Multiple sequence alignment - TraesCS1A01G003100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G003100 chr1A 100.000 6405 0 0 1 6405 1699603 1693199 0.000000e+00 11828.0
1 TraesCS1A01G003100 chr1A 80.711 197 37 1 2879 3074 441035008 441035204 1.110000e-32 152.0
2 TraesCS1A01G003100 chr5B 99.170 1084 9 0 5322 6405 531370242 531371325 0.000000e+00 1953.0
3 TraesCS1A01G003100 chr5B 84.211 190 28 2 2889 3077 14338911 14339099 3.940000e-42 183.0
4 TraesCS1A01G003100 chr5B 83.889 180 28 1 2892 3070 573411310 573411489 3.070000e-38 171.0
5 TraesCS1A01G003100 chr5B 81.875 160 20 6 1886 2037 607142999 607143157 6.740000e-25 126.0
6 TraesCS1A01G003100 chr5B 81.366 161 19 8 1886 2037 643322857 643322699 3.140000e-23 121.0
7 TraesCS1A01G003100 chr7B 88.541 925 95 7 5485 6405 720083159 720082242 0.000000e+00 1110.0
8 TraesCS1A01G003100 chr7B 85.905 901 118 6 5508 6405 739084989 739085883 0.000000e+00 952.0
9 TraesCS1A01G003100 chr7B 85.794 901 119 6 5508 6405 70905785 70906679 0.000000e+00 946.0
10 TraesCS1A01G003100 chr7B 78.980 1432 240 38 3823 5239 579349258 579347873 0.000000e+00 920.0
11 TraesCS1A01G003100 chr7A 86.696 902 109 8 5508 6405 649537 648643 0.000000e+00 990.0
12 TraesCS1A01G003100 chr7A 86.238 901 115 6 5508 6405 408093759 408094653 0.000000e+00 968.0
13 TraesCS1A01G003100 chr7A 87.786 131 14 2 1886 2015 3591845 3591716 1.110000e-32 152.0
14 TraesCS1A01G003100 chr2B 86.570 901 112 6 5508 6405 748155514 748156408 0.000000e+00 985.0
15 TraesCS1A01G003100 chr2B 83.230 161 19 5 1886 2038 191754811 191754971 2.410000e-29 141.0
16 TraesCS1A01G003100 chr2A 86.127 901 116 6 5508 6405 746950658 746949764 0.000000e+00 963.0
17 TraesCS1A01G003100 chr2A 84.413 911 97 23 2208 3074 768628439 768629348 0.000000e+00 854.0
18 TraesCS1A01G003100 chr2A 75.022 1149 166 63 1888 2999 686830930 686831994 2.760000e-113 420.0
19 TraesCS1A01G003100 chr2A 86.994 346 34 8 1886 2222 768628014 768628357 4.690000e-101 379.0
20 TraesCS1A01G003100 chr6B 85.905 901 118 6 5508 6405 29922601 29923495 0.000000e+00 952.0
21 TraesCS1A01G003100 chr4A 78.373 1512 265 43 3740 5221 697764407 697765886 0.000000e+00 924.0
22 TraesCS1A01G003100 chr5A 84.485 883 95 23 2232 3074 635898839 635897959 0.000000e+00 833.0
23 TraesCS1A01G003100 chr5A 86.744 347 34 9 1886 2222 635899323 635898979 6.060000e-100 375.0
24 TraesCS1A01G003100 chr5A 91.379 58 5 0 2208 2265 635898954 635898897 5.320000e-11 80.5
25 TraesCS1A01G003100 chr5A 92.308 52 4 0 2208 2259 635898897 635898846 2.480000e-09 75.0
26 TraesCS1A01G003100 chr1D 79.487 1248 165 39 1886 3074 433923996 433925211 0.000000e+00 802.0
27 TraesCS1A01G003100 chr1D 72.503 731 180 20 1001 1722 76980380 76979662 3.890000e-52 217.0
28 TraesCS1A01G003100 chr1D 88.608 158 16 2 2920 3076 433924150 433923994 2.360000e-44 191.0
29 TraesCS1A01G003100 chr1D 86.325 117 15 1 1887 2003 462105254 462105139 6.740000e-25 126.0
30 TraesCS1A01G003100 chr1B 82.327 447 57 14 1887 2314 35031486 35031043 1.010000e-97 368.0
31 TraesCS1A01G003100 chr1B 71.674 699 179 18 1027 1717 120647564 120646877 6.600000e-40 176.0
32 TraesCS1A01G003100 chrUn 72.207 734 177 24 1001 1722 777338 778056 3.920000e-47 200.0
33 TraesCS1A01G003100 chrUn 72.207 734 177 24 1001 1722 253483476 253484194 3.920000e-47 200.0
34 TraesCS1A01G003100 chrUn 72.207 734 177 24 1001 1722 264407687 264408405 3.920000e-47 200.0
35 TraesCS1A01G003100 chr2D 85.405 185 23 4 2892 3074 39419560 39419742 8.480000e-44 189.0
36 TraesCS1A01G003100 chr2D 82.609 161 17 6 1886 2037 446919161 446919003 1.450000e-26 132.0
37 TraesCS1A01G003100 chr2D 86.555 119 13 3 1886 2001 81810685 81810803 1.870000e-25 128.0
38 TraesCS1A01G003100 chr3B 98.851 87 1 0 5322 5408 487771262 487771176 8.600000e-34 156.0
39 TraesCS1A01G003100 chr6D 80.952 189 31 5 2889 3074 24612136 24612322 1.860000e-30 145.0
40 TraesCS1A01G003100 chr6D 77.174 276 17 15 2150 2404 300899962 300899712 1.130000e-22 119.0
41 TraesCS1A01G003100 chr6A 80.723 166 19 9 1882 2037 570067113 570066951 4.060000e-22 117.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G003100 chr1A 1693199 1699603 6404 True 11828.000 11828 100.0000 1 6405 1 chr1A.!!$R1 6404
1 TraesCS1A01G003100 chr5B 531370242 531371325 1083 False 1953.000 1953 99.1700 5322 6405 1 chr5B.!!$F2 1083
2 TraesCS1A01G003100 chr7B 720082242 720083159 917 True 1110.000 1110 88.5410 5485 6405 1 chr7B.!!$R2 920
3 TraesCS1A01G003100 chr7B 739084989 739085883 894 False 952.000 952 85.9050 5508 6405 1 chr7B.!!$F2 897
4 TraesCS1A01G003100 chr7B 70905785 70906679 894 False 946.000 946 85.7940 5508 6405 1 chr7B.!!$F1 897
5 TraesCS1A01G003100 chr7B 579347873 579349258 1385 True 920.000 920 78.9800 3823 5239 1 chr7B.!!$R1 1416
6 TraesCS1A01G003100 chr7A 648643 649537 894 True 990.000 990 86.6960 5508 6405 1 chr7A.!!$R1 897
7 TraesCS1A01G003100 chr7A 408093759 408094653 894 False 968.000 968 86.2380 5508 6405 1 chr7A.!!$F1 897
8 TraesCS1A01G003100 chr2B 748155514 748156408 894 False 985.000 985 86.5700 5508 6405 1 chr2B.!!$F2 897
9 TraesCS1A01G003100 chr2A 746949764 746950658 894 True 963.000 963 86.1270 5508 6405 1 chr2A.!!$R1 897
10 TraesCS1A01G003100 chr2A 768628014 768629348 1334 False 616.500 854 85.7035 1886 3074 2 chr2A.!!$F2 1188
11 TraesCS1A01G003100 chr2A 686830930 686831994 1064 False 420.000 420 75.0220 1888 2999 1 chr2A.!!$F1 1111
12 TraesCS1A01G003100 chr6B 29922601 29923495 894 False 952.000 952 85.9050 5508 6405 1 chr6B.!!$F1 897
13 TraesCS1A01G003100 chr4A 697764407 697765886 1479 False 924.000 924 78.3730 3740 5221 1 chr4A.!!$F1 1481
14 TraesCS1A01G003100 chr5A 635897959 635899323 1364 True 340.875 833 88.7290 1886 3074 4 chr5A.!!$R1 1188
15 TraesCS1A01G003100 chr1D 433923996 433925211 1215 False 802.000 802 79.4870 1886 3074 1 chr1D.!!$F1 1188
16 TraesCS1A01G003100 chr1D 76979662 76980380 718 True 217.000 217 72.5030 1001 1722 1 chr1D.!!$R1 721


