258 259 6.688073 ACATAGTACTAATTGCATAGGCCT 57.312 37.500 11.78 11.78 40.13 5.19
259 260 6.530534 CGTACATAGTACTAATTGCATAGGCC 59.469 42.308 6.70 0.00 40.13 5.19
260 261 7.088905 ACGTACATAGTACTAATTGCATAGGC 58.911 38.462 6.70 0.00 41.68 3.93
261 262 9.552114 GTACGTACATAGTACTAATTGCATAGG 57.448 37.037 20.67 0.74 40.75 2.57
262 263 9.552114 GGTACGTACATAGTACTAATTGCATAG 57.448 37.037 26.02 0.00 42.81 2.23
263 264 9.065798 TGGTACGTACATAGTACTAATTGCATA 57.934 33.333 26.02 0.00 42.81 3.14
264 265 7.944061 TGGTACGTACATAGTACTAATTGCAT 58.056 34.615 26.02 0.00 42.81 3.96
265 266 7.332213 TGGTACGTACATAGTACTAATTGCA 57.668 36.000 26.02 7.62 42.81 4.08
266 267 8.697067 CATTGGTACGTACATAGTACTAATTGC 58.303 37.037 26.02 5.14 46.68 3.56
267 268 9.955208 TCATTGGTACGTACATAGTACTAATTG 57.045 33.333 26.02 4.32 46.68 2.32
270 271 9.177608 ACTTCATTGGTACGTACATAGTACTAA 57.822 33.333 26.02 5.86 45.10 2.24
271 272 8.737168 ACTTCATTGGTACGTACATAGTACTA 57.263 34.615 26.02 4.77 42.81 1.82
272 273 7.466455 CGACTTCATTGGTACGTACATAGTACT 60.466 40.741 26.02 0.00 42.81 2.73
273 274 6.630443 CGACTTCATTGGTACGTACATAGTAC 59.370 42.308 26.02 9.02 42.58 2.73
274 275 6.538381 TCGACTTCATTGGTACGTACATAGTA 59.462 38.462 26.02 6.63 0.00 1.82
275 276 5.355071 TCGACTTCATTGGTACGTACATAGT 59.645 40.000 26.02 17.28 0.00 2.12
276 277 5.813717 TCGACTTCATTGGTACGTACATAG 58.186 41.667 26.02 14.69 0.00 2.23
277 278 5.816449 TCGACTTCATTGGTACGTACATA 57.184 39.130 26.02 13.87 0.00 2.29
278 279 4.707030 TCGACTTCATTGGTACGTACAT 57.293 40.909 26.02 10.17 0.00 2.29
279 280 4.417506 CATCGACTTCATTGGTACGTACA 58.582 43.478 26.02 8.12 0.00 2.90
280 281 3.242248 GCATCGACTTCATTGGTACGTAC 59.758 47.826 17.56 17.56 0.00 3.67
281 282 3.129813 AGCATCGACTTCATTGGTACGTA 59.870 43.478 0.00 0.00 0.00 3.57
282 283 2.094182 AGCATCGACTTCATTGGTACGT 60.094 45.455 0.00 0.00 0.00 3.57
283 284 2.540515 AGCATCGACTTCATTGGTACG 58.459 47.619 0.00 0.00 0.00 3.67
284 285 4.946784 AAAGCATCGACTTCATTGGTAC 57.053 40.909 0.00 0.00 0.00 3.34
285 286 7.624360 AATTAAAGCATCGACTTCATTGGTA 57.376 32.000 0.00 0.00 0.00 3.25
286 287 6.515272 AATTAAAGCATCGACTTCATTGGT 57.485 33.333 0.00 0.00 0.00 3.67
287 288 8.909708 TTTAATTAAAGCATCGACTTCATTGG 57.090 30.769 6.54 0.00 0.00 3.16
290 291 9.061610 CGTTTTTAATTAAAGCATCGACTTCAT 57.938 29.630 10.40 0.00 0.00 2.57
291 292 8.283992 TCGTTTTTAATTAAAGCATCGACTTCA 58.716 29.630 10.40 0.00 0.00 3.02
292 293 8.564766 GTCGTTTTTAATTAAAGCATCGACTTC 58.435 33.333 27.43 16.01 40.05 3.01
293 294 8.431020 GTCGTTTTTAATTAAAGCATCGACTT 57.569 30.769 27.43 0.00 40.05 3.01
294 295 7.803724 AGTCGTTTTTAATTAAAGCATCGACT 58.196 30.769 29.26 29.26 45.45 4.18
295 296 9.698617 ATAGTCGTTTTTAATTAAAGCATCGAC 57.301 29.630 27.44 27.44 42.31 4.20
296 297 9.910511 GATAGTCGTTTTTAATTAAAGCATCGA 57.089 29.630 10.40 14.31 0.00 3.59
297 298 9.155053 GGATAGTCGTTTTTAATTAAAGCATCG 57.845 33.333 10.40 12.69 0.00 3.84
298 299 9.997482 TGGATAGTCGTTTTTAATTAAAGCATC 57.003 29.630 10.40 7.16 0.00 3.91
300 301 9.005777 ACTGGATAGTCGTTTTTAATTAAAGCA 57.994 29.630 10.40 0.09 28.79 3.91
301 302 9.274065 CACTGGATAGTCGTTTTTAATTAAAGC 57.726 33.333 10.40 7.41 34.07 3.51
314 315 8.728833 GCTAATTAGTATACACTGGATAGTCGT 58.271 37.037 13.91 0.00 36.14 4.34
315 316 8.727910 TGCTAATTAGTATACACTGGATAGTCG 58.272 37.037 13.91 0.00 36.14 4.18
317 318 8.524487 GCTGCTAATTAGTATACACTGGATAGT 58.476 37.037 13.91 0.00 36.14 2.12
318 319 8.744652 AGCTGCTAATTAGTATACACTGGATAG 58.255 37.037 13.91 1.66 36.14 2.08
319 320 8.651589 AGCTGCTAATTAGTATACACTGGATA 57.348 34.615 13.91 0.00 36.14 2.59
320 321 7.546250 AGCTGCTAATTAGTATACACTGGAT 57.454 36.000 13.91 0.00 36.14 3.41
321 322 6.978674 AGCTGCTAATTAGTATACACTGGA 57.021 37.500 13.91 0.00 36.14 3.86
322 323 9.542462 TTTAAGCTGCTAATTAGTATACACTGG 57.458 33.333 13.91 0.00 36.14 4.00
324 325 9.543783 GGTTTAAGCTGCTAATTAGTATACACT 57.456 33.333 13.91 2.79 38.91 3.55
325 326 8.485591 CGGTTTAAGCTGCTAATTAGTATACAC 58.514 37.037 13.91 3.17 0.00 2.90
326 327 7.654520 CCGGTTTAAGCTGCTAATTAGTATACA 59.345 37.037 13.91 2.79 0.00 2.29
327 328 7.654923 ACCGGTTTAAGCTGCTAATTAGTATAC 59.345 37.037 13.91 5.21 0.00 1.47
328 329 7.729116 ACCGGTTTAAGCTGCTAATTAGTATA 58.271 34.615 13.91 0.00 0.00 1.47
329 330 6.589135 ACCGGTTTAAGCTGCTAATTAGTAT 58.411 36.000 13.91 0.00 0.00 2.12
330 331 5.981174 ACCGGTTTAAGCTGCTAATTAGTA 58.019 37.500 13.91 8.65 0.00 1.82
331 332 4.840271 ACCGGTTTAAGCTGCTAATTAGT 58.160 39.130 13.91 0.00 0.00 2.24
332 333 5.501897 CGAACCGGTTTAAGCTGCTAATTAG 60.502 44.000 23.22 8.20 0.00 1.73
333 334 4.330620 CGAACCGGTTTAAGCTGCTAATTA 59.669 41.667 23.22 0.00 0.00 1.40
334 335 3.126343 CGAACCGGTTTAAGCTGCTAATT 59.874 43.478 23.22 0.00 0.00 1.40
335 336 2.676342 CGAACCGGTTTAAGCTGCTAAT 59.324 45.455 23.22 0.00 0.00 1.73
336 337 2.070783 CGAACCGGTTTAAGCTGCTAA 58.929 47.619 23.22 0.00 0.00 3.09
337 338 1.673626 CCGAACCGGTTTAAGCTGCTA 60.674 52.381 23.22 0.00 42.73 3.49
338 339 0.953960 CCGAACCGGTTTAAGCTGCT 60.954 55.000 23.22 0.00 42.73 4.24
339 340 1.500396 CCGAACCGGTTTAAGCTGC 59.500 57.895 23.22 5.51 42.73 5.25
352 353 2.964438 TATGCGACCGCCATCCGAAC 62.964 60.000 12.08 0.00 41.09 3.95
353 354 2.299503 TTATGCGACCGCCATCCGAA 62.300 55.000 12.08 0.00 41.09 4.30
354 355 2.787567 TTATGCGACCGCCATCCGA 61.788 57.895 12.08 0.00 41.09 4.55
355 356 2.279851 TTATGCGACCGCCATCCG 60.280 61.111 12.08 0.00 41.09 4.18
356 357 1.498865 CTGTTATGCGACCGCCATCC 61.499 60.000 12.08 0.00 41.09 3.51
357 358 1.498865 CCTGTTATGCGACCGCCATC 61.499 60.000 12.08 1.22 41.09 3.51
358 359 1.523711 CCTGTTATGCGACCGCCAT 60.524 57.895 12.08 8.00 41.09 4.40
359 360 1.966901 ATCCTGTTATGCGACCGCCA 61.967 55.000 12.08 1.69 41.09 5.69
360 361 0.032952 TATCCTGTTATGCGACCGCC 59.967 55.000 12.08 0.00 41.09 6.13
361 362 1.419374 CTATCCTGTTATGCGACCGC 58.581 55.000 7.53 7.53 42.35 5.68
362 363 1.340248 ACCTATCCTGTTATGCGACCG 59.660 52.381 0.00 0.00 0.00 4.79
363 364 2.102588 ACACCTATCCTGTTATGCGACC 59.897 50.000 0.00 0.00 0.00 4.79
364 365 3.454371 ACACCTATCCTGTTATGCGAC 57.546 47.619 0.00 0.00 0.00 5.19
365 366 4.481368 AAACACCTATCCTGTTATGCGA 57.519 40.909 0.00 0.00 31.43 5.10
366 367 4.750098 CCTAAACACCTATCCTGTTATGCG 59.250 45.833 0.00 0.00 31.43 4.73
367 368 5.063880 CCCTAAACACCTATCCTGTTATGC 58.936 45.833 0.00 0.00 31.43 3.14
368 369 6.494666 TCCCTAAACACCTATCCTGTTATG 57.505 41.667 0.00 0.00 31.43 1.90
369 370 5.071923 GCTCCCTAAACACCTATCCTGTTAT 59.928 44.000 0.00 0.00 31.43 1.89
370 371 4.407945 GCTCCCTAAACACCTATCCTGTTA 59.592 45.833 0.00 0.00 31.43 2.41
371 372 3.200165 GCTCCCTAAACACCTATCCTGTT 59.800 47.826 0.00 0.00 33.09 3.16
372 373 2.772515 GCTCCCTAAACACCTATCCTGT 59.227 50.000 0.00 0.00 0.00 4.00
373 374 3.041946 AGCTCCCTAAACACCTATCCTG 58.958 50.000 0.00 0.00 0.00 3.86
374 375 3.423058 AGCTCCCTAAACACCTATCCT 57.577 47.619 0.00 0.00 0.00 3.24
375 376 5.280062 GGATAAGCTCCCTAAACACCTATCC 60.280 48.000 0.00 0.00 38.19 2.59
376 377 5.544562 AGGATAAGCTCCCTAAACACCTATC 59.455 44.000 0.89 0.00 46.27 2.08
377 378 5.477913 AGGATAAGCTCCCTAAACACCTAT 58.522 41.667 0.89 0.00 46.27 2.57
378 379 4.892198 AGGATAAGCTCCCTAAACACCTA 58.108 43.478 0.89 0.00 46.27 3.08
379 380 3.712218 GAGGATAAGCTCCCTAAACACCT 59.288 47.826 2.66 0.00 46.27 4.00
380 381 3.712218 AGAGGATAAGCTCCCTAAACACC 59.288 47.826 2.66 0.00 46.27 4.16
381 382 5.360649 AAGAGGATAAGCTCCCTAAACAC 57.639 43.478 2.66 0.00 46.27 3.32
382 383 6.388619 AAAAGAGGATAAGCTCCCTAAACA 57.611 37.500 2.66 0.00 46.27 2.83
403 404 2.376109 TCACAACCGGTAAGGCAAAAA 58.624 42.857 8.00 0.00 46.52 1.94
404 405 2.054232 TCACAACCGGTAAGGCAAAA 57.946 45.000 8.00 0.00 46.52 2.44
405 406 2.279935 ATCACAACCGGTAAGGCAAA 57.720 45.000 8.00 0.00 46.52 3.68
406 407 2.156098 GAATCACAACCGGTAAGGCAA 58.844 47.619 8.00 0.00 46.52 4.52
407 408 1.349688 AGAATCACAACCGGTAAGGCA 59.650 47.619 8.00 0.00 46.52 4.75
408 409 1.737793 CAGAATCACAACCGGTAAGGC 59.262 52.381 8.00 0.00 46.52 4.35
410 411 2.673368 GCTCAGAATCACAACCGGTAAG 59.327 50.000 8.00 6.45 0.00 2.34
411 412 2.037902 TGCTCAGAATCACAACCGGTAA 59.962 45.455 8.00 0.00 0.00 2.85
412 413 1.621317 TGCTCAGAATCACAACCGGTA 59.379 47.619 8.00 0.00 0.00 4.02
413 414 0.396435 TGCTCAGAATCACAACCGGT 59.604 50.000 0.00 0.00 0.00 5.28
414 415 1.399440 CATGCTCAGAATCACAACCGG 59.601 52.381 0.00 0.00 0.00 5.28
415 416 2.079158 ACATGCTCAGAATCACAACCG 58.921 47.619 0.00 0.00 0.00 4.44
416 417 4.256920 AGTACATGCTCAGAATCACAACC 58.743 43.478 0.00 0.00 0.00 3.77
417 418 5.869753 AAGTACATGCTCAGAATCACAAC 57.130 39.130 0.00 0.00 0.00 3.32
418 419 6.882610 AAAAGTACATGCTCAGAATCACAA 57.117 33.333 0.00 0.00 0.00 3.33