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
892 893 0.103208 CCCTCGCTACCACACATCTC 59.897 60.0 0.00 0.00 0.00 2.75 F
1018 1019 0.036010 AATGGAGGTTGCTCTCGTGG 60.036 55.0 0.00 0.00 34.74 4.94 F
1760 1761 0.036105 ACTTCTGATGATGGCGTGCA 60.036 50.0 0.00 0.00 0.00 4.57 F
3332 3574 0.039180 TCGAGTTGGGCCACTCTCTA 59.961 55.0 25.35 17.22 41.09 2.43 F
3691 3933 0.034896 CACGGGAGCTGTTACACCTT 59.965 55.0 0.00 0.00 0.00 3.50 F
4246 4494 0.036952 AAGAGGCTGTGGTCATGACG 60.037 55.0 19.33 6.92 0.00 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1741 1742 0.036105 TGCACGCCATCATCAGAAGT 60.036 50.0 0.00 0.00 0.00 3.01 R
2879 3120 0.248377 CGTAACGGTTCGGGCTAGAG 60.248 60.0 0.00 0.00 0.00 2.43 R
3672 3914 0.034896 AAGGTGTAACAGCTCCCGTG 59.965 55.0 0.00 0.00 41.59 4.94 R
5319 5585 0.031111 ACCATACTCCTGGCTAGCCA 60.031 55.0 33.82 33.82 45.02 4.75 R
5320 5586 0.682292 GACCATACTCCTGGCTAGCC 59.318 60.0 27.71 27.71 40.15 3.93 R
5425 5691 0.917533 ATCTGATGCTGGCAAGGACT 59.082 50.0 0.00 0.00 0.00 3.85 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
38 39 2.871096 AAACTAATGGCGGTCCTTCA 57.129 45.000 0.00 0.00 0.00 3.02
39 40 2.871096 AACTAATGGCGGTCCTTCAA 57.129 45.000 0.00 0.00 0.00 2.69
40 41 2.871096 ACTAATGGCGGTCCTTCAAA 57.129 45.000 0.00 0.00 0.00 2.69
41 42 3.366052 ACTAATGGCGGTCCTTCAAAT 57.634 42.857 0.00 0.00 0.00 2.32
42 43 3.279434 ACTAATGGCGGTCCTTCAAATC 58.721 45.455 0.00 0.00 0.00 2.17
43 44 2.514458 AATGGCGGTCCTTCAAATCT 57.486 45.000 0.00 0.00 0.00 2.40
44 45 3.644966 AATGGCGGTCCTTCAAATCTA 57.355 42.857 0.00 0.00 0.00 1.98
45 46 2.396590 TGGCGGTCCTTCAAATCTAC 57.603 50.000 0.00 0.00 0.00 2.59
46 47 1.906574 TGGCGGTCCTTCAAATCTACT 59.093 47.619 0.00 0.00 0.00 2.57
47 48 3.101437 TGGCGGTCCTTCAAATCTACTA 58.899 45.455 0.00 0.00 0.00 1.82
48 49 3.709653 TGGCGGTCCTTCAAATCTACTAT 59.290 43.478 0.00 0.00 0.00 2.12
49 50 4.897076 TGGCGGTCCTTCAAATCTACTATA 59.103 41.667 0.00 0.00 0.00 1.31
50 51 5.010719 TGGCGGTCCTTCAAATCTACTATAG 59.989 44.000 0.00 0.00 0.00 1.31
51 52 4.924462 GCGGTCCTTCAAATCTACTATAGC 59.076 45.833 0.00 0.00 0.00 2.97
52 53 5.154932 CGGTCCTTCAAATCTACTATAGCG 58.845 45.833 0.00 0.00 0.00 4.26
53 54 5.471257 GGTCCTTCAAATCTACTATAGCGG 58.529 45.833 0.00 0.00 0.00 5.52
54 55 5.471257 GTCCTTCAAATCTACTATAGCGGG 58.529 45.833 0.00 0.00 0.00 6.13
55 56 4.527038 TCCTTCAAATCTACTATAGCGGGG 59.473 45.833 0.00 0.00 0.00 5.73
56 57 3.955650 TCAAATCTACTATAGCGGGGC 57.044 47.619 0.00 0.00 0.00 5.80
57 58 3.507411 TCAAATCTACTATAGCGGGGCT 58.493 45.455 0.00 0.00 43.41 5.19
58 59 4.669700 TCAAATCTACTATAGCGGGGCTA 58.330 43.478 0.00 0.00 45.55 3.93
108 109 9.875691 GATAACTGTACATGAATCATATAGCCA 57.124 33.333 0.00 0.00 0.00 4.75
109 110 9.881649 ATAACTGTACATGAATCATATAGCCAG 57.118 33.333 0.00 0.00 0.00 4.85
110 111 7.308450 ACTGTACATGAATCATATAGCCAGT 57.692 36.000 0.00 0.00 0.00 4.00
111 112 7.382110 ACTGTACATGAATCATATAGCCAGTC 58.618 38.462 0.00 0.00 0.00 3.51
112 113 7.015584 ACTGTACATGAATCATATAGCCAGTCA 59.984 37.037 0.00 0.00 0.00 3.41
113 114 7.910584 TGTACATGAATCATATAGCCAGTCAT 58.089 34.615 0.00 0.00 0.00 3.06
114 115 8.377799 TGTACATGAATCATATAGCCAGTCATT 58.622 33.333 0.00 0.00 0.00 2.57
115 116 9.224267 GTACATGAATCATATAGCCAGTCATTT 57.776 33.333 0.00 0.00 0.00 2.32
117 118 9.445878 ACATGAATCATATAGCCAGTCATTTAG 57.554 33.333 0.00 0.00 0.00 1.85
118 119 7.912056 TGAATCATATAGCCAGTCATTTAGC 57.088 36.000 0.00 0.00 0.00 3.09
119 120 7.452562 TGAATCATATAGCCAGTCATTTAGCA 58.547 34.615 0.00 0.00 0.00 3.49
120 121 7.605309 TGAATCATATAGCCAGTCATTTAGCAG 59.395 37.037 0.00 0.00 0.00 4.24
121 122 6.670695 TCATATAGCCAGTCATTTAGCAGA 57.329 37.500 0.00 0.00 0.00 4.26
122 123 7.066307 TCATATAGCCAGTCATTTAGCAGAA 57.934 36.000 0.00 0.00 0.00 3.02
123 124 6.931281 TCATATAGCCAGTCATTTAGCAGAAC 59.069 38.462 0.00 0.00 0.00 3.01
124 125 2.716217 AGCCAGTCATTTAGCAGAACC 58.284 47.619 0.00 0.00 0.00 3.62
125 126 1.398390 GCCAGTCATTTAGCAGAACCG 59.602 52.381 0.00 0.00 0.00 4.44
126 127 2.699954 CCAGTCATTTAGCAGAACCGT 58.300 47.619 0.00 0.00 0.00 4.83
127 128 3.074412 CCAGTCATTTAGCAGAACCGTT 58.926 45.455 0.00 0.00 0.00 4.44
128 129 3.125316 CCAGTCATTTAGCAGAACCGTTC 59.875 47.826 2.81 2.81 0.00 3.95
129 130 3.997021 CAGTCATTTAGCAGAACCGTTCT 59.003 43.478 8.03 8.03 41.70 3.01
130 131 4.092091 CAGTCATTTAGCAGAACCGTTCTC 59.908 45.833 10.98 6.70 38.11 2.87
131 132 3.994392 GTCATTTAGCAGAACCGTTCTCA 59.006 43.478 10.98 0.00 38.11 3.27
132 133 4.451096 GTCATTTAGCAGAACCGTTCTCAA 59.549 41.667 10.98 3.54 38.11 3.02
133 134 5.049680 GTCATTTAGCAGAACCGTTCTCAAA 60.050 40.000 10.98 11.44 38.11 2.69
134 135 5.529430 TCATTTAGCAGAACCGTTCTCAAAA 59.471 36.000 10.98 11.42 38.11 2.44
135 136 4.806342 TTAGCAGAACCGTTCTCAAAAC 57.194 40.909 10.98 0.00 38.11 2.43
136 137 1.597663 AGCAGAACCGTTCTCAAAACG 59.402 47.619 10.98 3.46 38.11 3.60
137 138 1.920272 GCAGAACCGTTCTCAAAACGC 60.920 52.381 10.98 6.99 41.85 4.84
138 139 1.597663 CAGAACCGTTCTCAAAACGCT 59.402 47.619 10.98 0.00 41.85 5.07
139 140 2.798283 CAGAACCGTTCTCAAAACGCTA 59.202 45.455 10.98 0.00 41.85 4.26
140 141 2.798847 AGAACCGTTCTCAAAACGCTAC 59.201 45.455 8.03 0.00 41.85 3.58
141 142 2.228138 ACCGTTCTCAAAACGCTACA 57.772 45.000 4.86 0.00 41.85 2.74
142 143 2.553086 ACCGTTCTCAAAACGCTACAA 58.447 42.857 4.86 0.00 41.85 2.41
143 144 2.286025 ACCGTTCTCAAAACGCTACAAC 59.714 45.455 4.86 0.00 41.85 3.32
144 145 2.546665 CGTTCTCAAAACGCTACAACG 58.453 47.619 0.00 0.00 36.82 4.10
145 146 2.658224 CGTTCTCAAAACGCTACAACGG 60.658 50.000 0.00 0.00 36.82 4.44
146 147 2.512485 TCTCAAAACGCTACAACGGA 57.488 45.000 0.00 0.00 37.37 4.69
147 148 2.400399 TCTCAAAACGCTACAACGGAG 58.600 47.619 0.00 0.00 37.37 4.63
149 150 3.004629 TCTCAAAACGCTACAACGGAGTA 59.995 43.478 0.00 0.00 45.00 2.59
150 151 3.916761 TCAAAACGCTACAACGGAGTAT 58.083 40.909 0.00 0.00 45.00 2.12
151 152 5.058149 TCAAAACGCTACAACGGAGTATA 57.942 39.130 0.00 0.00 45.00 1.47
152 153 5.097529 TCAAAACGCTACAACGGAGTATAG 58.902 41.667 0.00 0.00 45.00 1.31