419 420 8.565896 AATAAAAGTACATGCTCAGAATCACA 57.434 30.769 0.00 0.00 0.00 3.58
420 421 9.846248 AAAATAAAAGTACATGCTCAGAATCAC 57.154 29.630 0.00 0.00 0.00 3.06
436 437 9.366216 ACGAAGCAAAGAAAAGAAAATAAAAGT 57.634 25.926 0.00 0.00 0.00 2.66
439 440 9.965748 CAAACGAAGCAAAGAAAAGAAAATAAA 57.034 25.926 0.00 0.00 0.00 1.40
440 441 8.113675 GCAAACGAAGCAAAGAAAAGAAAATAA 58.886 29.630 0.00 0.00 0.00 1.40
441 442 7.514435 CGCAAACGAAGCAAAGAAAAGAAAATA 60.514 33.333 0.00 0.00 43.93 1.40
442 443 6.477742 GCAAACGAAGCAAAGAAAAGAAAAT 58.522 32.000 0.00 0.00 0.00 1.82
443 444 5.443955 CGCAAACGAAGCAAAGAAAAGAAAA 60.444 36.000 0.00 0.00 43.93 2.29
444 445 4.031201 CGCAAACGAAGCAAAGAAAAGAAA 59.969 37.500 0.00 0.00 43.93 2.52
445 446 3.545873 CGCAAACGAAGCAAAGAAAAGAA 59.454 39.130 0.00 0.00 43.93 2.52
446 447 3.105203 CGCAAACGAAGCAAAGAAAAGA 58.895 40.909 0.00 0.00 43.93 2.52
447 448 3.472304 CGCAAACGAAGCAAAGAAAAG 57.528 42.857 0.00 0.00 43.93 2.27
460 461 2.268298 AGGTATTACAGCTCGCAAACG 58.732 47.619 0.00 0.00 42.01 3.60
461 462 4.680171 AAAGGTATTACAGCTCGCAAAC 57.320 40.909 0.00 0.00 32.46 2.93
462 463 6.995511 AATAAAGGTATTACAGCTCGCAAA 57.004 33.333 0.00 0.00 32.46 3.68
463 464 7.473027 GTAATAAAGGTATTACAGCTCGCAA 57.527 36.000 10.38 0.00 46.19 4.85
476 477 9.656040 TCGAAATAGCACAAAGTAATAAAGGTA 57.344 29.630 0.00 0.00 0.00 3.08
477 478 8.556213 TCGAAATAGCACAAAGTAATAAAGGT 57.444 30.769 0.00 0.00 0.00 3.50
478 479 8.879759 TCTCGAAATAGCACAAAGTAATAAAGG 58.120 33.333 0.00 0.00 0.00 3.11
479 480 9.690434 GTCTCGAAATAGCACAAAGTAATAAAG 57.310 33.333 0.00 0.00 0.00 1.85
480 481 9.431887 AGTCTCGAAATAGCACAAAGTAATAAA 57.568 29.630 0.00 0.00 0.00 1.40
481 482 8.997621 AGTCTCGAAATAGCACAAAGTAATAA 57.002 30.769 0.00 0.00 0.00 1.40
482 483 8.997621 AAGTCTCGAAATAGCACAAAGTAATA 57.002 30.769 0.00 0.00 0.00 0.98
483 484 7.907214 AAGTCTCGAAATAGCACAAAGTAAT 57.093 32.000 0.00 0.00 0.00 1.89
484 485 7.724305 AAAGTCTCGAAATAGCACAAAGTAA 57.276 32.000 0.00 0.00 0.00 2.24
485 486 7.724305 AAAAGTCTCGAAATAGCACAAAGTA 57.276 32.000 0.00 0.00 0.00 2.24
486 487 6.619801 AAAAGTCTCGAAATAGCACAAAGT 57.380 33.333 0.00 0.00 0.00 2.66
487 488 9.612620 ATTAAAAAGTCTCGAAATAGCACAAAG 57.387 29.630 0.00 0.00 0.00 2.77
499 500 9.594478 TGCAGTCATATTATTAAAAAGTCTCGA 57.406 29.630 0.00 0.00 0.00 4.04
502 503 9.956720 GCATGCAGTCATATTATTAAAAAGTCT 57.043 29.630 14.21 0.00 0.00 3.24
503 504 9.734620 TGCATGCAGTCATATTATTAAAAAGTC 57.265 29.630 18.46 0.00 0.00 3.01
512 513 9.403583 TCATAATGATGCATGCAGTCATATTAT 57.596 29.630 29.43 24.69 32.60 1.28
513 514 8.795842 TCATAATGATGCATGCAGTCATATTA 57.204 30.769 29.43 23.98 32.60 0.98
514 515 7.696992 TCATAATGATGCATGCAGTCATATT 57.303 32.000 29.43 23.09 32.60 1.28
515 516 7.707104 CATCATAATGATGCATGCAGTCATAT 58.293 34.615 29.43 23.60 46.37 1.78
516 517 7.083875 CATCATAATGATGCATGCAGTCATA 57.916 36.000 29.43 20.72 46.37 2.15
517 518 5.954335 CATCATAATGATGCATGCAGTCAT 58.046 37.500 26.69 26.52 46.37 3.06
518 519 5.371115 CATCATAATGATGCATGCAGTCA 57.629 39.130 26.69 25.65 46.37 3.41
529 530 2.303890 TCGGCCTCTGCATCATAATGAT 59.696 45.455 0.00 0.00 37.65 2.45
530 531 1.693606 TCGGCCTCTGCATCATAATGA 59.306 47.619 0.00 0.00 40.13 2.57
531 532 2.174363 TCGGCCTCTGCATCATAATG 57.826 50.000 0.00 0.00 40.13 1.90
532 533 2.551721 CCTTCGGCCTCTGCATCATAAT 60.552 50.000 0.00 0.00 40.13 1.28
533 534 1.202687 CCTTCGGCCTCTGCATCATAA 60.203 52.381 0.00 0.00 40.13 1.90
534 535 0.394192 CCTTCGGCCTCTGCATCATA 59.606 55.000 0.00 0.00 40.13 2.15
535 536 1.147824 CCTTCGGCCTCTGCATCAT 59.852 57.895 0.00 0.00 40.13 2.45
536 537 2.586245 CCTTCGGCCTCTGCATCA 59.414 61.111 0.00 0.00 40.13 3.07
537 538 2.899339 GCCTTCGGCCTCTGCATC 60.899 66.667 0.00 0.00 44.06 3.91
552 553 1.531739 TTTGGAAATGGAGGCGTGCC 61.532 55.000 1.67 1.67 0.00 5.01
553 554 0.316841 TTTTGGAAATGGAGGCGTGC 59.683 50.000 0.00 0.00 0.00 5.34
554 555 2.810439 TTTTTGGAAATGGAGGCGTG 57.190 45.000 0.00 0.00 0.00 5.34
573 574 4.139038 TCCCGTTTAAGCTGCTACTTTTT 58.861 39.130 0.90 0.00 0.00 1.94
574 575 3.746940 TCCCGTTTAAGCTGCTACTTTT 58.253 40.909 0.90 0.00 0.00 2.27
575 576 3.412237 TCCCGTTTAAGCTGCTACTTT 57.588 42.857 0.90 0.00 0.00 2.66
576 577 3.412237 TTCCCGTTTAAGCTGCTACTT 57.588 42.857 0.90 0.00 0.00 2.24
577 578 3.532542 GATTCCCGTTTAAGCTGCTACT 58.467 45.455 0.90 0.00 0.00 2.57
578 579 2.612672 GGATTCCCGTTTAAGCTGCTAC 59.387 50.000 0.90 0.00 0.00 3.58
579 580 2.237643 TGGATTCCCGTTTAAGCTGCTA 59.762 45.455 0.90 0.00 34.29 3.49
580 581 1.004277 TGGATTCCCGTTTAAGCTGCT 59.996 47.619 0.00 0.00 34.29 4.24
581 582 1.401905 CTGGATTCCCGTTTAAGCTGC 59.598 52.381 0.00 0.00 34.29 5.25
582 583 2.017049 CCTGGATTCCCGTTTAAGCTG 58.983 52.381 0.00 0.00 34.29 4.24
583 584 1.682087 GCCTGGATTCCCGTTTAAGCT 60.682 52.381 0.00 0.00 34.29 3.74
584 585 0.738975 GCCTGGATTCCCGTTTAAGC 59.261 55.000 0.00 0.00 34.29 3.09
585 586 2.122783 TGCCTGGATTCCCGTTTAAG 57.877 50.000 0.00 0.00 34.29 1.85
586 587 2.164338 GTTGCCTGGATTCCCGTTTAA 58.836 47.619 0.00 0.00 34.29 1.52
587 588 1.353022 AGTTGCCTGGATTCCCGTTTA 59.647 47.619 0.00 0.00 34.29 2.01
588 589 0.112412 AGTTGCCTGGATTCCCGTTT 59.888 50.000 0.00 0.00 34.29 3.60
589 590 0.988832 TAGTTGCCTGGATTCCCGTT 59.011 50.000 0.00 0.00 34.29 4.44
600 601 1.310933 GCACATGCAGCTAGTTGCCT 61.311 55.000 26.24 15.64 43.43 4.75
644 645 4.746611 GCACGTTATATGTACCTGGGTAAC 59.253 45.833 0.59 0.00 31.86 2.50
645 646 4.202243 GGCACGTTATATGTACCTGGGTAA 60.202 45.833 0.59 0.00 31.86 2.85
646 647 3.321682 GGCACGTTATATGTACCTGGGTA 59.678 47.826 0.00 0.00 0.00 3.69
647 648 2.103601 GGCACGTTATATGTACCTGGGT 59.896 50.000 0.00 0.00 0.00 4.51
648 649 2.549349 GGGCACGTTATATGTACCTGGG 60.549 54.545 0.00 0.00 0.00 4.45
649 650 2.103432 TGGGCACGTTATATGTACCTGG 59.897 50.000 0.00 0.00 0.00 4.45
650 651 3.462483 TGGGCACGTTATATGTACCTG 57.538 47.619 0.00 0.00 0.00 4.00
651 652 3.453353 ACTTGGGCACGTTATATGTACCT 59.547 43.478 0.00 0.00 0.00 3.08
680 681 1.743252 GCCAAGTCTTCTCCTGCCG 60.743 63.158 0.00 0.00 0.00 5.69
682 683 1.809547 GAAAGCCAAGTCTTCTCCTGC 59.190 52.381 0.00 0.00 0.00 4.85
683 684 2.072298 CGAAAGCCAAGTCTTCTCCTG 58.928 52.381 0.00 0.00 0.00 3.86
713 714 8.451908 ACCACCAAGTCTTTATCTTTATATGC 57.548 34.615 0.00 0.00 0.00 3.14
725 726 8.588290 TGCATATATAAAACCACCAAGTCTTT 57.412 30.769 0.00 0.00 0.00 2.52
727 728 7.573710 TCTGCATATATAAAACCACCAAGTCT 58.426 34.615 0.00 0.00 0.00 3.24
732 733 8.052748 AGACTTTCTGCATATATAAAACCACCA 58.947 33.333 0.00 0.00 0.00 4.17
733 734 8.451908 AGACTTTCTGCATATATAAAACCACC 57.548 34.615 0.00 0.00 0.00 4.61
734 735 9.937175 GAAGACTTTCTGCATATATAAAACCAC 57.063 33.333 0.00 0.00 0.00 4.16
751 752 7.522374 CATAAAACCTGCTAGTGAAGACTTTC 58.478 38.462 0.00 0.00 33.21 2.62
801 802 3.628942 GCATAGAACATGCCAGTGATCAA 59.371 43.478 0.00 0.00 39.01 2.57
802 803 3.208594 GCATAGAACATGCCAGTGATCA 58.791 45.455 0.00 0.00 39.01 2.92
829 830 6.307077 TCTTTACAGACATTGTATGAACGACG 59.693 38.462 17.76 0.00 41.72 5.12
885 891 1.609580 CGAGGGGAATCAAACGAACCA 60.610 52.381 0.00 0.00 0.00 3.67
916 922 5.059134 TCATGGCCATGTGTATTTGGATA 57.941 39.130 38.18 16.99 39.72 2.59
954 1048 8.958119 TGGTTTATATGGACATTACTGAAGAC 57.042 34.615 0.00 0.00 0.00 3.01
961 1055 6.016276 CCCAGCTTGGTTTATATGGACATTAC 60.016 42.308 0.00 0.00 35.17 1.89
962 1056 6.068010 CCCAGCTTGGTTTATATGGACATTA 58.932 40.000 0.00 0.00 35.17 1.90
963 1057 4.895297 CCCAGCTTGGTTTATATGGACATT 59.105 41.667 0.00 0.00 35.17 2.71
964 1058 4.167892 TCCCAGCTTGGTTTATATGGACAT 59.832 41.667 3.35 0.00 35.17 3.06
1011 1118 6.456501 AGGTGTAGAGTTGACAGTTGAATAC 58.543 40.000 0.00 0.00 0.00 1.89
1036 1143 8.370940 ACACTCATATTGTTTCTTCTTCTCTCA 58.629 33.333 0.00 0.00 0.00 3.27
1104 1211 4.436998 CCGTGACTGTCGCCTCCC 62.437 72.222 15.13 0.00 0.00 4.30
1119 1226 0.107456 CAGATTGATGTCCCCTCCCG 59.893 60.000 0.00 0.00 0.00 5.14
1120 1227 1.141858 GACAGATTGATGTCCCCTCCC 59.858 57.143 0.00 0.00 43.12 4.30
1123 1230 1.482593 GACGACAGATTGATGTCCCCT 59.517 52.381 0.00 0.00 45.56 4.79
1162 1269 1.002366 GCACTGTAACTGATCTGCCG 58.998 55.000 0.00 0.00 0.00 5.69
1181 1288 4.472691 TTGAACACGCAAAGATGAAGAG 57.527 40.909 0.00 0.00 0.00 2.85
1192 1299 2.083774 GGATCTGGAATTGAACACGCA 58.916 47.619 0.00 0.00 0.00 5.24
1194 1301 1.665679 CGGGATCTGGAATTGAACACG 59.334 52.381 0.00 0.00 0.00 4.49
1197 1304 2.017049 CCACGGGATCTGGAATTGAAC 58.983 52.381 0.00 0.00 0.00 3.18
1199 1306 1.486310 CTCCACGGGATCTGGAATTGA 59.514 52.381 3.95 0.00 37.36 2.57
1206 1313 0.833287 AATGGTCTCCACGGGATCTG 59.167 55.000 0.00 0.00 35.80 2.90
1214 1321 3.732048 TCCCCTTTTAATGGTCTCCAC 57.268 47.619 0.00 0.00 35.80 4.02