153 154 2.770699 ACGCTACAACGGAGTATAGC 57.229 50.000 6.40 6.40 45.00 2.97
154 155 2.295885 ACGCTACAACGGAGTATAGCT 58.704 47.619 11.85 0.00 45.00 3.32
155 156 2.033049 ACGCTACAACGGAGTATAGCTG 59.967 50.000 0.00 9.05 45.00 4.24
156 157 2.604855 CGCTACAACGGAGTATAGCTGG 60.605 54.545 0.00 0.00 45.00 4.85
157 158 2.862921 GCTACAACGGAGTATAGCTGGC 60.863 54.545 0.00 0.00 45.00 4.85
158 159 1.486211 ACAACGGAGTATAGCTGGCT 58.514 50.000 0.00 0.00 45.00 4.75
159 160 2.662866 ACAACGGAGTATAGCTGGCTA 58.337 47.619 4.72 4.72 45.00 3.93
160 161 3.231818 ACAACGGAGTATAGCTGGCTAT 58.768 45.455 17.51 17.51 45.00 2.97
161 162 3.641906 ACAACGGAGTATAGCTGGCTATT 59.358 43.478 18.40 3.80 45.00 1.73
162 163 4.101119 ACAACGGAGTATAGCTGGCTATTT 59.899 41.667 18.40 9.07 45.00 1.40
163 164 5.303589 ACAACGGAGTATAGCTGGCTATTTA 59.696 40.000 18.40 1.30 45.00 1.40
164 165 5.646577 ACGGAGTATAGCTGGCTATTTAG 57.353 43.478 18.40 9.76 41.94 1.85
165 166 5.322754 ACGGAGTATAGCTGGCTATTTAGA 58.677 41.667 18.40 0.31 41.94 2.10
166 167 5.773680 ACGGAGTATAGCTGGCTATTTAGAA 59.226 40.000 18.40 0.00 41.94 2.10
167 168 6.094061 CGGAGTATAGCTGGCTATTTAGAAC 58.906 44.000 18.40 11.09 39.65 3.01
168 169 6.071840 CGGAGTATAGCTGGCTATTTAGAACT 60.072 42.308 18.40 14.92 39.65 3.01
169 170 7.524038 CGGAGTATAGCTGGCTATTTAGAACTT 60.524 40.741 18.40 3.44 39.65 2.66
170 171 8.151596 GGAGTATAGCTGGCTATTTAGAACTTT 58.848 37.037 18.40 0.00 39.65 2.66
171 172 9.549078 GAGTATAGCTGGCTATTTAGAACTTTT 57.451 33.333 18.40 0.00 39.65 2.27
172 173 9.549078 AGTATAGCTGGCTATTTAGAACTTTTC 57.451 33.333 18.40 0.00 39.65 2.29
173 174 9.549078 GTATAGCTGGCTATTTAGAACTTTTCT 57.451 33.333 18.40 0.00 40.29 2.52
174 175 6.749923 AGCTGGCTATTTAGAACTTTTCTG 57.250 37.500 0.00 0.00 40.94 3.02
175 176 5.649831 AGCTGGCTATTTAGAACTTTTCTGG 59.350 40.000 0.00 0.00 40.94 3.86
176 177 5.648092 GCTGGCTATTTAGAACTTTTCTGGA 59.352 40.000 0.00 0.00 40.94 3.86
177 178 6.403746 GCTGGCTATTTAGAACTTTTCTGGAC 60.404 42.308 0.00 0.00 40.94 4.02
178 179 6.539173 TGGCTATTTAGAACTTTTCTGGACA 58.461 36.000 0.00 0.00 40.94 4.02
179 180 7.001674 TGGCTATTTAGAACTTTTCTGGACAA 58.998 34.615 0.00 0.00 40.94 3.18
180 181 7.040686 TGGCTATTTAGAACTTTTCTGGACAAC 60.041 37.037 0.00 0.00 40.94 3.32
181 182 7.306213 GCTATTTAGAACTTTTCTGGACAACC 58.694 38.462 0.00 0.00 40.94 3.77
182 183 5.744666 TTTAGAACTTTTCTGGACAACCG 57.255 39.130 0.00 0.00 40.94 4.44
183 184 3.277142 AGAACTTTTCTGGACAACCGT 57.723 42.857 0.00 0.00 38.91 4.83
184 185 4.411256 AGAACTTTTCTGGACAACCGTA 57.589 40.909 0.00 0.00 38.91 4.02
185 186 4.124970 AGAACTTTTCTGGACAACCGTAC 58.875 43.478 0.00 0.00 38.91 3.67
186 187 3.547054 ACTTTTCTGGACAACCGTACA 57.453 42.857 0.00 0.00 39.42 2.90
187 188 4.081322 ACTTTTCTGGACAACCGTACAT 57.919 40.909 0.00 0.00 34.66 2.29
188 189 3.813166 ACTTTTCTGGACAACCGTACATG 59.187 43.478 0.00 0.00 34.66 3.21
189 190 3.755112 TTTCTGGACAACCGTACATGA 57.245 42.857 0.00 0.00 34.66 3.07
190 191 3.755112 TTCTGGACAACCGTACATGAA 57.245 42.857 0.00 0.00 34.66 2.57
191 192 3.973206 TCTGGACAACCGTACATGAAT 57.027 42.857 0.00 0.00 34.66 2.57
192 193 3.857052 TCTGGACAACCGTACATGAATC 58.143 45.455 0.00 0.00 34.66 2.52
193 194 3.259625 TCTGGACAACCGTACATGAATCA 59.740 43.478 0.00 0.00 34.66 2.57
194 195 4.081142 TCTGGACAACCGTACATGAATCAT 60.081 41.667 0.00 0.00 34.66 2.45
195 196 3.938334 TGGACAACCGTACATGAATCATG 59.062 43.478 20.58 20.58 42.17 3.07
196 197 4.564613 TGGACAACCGTACATGAATCATGT 60.565 41.667 28.78 28.78 46.58 3.21
197 198 5.337652 TGGACAACCGTACATGAATCATGTA 60.338 40.000 26.80 26.80 44.87 2.29
205 206 2.837498 CATGAATCATGTAGCCGGTCA 58.163 47.619 14.70 0.35 37.12 4.02
206 207 3.405831 CATGAATCATGTAGCCGGTCAT 58.594 45.455 14.70 3.07 37.12 3.06
207 208 3.558931 TGAATCATGTAGCCGGTCATT 57.441 42.857 1.90 0.00 0.00 2.57
208 209 3.884895 TGAATCATGTAGCCGGTCATTT 58.115 40.909 1.90 0.00 0.00 2.32
209 210 5.029807 TGAATCATGTAGCCGGTCATTTA 57.970 39.130 1.90 0.00 0.00 1.40
210 211 4.814234 TGAATCATGTAGCCGGTCATTTAC 59.186 41.667 1.90 0.00 0.00 2.01
211 212 3.188159 TCATGTAGCCGGTCATTTACC 57.812 47.619 1.90 0.00 45.77 2.85
218 219 3.803886 GGTCATTTACCGGCGACC 58.196 61.111 9.30 6.60 41.08 4.79
219 220 1.219935 GGTCATTTACCGGCGACCT 59.780 57.895 9.30 0.00 43.79 3.85
220 221 0.461135 GGTCATTTACCGGCGACCTA 59.539 55.000 9.30 0.00 43.79 3.08
221 222 1.564207 GTCATTTACCGGCGACCTAC 58.436 55.000 9.30 0.00 0.00 3.18
222 223 1.135721 GTCATTTACCGGCGACCTACT 59.864 52.381 9.30 0.00 0.00 2.57
223 224 1.406539 TCATTTACCGGCGACCTACTC 59.593 52.381 9.30 0.00 0.00 2.59
224 225 1.135527 CATTTACCGGCGACCTACTCA 59.864 52.381 9.30 0.00 0.00 3.41
225 226 1.255882 TTTACCGGCGACCTACTCAA 58.744 50.000 9.30 0.00 0.00 3.02
226 227 1.255882 TTACCGGCGACCTACTCAAA 58.744 50.000 9.30 0.00 0.00 2.69
227 228 1.255882 TACCGGCGACCTACTCAAAA 58.744 50.000 9.30 0.00 0.00 2.44
228 229 0.320160 ACCGGCGACCTACTCAAAAC 60.320 55.000 9.30 0.00 0.00 2.43
229 230 0.320073 CCGGCGACCTACTCAAAACA 60.320 55.000 9.30 0.00 0.00 2.83
230 231 0.788391 CGGCGACCTACTCAAAACAC 59.212 55.000 0.00 0.00 0.00 3.32
231 232 1.604693 CGGCGACCTACTCAAAACACT 60.605 52.381 0.00 0.00 0.00 3.55
232 233 2.352030 CGGCGACCTACTCAAAACACTA 60.352 50.000 0.00 0.00 0.00 2.74
233 234 2.991866 GGCGACCTACTCAAAACACTAC 59.008 50.000 0.00 0.00 0.00 2.73
234 235 3.553508 GGCGACCTACTCAAAACACTACA 60.554 47.826 0.00 0.00 0.00 2.74
235 236 4.053295 GCGACCTACTCAAAACACTACAA 58.947 43.478 0.00 0.00 0.00 2.41
236 237 4.084693 GCGACCTACTCAAAACACTACAAC 60.085 45.833 0.00 0.00 0.00 3.32
237 238 5.045215 CGACCTACTCAAAACACTACAACA 58.955 41.667 0.00 0.00 0.00 3.33
238 239 5.521010 CGACCTACTCAAAACACTACAACAA 59.479 40.000 0.00 0.00 0.00 2.83
239 240 6.292168 CGACCTACTCAAAACACTACAACAAG 60.292 42.308 0.00 0.00 0.00 3.16
240 241 5.820947 ACCTACTCAAAACACTACAACAAGG 59.179 40.000 0.00 0.00 0.00 3.61
241 242 4.632538 ACTCAAAACACTACAACAAGGC 57.367 40.909 0.00 0.00 0.00 4.35
242 243 4.270008 ACTCAAAACACTACAACAAGGCT 58.730 39.130 0.00 0.00 0.00 4.58
243 244 5.433526 ACTCAAAACACTACAACAAGGCTA 58.566 37.500 0.00 0.00 0.00 3.93
244 245 6.062095 ACTCAAAACACTACAACAAGGCTAT 58.938 36.000 0.00 0.00 0.00 2.97
245 246 7.221450 ACTCAAAACACTACAACAAGGCTATA 58.779 34.615 0.00 0.00 0.00 1.31
246 247 7.387948 ACTCAAAACACTACAACAAGGCTATAG 59.612 37.037 0.00 0.00 0.00 1.31
247 248 6.148811 TCAAAACACTACAACAAGGCTATAGC 59.851 38.462 16.78 16.78 41.14 2.97
262 263 4.914540 GCTATAGCCAGCTTTTTCAGAAC 58.085 43.478 14.13 0.00 38.57 3.01
263 264 4.201960 GCTATAGCCAGCTTTTTCAGAACC 60.202 45.833 14.13 0.00 38.57 3.62
264 265 2.371658 AGCCAGCTTTTTCAGAACCT 57.628 45.000 0.00 0.00 0.00 3.50
265 266 2.670939 AGCCAGCTTTTTCAGAACCTT 58.329 42.857 0.00 0.00 0.00 3.50
266 267 3.033909 AGCCAGCTTTTTCAGAACCTTT 58.966 40.909 0.00 0.00 0.00 3.11
267 268 3.452264 AGCCAGCTTTTTCAGAACCTTTT 59.548 39.130 0.00 0.00 0.00 2.27
268 269 4.080919 AGCCAGCTTTTTCAGAACCTTTTT 60.081 37.500 0.00 0.00 0.00 1.94
269 270 4.034394 GCCAGCTTTTTCAGAACCTTTTTG 59.966 41.667 0.00 0.00 0.00 2.44
270 271 5.418676 CCAGCTTTTTCAGAACCTTTTTGA 58.581 37.500 0.00 0.00 0.00 2.69
271 272 5.291858 CCAGCTTTTTCAGAACCTTTTTGAC 59.708 40.000 0.00 0.00 0.00 3.18
272 273 5.868801 CAGCTTTTTCAGAACCTTTTTGACA 59.131 36.000 0.00 0.00 0.00 3.58
273 274 6.368516 CAGCTTTTTCAGAACCTTTTTGACAA 59.631 34.615 0.00 0.00 0.00 3.18
274 275 7.064966 CAGCTTTTTCAGAACCTTTTTGACAAT 59.935 33.333 0.00 0.00 0.00 2.71
275 276 7.607607 AGCTTTTTCAGAACCTTTTTGACAATT 59.392 29.630 0.00 0.00 0.00 2.32
276 277 8.878769 GCTTTTTCAGAACCTTTTTGACAATTA 58.121 29.630 0.00 0.00 0.00 1.40
307 308 9.725019 TGAATACTATAGCCAATCATTTAGTGG 57.275 33.333 0.00 0.00 46.46 4.00
308 309 9.944376 GAATACTATAGCCAATCATTTAGTGGA 57.056 33.333 0.00 0.00 46.68 4.02
310 311 9.726438 ATACTATAGCCAATCATTTAGTGGAAC 57.274 33.333 0.00 0.00 46.68 3.62
311 312 7.573710 ACTATAGCCAATCATTTAGTGGAACA 58.426 34.615 0.00 0.00 46.68 3.18
312 313 8.220559 ACTATAGCCAATCATTTAGTGGAACAT 58.779 33.333 0.00 0.00 46.68 2.71
313 314 7.902920 ATAGCCAATCATTTAGTGGAACATT 57.097 32.000 0.00 0.00 46.68 2.71
314 315 5.969423 AGCCAATCATTTAGTGGAACATTG 58.031 37.500 0.00 0.00 46.68 2.82
315 316 5.716228 AGCCAATCATTTAGTGGAACATTGA 59.284 36.000 0.00 0.00 46.68 2.57
316 317 6.381994 AGCCAATCATTTAGTGGAACATTGAT 59.618 34.615 0.00 0.00 46.68 2.57
317 318 7.560991 AGCCAATCATTTAGTGGAACATTGATA 59.439 33.333 0.00 0.00 46.68 2.15
318 319 8.362639 GCCAATCATTTAGTGGAACATTGATAT 58.637 33.333 0.00 0.00 46.68 1.63
321 322 9.754382 AATCATTTAGTGGAACATTGATATTGC 57.246 29.630 0.00 0.00 44.52 3.56
322 323 7.715657 TCATTTAGTGGAACATTGATATTGCC 58.284 34.615 0.00 0.00 44.52 4.52
323 324 7.560991 TCATTTAGTGGAACATTGATATTGCCT 59.439 33.333 0.00 0.00 44.52 4.75
324 325 8.849168 CATTTAGTGGAACATTGATATTGCCTA 58.151 33.333 0.00 0.00 44.52 3.93
325 326 8.450578 TTTAGTGGAACATTGATATTGCCTAG 57.549 34.615 0.00 0.00 44.52 3.02
326 327 6.006275 AGTGGAACATTGATATTGCCTAGT 57.994 37.500 0.00 0.00 44.52 2.57
327 328 5.824624 AGTGGAACATTGATATTGCCTAGTG 59.175 40.000 0.00 0.00 44.52 2.74
328 329 5.590259 GTGGAACATTGATATTGCCTAGTGT 59.410 40.000 0.00 0.00 44.52 3.55
329 330 5.822519 TGGAACATTGATATTGCCTAGTGTC 59.177 40.000 0.00 0.00 0.00 3.67
330 331 5.822519 GGAACATTGATATTGCCTAGTGTCA 59.177 40.000 0.00 0.00 0.00 3.58
331 332 6.017605 GGAACATTGATATTGCCTAGTGTCAG 60.018 42.308 0.00 0.00 0.00 3.51
332 333 6.239217 ACATTGATATTGCCTAGTGTCAGA 57.761 37.500 0.00 0.00 0.00 3.27
333 334 6.653020 ACATTGATATTGCCTAGTGTCAGAA 58.347 36.000 0.00 0.00 0.00 3.02
334 335 6.765036 ACATTGATATTGCCTAGTGTCAGAAG 59.235 38.462 0.00 0.00 0.00 2.85
335 336 4.697514 TGATATTGCCTAGTGTCAGAAGC 58.302 43.478 0.00 0.00 0.00 3.86
336 337 4.406972 TGATATTGCCTAGTGTCAGAAGCT 59.593 41.667 0.00 0.00 0.00 3.74
337 338 5.598417 TGATATTGCCTAGTGTCAGAAGCTA 59.402 40.000 0.00 0.00 0.00 3.32
338 339 6.268617 TGATATTGCCTAGTGTCAGAAGCTAT 59.731 38.462 0.00 0.00 0.00 2.97
339 340 7.451566 TGATATTGCCTAGTGTCAGAAGCTATA 59.548 37.037 0.00 0.00 0.00 1.31
340 341 5.932619 TTGCCTAGTGTCAGAAGCTATAA 57.067 39.130 0.00 0.00 0.00 0.98
341 342 5.263968 TGCCTAGTGTCAGAAGCTATAAC 57.736 43.478 0.00 0.00 0.00 1.89
342 343 4.709886 TGCCTAGTGTCAGAAGCTATAACA 59.290 41.667 0.00 0.00 0.00 2.41
343 344 5.163509 TGCCTAGTGTCAGAAGCTATAACAG 60.164 44.000 0.00 0.00 0.00 3.16
344 345 5.737635 GCCTAGTGTCAGAAGCTATAACAGG 60.738 48.000 0.00 0.00 0.00 4.00
345 346 4.130286 AGTGTCAGAAGCTATAACAGGC 57.870 45.455 0.00 0.00 0.00 4.85
346 347 3.772025 AGTGTCAGAAGCTATAACAGGCT 59.228 43.478 0.00 0.00 40.85 4.58
347 348 4.956700 AGTGTCAGAAGCTATAACAGGCTA 59.043 41.667 0.00 0.00 37.87 3.93
348 349 5.422331 AGTGTCAGAAGCTATAACAGGCTAA 59.578 40.000 0.00 0.00 37.87 3.09
349 350 6.070767 AGTGTCAGAAGCTATAACAGGCTAAA 60.071 38.462 0.00 0.00 37.87 1.85
350 351 6.256757 GTGTCAGAAGCTATAACAGGCTAAAG 59.743 42.308 0.00 0.00 37.87 1.85
351 352 6.070767 TGTCAGAAGCTATAACAGGCTAAAGT 60.071 38.462 0.00 0.00 37.87 2.66
352 353 6.477360 GTCAGAAGCTATAACAGGCTAAAGTC 59.523 42.308 0.00 0.00 37.87 3.01
353 354 6.154534 TCAGAAGCTATAACAGGCTAAAGTCA 59.845 38.462 0.00 0.00 37.87 3.41
354 355 6.478344 CAGAAGCTATAACAGGCTAAAGTCAG 59.522 42.308 0.00 0.00 37.87 3.51
355 356 4.698575 AGCTATAACAGGCTAAAGTCAGC 58.301 43.478 0.00 0.00 41.02 4.26
356 357 4.407296 AGCTATAACAGGCTAAAGTCAGCT 59.593 41.667 0.00 0.00 41.50 4.24
357 358 5.598830 AGCTATAACAGGCTAAAGTCAGCTA 59.401 40.000 6.84 0.00 41.50 3.32
358 359 6.268847 AGCTATAACAGGCTAAAGTCAGCTAT 59.731 38.462 6.84 0.00 41.50 2.97
359 360 6.931840 GCTATAACAGGCTAAAGTCAGCTATT 59.068 38.462 0.00 0.00 41.50 1.73
360 361 7.442666 GCTATAACAGGCTAAAGTCAGCTATTT 59.557 37.037 0.00 0.00 41.50 1.40
361 362 9.982651 CTATAACAGGCTAAAGTCAGCTATTTA 57.017 33.333 0.00 0.00 41.50 1.40
363 364 7.996098 AACAGGCTAAAGTCAGCTATTTAAA 57.004 32.000 0.00 0.00 41.50 1.52
364 365 7.996098 ACAGGCTAAAGTCAGCTATTTAAAA 57.004 32.000 0.00 0.00 41.50 1.52
365 366 7.817641 ACAGGCTAAAGTCAGCTATTTAAAAC 58.182 34.615 0.00 0.00 41.50 2.43