1255 1362 0.675633 GGCCGGCGATAAGGTAGTAA 59.324 55.000 22.54 0.00 0.00 2.24
1333 1440 1.302832 AGAGGCGGCAACAAAGGAG 60.303 57.895 13.08 0.00 0.00 3.69
1339 1446 4.577677 TTGGCAGAGGCGGCAACA 62.578 61.111 13.08 0.00 45.48 3.33
1393 1500 1.010935 CGAGCTCTTCTTGCAGCGAA 61.011 55.000 12.85 0.00 40.84 4.70
1415 1522 2.109799 CTCGGCCGCATGGAAGAT 59.890 61.111 23.51 0.00 37.49 2.40
1501 1608 2.902457 ATGGTTCCACGTCACCCCC 61.902 63.158 5.78 0.00 31.24 5.40
1534 1641 1.615165 TAAACTGCGCCATCCCGGTA 61.615 55.000 4.18 0.00 36.97 4.02
1561 1668 2.202932 CGGGCCAACTCTCCGATG 60.203 66.667 4.39 0.00 45.96 3.84
1678 1785 4.115199 ATTGGGGACGGCTGGAGC 62.115 66.667 0.00 0.00 41.14 4.70
1729 1836 0.313672 TGCTTTTGATGCGGTTGACC 59.686 50.000 0.00 0.00 0.00 4.02
1766 1873 3.740397 CACAGTGCATGGCCGGTG 61.740 66.667 1.90 0.00 0.00 4.94
1768 1875 2.563798 AAACACAGTGCATGGCCGG 61.564 57.895 0.00 0.00 0.00 6.13
1778 1885 0.740737 GCAACTGCCTCAAACACAGT 59.259 50.000 0.00 0.00 46.27 3.55
2030 2137 2.103143 CCGCAGCTCGTCGATCTT 59.897 61.111 0.00 0.00 36.19 2.40
2083 2190 1.213537 CATGCCAAGGTTTCGCCAG 59.786 57.895 0.00 0.00 40.61 4.85
2157 2264 1.961277 CTTGGCAGCGTCGTCCTTT 60.961 57.895 0.00 0.00 0.00 3.11
2182 2289 1.896660 ATTGCAAGGGACGCACGTT 60.897 52.632 4.94 0.00 39.59 3.99
2260 2367 4.462483 GTGAGGTGGGATTTTGCTAATTCA 59.538 41.667 5.41 0.00 0.00 2.57
2324 2431 3.245158 ACATATCCTTCCATGCATCTGGG 60.245 47.826 6.50 0.76 36.89 4.45
2325 2432 4.030314 ACATATCCTTCCATGCATCTGG 57.970 45.455 0.00 0.00 37.66 3.86
2417 2524 9.241919 GGGAGTACTAAAGTTCTACTACTTTCT 57.758 37.037 0.00 0.00 43.04 2.52
2421 2528 7.345691 GGAGGGAGTACTAAAGTTCTACTACT 58.654 42.308 0.00 0.00 0.00 2.57
2425 2533 4.946772 ACGGAGGGAGTACTAAAGTTCTAC 59.053 45.833 0.00 0.00 0.00 2.59
2428 2536 3.130164 GGACGGAGGGAGTACTAAAGTTC 59.870 52.174 0.00 0.00 0.00 3.01
2440 2548 1.368374 AGAATTTTGGGACGGAGGGA 58.632 50.000 0.00 0.00 0.00 4.20
2441 2549 1.818674 CAAGAATTTTGGGACGGAGGG 59.181 52.381 0.00 0.00 0.00 4.30
2442 2550 2.488153 GACAAGAATTTTGGGACGGAGG 59.512 50.000 0.00 0.00 0.00 4.30
2443 2551 3.412386 AGACAAGAATTTTGGGACGGAG 58.588 45.455 0.00 0.00 0.00 4.63
2444 2552 3.502123 AGACAAGAATTTTGGGACGGA 57.498 42.857 0.00 0.00 0.00 4.69
2445 2553 5.001232 TCTAAGACAAGAATTTTGGGACGG 58.999 41.667 0.00 0.00 0.00 4.79
2446 2554 6.743575 ATCTAAGACAAGAATTTTGGGACG 57.256 37.500 5.68 0.00 0.00 4.79
2447 2555 8.360390 ACAAATCTAAGACAAGAATTTTGGGAC 58.640 33.333 0.00 0.00 33.04 4.46
2448 2556 8.477419 ACAAATCTAAGACAAGAATTTTGGGA 57.523 30.769 0.00 0.00 33.04 4.37
2449 2557 8.579863 AGACAAATCTAAGACAAGAATTTTGGG 58.420 33.333 0.00 0.00 33.04 4.12
2508 2616 9.570468 AGATTTGTCTAGATACGGATGTAACTA 57.430 33.333 0.00 0.00 35.55 2.24
2509 2617 8.466617 AGATTTGTCTAGATACGGATGTAACT 57.533 34.615 0.00 0.00 37.45 2.24
2512 2620 9.788889 TCTTAGATTTGTCTAGATACGGATGTA 57.211 33.333 0.00 0.00 34.45 2.29
2513 2621 8.569641 GTCTTAGATTTGTCTAGATACGGATGT 58.430 37.037 0.00 0.00 0.00 3.06
2514 2622 8.568794 TGTCTTAGATTTGTCTAGATACGGATG 58.431 37.037 0.00 0.00 0.00 3.51
2515 2623 8.693120 TGTCTTAGATTTGTCTAGATACGGAT 57.307 34.615 0.00 0.00 0.00 4.18
2516 2624 8.515695 TTGTCTTAGATTTGTCTAGATACGGA 57.484 34.615 0.00 0.00 0.00 4.69
2517 2625 8.622157 TCTTGTCTTAGATTTGTCTAGATACGG 58.378 37.037 0.00 0.00 0.00 4.02
2525 2633 9.354673 TCCAAATTTCTTGTCTTAGATTTGTCT 57.645 29.630 0.00 0.00 28.79 3.41
2526 2634 9.965824 TTCCAAATTTCTTGTCTTAGATTTGTC 57.034 29.630 0.00 0.00 28.79 3.18
2527 2635 9.750125 GTTCCAAATTTCTTGTCTTAGATTTGT 57.250 29.630 0.00 0.00 28.79 2.83
2528 2636 9.748708 TGTTCCAAATTTCTTGTCTTAGATTTG 57.251 29.630 0.00 0.00 29.84 2.32
2529 2637 9.971922 CTGTTCCAAATTTCTTGTCTTAGATTT 57.028 29.630 0.00 0.00 0.00 2.17
2530 2638 9.354673 TCTGTTCCAAATTTCTTGTCTTAGATT 57.645 29.630 0.00 0.00 0.00 2.40
2531 2639 8.924511 TCTGTTCCAAATTTCTTGTCTTAGAT 57.075 30.769 0.00 0.00 0.00 1.98
2532 2640 7.445402 CCTCTGTTCCAAATTTCTTGTCTTAGA 59.555 37.037 0.00 0.00 0.00 2.10
2533 2641 7.308830 CCCTCTGTTCCAAATTTCTTGTCTTAG 60.309 40.741 0.00 0.00 0.00 2.18
2534 2642 6.490040 CCCTCTGTTCCAAATTTCTTGTCTTA 59.510 38.462 0.00 0.00 0.00 2.10
2535 2643 5.302823 CCCTCTGTTCCAAATTTCTTGTCTT 59.697 40.000 0.00 0.00 0.00 3.01
2536 2644 4.829492 CCCTCTGTTCCAAATTTCTTGTCT 59.171 41.667 0.00 0.00 0.00 3.41
2537 2645 4.827284 TCCCTCTGTTCCAAATTTCTTGTC 59.173 41.667 0.00 0.00 0.00 3.18
2538 2646 4.803452 TCCCTCTGTTCCAAATTTCTTGT 58.197 39.130 0.00 0.00 0.00 3.16
2539 2647 4.829492 ACTCCCTCTGTTCCAAATTTCTTG 59.171 41.667 0.00 0.00 0.00 3.02
2540 2648 5.066913 ACTCCCTCTGTTCCAAATTTCTT 57.933 39.130 0.00 0.00 0.00 2.52
2541 2649 4.731313 ACTCCCTCTGTTCCAAATTTCT 57.269 40.909 0.00 0.00 0.00 2.52
2542 2650 5.313712 TGTACTCCCTCTGTTCCAAATTTC 58.686 41.667 0.00 0.00 0.00 2.17
2543 2651 5.319043 TGTACTCCCTCTGTTCCAAATTT 57.681 39.130 0.00 0.00 0.00 1.82
2544 2652 4.993705 TGTACTCCCTCTGTTCCAAATT 57.006 40.909 0.00 0.00 0.00 1.82
2545 2653 6.636454 TTATGTACTCCCTCTGTTCCAAAT 57.364 37.500 0.00 0.00 0.00 2.32
2546 2654 6.636454 ATTATGTACTCCCTCTGTTCCAAA 57.364 37.500 0.00 0.00 0.00 3.28
2547 2655 6.012858 ACAATTATGTACTCCCTCTGTTCCAA 60.013 38.462 0.00 0.00 38.24 3.53
2548 2656 5.487488 ACAATTATGTACTCCCTCTGTTCCA 59.513 40.000 0.00 0.00 38.24 3.53
2549 2657 5.990668 ACAATTATGTACTCCCTCTGTTCC 58.009 41.667 0.00 0.00 38.24 3.62
2554 2662 9.780186 GCTTTAATACAATTATGTACTCCCTCT 57.220 33.333 0.00 0.00 44.47 3.69
2555 2663 9.555727 TGCTTTAATACAATTATGTACTCCCTC 57.444 33.333 0.00 0.00 44.47 4.30
2556 2664 9.561069 CTGCTTTAATACAATTATGTACTCCCT 57.439 33.333 0.00 0.00 44.47 4.20
2557 2665 8.290325 GCTGCTTTAATACAATTATGTACTCCC 58.710 37.037 0.00 0.00 44.47 4.30
2558 2666 8.009974 CGCTGCTTTAATACAATTATGTACTCC 58.990 37.037 0.00 0.00 44.47 3.85
2559 2667 8.761497 TCGCTGCTTTAATACAATTATGTACTC 58.239 33.333 0.00 0.00 44.47 2.59
2560 2668 8.548721 GTCGCTGCTTTAATACAATTATGTACT 58.451 33.333 0.00 0.00 44.47 2.73
2561 2669 8.332464 TGTCGCTGCTTTAATACAATTATGTAC 58.668 33.333 0.00 0.00 44.47 2.90
2562 2670 8.426881 TGTCGCTGCTTTAATACAATTATGTA 57.573 30.769 0.00 0.00 45.67 2.29
2563 2671 7.315247 TGTCGCTGCTTTAATACAATTATGT 57.685 32.000 0.00 0.00 43.74 2.29
2564 2672 8.786937 ATTGTCGCTGCTTTAATACAATTATG 57.213 30.769 0.00 0.00 34.76 1.90
2566 2674 9.929722 CTAATTGTCGCTGCTTTAATACAATTA 57.070 29.630 14.31 14.31 42.56 1.40
2567 2675 8.458843 ACTAATTGTCGCTGCTTTAATACAATT 58.541 29.630 13.71 13.71 44.92 2.32
2568 2676 7.985476 ACTAATTGTCGCTGCTTTAATACAAT 58.015 30.769 0.00 0.00 38.75 2.71
2569 2677 7.372451 ACTAATTGTCGCTGCTTTAATACAA 57.628 32.000 0.00 0.00 0.00 2.41
2570 2678 6.978343 ACTAATTGTCGCTGCTTTAATACA 57.022 33.333 0.00 0.00 0.00 2.29
2571 2679 8.009974 CCATACTAATTGTCGCTGCTTTAATAC 58.990 37.037 0.00 0.00 0.00 1.89
2572 2680 7.929245 TCCATACTAATTGTCGCTGCTTTAATA 59.071 33.333 0.00 0.00 0.00 0.98
2573 2681 6.765989 TCCATACTAATTGTCGCTGCTTTAAT 59.234 34.615 0.00 0.00 0.00 1.40
2574 2682 6.110033 TCCATACTAATTGTCGCTGCTTTAA 58.890 36.000 0.00 0.00 0.00 1.52
2575 2683 5.666462 TCCATACTAATTGTCGCTGCTTTA 58.334 37.500 0.00 0.00 0.00 1.85
2576 2684 4.513442 TCCATACTAATTGTCGCTGCTTT 58.487 39.130 0.00 0.00 0.00 3.51
2577 2685 4.137116 TCCATACTAATTGTCGCTGCTT 57.863 40.909 0.00 0.00 0.00 3.91
2578 2686 3.819564 TCCATACTAATTGTCGCTGCT 57.180 42.857 0.00 0.00 0.00 4.24
2579 2687 3.121944 CGATCCATACTAATTGTCGCTGC 59.878 47.826 0.00 0.00 0.00 5.25
2580 2688 3.675225 CCGATCCATACTAATTGTCGCTG 59.325 47.826 0.00 0.00 0.00 5.18
2581 2689 3.572682 TCCGATCCATACTAATTGTCGCT 59.427 43.478 0.00 0.00 0.00 4.93
2582 2690 3.909430 TCCGATCCATACTAATTGTCGC 58.091 45.455 0.00 0.00 0.00 5.19
2583 2691 4.917998 CACTCCGATCCATACTAATTGTCG 59.082 45.833 0.00 0.00 0.00 4.35
2584 2692 6.085555 TCACTCCGATCCATACTAATTGTC 57.914 41.667 0.00 0.00 0.00 3.18
2585 2693 5.598830 ACTCACTCCGATCCATACTAATTGT 59.401 40.000 0.00 0.00 0.00 2.71
2586 2694 6.090483 ACTCACTCCGATCCATACTAATTG 57.910 41.667 0.00 0.00 0.00 2.32
2587 2695 7.834881 TTACTCACTCCGATCCATACTAATT 57.165 36.000 0.00 0.00 0.00 1.40
2588 2696 9.702253 ATATTACTCACTCCGATCCATACTAAT 57.298 33.333 0.00 0.00 0.00 1.73
2589 2697 8.957466 CATATTACTCACTCCGATCCATACTAA 58.043 37.037 0.00 0.00 0.00 2.24
2590 2698 8.107729 ACATATTACTCACTCCGATCCATACTA 58.892 37.037 0.00 0.00 0.00 1.82
2591 2699 6.948886 ACATATTACTCACTCCGATCCATACT 59.051 38.462 0.00 0.00 0.00 2.12
2592 2700 7.159322 ACATATTACTCACTCCGATCCATAC 57.841 40.000 0.00 0.00 0.00 2.39
2593 2701 8.107729 AGTACATATTACTCACTCCGATCCATA 58.892 37.037 0.00 0.00 0.00 2.74
2594 2702 6.948886 AGTACATATTACTCACTCCGATCCAT 59.051 38.462 0.00 0.00 0.00 3.41