366 367 7.447238 ACAGGCTAAAGTCAGCTATTTAAAACA 59.553 33.333 0.00 0.00 41.50 2.83
367 368 8.462016 CAGGCTAAAGTCAGCTATTTAAAACAT 58.538 33.333 0.00 0.00 41.50 2.71
368 369 9.025041 AGGCTAAAGTCAGCTATTTAAAACATT 57.975 29.630 0.00 0.00 41.50 2.71
369 370 9.076596 GGCTAAAGTCAGCTATTTAAAACATTG 57.923 33.333 0.00 0.00 41.50 2.82
370 371 9.840427 GCTAAAGTCAGCTATTTAAAACATTGA 57.160 29.630 0.00 0.00 38.57 2.57
377 378 9.748708 TCAGCTATTTAAAACATTGATATTGCC 57.251 29.630 0.00 0.00 0.00 4.52
378 379 8.693504 CAGCTATTTAAAACATTGATATTGCCG 58.306 33.333 0.00 0.00 0.00 5.69
379 380 8.629158 AGCTATTTAAAACATTGATATTGCCGA 58.371 29.630 0.00 0.00 0.00 5.54
380 381 8.905702 GCTATTTAAAACATTGATATTGCCGAG 58.094 33.333 0.00 0.00 0.00 4.63
381 382 9.950680 CTATTTAAAACATTGATATTGCCGAGT 57.049 29.630 0.00 0.00 0.00 4.18
382 383 8.633075 ATTTAAAACATTGATATTGCCGAGTG 57.367 30.769 0.00 0.00 0.00 3.51
383 384 3.698029 AACATTGATATTGCCGAGTGC 57.302 42.857 0.00 0.00 41.77 4.40
384 385 1.949525 ACATTGATATTGCCGAGTGCC 59.050 47.619 0.00 0.00 40.16 5.01
385 386 1.267806 CATTGATATTGCCGAGTGCCC 59.732 52.381 0.00 0.00 40.16 5.36
386 387 0.546122 TTGATATTGCCGAGTGCCCT 59.454 50.000 0.00 0.00 40.16 5.19
387 388 0.106708 TGATATTGCCGAGTGCCCTC 59.893 55.000 0.00 0.00 40.16 4.30
388 389 0.106708 GATATTGCCGAGTGCCCTCA 59.893 55.000 0.00 0.00 40.16 3.86
389 390 0.767375 ATATTGCCGAGTGCCCTCAT 59.233 50.000 0.00 0.00 40.16 2.90
390 391 0.106708 TATTGCCGAGTGCCCTCATC 59.893 55.000 0.00 0.00 40.16 2.92
391 392 1.913951 ATTGCCGAGTGCCCTCATCA 61.914 55.000 0.00 0.00 40.16 3.07
392 393 2.512515 GCCGAGTGCCCTCATCAC 60.513 66.667 0.00 0.00 37.59 3.06
393 394 2.981302 CCGAGTGCCCTCATCACA 59.019 61.111 0.00 0.00 37.59 3.58
394 395 1.296392 CCGAGTGCCCTCATCACAA 59.704 57.895 0.00 0.00 37.59 3.33
395 396 0.742281 CCGAGTGCCCTCATCACAAG 60.742 60.000 0.00 0.00 37.59 3.16
396 397 0.742281 CGAGTGCCCTCATCACAAGG 60.742 60.000 0.00 0.00 37.59 3.61
397 398 0.615331 GAGTGCCCTCATCACAAGGA 59.385 55.000 0.00 0.00 37.67 3.36
398 399 1.211457 GAGTGCCCTCATCACAAGGAT 59.789 52.381 0.00 0.00 37.67 3.24
399 400 2.435805 GAGTGCCCTCATCACAAGGATA 59.564 50.000 0.00 0.00 37.67 2.59
400 401 2.171448 AGTGCCCTCATCACAAGGATAC 59.829 50.000 0.00 0.00 35.83 2.24
401 402 4.143696 AGTGCCCTCATCACAAGGATACT 61.144 47.826 0.00 0.00 39.62 2.12
402 403 4.879683 AGTGCCCTCATCACAAGGATACTA 60.880 45.833 0.00 0.00 40.46 1.82
403 404 6.913009 AGTGCCCTCATCACAAGGATACTAC 61.913 48.000 0.00 0.00 40.46 2.73
415 416 2.448453 GGATACTACCCCATCCTCTCG 58.552 57.143 0.00 0.00 38.16 4.04
416 417 2.225066 GGATACTACCCCATCCTCTCGT 60.225 54.545 0.00 0.00 38.16 4.18
417 418 3.009916 GGATACTACCCCATCCTCTCGTA 59.990 52.174 0.00 0.00 38.16 3.43
418 419 4.325187 GGATACTACCCCATCCTCTCGTAT 60.325 50.000 0.00 0.00 38.16 3.06
419 420 3.614568 ACTACCCCATCCTCTCGTATT 57.385 47.619 0.00 0.00 0.00 1.89
420 421 3.924922 ACTACCCCATCCTCTCGTATTT 58.075 45.455 0.00 0.00 0.00 1.40
421 422 3.641906 ACTACCCCATCCTCTCGTATTTG 59.358 47.826 0.00 0.00 0.00 2.32
422 423 1.768870 ACCCCATCCTCTCGTATTTGG 59.231 52.381 0.00 0.00 0.00 3.28
423 424 1.768870 CCCCATCCTCTCGTATTTGGT 59.231 52.381 0.00 0.00 0.00 3.67
424 425 2.172717 CCCCATCCTCTCGTATTTGGTT 59.827 50.000 0.00 0.00 0.00 3.67
425 426 3.371595 CCCCATCCTCTCGTATTTGGTTT 60.372 47.826 0.00 0.00 0.00 3.27
426 427 4.141574 CCCCATCCTCTCGTATTTGGTTTA 60.142 45.833 0.00 0.00 0.00 2.01
427 428 5.433526 CCCATCCTCTCGTATTTGGTTTAA 58.566 41.667 0.00 0.00 0.00 1.52
428 429 5.883673 CCCATCCTCTCGTATTTGGTTTAAA 59.116 40.000 0.00 0.00 0.00 1.52
429 430 6.038271 CCCATCCTCTCGTATTTGGTTTAAAG 59.962 42.308 0.00 0.00 0.00 1.85
430 431 6.598064 CCATCCTCTCGTATTTGGTTTAAAGT 59.402 38.462 0.00 0.00 0.00 2.66
431 432 7.414098 CCATCCTCTCGTATTTGGTTTAAAGTG 60.414 40.741 0.00 0.00 0.00 3.16
432 433 6.527423 TCCTCTCGTATTTGGTTTAAAGTGT 58.473 36.000 0.00 0.00 0.00 3.55
433 434 6.425721 TCCTCTCGTATTTGGTTTAAAGTGTG 59.574 38.462 0.00 0.00 0.00 3.82
434 435 6.425721 CCTCTCGTATTTGGTTTAAAGTGTGA 59.574 38.462 0.00 0.00 0.00 3.58
435 436 7.181143 TCTCGTATTTGGTTTAAAGTGTGAC 57.819 36.000 0.00 0.00 0.00 3.67
436 437 6.203338 TCTCGTATTTGGTTTAAAGTGTGACC 59.797 38.462 0.00 0.00 0.00 4.02
437 438 5.821470 TCGTATTTGGTTTAAAGTGTGACCA 59.179 36.000 0.00 0.00 40.23 4.02
438 439 6.487331 TCGTATTTGGTTTAAAGTGTGACCAT 59.513 34.615 0.00 0.00 41.45 3.55
439 440 6.799925 CGTATTTGGTTTAAAGTGTGACCATC 59.200 38.462 0.00 0.00 41.45 3.51
440 441 6.976934 ATTTGGTTTAAAGTGTGACCATCT 57.023 33.333 0.00 0.00 41.45 2.90
441 442 9.005777 GTATTTGGTTTAAAGTGTGACCATCTA 57.994 33.333 0.00 0.00 41.45 1.98
442 443 8.650143 ATTTGGTTTAAAGTGTGACCATCTAT 57.350 30.769 0.00 0.00 41.45 1.98
443 444 7.681939 TTGGTTTAAAGTGTGACCATCTATC 57.318 36.000 0.00 0.00 41.45 2.08
444 445 7.016153 TGGTTTAAAGTGTGACCATCTATCT 57.984 36.000 0.00 0.00 37.26 1.98
445 446 8.141298 TGGTTTAAAGTGTGACCATCTATCTA 57.859 34.615 0.00 0.00 37.26 1.98
446 447 8.598916 TGGTTTAAAGTGTGACCATCTATCTAA 58.401 33.333 0.00 0.00 37.26 2.10
447 448 9.444600 GGTTTAAAGTGTGACCATCTATCTAAA 57.555 33.333 0.00 0.00 32.41 1.85
452 453 9.739276 AAAGTGTGACCATCTATCTAAAAATGA 57.261 29.630 0.00 0.00 0.00 2.57
453 454 9.739276 AAGTGTGACCATCTATCTAAAAATGAA 57.261 29.630 0.00 0.00 0.00 2.57
454 455 9.388506 AGTGTGACCATCTATCTAAAAATGAAG 57.611 33.333 0.00 0.00 0.00 3.02
455 456 9.167311 GTGTGACCATCTATCTAAAAATGAAGT 57.833 33.333 0.00 0.00 0.00 3.01
506 507 8.748380 AGATTTTCTCTTAAAATTGGCTTTCG 57.252 30.769 0.00 0.00 30.68 3.46
507 508 7.814587 AGATTTTCTCTTAAAATTGGCTTTCGG 59.185 33.333 0.00 0.00 30.68 4.30
508 509 4.434713 TCTCTTAAAATTGGCTTTCGGC 57.565 40.909 0.00 0.00 40.90 5.54
509 510 4.079253 TCTCTTAAAATTGGCTTTCGGCT 58.921 39.130 0.00 0.00 41.46 5.52
510 511 4.156008 TCTCTTAAAATTGGCTTTCGGCTC 59.844 41.667 0.00 0.00 41.46 4.70
511 512 2.911819 TAAAATTGGCTTTCGGCTCG 57.088 45.000 0.00 0.00 41.46 5.03
512 513 0.388520 AAAATTGGCTTTCGGCTCGC 60.389 50.000 0.00 0.00 41.46 5.03
513 514 1.244019 AAATTGGCTTTCGGCTCGCT 61.244 50.000 0.00 0.00 41.46 4.93