2595 2703 6.304624 AGTACATATTACTCACTCCGATCCA 58.695 40.000 0.00 0.00 0.00 3.41
2596 2704 6.127952 GGAGTACATATTACTCACTCCGATCC 60.128 46.154 18.54 0.00 44.17 3.36
2597 2705 6.844254 GGAGTACATATTACTCACTCCGATC 58.156 44.000 18.54 0.00 44.17 3.69
2598 2706 6.821031 GGAGTACATATTACTCACTCCGAT 57.179 41.667 18.54 0.00 44.17 4.18
2602 2710 7.768807 ATCCAGGAGTACATATTACTCACTC 57.231 40.000 18.54 8.10 44.18 3.51
2603 2711 9.830186 AATATCCAGGAGTACATATTACTCACT 57.170 33.333 18.54 13.28 44.18 3.41
2605 2713 8.957466 CGAATATCCAGGAGTACATATTACTCA 58.043 37.037 18.54 6.45 44.18 3.41
2606 2714 8.958506 ACGAATATCCAGGAGTACATATTACTC 58.041 37.037 12.79 12.79 42.28 2.59
2607 2715 8.880991 ACGAATATCCAGGAGTACATATTACT 57.119 34.615 0.00 0.00 0.00 2.24
2608 2716 9.924650 AAACGAATATCCAGGAGTACATATTAC 57.075 33.333 0.00 0.00 0.00 1.89
2610 2718 9.273016 CAAAACGAATATCCAGGAGTACATATT 57.727 33.333 0.00 0.00 0.00 1.28
2611 2719 7.878127 CCAAAACGAATATCCAGGAGTACATAT 59.122 37.037 0.00 0.00 0.00 1.78
2612 2720 7.214381 CCAAAACGAATATCCAGGAGTACATA 58.786 38.462 0.00 0.00 0.00 2.29
2613 2721 6.055588 CCAAAACGAATATCCAGGAGTACAT 58.944 40.000 0.00 0.00 0.00 2.29
2614 2722 5.424757 CCAAAACGAATATCCAGGAGTACA 58.575 41.667 0.00 0.00 0.00 2.90
2615 2723 4.272748 GCCAAAACGAATATCCAGGAGTAC 59.727 45.833 0.00 0.00 0.00 2.73
2616 2724 4.080807 TGCCAAAACGAATATCCAGGAGTA 60.081 41.667 0.00 0.00 0.00 2.59
2617 2725 3.279434 GCCAAAACGAATATCCAGGAGT 58.721 45.455 0.00 0.00 0.00 3.85
2618 2726 3.278574 TGCCAAAACGAATATCCAGGAG 58.721 45.455 0.00 0.00 0.00 3.69
2619 2727 3.358111 TGCCAAAACGAATATCCAGGA 57.642 42.857 0.00 0.00 0.00 3.86
2620 2728 3.443681 AGTTGCCAAAACGAATATCCAGG 59.556 43.478 0.00 0.00 0.00 4.45
2621 2729 4.701956 AGTTGCCAAAACGAATATCCAG 57.298 40.909 0.00 0.00 0.00 3.86
2622 2730 4.638421 CCTAGTTGCCAAAACGAATATCCA 59.362 41.667 0.00 0.00 0.00 3.41
2623 2731 4.638865 ACCTAGTTGCCAAAACGAATATCC 59.361 41.667 0.00 0.00 0.00 2.59
2624 2732 5.220796 GGACCTAGTTGCCAAAACGAATATC 60.221 44.000 0.00 0.00 0.00 1.63
2625 2733 4.638865 GGACCTAGTTGCCAAAACGAATAT 59.361 41.667 0.00 0.00 0.00 1.28
2626 2734 4.004982 GGACCTAGTTGCCAAAACGAATA 58.995 43.478 0.00 0.00 0.00 1.75
2627 2735 2.817844 GGACCTAGTTGCCAAAACGAAT 59.182 45.455 0.00 0.00 0.00 3.34
2628 2736 2.223745 GGACCTAGTTGCCAAAACGAA 58.776 47.619 0.00 0.00 0.00 3.85
2629 2737 1.141254 TGGACCTAGTTGCCAAAACGA 59.859 47.619 0.00 0.00 0.00 3.85
2630 2738 1.535462 CTGGACCTAGTTGCCAAAACG 59.465 52.381 0.00 0.00 0.00 3.60
2631 2739 1.886542 CCTGGACCTAGTTGCCAAAAC 59.113 52.381 0.00 0.00 0.00 2.43
2632 2740 1.497286 ACCTGGACCTAGTTGCCAAAA 59.503 47.619 0.00 0.00 0.00 2.44
2633 2741 1.145571 ACCTGGACCTAGTTGCCAAA 58.854 50.000 0.00 0.00 0.00 3.28
2634 2742 0.400213 CACCTGGACCTAGTTGCCAA 59.600 55.000 0.00 0.00 0.00 4.52
2635 2743 0.472925 TCACCTGGACCTAGTTGCCA 60.473 55.000 0.00 0.00 0.00 4.92
2636 2744 0.912486 ATCACCTGGACCTAGTTGCC 59.088 55.000 0.00 0.00 0.00 4.52
2637 2745 1.834263 AGATCACCTGGACCTAGTTGC 59.166 52.381 0.00 0.00 0.00 4.17
2638 2746 2.099921 CGAGATCACCTGGACCTAGTTG 59.900 54.545 0.00 0.00 0.00 3.16
2639 2747 2.025226 TCGAGATCACCTGGACCTAGTT 60.025 50.000 0.00 0.00 0.00 2.24
2640 2748 1.564818 TCGAGATCACCTGGACCTAGT 59.435 52.381 0.00 0.00 0.00 2.57
2641 2749 2.350057 TCGAGATCACCTGGACCTAG 57.650 55.000 0.00 0.00 0.00 3.02
2642 2750 2.820728 TTCGAGATCACCTGGACCTA 57.179 50.000 0.00 0.00 28.94 3.08
2643 2751 1.938585 TTTCGAGATCACCTGGACCT 58.061 50.000 0.00 0.00 28.94 3.85
2644 2752 2.432510 AGATTTCGAGATCACCTGGACC 59.567 50.000 17.33 0.00 28.94 4.46
2645 2753 3.452474 CAGATTTCGAGATCACCTGGAC 58.548 50.000 17.33 0.00 28.94 4.02
2646 2754 2.159043 GCAGATTTCGAGATCACCTGGA 60.159 50.000 17.33 0.00 0.00 3.86
2647 2755 2.208431 GCAGATTTCGAGATCACCTGG 58.792 52.381 17.33 0.00 0.00 4.45
2648 2756 2.606725 GTGCAGATTTCGAGATCACCTG 59.393 50.000 17.33 8.63 0.00 4.00
2649 2757 2.419297 GGTGCAGATTTCGAGATCACCT 60.419 50.000 17.33 0.00 39.36 4.00
2650 2758 1.936547 GGTGCAGATTTCGAGATCACC 59.063 52.381 17.33 12.77 36.20 4.02
2651 2759 2.621338 TGGTGCAGATTTCGAGATCAC 58.379 47.619 17.33 9.75 0.00 3.06
2652 2760 3.264947 CTTGGTGCAGATTTCGAGATCA 58.735 45.455 17.33 0.00 0.00 2.92
2653 2761 2.031437 GCTTGGTGCAGATTTCGAGATC 59.969 50.000 7.85 7.85 42.31 2.75
2654 2762 2.012673 GCTTGGTGCAGATTTCGAGAT 58.987 47.619 0.00 0.00 42.31 2.75
2655 2763 1.442769 GCTTGGTGCAGATTTCGAGA 58.557 50.000 0.00 0.00 42.31 4.04
2656 2764 0.095935 CGCTTGGTGCAGATTTCGAG 59.904 55.000 0.00 0.00 43.06 4.04
2657 2765 1.911293 GCGCTTGGTGCAGATTTCGA 61.911 55.000 0.00 0.00 43.06 3.71
2658 2766 1.512734 GCGCTTGGTGCAGATTTCG 60.513 57.895 0.00 0.00 43.06 3.46
2659 2767 0.179179 GAGCGCTTGGTGCAGATTTC 60.179 55.000 13.26 0.00 42.00 2.17
2660 2768 0.607489 AGAGCGCTTGGTGCAGATTT 60.607 50.000 13.26 0.00 42.00 2.17
2661 2769 1.002868 AGAGCGCTTGGTGCAGATT 60.003 52.632 13.26 0.00 42.00 2.40
2662 2770 1.449246 GAGAGCGCTTGGTGCAGAT 60.449 57.895 13.26 0.00 42.00 2.90
2663 2771 2.047844 GAGAGCGCTTGGTGCAGA 60.048 61.111 13.26 0.00 42.00 4.26
2664 2772 2.357881 TGAGAGCGCTTGGTGCAG 60.358 61.111 13.26 0.00 42.00 4.41
2665 2773 2.666190 GTGAGAGCGCTTGGTGCA 60.666 61.111 13.26 2.71 42.00 4.57
2666 2774 3.782244 CGTGAGAGCGCTTGGTGC 61.782 66.667 13.26 0.00 39.59 5.01
2667 2775 3.114616 CCGTGAGAGCGCTTGGTG 61.115 66.667 13.26 0.45 0.00 4.17
2668 2776 3.288308 CTCCGTGAGAGCGCTTGGT 62.288 63.158 13.26 0.00 35.31 3.67
2669 2777 2.290122 ATCTCCGTGAGAGCGCTTGG 62.290 60.000 13.26 9.32 42.26 3.61
2670 2778 1.140589 ATCTCCGTGAGAGCGCTTG 59.859 57.895 13.26 0.00 42.26 4.01
2671 2779 1.140589 CATCTCCGTGAGAGCGCTT 59.859 57.895 13.26 0.58 42.26 4.68
2672 2780 2.804167 CATCTCCGTGAGAGCGCT 59.196 61.111 11.27 11.27 42.26 5.92
2673 2781 2.959071 GCATCTCCGTGAGAGCGC 60.959 66.667 0.00 0.00 42.26 5.92
2674 2782 1.875813 GTGCATCTCCGTGAGAGCG 60.876 63.158 9.09 4.89 42.26 5.03
2675 2783 1.080995 GTGTGCATCTCCGTGAGAGC 61.081 60.000 9.09 11.53 42.26 4.09
2676 2784 0.529833 AGTGTGCATCTCCGTGAGAG 59.470 55.000 9.09 0.00 42.26 3.20
2677 2785 0.244721 CAGTGTGCATCTCCGTGAGA 59.755 55.000 6.14 6.14 43.20 3.27
2678 2786 1.357258 GCAGTGTGCATCTCCGTGAG 61.357 60.000 0.00 0.00 44.26 3.51
2679 2787 1.374631 GCAGTGTGCATCTCCGTGA 60.375 57.895 0.00 0.00 44.26 4.35
2680 2788 3.171987 GCAGTGTGCATCTCCGTG 58.828 61.111 0.00 0.00 44.26 4.94
2689 2797 5.708948 TGTTCATAATTAAAGGCAGTGTGC 58.291 37.500 0.00 0.00 44.08 4.57
2690 2798 7.814107 ACATTGTTCATAATTAAAGGCAGTGTG 59.186 33.333 9.21 0.00 0.00 3.82
2691 2799 7.895759 ACATTGTTCATAATTAAAGGCAGTGT 58.104 30.769 0.00 0.00 0.00 3.55
2692 2800 8.761575 AACATTGTTCATAATTAAAGGCAGTG 57.238 30.769 0.00 0.00 0.00 3.66
2693 2801 8.806146 AGAACATTGTTCATAATTAAAGGCAGT 58.194 29.630 26.73 2.38 0.00 4.40
2694 2802 9.294030 GAGAACATTGTTCATAATTAAAGGCAG 57.706 33.333 26.73 0.00 0.00 4.85
2695 2803 9.023962 AGAGAACATTGTTCATAATTAAAGGCA 57.976 29.630 26.73 0.00 0.00 4.75
2707 2815 8.239314 GCATTGAAGAATAGAGAACATTGTTCA 58.761 33.333 26.73 10.66 41.32 3.18
2708 2816 8.457261 AGCATTGAAGAATAGAGAACATTGTTC 58.543 33.333 19.64 19.64 36.63 3.18
2709 2817 8.345724 AGCATTGAAGAATAGAGAACATTGTT 57.654 30.769 0.63 0.63 0.00 2.83
2710 2818 7.828223 AGAGCATTGAAGAATAGAGAACATTGT 59.172 33.333 0.00 0.00 0.00 2.71
2711 2819 8.123575 CAGAGCATTGAAGAATAGAGAACATTG 58.876 37.037 0.00 0.00 0.00 2.82
2712 2820 7.828223 ACAGAGCATTGAAGAATAGAGAACATT 59.172 33.333 0.00 0.00 0.00 2.71
2713 2821 7.337167 ACAGAGCATTGAAGAATAGAGAACAT 58.663 34.615 0.00 0.00 0.00 2.71
2714 2822 6.705302 ACAGAGCATTGAAGAATAGAGAACA 58.295 36.000 0.00 0.00 0.00 3.18
2715 2823 6.257630 GGACAGAGCATTGAAGAATAGAGAAC 59.742 42.308 0.00 0.00 0.00 3.01
2716 2824 6.155910 AGGACAGAGCATTGAAGAATAGAGAA 59.844 38.462 0.00 0.00 0.00 2.87
2717 2825 5.660417 AGGACAGAGCATTGAAGAATAGAGA 59.340 40.000 0.00 0.00 0.00 3.10
2718 2826 5.916318 AGGACAGAGCATTGAAGAATAGAG 58.084 41.667 0.00 0.00 0.00 2.43
2719 2827 5.946942 AGGACAGAGCATTGAAGAATAGA 57.053 39.130 0.00 0.00 0.00 1.98
2720 2828 6.998968 AAAGGACAGAGCATTGAAGAATAG 57.001 37.500 0.00 0.00 0.00 1.73
2721 2829 6.535150 CGTAAAGGACAGAGCATTGAAGAATA 59.465 38.462 0.00 0.00 0.00 1.75
2722 2830 5.352569 CGTAAAGGACAGAGCATTGAAGAAT 59.647 40.000 0.00 0.00 0.00 2.40
2723 2831 4.690748 CGTAAAGGACAGAGCATTGAAGAA 59.309 41.667 0.00 0.00 0.00 2.52
2724 2832 4.021456 TCGTAAAGGACAGAGCATTGAAGA 60.021 41.667 0.00 0.00 0.00 2.87
2725 2833 4.245660 TCGTAAAGGACAGAGCATTGAAG 58.754 43.478 0.00 0.00 0.00 3.02
2726 2834 4.265904 TCGTAAAGGACAGAGCATTGAA 57.734 40.909 0.00 0.00 0.00 2.69
2727 2835 3.953712 TCGTAAAGGACAGAGCATTGA 57.046 42.857 0.00 0.00 0.00 2.57