514 515 1.244019 AATTGGCTTTCGGCTCGCTT 61.244 50.000 0.00 0.00 41.46 4.68
515 516 1.244019 ATTGGCTTTCGGCTCGCTTT 61.244 50.000 0.00 0.00 41.46 3.51
516 517 1.452145 TTGGCTTTCGGCTCGCTTTT 61.452 50.000 0.00 0.00 41.46 2.27
517 518 0.604243 TGGCTTTCGGCTCGCTTTTA 60.604 50.000 0.00 0.00 41.46 1.52
518 519 0.733150 GGCTTTCGGCTCGCTTTTAT 59.267 50.000 0.00 0.00 41.46 1.40
519 520 1.937899 GGCTTTCGGCTCGCTTTTATA 59.062 47.619 0.00 0.00 41.46 0.98
520 521 2.353579 GGCTTTCGGCTCGCTTTTATAA 59.646 45.455 0.00 0.00 41.46 0.98
521 522 3.181504 GGCTTTCGGCTCGCTTTTATAAA 60.182 43.478 0.00 0.00 41.46 1.40
522 523 4.497507 GGCTTTCGGCTCGCTTTTATAAAT 60.498 41.667 0.00 0.00 41.46 1.40
523 524 5.277634 GGCTTTCGGCTCGCTTTTATAAATA 60.278 40.000 0.00 0.00 41.46 1.40
524 525 6.196571 GCTTTCGGCTCGCTTTTATAAATAA 58.803 36.000 0.00 0.00 38.06 1.40
525 526 6.689669 GCTTTCGGCTCGCTTTTATAAATAAA 59.310 34.615 0.00 0.00 38.06 1.40
526 527 7.097006 GCTTTCGGCTCGCTTTTATAAATAAAG 60.097 37.037 0.00 0.00 38.06 1.85
539 540 9.646427 TTTTATAAATAAAGCAACACCATGTCC 57.354 29.630 0.00 0.00 34.13 4.02
540 541 6.849085 ATAAATAAAGCAACACCATGTCCA 57.151 33.333 0.00 0.00 0.00 4.02
541 542 5.743636 AAATAAAGCAACACCATGTCCAT 57.256 34.783 0.00 0.00 0.00 3.41
542 543 6.849085 AAATAAAGCAACACCATGTCCATA 57.151 33.333 0.00 0.00 0.00 2.74
543 544 5.835113 ATAAAGCAACACCATGTCCATAC 57.165 39.130 0.00 0.00 0.00 2.39
544 545 2.877097 AGCAACACCATGTCCATACA 57.123 45.000 0.00 0.00 40.69 2.29
545 546 3.153369 AGCAACACCATGTCCATACAA 57.847 42.857 0.00 0.00 39.58 2.41
546 547 2.819608 AGCAACACCATGTCCATACAAC 59.180 45.455 0.00 0.00 39.58 3.32
547 548 2.556189 GCAACACCATGTCCATACAACA 59.444 45.455 0.00 0.00 39.58 3.33
548 549 3.005261 GCAACACCATGTCCATACAACAA 59.995 43.478 0.00 0.00 39.58 2.83
549 550 4.797471 CAACACCATGTCCATACAACAAG 58.203 43.478 0.00 0.00 39.58 3.16
550 551 4.098914 ACACCATGTCCATACAACAAGT 57.901 40.909 0.00 0.00 39.58 3.16
551 552 5.235850 ACACCATGTCCATACAACAAGTA 57.764 39.130 0.00 0.00 39.58 2.24
552 553 5.245531 ACACCATGTCCATACAACAAGTAG 58.754 41.667 0.00 0.00 39.58 2.57
553 554 4.094887 CACCATGTCCATACAACAAGTAGC 59.905 45.833 0.00 0.00 39.58 3.58
554 555 4.260985 CCATGTCCATACAACAAGTAGCA 58.739 43.478 0.00 0.00 39.58 3.49
555 556 4.094887 CCATGTCCATACAACAAGTAGCAC 59.905 45.833 0.00 0.00 39.58 4.40
556 557 3.670625 TGTCCATACAACAAGTAGCACC 58.329 45.455 0.00 0.00 35.85 5.01
557 558 3.071747 TGTCCATACAACAAGTAGCACCA 59.928 43.478 0.00 0.00 35.85 4.17
558 559 4.261801 GTCCATACAACAAGTAGCACCAT 58.738 43.478 0.00 0.00 35.85 3.55
559 560 4.094887 GTCCATACAACAAGTAGCACCATG 59.905 45.833 0.00 0.00 35.85 3.66
560 561 4.009675 CCATACAACAAGTAGCACCATGT 58.990 43.478 0.00 0.00 35.85 3.21
561 562 4.094887 CCATACAACAAGTAGCACCATGTC 59.905 45.833 0.00 0.00 35.85 3.06
562 563 2.504367 ACAACAAGTAGCACCATGTCC 58.496 47.619 0.00 0.00 0.00 4.02
563 564 2.158682 ACAACAAGTAGCACCATGTCCA 60.159 45.455 0.00 0.00 0.00 4.02
564 565 3.084039 CAACAAGTAGCACCATGTCCAT 58.916 45.455 0.00 0.00 0.00 3.41
565 566 4.260985 CAACAAGTAGCACCATGTCCATA 58.739 43.478 0.00 0.00 0.00 2.74
566 567 3.873910 ACAAGTAGCACCATGTCCATAC 58.126 45.455 0.00 0.00 0.00 2.39
567 568 3.263170 ACAAGTAGCACCATGTCCATACA 59.737 43.478 0.00 0.00 40.69 2.29
569 570 4.342862 AGTAGCACCATGTCCATACATC 57.657 45.455 0.00 0.00 44.70 3.06
570 571 3.711190 AGTAGCACCATGTCCATACATCA 59.289 43.478 0.00 0.00 44.70 3.07
571 572 3.650281 AGCACCATGTCCATACATCAA 57.350 42.857 0.00 0.00 44.70 2.57
572 573 3.548770 AGCACCATGTCCATACATCAAG 58.451 45.455 0.00 0.00 44.70 3.02
573 574 3.054139 AGCACCATGTCCATACATCAAGT 60.054 43.478 0.00 0.00 44.70 3.16
574 575 4.164030 AGCACCATGTCCATACATCAAGTA 59.836 41.667 0.00 0.00 44.70 2.24
575 576 4.512944 GCACCATGTCCATACATCAAGTAG 59.487 45.833 0.00 0.00 44.70 2.57
576 577 4.512944 CACCATGTCCATACATCAAGTAGC 59.487 45.833 0.00 0.00 44.70 3.58
577 578 4.164030 ACCATGTCCATACATCAAGTAGCA 59.836 41.667 0.00 0.00 44.70 3.49
578 579 5.125356 CCATGTCCATACATCAAGTAGCAA 58.875 41.667 0.00 0.00 44.70 3.91
579 580 5.589855 CCATGTCCATACATCAAGTAGCAAA 59.410 40.000 0.00 0.00 44.70 3.68
580 581 6.263842 CCATGTCCATACATCAAGTAGCAAAT 59.736 38.462 0.00 0.00 44.70 2.32
581 582 6.925610 TGTCCATACATCAAGTAGCAAATC 57.074 37.500 0.00 0.00 35.85 2.17
582 583 6.413892 TGTCCATACATCAAGTAGCAAATCA 58.586 36.000 0.00 0.00 35.85 2.57
583 584 6.316140 TGTCCATACATCAAGTAGCAAATCAC 59.684 38.462 0.00 0.00 35.85 3.06
584 585 5.822519 TCCATACATCAAGTAGCAAATCACC 59.177 40.000 0.00 0.00 35.85 4.02
585 586 5.277490 CCATACATCAAGTAGCAAATCACCG 60.277 44.000 0.00 0.00 35.85 4.94
586 587 3.937814 ACATCAAGTAGCAAATCACCGA 58.062 40.909 0.00 0.00 0.00 4.69
587 588 3.935203 ACATCAAGTAGCAAATCACCGAG 59.065 43.478 0.00 0.00 0.00 4.63
588 589 3.953712 TCAAGTAGCAAATCACCGAGA 57.046 42.857 0.00 0.00 0.00 4.04
589 590 4.471904 TCAAGTAGCAAATCACCGAGAT 57.528 40.909 0.00 0.00 39.09 2.75
590 591 5.592104 TCAAGTAGCAAATCACCGAGATA 57.408 39.130 0.00 0.00 35.39 1.98
591 592 5.972935 TCAAGTAGCAAATCACCGAGATAA 58.027 37.500 0.00 0.00 35.39 1.75
592 593 6.403049 TCAAGTAGCAAATCACCGAGATAAA 58.597 36.000 0.00 0.00 35.39 1.40
593 594 6.876789 TCAAGTAGCAAATCACCGAGATAAAA 59.123 34.615 0.00 0.00 35.39 1.52
594 595 7.552687 TCAAGTAGCAAATCACCGAGATAAAAT 59.447 33.333 0.00 0.00 35.39 1.82
595 596 8.826710 CAAGTAGCAAATCACCGAGATAAAATA 58.173 33.333 0.00 0.00 35.39 1.40
596 597 8.594881 AGTAGCAAATCACCGAGATAAAATAG 57.405 34.615 0.00 0.00 35.39 1.73
597 598 8.204836 AGTAGCAAATCACCGAGATAAAATAGT 58.795 33.333 0.00 0.00 35.39 2.12
598 599 7.484035 AGCAAATCACCGAGATAAAATAGTC 57.516 36.000 0.00 0.00 35.39 2.59
599 600 7.275920 AGCAAATCACCGAGATAAAATAGTCT 58.724 34.615 0.00 0.00 35.39 3.24
600 601 7.225538 AGCAAATCACCGAGATAAAATAGTCTG 59.774 37.037 0.00 0.00 35.39 3.51
601 602 7.011482 GCAAATCACCGAGATAAAATAGTCTGT 59.989 37.037 0.00 0.00 35.39 3.41
602 603 8.883731 CAAATCACCGAGATAAAATAGTCTGTT 58.116 33.333 0.00 0.00 35.39 3.16