2728 2836 3.745975 TGTTCGTAAAGGACAGAGCATTG 59.254 43.478 0.00 0.00 0.00 2.82
2729 2837 4.002906 TGTTCGTAAAGGACAGAGCATT 57.997 40.909 0.00 0.00 0.00 3.56
2730 2838 3.678056 TGTTCGTAAAGGACAGAGCAT 57.322 42.857 0.00 0.00 0.00 3.79
2731 2839 3.678056 ATGTTCGTAAAGGACAGAGCA 57.322 42.857 0.00 0.00 0.00 4.26
2732 2840 5.358298 AAAATGTTCGTAAAGGACAGAGC 57.642 39.130 0.00 0.00 0.00 4.09
2754 2862 1.964223 TGGCGCCAGGAACATTAAAAA 59.036 42.857 29.03 0.00 0.00 1.94
2755 2863 1.621992 TGGCGCCAGGAACATTAAAA 58.378 45.000 29.03 0.00 0.00 1.52
2756 2864 1.476085 CATGGCGCCAGGAACATTAAA 59.524 47.619 36.51 6.13 0.00 1.52
2757 2865 1.102154 CATGGCGCCAGGAACATTAA 58.898 50.000 36.51 6.76 0.00 1.40
2758 2866 0.254462 TCATGGCGCCAGGAACATTA 59.746 50.000 39.07 17.69 33.63 1.90
2759 2867 0.396139 ATCATGGCGCCAGGAACATT 60.396 50.000 43.01 26.78 40.19 2.71
2760 2868 0.473755 TATCATGGCGCCAGGAACAT 59.526 50.000 43.01 30.40 40.19 2.71
2761 2869 0.463654 GTATCATGGCGCCAGGAACA 60.464 55.000 43.01 31.21 40.19 3.18
2762 2870 1.166531 GGTATCATGGCGCCAGGAAC 61.167 60.000 43.01 35.64 40.19 3.62
2763 2871 1.148273 GGTATCATGGCGCCAGGAA 59.852 57.895 43.01 29.25 40.19 3.36
2764 2872 2.043604 CTGGTATCATGGCGCCAGGA 62.044 60.000 41.86 41.86 43.39 3.86
2765 2873 1.598962 CTGGTATCATGGCGCCAGG 60.599 63.158 34.28 34.28 43.39 4.45
2766 2874 4.054085 CTGGTATCATGGCGCCAG 57.946 61.111 35.36 25.00 41.89 4.85
2767 2875 0.833949 TTACTGGTATCATGGCGCCA 59.166 50.000 34.80 34.80 0.00 5.69
2768 2876 2.185004 ATTACTGGTATCATGGCGCC 57.815 50.000 22.73 22.73 0.00 6.53
2769 2877 4.568152 AAAATTACTGGTATCATGGCGC 57.432 40.909 0.00 0.00 0.00 6.53
2770 2878 7.648142 ACATTAAAATTACTGGTATCATGGCG 58.352 34.615 0.00 0.00 0.00 5.69
2771 2879 9.816354 AAACATTAAAATTACTGGTATCATGGC 57.184 29.630 0.00 0.00 0.00 4.40
2785 2893 8.113675 GCGACACTGAACAAAAACATTAAAATT 58.886 29.630 0.00 0.00 0.00 1.82
2786 2894 7.254286 GGCGACACTGAACAAAAACATTAAAAT 60.254 33.333 0.00 0.00 0.00 1.82
2787 2895 6.035112 GGCGACACTGAACAAAAACATTAAAA 59.965 34.615 0.00 0.00 0.00 1.52
2788 2896 5.517054 GGCGACACTGAACAAAAACATTAAA 59.483 36.000 0.00 0.00 0.00 1.52
2789 2897 5.038033 GGCGACACTGAACAAAAACATTAA 58.962 37.500 0.00 0.00 0.00 1.40
2790 2898 4.096532 TGGCGACACTGAACAAAAACATTA 59.903 37.500 0.00 0.00 33.40 1.90
2791 2899 3.119316 TGGCGACACTGAACAAAAACATT 60.119 39.130 0.00 0.00 33.40 2.71
2792 2900 2.425312 TGGCGACACTGAACAAAAACAT 59.575 40.909 0.00 0.00 33.40 2.71
2793 2901 1.813178 TGGCGACACTGAACAAAAACA 59.187 42.857 0.00 0.00 33.40 2.83
2794 2902 2.553079 TGGCGACACTGAACAAAAAC 57.447 45.000 0.00 0.00 33.40 2.43
2806 2914 9.251286 ACAAGGTTGTATAGATACATGGCGACA 62.251 40.741 0.00 0.00 42.32 4.35
2807 2915 5.135508 AGGTTGTATAGATACATGGCGAC 57.864 43.478 3.28 0.00 42.32 5.19
2808 2916 5.069914 ACAAGGTTGTATAGATACATGGCGA 59.930 40.000 3.28 0.00 42.32 5.54
2809 2917 5.297547 ACAAGGTTGTATAGATACATGGCG 58.702 41.667 3.28 0.00 42.32 5.69
2810 2918 7.667557 TCTACAAGGTTGTATAGATACATGGC 58.332 38.462 3.08 0.00 42.32 4.40
2823 2931 8.088365 GCAAGGAAAATAATTCTACAAGGTTGT 58.912 33.333 0.24 0.24 44.86 3.32
2824 2932 8.087750 TGCAAGGAAAATAATTCTACAAGGTTG 58.912 33.333 0.00 0.00 0.00 3.77
2825 2933 8.189119 TGCAAGGAAAATAATTCTACAAGGTT 57.811 30.769 0.00 0.00 0.00 3.50
2826 2934 7.775053 TGCAAGGAAAATAATTCTACAAGGT 57.225 32.000 0.00 0.00 0.00 3.50
2827 2935 8.925700 GTTTGCAAGGAAAATAATTCTACAAGG 58.074 33.333 0.00 0.00 0.00 3.61
2828 2936 8.925700 GGTTTGCAAGGAAAATAATTCTACAAG 58.074 33.333 0.00 0.00 0.00 3.16
2829 2937 8.424918 TGGTTTGCAAGGAAAATAATTCTACAA 58.575 29.630 0.00 0.00 0.00 2.41
2830 2938 7.957002 TGGTTTGCAAGGAAAATAATTCTACA 58.043 30.769 0.00 0.00 0.00 2.74
2836 2944 9.956640 TCATTTATGGTTTGCAAGGAAAATAAT 57.043 25.926 0.00 0.00 0.00 1.28
2837 2945 9.956640 ATCATTTATGGTTTGCAAGGAAAATAA 57.043 25.926 0.00 0.00 0.00 1.40
2842 2950 9.639563 TCTATATCATTTATGGTTTGCAAGGAA 57.360 29.630 0.00 0.00 0.00 3.36
2843 2951 9.066892 GTCTATATCATTTATGGTTTGCAAGGA 57.933 33.333 0.00 0.00 0.00 3.36
2844 2952 8.849168 TGTCTATATCATTTATGGTTTGCAAGG 58.151 33.333 0.00 0.00 0.00 3.61
2847 2955 9.183368 TGTTGTCTATATCATTTATGGTTTGCA 57.817 29.630 0.00 0.00 0.00 4.08
2848 2956 9.450807 GTGTTGTCTATATCATTTATGGTTTGC 57.549 33.333 0.00 0.00 0.00 3.68
2856 2964 9.890629 AAGCAGAAGTGTTGTCTATATCATTTA 57.109 29.630 0.00 0.00 0.00 1.40
2857 2965 8.798859 AAGCAGAAGTGTTGTCTATATCATTT 57.201 30.769 0.00 0.00 0.00 2.32
2858 2966 7.223582 CGAAGCAGAAGTGTTGTCTATATCATT 59.776 37.037 0.00 0.00 0.00 2.57
2859 2967 6.699204 CGAAGCAGAAGTGTTGTCTATATCAT 59.301 38.462 0.00 0.00 0.00 2.45
2860 2968 6.036470 CGAAGCAGAAGTGTTGTCTATATCA 58.964 40.000 0.00 0.00 0.00 2.15
2861 2969 5.460419 CCGAAGCAGAAGTGTTGTCTATATC 59.540 44.000 0.00 0.00 0.00 1.63
2862 2970 5.105310 ACCGAAGCAGAAGTGTTGTCTATAT 60.105 40.000 0.00 0.00 0.00 0.86
2863 2971 4.219944 ACCGAAGCAGAAGTGTTGTCTATA 59.780 41.667 0.00 0.00 0.00 1.31
2864 2972 3.006967 ACCGAAGCAGAAGTGTTGTCTAT 59.993 43.478 0.00 0.00 0.00 1.98
2865 2973 2.364324 ACCGAAGCAGAAGTGTTGTCTA 59.636 45.455 0.00 0.00 0.00 2.59
2866 2974 1.139058 ACCGAAGCAGAAGTGTTGTCT 59.861 47.619 0.00 0.00 0.00 3.41
2867 2975 1.583054 ACCGAAGCAGAAGTGTTGTC 58.417 50.000 0.00 0.00 0.00 3.18
2868 2976 2.364324 TCTACCGAAGCAGAAGTGTTGT 59.636 45.455 0.00 0.00 0.00 3.32
2869 2977 2.731976 GTCTACCGAAGCAGAAGTGTTG 59.268 50.000 0.00 0.00 0.00 3.33
2870 2978 2.288886 GGTCTACCGAAGCAGAAGTGTT 60.289 50.000 0.00 0.00 0.00 3.32
2871 2979 1.272769 GGTCTACCGAAGCAGAAGTGT 59.727 52.381 0.00 0.00 0.00 3.55
2872 2980 1.404315 GGGTCTACCGAAGCAGAAGTG 60.404 57.143 0.00 0.00 36.71 3.16
2873 2981 0.896226 GGGTCTACCGAAGCAGAAGT 59.104 55.000 0.00 0.00 36.71 3.01
2874 2982 0.175989 GGGGTCTACCGAAGCAGAAG 59.824 60.000 0.00 0.00 41.60 2.85
2875 2983 1.262640 GGGGGTCTACCGAAGCAGAA 61.263 60.000 0.00 0.00 41.60 3.02
2876 2984 1.684734 GGGGGTCTACCGAAGCAGA 60.685 63.158 0.00 0.00 41.60 4.26
2877 2985 2.901042 GGGGGTCTACCGAAGCAG 59.099 66.667 0.00 0.00 41.60 4.24
2891 2999 1.771255 CCTTGTATTCAGGAGAGGGGG 59.229 57.143 0.00 0.00 0.00 5.40
2892 3000 2.764269 TCCTTGTATTCAGGAGAGGGG 58.236 52.381 0.00 0.00 0.00 4.79
2893 3001 3.072184 CCATCCTTGTATTCAGGAGAGGG 59.928 52.174 0.00 0.00 34.94 4.30
2894 3002 3.495806 GCCATCCTTGTATTCAGGAGAGG 60.496 52.174 6.07 6.07 34.94 3.69
2895 3003 3.390639 AGCCATCCTTGTATTCAGGAGAG 59.609 47.826 0.00 0.00 34.94 3.20
2896 3004 3.135348 CAGCCATCCTTGTATTCAGGAGA 59.865 47.826 0.00 0.00 34.94 3.71
2897 3005 3.135348 TCAGCCATCCTTGTATTCAGGAG 59.865 47.826 0.00 0.00 34.94 3.69
2898 3006 3.114606 TCAGCCATCCTTGTATTCAGGA 58.885 45.455 0.00 0.00 36.04 3.86
2899 3007 3.135348 TCTCAGCCATCCTTGTATTCAGG 59.865 47.826 0.00 0.00 0.00 3.86
2900 3008 4.412796 TCTCAGCCATCCTTGTATTCAG 57.587 45.455 0.00 0.00 0.00 3.02
2901 3009 5.128205 CAATCTCAGCCATCCTTGTATTCA 58.872 41.667 0.00 0.00 0.00 2.57
2902 3010 4.518211 CCAATCTCAGCCATCCTTGTATTC 59.482 45.833 0.00 0.00 0.00 1.75
2903 3011 4.079558 ACCAATCTCAGCCATCCTTGTATT 60.080 41.667 0.00 0.00 0.00 1.89
2904 3012 3.461085 ACCAATCTCAGCCATCCTTGTAT 59.539 43.478 0.00 0.00 0.00 2.29
2905 3013 2.846206 ACCAATCTCAGCCATCCTTGTA 59.154 45.455 0.00 0.00 0.00 2.41
2906 3014 1.637553 ACCAATCTCAGCCATCCTTGT 59.362 47.619 0.00 0.00 0.00 3.16
2907 3015 2.295885 GACCAATCTCAGCCATCCTTG 58.704 52.381 0.00 0.00 0.00 3.61
2908 3016 1.134280 CGACCAATCTCAGCCATCCTT 60.134 52.381 0.00 0.00 0.00 3.36
2909 3017 0.467384 CGACCAATCTCAGCCATCCT 59.533 55.000 0.00 0.00 0.00 3.24
2910 3018 0.465705 TCGACCAATCTCAGCCATCC 59.534 55.000 0.00 0.00 0.00 3.51
2911 3019 2.540265 ATCGACCAATCTCAGCCATC 57.460 50.000 0.00 0.00 0.00 3.51
2912 3020 2.037772 GGTATCGACCAATCTCAGCCAT 59.962 50.000 0.00 0.00 46.12 4.40
2913 3021 1.412710 GGTATCGACCAATCTCAGCCA 59.587 52.381 0.00 0.00 46.12 4.75
2914 3022 2.156343 GGTATCGACCAATCTCAGCC 57.844 55.000 0.00 0.00 46.12 4.85
2925 3033 5.753921 CCCTTTGTTATGAAGAGGTATCGAC 59.246 44.000 0.00 0.00 0.00 4.20
2926 3034 5.684030 GCCCTTTGTTATGAAGAGGTATCGA 60.684 44.000 0.00 0.00 0.00 3.59
2927 3035 4.511826 GCCCTTTGTTATGAAGAGGTATCG 59.488 45.833 0.00 0.00 0.00 2.92
2928 3036 5.437060 TGCCCTTTGTTATGAAGAGGTATC 58.563 41.667 0.00 0.00 0.00 2.24
2929 3037 5.450818 TGCCCTTTGTTATGAAGAGGTAT 57.549 39.130 0.00 0.00 0.00 2.73
2930 3038 4.919774 TGCCCTTTGTTATGAAGAGGTA 57.080 40.909 0.00 0.00 0.00 3.08
2931 3039 3.806949 TGCCCTTTGTTATGAAGAGGT 57.193 42.857 0.00 0.00 0.00 3.85
2932 3040 4.272489 TCATGCCCTTTGTTATGAAGAGG 58.728 43.478 0.00 0.00 0.00 3.69
2933 3041 5.221185 CCATCATGCCCTTTGTTATGAAGAG 60.221 44.000 0.00 0.00 33.71 2.85
2934 3042 4.646040 CCATCATGCCCTTTGTTATGAAGA 59.354 41.667 0.00 0.00 33.71 2.87
2935 3043 4.403432 ACCATCATGCCCTTTGTTATGAAG 59.597 41.667 0.00 0.00 33.71 3.02
2936 3044 4.352009 ACCATCATGCCCTTTGTTATGAA 58.648 39.130 0.00 0.00 33.71 2.57
2937 3045 3.953612 GACCATCATGCCCTTTGTTATGA 59.046 43.478 0.00 0.00 34.42 2.15
2938 3046 3.700539 TGACCATCATGCCCTTTGTTATG 59.299 43.478 0.00 0.00 0.00 1.90
2939 3047 3.979911 TGACCATCATGCCCTTTGTTAT 58.020 40.909 0.00 0.00 0.00 1.89
2940 3048 3.448093 TGACCATCATGCCCTTTGTTA 57.552 42.857 0.00 0.00 0.00 2.41
2941 3049 2.307496 TGACCATCATGCCCTTTGTT 57.693 45.000 0.00 0.00 0.00 2.83
2942 3050 2.537633 ATGACCATCATGCCCTTTGT 57.462 45.000 0.00 0.00 35.43 2.83
2943 3051 5.540400 AAATATGACCATCATGCCCTTTG 57.460 39.130 1.49 0.00 37.70 2.77
2944 3052 5.662208 TCAAAATATGACCATCATGCCCTTT 59.338 36.000 1.49 0.00 37.70 3.11
2945 3053 5.210430 TCAAAATATGACCATCATGCCCTT 58.790 37.500 1.49 0.00 37.70 3.95
2946 3054 4.806892 TCAAAATATGACCATCATGCCCT 58.193 39.130 1.49 0.00 37.70 5.19
2947 3055 5.534207 TTCAAAATATGACCATCATGCCC 57.466 39.130 1.49 0.00 37.70 5.36
2948 3056 7.550196 ACTTTTTCAAAATATGACCATCATGCC 59.450 33.333 1.49 0.00 37.70 4.40
2949 3057 8.385111 CACTTTTTCAAAATATGACCATCATGC 58.615 33.333 1.49 0.00 37.70 4.06
2950 3058 9.642327 TCACTTTTTCAAAATATGACCATCATG 57.358 29.630 1.49 0.00 37.70 3.07
2951 3059 9.643693 GTCACTTTTTCAAAATATGACCATCAT 57.356 29.630 12.86 0.00 40.72 2.45
2957 3065 5.344933 GGCGGTCACTTTTTCAAAATATGAC 59.655 40.000 14.55 14.55 40.07 3.06
2958 3066 5.465935 GGCGGTCACTTTTTCAAAATATGA 58.534 37.500 0.00 0.00 35.85 2.15
2959 3067 4.625311 GGGCGGTCACTTTTTCAAAATATG 59.375 41.667 0.00 0.00 0.00 1.78
2960 3068 4.617298 CGGGCGGTCACTTTTTCAAAATAT 60.617 41.667 0.00 0.00 0.00 1.28
2961 3069 3.304794 CGGGCGGTCACTTTTTCAAAATA 60.305 43.478 0.00 0.00 0.00 1.40
2962 3070 2.544903 CGGGCGGTCACTTTTTCAAAAT 60.545 45.455 0.00 0.00 0.00 1.82
2963 3071 1.202313 CGGGCGGTCACTTTTTCAAAA 60.202 47.619 0.00 0.00 0.00 2.44
2964 3072 0.382515 CGGGCGGTCACTTTTTCAAA 59.617 50.000 0.00 0.00 0.00 2.69
2965 3073 1.448922 CCGGGCGGTCACTTTTTCAA 61.449 55.000 0.00 0.00 0.00 2.69
2966 3074 1.894756 CCGGGCGGTCACTTTTTCA 60.895 57.895 0.00 0.00 0.00 2.69
2967 3075 2.951458 CCGGGCGGTCACTTTTTC 59.049 61.111 0.00 0.00 0.00 2.29
2968 3076 3.292159 GCCGGGCGGTCACTTTTT 61.292 61.111 1.81 0.00 37.65 1.94
2987 3095 9.757286 GTATTTCTATACATATCCCCGTCGGGC 62.757 48.148 25.88 0.21 41.55 6.13
2988 3096 6.460676 GTATTTCTATACATATCCCCGTCGGG 60.461 46.154 24.35 24.35 42.29 5.14
2989 3097 5.593679 ATTTCTATACATATCCCCGTCGG 57.406 43.478 3.60 3.60 0.00 4.79
2990 3098 6.183360 ACGTATTTCTATACATATCCCCGTCG 60.183 42.308 0.00 0.00 37.12 5.12
2991 3099 6.971184 CACGTATTTCTATACATATCCCCGTC 59.029 42.308 0.00 0.00 37.12 4.79
2992 3100 6.435277 ACACGTATTTCTATACATATCCCCGT 59.565 38.462 0.00 0.00 37.12 5.28
2993 3101 6.860080 ACACGTATTTCTATACATATCCCCG 58.140 40.000 0.00 0.00 37.12 5.73
2994 3102 7.548075 CCAACACGTATTTCTATACATATCCCC 59.452 40.741 0.00 0.00 37.12 4.81
2995 3103 8.092687 ACCAACACGTATTTCTATACATATCCC 58.907 37.037 0.00 0.00 37.12 3.85
3000 3108 9.880157 AAACTACCAACACGTATTTCTATACAT 57.120 29.630 0.00 0.00 37.12 2.29
3001 3109 9.709495 AAAACTACCAACACGTATTTCTATACA 57.291 29.630 0.00 0.00 37.12 2.29
3062 3170 3.980442 TTTCCCACATACCCGCGGC 62.980 63.158 22.85 0.00 0.00 6.53
3063 3171 0.961358 TTTTTCCCACATACCCGCGG 60.961 55.000 21.04 21.04 0.00 6.46
3064 3172 2.557451 TTTTTCCCACATACCCGCG 58.443 52.632 0.00 0.00 0.00 6.46
3092 3200 0.521735 GAGCGAAGTCGGGCATTTTT 59.478 50.000 2.47 0.00 40.23 1.94
3093 3201 1.305930 GGAGCGAAGTCGGGCATTTT 61.306 55.000 2.47 0.00 40.23 1.82
3094 3202 1.745489 GGAGCGAAGTCGGGCATTT 60.745 57.895 2.47 0.00 40.23 2.32
3095 3203 2.125106 GGAGCGAAGTCGGGCATT 60.125 61.111 2.47 0.00 40.23 3.56
3096 3204 3.077556 AGGAGCGAAGTCGGGCAT 61.078 61.111 2.47 0.00 40.23 4.40
3097 3205 4.069232 CAGGAGCGAAGTCGGGCA 62.069 66.667 2.47 0.00 40.23 5.36
3098 3206 4.821589 CCAGGAGCGAAGTCGGGC 62.822 72.222 2.47 0.00 40.23 6.13
3099 3207 4.148825 CCCAGGAGCGAAGTCGGG 62.149 72.222 2.47 0.00 40.23 5.14
3100 3208 4.821589 GCCCAGGAGCGAAGTCGG 62.822 72.222 2.47 0.00 40.23 4.79
3101 3209 4.821589 GGCCCAGGAGCGAAGTCG 62.822 72.222 0.00 0.00 43.27 4.18
3102 3210 4.475135 GGGCCCAGGAGCGAAGTC 62.475 72.222 19.95 0.00 0.00 3.01
3104 3212 2.388890 CTATGGGCCCAGGAGCGAAG 62.389 65.000 31.97 13.83 0.00 3.79
3105 3213 2.366301 TATGGGCCCAGGAGCGAA 60.366 61.111 31.97 2.97 0.00 4.70
3106 3214 2.306715 TACTATGGGCCCAGGAGCGA 62.307 60.000 31.97 17.50 0.00 4.93
3107 3215 1.407656 TTACTATGGGCCCAGGAGCG 61.408 60.000 31.97 17.62 0.00 5.03
3108 3216 0.843984 TTTACTATGGGCCCAGGAGC 59.156 55.000 31.97 0.00 0.00 4.70
3109 3217 2.127708 AGTTTACTATGGGCCCAGGAG 58.872 52.381 31.97 29.40 0.00 3.69
3110 3218 2.280308 AGTTTACTATGGGCCCAGGA 57.720 50.000 31.97 19.68 0.00 3.86
3111 3219 4.595781 TGTATAGTTTACTATGGGCCCAGG 59.404 45.833 31.97 26.05 39.36 4.45
3112 3220 5.818678 TGTATAGTTTACTATGGGCCCAG 57.181 43.478 31.97 20.41 39.36 4.45
3113 3221 6.330514 TGATTGTATAGTTTACTATGGGCCCA 59.669 38.462 30.92 30.92 39.36 5.36
3114 3222 6.775708 TGATTGTATAGTTTACTATGGGCCC 58.224 40.000 17.59 17.59 39.36 5.80
3115 3223 7.174426 GGTTGATTGTATAGTTTACTATGGGCC 59.826 40.741 11.70 0.00 39.36 5.80
3116 3224 7.174426 GGGTTGATTGTATAGTTTACTATGGGC 59.826 40.741 11.70 4.18 39.36 5.36
3117 3225 8.215050 TGGGTTGATTGTATAGTTTACTATGGG 58.785 37.037 11.70 0.00 39.36 4.00
3118 3226 9.621629 TTGGGTTGATTGTATAGTTTACTATGG 57.378 33.333 11.70 0.00 39.36 2.74
3122 3230 9.747898 TGATTTGGGTTGATTGTATAGTTTACT 57.252 29.630 0.00 0.00 0.00 2.24
3125 3233 8.034804 GCTTGATTTGGGTTGATTGTATAGTTT 58.965 33.333 0.00 0.00 0.00 2.66
3126 3234 7.363793 GGCTTGATTTGGGTTGATTGTATAGTT 60.364 37.037 0.00 0.00 0.00 2.24
3127 3235 6.096846 GGCTTGATTTGGGTTGATTGTATAGT 59.903 38.462 0.00 0.00 0.00 2.12
3128 3236 6.461509 GGGCTTGATTTGGGTTGATTGTATAG 60.462 42.308 0.00 0.00 0.00 1.31
3129 3237 5.362430 GGGCTTGATTTGGGTTGATTGTATA 59.638 40.000 0.00 0.00 0.00 1.47
3130 3238 4.162131 GGGCTTGATTTGGGTTGATTGTAT 59.838 41.667 0.00 0.00 0.00 2.29
3131 3239 3.513515 GGGCTTGATTTGGGTTGATTGTA 59.486 43.478 0.00 0.00 0.00 2.41
3132 3240 2.302733 GGGCTTGATTTGGGTTGATTGT 59.697 45.455 0.00 0.00 0.00 2.71
3133 3241 2.674747 CGGGCTTGATTTGGGTTGATTG 60.675 50.000 0.00 0.00 0.00 2.67
3134 3242 1.550072 CGGGCTTGATTTGGGTTGATT 59.450 47.619 0.00 0.00 0.00 2.57
3135 3243 1.185315 CGGGCTTGATTTGGGTTGAT 58.815 50.000 0.00 0.00 0.00 2.57
3136 3244 0.111446 TCGGGCTTGATTTGGGTTGA 59.889 50.000 0.00 0.00 0.00 3.18
3137 3245 0.965439 TTCGGGCTTGATTTGGGTTG 59.035 50.000 0.00 0.00 0.00 3.77
3138 3246 1.203001 TCTTCGGGCTTGATTTGGGTT 60.203 47.619 0.00 0.00 0.00 4.11
3139 3247 0.404040 TCTTCGGGCTTGATTTGGGT 59.596 50.000 0.00 0.00 0.00 4.51
3140 3248 0.811281 GTCTTCGGGCTTGATTTGGG 59.189 55.000 0.00 0.00 0.00 4.12
3141 3249 0.447801 CGTCTTCGGGCTTGATTTGG 59.552 55.000 0.00 0.00 0.00 3.28
3142 3250 1.128692 GTCGTCTTCGGGCTTGATTTG 59.871 52.381 0.00 0.00 37.69 2.32
3143 3251 1.002087 AGTCGTCTTCGGGCTTGATTT 59.998 47.619 0.00 0.00 37.69 2.17
3144 3252 0.608640 AGTCGTCTTCGGGCTTGATT 59.391 50.000 0.00 0.00 37.69 2.57
3145 3253 0.173708 GAGTCGTCTTCGGGCTTGAT 59.826 55.000 0.00 0.00 37.69 2.57
3146 3254 1.585006 GAGTCGTCTTCGGGCTTGA 59.415 57.895 0.00 0.00 37.69 3.02
3147 3255 1.801913 CGAGTCGTCTTCGGGCTTG 60.802 63.158 3.82 0.00 37.69 4.01
3148 3256 2.567049 CGAGTCGTCTTCGGGCTT 59.433 61.111 3.82 0.00 37.69 4.35
3149 3257 3.441290 CCGAGTCGTCTTCGGGCT 61.441 66.667 12.31 0.00 42.70 5.19
3152 3260 4.831307 CGCCCGAGTCGTCTTCGG 62.831 72.222 12.31 14.87 45.65 4.30
3153 3261 4.831307 CCGCCCGAGTCGTCTTCG 62.831 72.222 12.31 8.62 38.55 3.79
3154 3262 3.680338 GACCGCCCGAGTCGTCTTC 62.680 68.421 12.31 0.00 0.00 2.87
3155 3263 3.745803 GACCGCCCGAGTCGTCTT 61.746 66.667 12.31 0.00 0.00 3.01
3160 3268 2.278661 GAATCGACCGCCCGAGTC 60.279 66.667 8.78 8.78 44.33 3.36
3161 3269 4.189188 CGAATCGACCGCCCGAGT 62.189 66.667 0.00 0.96 42.21 4.18
3162 3270 4.925576 CCGAATCGACCGCCCGAG 62.926 72.222 3.36 0.00 42.21 4.63
3170 3278 2.469516 ATTTGCGGGCCGAATCGAC 61.470 57.895 33.44 11.52 0.00 4.20
3171 3279 2.124901 ATTTGCGGGCCGAATCGA 60.125 55.556 33.44 9.29 0.00 3.59
3172 3280 2.024588 CATTTGCGGGCCGAATCG 59.975 61.111 33.44 6.74 0.00 3.34
3173 3281 2.412937 CCATTTGCGGGCCGAATC 59.587 61.111 33.44 13.24 0.00 2.52
3174 3282 3.146913 CCCATTTGCGGGCCGAAT 61.147 61.111 33.44 18.94 40.07 3.34
3181 3289 2.679642 TTCTGGGCCCATTTGCGG 60.680 61.111 28.82 13.22 0.00 5.69