603 604 8.425577 AATCACCGAGATAAAATAGTCTGTTG 57.574 34.615 0.00 0.00 35.39 3.33
604 605 6.338146 TCACCGAGATAAAATAGTCTGTTGG 58.662 40.000 0.00 0.00 0.00 3.77
605 606 5.523916 CACCGAGATAAAATAGTCTGTTGGG 59.476 44.000 0.00 0.00 0.00 4.12
606 607 5.057149 CCGAGATAAAATAGTCTGTTGGGG 58.943 45.833 0.00 0.00 0.00 4.96
607 608 4.511826 CGAGATAAAATAGTCTGTTGGGGC 59.488 45.833 0.00 0.00 0.00 5.80
608 609 5.437060 GAGATAAAATAGTCTGTTGGGGCA 58.563 41.667 0.00 0.00 0.00 5.36
609 610 6.018433 AGATAAAATAGTCTGTTGGGGCAT 57.982 37.500 0.00 0.00 0.00 4.40
610 611 6.064717 AGATAAAATAGTCTGTTGGGGCATC 58.935 40.000 0.00 0.00 0.00 3.91
611 612 3.737559 AAATAGTCTGTTGGGGCATCA 57.262 42.857 0.00 0.00 0.00 3.07
612 613 3.287867 AATAGTCTGTTGGGGCATCAG 57.712 47.619 0.00 0.00 33.84 2.90
613 614 1.656587 TAGTCTGTTGGGGCATCAGT 58.343 50.000 0.00 0.00 34.12 3.41
614 615 1.656587 AGTCTGTTGGGGCATCAGTA 58.343 50.000 0.00 0.00 34.12 2.74
615 616 2.200081 AGTCTGTTGGGGCATCAGTAT 58.800 47.619 0.00 0.00 34.12 2.12
616 617 3.384168 AGTCTGTTGGGGCATCAGTATA 58.616 45.455 0.00 0.00 34.12 1.47
617 618 3.780294 AGTCTGTTGGGGCATCAGTATAA 59.220 43.478 0.00 0.00 34.12 0.98
618 619 4.130118 GTCTGTTGGGGCATCAGTATAAG 58.870 47.826 0.00 0.00 34.12 1.73
619 620 4.037222 TCTGTTGGGGCATCAGTATAAGA 58.963 43.478 0.00 0.00 34.12 2.10
620 621 4.101585 TCTGTTGGGGCATCAGTATAAGAG 59.898 45.833 0.00 0.00 34.12 2.85
621 622 4.037222 TGTTGGGGCATCAGTATAAGAGA 58.963 43.478 0.00 0.00 0.00 3.10
622 623 4.473196 TGTTGGGGCATCAGTATAAGAGAA 59.527 41.667 0.00 0.00 0.00 2.87
623 624 5.045213 TGTTGGGGCATCAGTATAAGAGAAA 60.045 40.000 0.00 0.00 0.00 2.52
624 625 5.296151 TGGGGCATCAGTATAAGAGAAAG 57.704 43.478 0.00 0.00 0.00 2.62
625 626 4.968719 TGGGGCATCAGTATAAGAGAAAGA 59.031 41.667 0.00 0.00 0.00 2.52
626 627 5.608437 TGGGGCATCAGTATAAGAGAAAGAT 59.392 40.000 0.00 0.00 0.00 2.40
627 628 6.787458 TGGGGCATCAGTATAAGAGAAAGATA 59.213 38.462 0.00 0.00 0.00 1.98
628 629 7.038729 TGGGGCATCAGTATAAGAGAAAGATAG 60.039 40.741 0.00 0.00 0.00 2.08
629 630 7.179338 GGGGCATCAGTATAAGAGAAAGATAGA 59.821 40.741 0.00 0.00 0.00 1.98
630 631 8.589338 GGGCATCAGTATAAGAGAAAGATAGAA 58.411 37.037 0.00 0.00 0.00 2.10
631 632 9.988815 GGCATCAGTATAAGAGAAAGATAGAAA 57.011 33.333 0.00 0.00 0.00 2.52
658 659 2.806608 CCACAAATGGCCATAGCATC 57.193 50.000 21.15 0.00 39.82 3.91
659 660 2.033372 CCACAAATGGCCATAGCATCA 58.967 47.619 21.15 0.00 39.82 3.07
660 661 2.035449 CCACAAATGGCCATAGCATCAG 59.965 50.000 21.15 6.53 39.82 2.90
661 662 2.953648 CACAAATGGCCATAGCATCAGA 59.046 45.455 21.15 0.00 42.56 3.27
662 663 3.004419 CACAAATGGCCATAGCATCAGAG 59.996 47.826 21.15 3.89 42.56 3.35
663 664 2.557056 CAAATGGCCATAGCATCAGAGG 59.443 50.000 21.15 0.00 42.56 3.69
664 665 1.738474 ATGGCCATAGCATCAGAGGA 58.262 50.000 19.18 0.00 42.56 3.71
665 666 1.738474 TGGCCATAGCATCAGAGGAT 58.262 50.000 0.00 0.00 42.56 3.24
666 667 1.627329 TGGCCATAGCATCAGAGGATC 59.373 52.381 0.00 0.00 42.56 3.36
667 668 1.907936 GGCCATAGCATCAGAGGATCT 59.092 52.381 0.00 0.00 45.63 2.75
678 679 3.271142 GAGGATCTGCAGCGAAGAG 57.729 57.895 9.47 0.00 0.00 2.85
679 680 0.743688 GAGGATCTGCAGCGAAGAGA 59.256 55.000 9.47 0.00 0.00 3.10
680 681 0.746063 AGGATCTGCAGCGAAGAGAG 59.254 55.000 9.47 0.00 0.00 3.20
681 682 0.249405 GGATCTGCAGCGAAGAGAGG 60.249 60.000 9.47 0.00 0.00 3.69
682 683 0.459489 GATCTGCAGCGAAGAGAGGT 59.541 55.000 9.47 0.00 0.00 3.85
683 684 0.175302 ATCTGCAGCGAAGAGAGGTG 59.825 55.000 9.47 0.00 39.81 4.00
684 685 1.181741 TCTGCAGCGAAGAGAGGTGT 61.182 55.000 9.47 0.00 39.11 4.16
685 686 0.735632 CTGCAGCGAAGAGAGGTGTC 60.736 60.000 0.00 0.00 39.11 3.67
686 687 1.803519 GCAGCGAAGAGAGGTGTCG 60.804 63.158 0.00 0.00 39.11 4.35
687 688 1.876664 CAGCGAAGAGAGGTGTCGA 59.123 57.895 0.00 0.00 36.92 4.20
688 689 0.179176 CAGCGAAGAGAGGTGTCGAG 60.179 60.000 0.00 0.00 36.92 4.04
689 690 1.515304 GCGAAGAGAGGTGTCGAGC 60.515 63.158 0.00 0.00 36.92 5.03
690 691 1.876664 CGAAGAGAGGTGTCGAGCA 59.123 57.895 0.00 0.00 36.92 4.26
691 692 0.179176 CGAAGAGAGGTGTCGAGCAG 60.179 60.000 0.00 0.00 36.92 4.24
692 693 0.457681 GAAGAGAGGTGTCGAGCAGC 60.458 60.000 8.52 8.52 45.33 5.25
697 698 2.661866 GGTGTCGAGCAGCAACGT 60.662 61.111 10.84 0.00 44.44 3.99
698 699 2.546321 GTGTCGAGCAGCAACGTG 59.454 61.111 10.84 0.00 0.00 4.49
699 700 3.337889 TGTCGAGCAGCAACGTGC 61.338 61.111 10.84 0.00 45.46 5.34
709 710 4.249020 CAACGTGCAGCGCAACCA 62.249 61.111 11.47 0.00 46.11 3.67
710 711 3.513438 AACGTGCAGCGCAACCAA 61.513 55.556 11.47 0.00 46.11 3.67
711 712 3.749735 AACGTGCAGCGCAACCAAC 62.750 57.895 11.47 0.00 46.11 3.77
712 713 4.249020 CGTGCAGCGCAACCAACA 62.249 61.111 11.47 0.00 41.47 3.33
713 714 2.336088 GTGCAGCGCAACCAACAT 59.664 55.556 11.47 0.00 41.47 2.71
714 715 1.730547 GTGCAGCGCAACCAACATC 60.731 57.895 11.47 0.00 41.47 3.06
715 716 1.898094 TGCAGCGCAACCAACATCT 60.898 52.632 11.47 0.00 34.76 2.90
716 717 0.605050 TGCAGCGCAACCAACATCTA 60.605 50.000 11.47 0.00 34.76 1.98
717 718 0.179189 GCAGCGCAACCAACATCTAC 60.179 55.000 11.47 0.00 0.00 2.59
718 719 0.447801 CAGCGCAACCAACATCTACC 59.552 55.000 11.47 0.00 0.00 3.18
719 720 0.676782 AGCGCAACCAACATCTACCC 60.677 55.000 11.47 0.00 0.00 3.69
720 721 1.654023 GCGCAACCAACATCTACCCC 61.654 60.000 0.30 0.00 0.00 4.95
721 722 0.322098 CGCAACCAACATCTACCCCA 60.322 55.000 0.00 0.00 0.00 4.96
722 723 1.463674 GCAACCAACATCTACCCCAG 58.536 55.000 0.00 0.00 0.00 4.45
723 724 1.271926 GCAACCAACATCTACCCCAGT 60.272 52.381 0.00 0.00 0.00 4.00
724 725 2.711542 CAACCAACATCTACCCCAGTC 58.288 52.381 0.00 0.00 0.00 3.51
725 726 0.902531 ACCAACATCTACCCCAGTCG 59.097 55.000 0.00 0.00 0.00 4.18
726 727 0.178068 CCAACATCTACCCCAGTCGG 59.822 60.000 0.00 0.00 0.00 4.79
727 728 0.902531 CAACATCTACCCCAGTCGGT 59.097 55.000 0.00 0.00 40.13 4.69
728 729 1.134788 CAACATCTACCCCAGTCGGTC 60.135 57.143 0.00 0.00 37.34 4.79
729 730 1.035932 ACATCTACCCCAGTCGGTCG 61.036 60.000 0.00 0.00 37.34 4.79
730 731 1.035932 CATCTACCCCAGTCGGTCGT 61.036 60.000 0.00 0.00 37.34 4.34