3182 3290 2.713967 CCTTCTGGGCCCATTTGCG 61.714 63.158 28.82 14.09 0.00 4.85
3183 3291 3.302129 CCTTCTGGGCCCATTTGC 58.698 61.111 28.82 0.00 0.00 3.68
3193 3301 1.296715 CGTTGGACCTCCCTTCTGG 59.703 63.158 0.00 0.00 35.38 3.86
3194 3302 1.296715 CCGTTGGACCTCCCTTCTG 59.703 63.158 0.00 0.00 35.38 3.02
3195 3303 1.918800 CCCGTTGGACCTCCCTTCT 60.919 63.158 0.00 0.00 35.38 2.85
3196 3304 2.669240 CCCGTTGGACCTCCCTTC 59.331 66.667 0.00 0.00 35.38 3.46
3197 3305 2.933834 CCCCGTTGGACCTCCCTT 60.934 66.667 0.00 0.00 35.39 3.95
3210 3318 3.901797 AAAAGTCTCTGCCGCCCCG 62.902 63.158 0.00 0.00 0.00 5.73
3211 3319 2.034221 AAAAGTCTCTGCCGCCCC 59.966 61.111 0.00 0.00 0.00 5.80
3212 3320 1.302511 TCAAAAGTCTCTGCCGCCC 60.303 57.895 0.00 0.00 0.00 6.13
3213 3321 1.578206 GGTCAAAAGTCTCTGCCGCC 61.578 60.000 0.00 0.00 0.00 6.13
3214 3322 1.869690 GGTCAAAAGTCTCTGCCGC 59.130 57.895 0.00 0.00 0.00 6.53
3215 3323 1.901650 GCGGTCAAAAGTCTCTGCCG 61.902 60.000 0.00 0.00 40.52 5.69
3216 3324 1.578206 GGCGGTCAAAAGTCTCTGCC 61.578 60.000 0.00 0.00 43.54 4.85
3217 3325 1.578206 GGGCGGTCAAAAGTCTCTGC 61.578 60.000 0.00 0.00 0.00 4.26
3218 3326 0.250295 TGGGCGGTCAAAAGTCTCTG 60.250 55.000 0.00 0.00 0.00 3.35
3219 3327 0.250338 GTGGGCGGTCAAAAGTCTCT 60.250 55.000 0.00 0.00 0.00 3.10
3220 3328 0.534203 TGTGGGCGGTCAAAAGTCTC 60.534 55.000 0.00 0.00 0.00 3.36
3221 3329 0.535102 CTGTGGGCGGTCAAAAGTCT 60.535 55.000 0.00 0.00 0.00 3.24
3222 3330 0.534203 TCTGTGGGCGGTCAAAAGTC 60.534 55.000 0.00 0.00 0.00 3.01
3223 3331 0.818040 GTCTGTGGGCGGTCAAAAGT 60.818 55.000 0.00 0.00 0.00 2.66
3224 3332 0.535102 AGTCTGTGGGCGGTCAAAAG 60.535 55.000 0.00 0.00 0.00 2.27
3225 3333 0.759959 TAGTCTGTGGGCGGTCAAAA 59.240 50.000 0.00 0.00 0.00 2.44
3226 3334 0.034337 GTAGTCTGTGGGCGGTCAAA 59.966 55.000 0.00 0.00 0.00 2.69
3227 3335 1.116536 TGTAGTCTGTGGGCGGTCAA 61.117 55.000 0.00 0.00 0.00 3.18
3228 3336 0.902984 ATGTAGTCTGTGGGCGGTCA 60.903 55.000 0.00 0.00 0.00 4.02
3229 3337 1.108776 TATGTAGTCTGTGGGCGGTC 58.891 55.000 0.00 0.00 0.00 4.79
3230 3338 1.563924 TTATGTAGTCTGTGGGCGGT 58.436 50.000 0.00 0.00 0.00 5.68
3231 3339 2.684001 TTTATGTAGTCTGTGGGCGG 57.316 50.000 0.00 0.00 0.00 6.13
3232 3340 3.531538 ACATTTATGTAGTCTGTGGGCG 58.468 45.455 0.00 0.00 39.68 6.13
3233 3341 5.878116 TGTTACATTTATGTAGTCTGTGGGC 59.122 40.000 3.10 0.00 43.44 5.36
3234 3342 7.103641 AGTGTTACATTTATGTAGTCTGTGGG 58.896 38.462 3.10 0.00 43.44 4.61
3235 3343 9.817809 ATAGTGTTACATTTATGTAGTCTGTGG 57.182 33.333 3.10 0.00 43.44 4.17
3254 3362 9.899226 GAAGAAAGCTTTGTGATAAATAGTGTT 57.101 29.630 18.30 0.00 33.61 3.32
3255 3363 9.066892 TGAAGAAAGCTTTGTGATAAATAGTGT 57.933 29.630 18.30 0.00 33.61 3.55
3256 3364 9.552114 CTGAAGAAAGCTTTGTGATAAATAGTG 57.448 33.333 18.30 0.00 33.61 2.74
3257 3365 9.507329 TCTGAAGAAAGCTTTGTGATAAATAGT 57.493 29.630 18.30 0.00 33.61 2.12
3258 3366 9.766277 GTCTGAAGAAAGCTTTGTGATAAATAG 57.234 33.333 18.30 4.72 33.61 1.73
3259 3367 9.283768 TGTCTGAAGAAAGCTTTGTGATAAATA 57.716 29.630 18.30 0.00 33.61 1.40
3260 3368 8.169977 TGTCTGAAGAAAGCTTTGTGATAAAT 57.830 30.769 18.30 0.00 33.61 1.40
3261 3369 7.498900 TCTGTCTGAAGAAAGCTTTGTGATAAA 59.501 33.333 18.30 0.00 33.61 1.40
3262 3370 6.992123 TCTGTCTGAAGAAAGCTTTGTGATAA 59.008 34.615 18.30 0.00 33.61 1.75
3263 3371 6.524734 TCTGTCTGAAGAAAGCTTTGTGATA 58.475 36.000 18.30 4.08 33.61 2.15
3264 3372 5.371526 TCTGTCTGAAGAAAGCTTTGTGAT 58.628 37.500 18.30 0.00 33.61 3.06
3265 3373 4.769688 TCTGTCTGAAGAAAGCTTTGTGA 58.230 39.130 18.30 3.46 33.61 3.58
3266 3374 5.490139 TTCTGTCTGAAGAAAGCTTTGTG 57.510 39.130 18.30 0.76 33.25 3.33
3267 3375 6.705863 ATTTCTGTCTGAAGAAAGCTTTGT 57.294 33.333 18.30 10.29 46.43 2.83
3268 3376 8.092521 TCTATTTCTGTCTGAAGAAAGCTTTG 57.907 34.615 18.30 1.32 46.43 2.77
3269 3377 8.682936 TTCTATTTCTGTCTGAAGAAAGCTTT 57.317 30.769 12.53 12.53 46.43 3.51
3270 3378 8.682936 TTTCTATTTCTGTCTGAAGAAAGCTT 57.317 30.769 15.21 0.00 46.43 3.74
3271 3379 8.153550 TCTTTCTATTTCTGTCTGAAGAAAGCT 58.846 33.333 18.53 7.02 46.43 3.74
3272 3380 8.316640 TCTTTCTATTTCTGTCTGAAGAAAGC 57.683 34.615 18.53 0.00 46.43 3.51
3300 3408 8.053355 TCCTGACTCTCTTTTTAAGGAGTTTTT 58.947 33.333 10.04 0.00 38.38 1.94
3301 3409 7.574607 TCCTGACTCTCTTTTTAAGGAGTTTT 58.425 34.615 10.04 0.00 38.38 2.43
3302 3410 7.138054 TCCTGACTCTCTTTTTAAGGAGTTT 57.862 36.000 10.04 0.00 38.38 2.66
3303 3411 6.749036 TCCTGACTCTCTTTTTAAGGAGTT 57.251 37.500 10.04 0.00 38.38 3.01
3304 3412 6.742926 GCTTCCTGACTCTCTTTTTAAGGAGT 60.743 42.308 9.04 9.04 39.85 3.85
3305 3413 5.641636 GCTTCCTGACTCTCTTTTTAAGGAG 59.358 44.000 0.00 0.00 34.04 3.69
3306 3414 5.071788 TGCTTCCTGACTCTCTTTTTAAGGA 59.928 40.000 0.00 0.00 0.00 3.36
3307 3415 5.308825 TGCTTCCTGACTCTCTTTTTAAGG 58.691 41.667 0.00 0.00 0.00 2.69
3308 3416 6.260936 TGTTGCTTCCTGACTCTCTTTTTAAG 59.739 38.462 0.00 0.00 0.00 1.85
3309 3417 6.119536 TGTTGCTTCCTGACTCTCTTTTTAA 58.880 36.000 0.00 0.00 0.00 1.52
3310 3418 5.680619 TGTTGCTTCCTGACTCTCTTTTTA 58.319 37.500 0.00 0.00 0.00 1.52
3311 3419 4.526970 TGTTGCTTCCTGACTCTCTTTTT 58.473 39.130 0.00 0.00 0.00 1.94
3312 3420 4.156455 TGTTGCTTCCTGACTCTCTTTT 57.844 40.909 0.00 0.00 0.00 2.27
3313 3421 3.845781 TGTTGCTTCCTGACTCTCTTT 57.154 42.857 0.00 0.00 0.00 2.52
3314 3422 3.307339 GGATGTTGCTTCCTGACTCTCTT 60.307 47.826 0.00 0.00 0.00 2.85
3315 3423 2.235898 GGATGTTGCTTCCTGACTCTCT 59.764 50.000 0.00 0.00 0.00 3.10
3316 3424 2.027745 TGGATGTTGCTTCCTGACTCTC 60.028 50.000 3.33 0.00 34.17 3.20
3317 3425 1.980765 TGGATGTTGCTTCCTGACTCT 59.019 47.619 3.33 0.00 34.17 3.24
3318 3426 2.479566 TGGATGTTGCTTCCTGACTC 57.520 50.000 3.33 0.00 34.17 3.36
3319 3427 2.787994 CTTGGATGTTGCTTCCTGACT 58.212 47.619 3.33 0.00 34.17 3.41
3320 3428 1.200948 GCTTGGATGTTGCTTCCTGAC 59.799 52.381 3.33 0.00 34.17 3.51
3321 3429 1.074405 AGCTTGGATGTTGCTTCCTGA 59.926 47.619 3.33 0.00 32.61 3.86
3322 3430 1.471684 GAGCTTGGATGTTGCTTCCTG 59.528 52.381 0.00 0.00 37.16 3.86
3323 3431 1.353694 AGAGCTTGGATGTTGCTTCCT 59.646 47.619 0.00 0.00 37.16 3.36
3324 3432 1.831580 AGAGCTTGGATGTTGCTTCC 58.168 50.000 0.00 0.00 37.16 3.46
3325 3433 2.680339 GGTAGAGCTTGGATGTTGCTTC 59.320 50.000 0.00 0.00 37.16 3.86
3326 3434 2.040278 TGGTAGAGCTTGGATGTTGCTT 59.960 45.455 0.00 0.00 37.16 3.91
3327 3435 1.630369 TGGTAGAGCTTGGATGTTGCT 59.370 47.619 0.00 0.00 40.02 3.91
3328 3436 2.113860 TGGTAGAGCTTGGATGTTGC 57.886 50.000 0.00 0.00 0.00 4.17
3329 3437 5.282055 TCTATGGTAGAGCTTGGATGTTG 57.718 43.478 0.00 0.00 0.00 3.33
3330 3438 5.957771 TTCTATGGTAGAGCTTGGATGTT 57.042 39.130 0.00 0.00 35.96 2.71
3331 3439 5.675538 GTTTCTATGGTAGAGCTTGGATGT 58.324 41.667 0.00 0.00 35.96 3.06
3332 3440 4.747108 CGTTTCTATGGTAGAGCTTGGATG 59.253 45.833 0.00 0.00 35.96 3.51
3333 3441 4.740934 GCGTTTCTATGGTAGAGCTTGGAT 60.741 45.833 0.00 0.00 35.96 3.41
3334 3442 3.430374 GCGTTTCTATGGTAGAGCTTGGA 60.430 47.826 0.00 0.00 35.96 3.53
3335 3443 2.866762 GCGTTTCTATGGTAGAGCTTGG 59.133 50.000 0.00 0.00 35.96 3.61
3336 3444 3.307242 GTGCGTTTCTATGGTAGAGCTTG 59.693 47.826 0.00 0.00 35.96 4.01
3337 3445 3.056107 TGTGCGTTTCTATGGTAGAGCTT 60.056 43.478 0.00 0.00 35.96 3.74
3338 3446 2.496070 TGTGCGTTTCTATGGTAGAGCT 59.504 45.455 0.00 0.00 35.96 4.09
3339 3447 2.888594 TGTGCGTTTCTATGGTAGAGC 58.111 47.619 0.00 0.00 35.96 4.09
3340 3448 5.109210 TGAATGTGCGTTTCTATGGTAGAG 58.891 41.667 0.00 0.00 35.96 2.43
3341 3449 5.079689 TGAATGTGCGTTTCTATGGTAGA 57.920 39.130 0.00 0.00 0.00 2.59
3342 3450 5.794687 TTGAATGTGCGTTTCTATGGTAG 57.205 39.130 0.00 0.00 0.00 3.18
3343 3451 5.123186 CCTTTGAATGTGCGTTTCTATGGTA 59.877 40.000 0.00 0.00 0.00 3.25
3344 3452 4.082787 CCTTTGAATGTGCGTTTCTATGGT 60.083 41.667 0.00 0.00 0.00 3.55
3345 3453 4.155826 TCCTTTGAATGTGCGTTTCTATGG 59.844 41.667 0.00 0.00 0.00 2.74
3346 3454 5.295431 TCCTTTGAATGTGCGTTTCTATG 57.705 39.130 0.00 0.00 0.00 2.23
3347 3455 5.619981 GCTTCCTTTGAATGTGCGTTTCTAT 60.620 40.000 0.00 0.00 0.00 1.98
3348 3456 4.320202 GCTTCCTTTGAATGTGCGTTTCTA 60.320 41.667 0.00 0.00 0.00 2.10
3349 3457 3.550842 GCTTCCTTTGAATGTGCGTTTCT 60.551 43.478 0.00 0.00 0.00 2.52
3350 3458 2.726241 GCTTCCTTTGAATGTGCGTTTC 59.274 45.455 0.00 0.00 0.00 2.78
3351 3459 2.545742 GGCTTCCTTTGAATGTGCGTTT 60.546 45.455 0.00 0.00 0.00 3.60
3352 3460 1.000274 GGCTTCCTTTGAATGTGCGTT 60.000 47.619 0.00 0.00 0.00 4.84
3353 3461 0.598065 GGCTTCCTTTGAATGTGCGT 59.402 50.000 0.00 0.00 0.00 5.24
3354 3462 0.597568 TGGCTTCCTTTGAATGTGCG 59.402 50.000 0.00 0.00 0.00 5.34
3355 3463 2.036346 AGTTGGCTTCCTTTGAATGTGC 59.964 45.455 0.00 0.00 0.00 4.57
3356 3464 3.645884 CAGTTGGCTTCCTTTGAATGTG 58.354 45.455 0.00 0.00 0.00 3.21
3357 3465 2.036346 GCAGTTGGCTTCCTTTGAATGT 59.964 45.455 0.00 0.00 40.25 2.71
3358 3466 2.611224 GGCAGTTGGCTTCCTTTGAATG 60.611 50.000 0.00 0.00 44.01 2.67
3359 3467 1.620323 GGCAGTTGGCTTCCTTTGAAT 59.380 47.619 0.00 0.00 44.01 2.57
3360 3468 1.039856 GGCAGTTGGCTTCCTTTGAA 58.960 50.000 0.00 0.00 44.01 2.69
3361 3469 0.827507 GGGCAGTTGGCTTCCTTTGA 60.828 55.000 5.63 0.00 44.01 2.69
3362 3470 1.114722 TGGGCAGTTGGCTTCCTTTG 61.115 55.000 5.63 0.00 44.01 2.77
3363 3471 1.115326 GTGGGCAGTTGGCTTCCTTT 61.115 55.000 5.63 0.00 44.01 3.11
3364 3472 1.531602 GTGGGCAGTTGGCTTCCTT 60.532 57.895 5.63 0.00 44.01 3.36
3365 3473 2.011617 AAGTGGGCAGTTGGCTTCCT 62.012 55.000 5.63 0.00 44.01 3.36
3366 3474 1.531602 AAGTGGGCAGTTGGCTTCC 60.532 57.895 5.63 0.00 44.01 3.46
3367 3475 1.662044 CAAGTGGGCAGTTGGCTTC 59.338 57.895 5.63 0.06 44.01 3.86
3368 3476 3.860681 CAAGTGGGCAGTTGGCTT 58.139 55.556 5.63 0.00 44.01 4.35
3372 3480 2.006888 CGTATACCAAGTGGGCAGTTG 58.993 52.381 1.69 0.00 42.05 3.16
3373 3481 1.065709 CCGTATACCAAGTGGGCAGTT 60.066 52.381 1.69 0.00 42.05 3.16
3374 3482 0.539986 CCGTATACCAAGTGGGCAGT 59.460 55.000 1.69 0.00 42.05 4.40
3375 3483 0.814010 GCCGTATACCAAGTGGGCAG 60.814 60.000 11.10 0.00 42.05 4.85
3376 3484 1.222387 GCCGTATACCAAGTGGGCA 59.778 57.895 11.10 0.00 42.05 5.36
3377 3485 0.814010 CTGCCGTATACCAAGTGGGC 60.814 60.000 9.53 9.53 42.05 5.36
3378 3486 0.814010 GCTGCCGTATACCAAGTGGG 60.814 60.000 1.69 0.00 44.81 4.61
3379 3487 0.107897 TGCTGCCGTATACCAAGTGG 60.108 55.000 0.00 0.00 42.17 4.00
3380 3488 1.290203 CTGCTGCCGTATACCAAGTG 58.710 55.000 0.00 0.00 0.00 3.16
3381 3489 0.462047 GCTGCTGCCGTATACCAAGT 60.462 55.000 3.85 0.00 0.00 3.16
3382 3490 0.179073 AGCTGCTGCCGTATACCAAG 60.179 55.000 12.44 0.00 40.80 3.61
3383 3491 0.461870 CAGCTGCTGCCGTATACCAA 60.462 55.000 17.73 0.00 40.80 3.67
3384 3492 1.143838 CAGCTGCTGCCGTATACCA 59.856 57.895 17.73 0.00 40.80 3.25
3385 3493 1.144057 ACAGCTGCTGCCGTATACC 59.856 57.895 28.39 0.00 40.80 2.73
3386 3494 1.154205 CCACAGCTGCTGCCGTATAC 61.154 60.000 28.39 0.00 40.80 1.47
3387 3495 1.143838 CCACAGCTGCTGCCGTATA 59.856 57.895 28.39 0.00 40.80 1.47
3388 3496 1.613317 TACCACAGCTGCTGCCGTAT 61.613 55.000 28.39 12.68 40.80 3.06
3389 3497 1.613317 ATACCACAGCTGCTGCCGTA 61.613 55.000 28.39 25.47 40.80 4.02
3390 3498 2.859273 GATACCACAGCTGCTGCCGT 62.859 60.000 28.39 24.30 40.80 5.68
3391 3499 2.124983 ATACCACAGCTGCTGCCG 60.125 61.111 28.39 20.16 40.80 5.69
3392 3500 2.176273 CGATACCACAGCTGCTGCC 61.176 63.158 28.39 10.35 40.80 4.85
3393 3501 1.021390 AACGATACCACAGCTGCTGC 61.021 55.000 28.39 7.62 34.37 5.25
3394 3502 1.394917 GAAACGATACCACAGCTGCTG 59.605 52.381 27.02 27.02 37.52 4.41
3395 3503 1.001974 TGAAACGATACCACAGCTGCT 59.998 47.619 15.27 0.00 0.00 4.24
3396 3504 1.438651 TGAAACGATACCACAGCTGC 58.561 50.000 15.27 0.00 0.00 5.25
3397 3505 4.024048 AGTTTTGAAACGATACCACAGCTG 60.024 41.667 13.48 13.48 43.51 4.24
3398 3506 4.134563 AGTTTTGAAACGATACCACAGCT 58.865 39.130 0.00 0.00 43.51 4.24
3399 3507 4.483476 AGTTTTGAAACGATACCACAGC 57.517 40.909 0.00 0.00 43.51 4.40
3400 3508 9.458374 AAAAATAGTTTTGAAACGATACCACAG 57.542 29.630 0.00 0.00 43.51 3.66
3415 3523 9.489084 GCACTTCCTGGAAATAAAAATAGTTTT 57.511 29.630 10.86 6.13 40.15 2.43
3416 3524 7.812669 CGCACTTCCTGGAAATAAAAATAGTTT 59.187 33.333 10.86 0.00 0.00 2.66
3417 3525 7.175990 TCGCACTTCCTGGAAATAAAAATAGTT 59.824 33.333 10.86 0.00 0.00 2.24
3418 3526 6.657541 TCGCACTTCCTGGAAATAAAAATAGT 59.342 34.615 10.86 0.00 0.00 2.12
3419 3527 7.083875 TCGCACTTCCTGGAAATAAAAATAG 57.916 36.000 10.86 0.00 0.00 1.73
3420 3528 6.404293 GCTCGCACTTCCTGGAAATAAAAATA 60.404 38.462 10.86 0.00 0.00 1.40
3421 3529 5.622233 GCTCGCACTTCCTGGAAATAAAAAT 60.622 40.000 10.86 0.00 0.00 1.82
3422 3530 4.320935 GCTCGCACTTCCTGGAAATAAAAA 60.321 41.667 10.86 0.00 0.00 1.94
3423 3531 3.190535 GCTCGCACTTCCTGGAAATAAAA 59.809 43.478 10.86 0.00 0.00 1.52
3424 3532 2.747446 GCTCGCACTTCCTGGAAATAAA 59.253 45.455 10.86 0.00 0.00 1.40
3425 3533 2.027192 AGCTCGCACTTCCTGGAAATAA 60.027 45.455 10.86 0.00 0.00 1.40
3426 3534 1.555075 AGCTCGCACTTCCTGGAAATA 59.445 47.619 10.86 0.00 0.00 1.40
3427 3535 0.326264 AGCTCGCACTTCCTGGAAAT 59.674 50.000 10.86 0.00 0.00 2.17
3428 3536 0.320771 GAGCTCGCACTTCCTGGAAA 60.321 55.000 10.86 0.00 0.00 3.13
3429 3537 1.293498 GAGCTCGCACTTCCTGGAA 59.707 57.895 9.14 9.14 0.00 3.53
3430 3538 2.650116 GGAGCTCGCACTTCCTGGA 61.650 63.158 7.83 0.00 0.00 3.86
3431 3539 2.125350 GGAGCTCGCACTTCCTGG 60.125 66.667 7.83 0.00 0.00 4.45
3432 3540 2.125350 GGGAGCTCGCACTTCCTG 60.125 66.667 24.65 0.00 31.85 3.86
3433 3541 3.394836 GGGGAGCTCGCACTTCCT 61.395 66.667 29.41 0.00 35.40 3.36
3434 3542 3.254024 TTGGGGAGCTCGCACTTCC 62.254 63.158 29.41 13.82 38.08 3.46
3435 3543 2.035442 GTTGGGGAGCTCGCACTTC 61.035 63.158 29.41 14.30 38.08 3.01
3436 3544 2.032681 GTTGGGGAGCTCGCACTT 59.967 61.111 29.41 0.00 38.08 3.16
3437 3545 4.021925 GGTTGGGGAGCTCGCACT 62.022 66.667 29.41 0.00 38.08 4.40
3438 3546 1.972660 ATAGGTTGGGGAGCTCGCAC 61.973 60.000 29.41 20.16 38.08 5.34
3439 3547 1.271840 AATAGGTTGGGGAGCTCGCA 61.272 55.000 29.41 14.60 37.30 5.10
3440 3548 0.533085 GAATAGGTTGGGGAGCTCGC 60.533 60.000 21.89 21.89 37.30 5.03
3441 3549 0.830648 TGAATAGGTTGGGGAGCTCG 59.169 55.000 7.83 0.00 37.30 5.03
3442 3550 2.239907 ACTTGAATAGGTTGGGGAGCTC 59.760 50.000 4.71 4.71 37.30 4.09
3443 3551 2.279173 ACTTGAATAGGTTGGGGAGCT 58.721 47.619 0.00 0.00 39.87 4.09
3444 3552 2.808906 ACTTGAATAGGTTGGGGAGC 57.191 50.000 0.00 0.00 0.00 4.70
3445 3553 6.663523 ACATAAAACTTGAATAGGTTGGGGAG 59.336 38.462 0.00 0.00 32.89 4.30
3446 3554 6.557568 ACATAAAACTTGAATAGGTTGGGGA 58.442 36.000 0.00 0.00 32.89 4.81
3447 3555 6.663523 AGACATAAAACTTGAATAGGTTGGGG 59.336 38.462 0.00 0.00 32.89 4.96
3448 3556 7.393234 TGAGACATAAAACTTGAATAGGTTGGG 59.607 37.037 0.00 0.00 32.89 4.12
3449 3557 8.335532 TGAGACATAAAACTTGAATAGGTTGG 57.664 34.615 0.00 0.00 32.89 3.77
3456 3564 9.415544 GCTTGAATTGAGACATAAAACTTGAAT 57.584 29.630 0.00 0.00 0.00 2.57
3457 3565 8.632679 AGCTTGAATTGAGACATAAAACTTGAA 58.367 29.630 0.00 0.00 0.00 2.69
3458 3566 8.169977 AGCTTGAATTGAGACATAAAACTTGA 57.830 30.769 0.00 0.00 0.00 3.02
3459 3567 8.077991 TGAGCTTGAATTGAGACATAAAACTTG 58.922 33.333 0.00 0.00 0.00 3.16
3460 3568 8.169977 TGAGCTTGAATTGAGACATAAAACTT 57.830 30.769 0.00 0.00 0.00 2.66
3461 3569 7.574592 GCTGAGCTTGAATTGAGACATAAAACT 60.575 37.037 0.00 0.00 0.00 2.66
3462 3570 6.525976 GCTGAGCTTGAATTGAGACATAAAAC 59.474 38.462 0.00 0.00 0.00 2.43
3463 3571 6.432162 AGCTGAGCTTGAATTGAGACATAAAA 59.568 34.615 0.00 0.00 33.89 1.52
3464 3572 5.942236 AGCTGAGCTTGAATTGAGACATAAA 59.058 36.000 0.00 0.00 33.89 1.40
3465 3573 5.494724 AGCTGAGCTTGAATTGAGACATAA 58.505 37.500 0.00 0.00 33.89 1.90
3466 3574 5.095145 AGCTGAGCTTGAATTGAGACATA 57.905 39.130 0.00 0.00 33.89 2.29
3467 3575 3.940221 GAGCTGAGCTTGAATTGAGACAT 59.060 43.478 9.00 0.00 39.88 3.06
3468 3576 3.332919 GAGCTGAGCTTGAATTGAGACA 58.667 45.455 9.00 0.00 39.88 3.41
3469 3577 2.348059 CGAGCTGAGCTTGAATTGAGAC 59.652 50.000 16.74 0.00 42.27 3.36
3470 3578 2.232208 TCGAGCTGAGCTTGAATTGAGA 59.768 45.455 21.57 0.00 44.93 3.27
3471 3579 2.604011 CTCGAGCTGAGCTTGAATTGAG 59.396 50.000 23.58 9.34 46.79 3.02
3472 3580 2.028658 ACTCGAGCTGAGCTTGAATTGA 60.029 45.455 23.58 3.31 46.79 2.57
3473 3581 2.344950 ACTCGAGCTGAGCTTGAATTG 58.655 47.619 23.58 15.22 46.79 2.32
3474 3582 2.615869 GACTCGAGCTGAGCTTGAATT 58.384 47.619 23.58 14.32 46.79 2.17
3475 3583 1.134848 GGACTCGAGCTGAGCTTGAAT 60.135 52.381 23.58 15.58 46.79 2.57
3476 3584 0.244994 GGACTCGAGCTGAGCTTGAA 59.755 55.000 23.58 9.27 46.79 2.69
3483 3591 2.484065 GCTAGACTAGGACTCGAGCTGA 60.484 54.545 13.61 0.00 34.54 4.26
3484 3592 1.871039 GCTAGACTAGGACTCGAGCTG 59.129 57.143 13.61 0.75 34.54 4.24
3485 3593 1.202722 GGCTAGACTAGGACTCGAGCT 60.203 57.143 13.61 4.97 36.80 4.09
3486 3594 1.232119 GGCTAGACTAGGACTCGAGC 58.768 60.000 13.61 5.26 36.09 5.03
3487 3595 1.068895 TCGGCTAGACTAGGACTCGAG 59.931 57.143 11.84 11.84 0.00 4.04
3488 3596 1.068895 CTCGGCTAGACTAGGACTCGA 59.931 57.143 11.48 6.21 0.00 4.04
3489 3597 1.504359 CTCGGCTAGACTAGGACTCG 58.496 60.000 11.48 2.70 0.00 4.18
3490 3598 1.232119 GCTCGGCTAGACTAGGACTC 58.768 60.000 11.48 0.00 0.00 3.36
3491 3599 0.547075 TGCTCGGCTAGACTAGGACT 59.453 55.000 11.48 0.00 0.00 3.85
3492 3600 1.538075 GATGCTCGGCTAGACTAGGAC 59.462 57.143 11.48 0.00 0.00 3.85
3493 3601 1.143073 TGATGCTCGGCTAGACTAGGA 59.857 52.381 11.48 0.00 0.00 2.94
3494 3602 1.610363 TGATGCTCGGCTAGACTAGG 58.390 55.000