731 732 0.548031 ATCTACCCCAGTCGGTCGTA 59.452 55.000 0.00 0.00 37.34 3.43
732 733 0.107508 TCTACCCCAGTCGGTCGTAG 60.108 60.000 0.00 0.00 37.34 3.51
733 734 0.393537 CTACCCCAGTCGGTCGTAGT 60.394 60.000 0.00 0.00 37.34 2.73
734 735 0.392998 TACCCCAGTCGGTCGTAGTC 60.393 60.000 0.00 0.00 37.34 2.59
735 736 2.413142 CCCCAGTCGGTCGTAGTCC 61.413 68.421 0.00 0.00 0.00 3.85
736 737 1.378250 CCCAGTCGGTCGTAGTCCT 60.378 63.158 0.00 0.00 32.30 3.85
737 738 1.654954 CCCAGTCGGTCGTAGTCCTG 61.655 65.000 0.00 0.00 32.30 3.86
738 739 1.136984 CAGTCGGTCGTAGTCCTGC 59.863 63.158 0.00 0.00 32.30 4.85
739 740 1.002379 AGTCGGTCGTAGTCCTGCT 60.002 57.895 0.00 0.00 32.30 4.24
740 741 1.136984 GTCGGTCGTAGTCCTGCTG 59.863 63.158 0.00 0.00 32.30 4.41
741 742 2.202623 CGGTCGTAGTCCTGCTGC 60.203 66.667 0.00 0.00 32.30 5.25
742 743 2.184579 GGTCGTAGTCCTGCTGCC 59.815 66.667 0.00 0.00 31.62 4.85
743 744 2.352032 GGTCGTAGTCCTGCTGCCT 61.352 63.158 0.00 0.00 31.62 4.75
744 745 1.035932 GGTCGTAGTCCTGCTGCCTA 61.036 60.000 0.00 0.00 31.62 3.93
745 746 0.382515 GTCGTAGTCCTGCTGCCTAG 59.617 60.000 0.00 0.00 0.00 3.02
760 761 4.794648 TAGCAAGCGGGCGCCAAT 62.795 61.111 30.85 10.52 43.17 3.16
779 780 3.694746 GGCCTGGCCTAACAAACC 58.305 61.111 30.42 0.00 46.69 3.27
780 781 2.340328 GGCCTGGCCTAACAAACCG 61.340 63.158 30.42 0.00 46.69 4.44
781 782 2.340328 GCCTGGCCTAACAAACCGG 61.340 63.158 7.66 0.00 0.00 5.28
782 783 1.677633 CCTGGCCTAACAAACCGGG 60.678 63.158 6.32 0.00 43.48 5.73
783 784 1.377229 CTGGCCTAACAAACCGGGA 59.623 57.895 6.32 0.00 0.00 5.14
784 785 0.250989 CTGGCCTAACAAACCGGGAA 60.251 55.000 6.32 0.00 0.00 3.97
785 786 0.406361 TGGCCTAACAAACCGGGAAT 59.594 50.000 6.32 0.00 0.00 3.01
786 787 0.815095 GGCCTAACAAACCGGGAATG 59.185 55.000 6.32 3.86 0.00 2.67
787 788 1.614850 GGCCTAACAAACCGGGAATGA 60.615 52.381 6.32 0.00 0.00 2.57
788 789 1.743394 GCCTAACAAACCGGGAATGAG 59.257 52.381 6.32 0.00 0.00 2.90
789 790 2.365582 CCTAACAAACCGGGAATGAGG 58.634 52.381 6.32 0.78 0.00 3.86
790 791 2.365582 CTAACAAACCGGGAATGAGGG 58.634 52.381 6.32 0.00 0.00 4.30
791 792 0.774908 AACAAACCGGGAATGAGGGA 59.225 50.000 6.32 0.00 0.00 4.20
792 793 0.328258 ACAAACCGGGAATGAGGGAG 59.672 55.000 6.32 0.00 0.00 4.30
793 794 0.328258 CAAACCGGGAATGAGGGAGT 59.672 55.000 6.32 0.00 0.00 3.85
794 795 1.557832 CAAACCGGGAATGAGGGAGTA 59.442 52.381 6.32 0.00 0.00 2.59
795 796 1.497161 AACCGGGAATGAGGGAGTAG 58.503 55.000 6.32 0.00 0.00 2.57
796 797 1.049289 ACCGGGAATGAGGGAGTAGC 61.049 60.000 6.32 0.00 0.00 3.58
797 798 1.048724 CCGGGAATGAGGGAGTAGCA 61.049 60.000 0.00 0.00 0.00 3.49
798 799 0.105039 CGGGAATGAGGGAGTAGCAC 59.895 60.000 0.00 0.00 0.00 4.40
799 800 0.105039 GGGAATGAGGGAGTAGCACG 59.895 60.000 0.00 0.00 0.00 5.34
800 801 0.530870 GGAATGAGGGAGTAGCACGC 60.531 60.000 0.00 0.00 0.00 5.34
801 802 0.175760 GAATGAGGGAGTAGCACGCA 59.824 55.000 0.00 0.00 33.02 5.24
802 803 0.613260 AATGAGGGAGTAGCACGCAA 59.387 50.000 0.00 0.00 31.94 4.85
803 804 0.613260 ATGAGGGAGTAGCACGCAAA 59.387 50.000 0.00 0.00 31.94 3.68
804 805 0.613260 TGAGGGAGTAGCACGCAAAT 59.387 50.000 0.00 0.00 0.00 2.32
805 806 1.009829 GAGGGAGTAGCACGCAAATG 58.990 55.000 0.00 0.00 0.00 2.32
806 807 1.026718 AGGGAGTAGCACGCAAATGC 61.027 55.000 0.00 0.00 46.50 3.56
812 813 3.465753 GCACGCAAATGCACCATG 58.534 55.556 6.18 0.00 45.39 3.66
813 814 1.373246 GCACGCAAATGCACCATGT 60.373 52.632 6.18 0.00 45.39 3.21
814 815 1.346378 GCACGCAAATGCACCATGTC 61.346 55.000 6.18 0.00 45.39 3.06
815 816 1.066656 CACGCAAATGCACCATGTCG 61.067 55.000 6.18 0.00 42.21 4.35
816 817 1.514657 CGCAAATGCACCATGTCGG 60.515 57.895 6.18 0.00 42.21 4.79
817 818 1.806758 GCAAATGCACCATGTCGGC 60.807 57.895 0.00 0.00 41.59 5.54
818 819 1.153784 CAAATGCACCATGTCGGCC 60.154 57.895 0.00 0.00 39.03 6.13
819 820 1.606025 AAATGCACCATGTCGGCCA 60.606 52.632 2.24 0.00 39.03 5.36
820 821 1.184322 AAATGCACCATGTCGGCCAA 61.184 50.000 2.24 0.00 39.03 4.52
821 822 1.876497 AATGCACCATGTCGGCCAAC 61.876 55.000 2.24 0.00 39.03 3.77
822 823 2.983030 GCACCATGTCGGCCAACA 60.983 61.111 0.00 0.00 39.03 3.33
823 824 2.560119 GCACCATGTCGGCCAACAA 61.560 57.895 0.00 0.00 39.03 2.83
824 825 1.876497 GCACCATGTCGGCCAACAAT 61.876 55.000 0.00 0.00 39.03 2.71
825 826 0.109179 CACCATGTCGGCCAACAATG 60.109 55.000 0.00 0.00 39.03 2.82
826 827 0.251121 ACCATGTCGGCCAACAATGA 60.251 50.000 0.00 0.00 39.03 2.57
827 828 0.171007 CCATGTCGGCCAACAATGAC 59.829 55.000 0.00 0.00 31.81 3.06
828 829 0.880441 CATGTCGGCCAACAATGACA 59.120 50.000 0.00 5.92 44.58 3.58
829 830 1.838112 ATGTCGGCCAACAATGACAT 58.162 45.000 13.93 13.93 44.40 3.06
830 831 0.880441 TGTCGGCCAACAATGACATG 59.120 50.000 2.24 0.00 36.50 3.21
831 832 0.881118 GTCGGCCAACAATGACATGT 59.119 50.000 2.24 0.00 34.24 3.21
832 833 0.880441 TCGGCCAACAATGACATGTG 59.120 50.000 1.15 0.00 32.81 3.21
833 834 0.880441 CGGCCAACAATGACATGTGA 59.120 50.000 1.15 0.00 32.81 3.58
834 835 1.269174 CGGCCAACAATGACATGTGAA 59.731 47.619 1.15 0.00 32.81 3.18
835 836 2.094597 CGGCCAACAATGACATGTGAAT 60.095 45.455 1.15 0.00 32.81 2.57
836 837 3.614630 CGGCCAACAATGACATGTGAATT 60.615 43.478 1.15 0.00 32.81 2.17
837 838 3.928375 GGCCAACAATGACATGTGAATTC 59.072 43.478 1.15 0.00 32.81 2.17
838 839 4.558178 GCCAACAATGACATGTGAATTCA 58.442 39.130 1.15 3.38 32.81 2.57
839 840 4.386652 GCCAACAATGACATGTGAATTCAC 59.613 41.667 28.10 28.10 46.59 3.18
849 850 2.483583 GTGAATTCACACCAAACGCA 57.516 45.000 29.43 0.00 45.75 5.24
850 851 2.116366 GTGAATTCACACCAAACGCAC 58.884 47.619 29.43 1.98 45.75 5.34
851 852 1.745653 TGAATTCACACCAAACGCACA 59.254 42.857 3.38 0.00 0.00 4.57
852 853 2.116366 GAATTCACACCAAACGCACAC 58.884 47.619 0.00 0.00 0.00 3.82
853 854 1.098869 ATTCACACCAAACGCACACA 58.901 45.000 0.00 0.00 0.00 3.72
854 855 0.449786 TTCACACCAAACGCACACAG 59.550 50.000 0.00 0.00 0.00 3.66
855 856 1.063972 CACACCAAACGCACACAGG 59.936 57.895 0.00 0.00 0.00 4.00
856 857 2.118404 ACACCAAACGCACACAGGG 61.118 57.895 0.00 0.00 0.00 4.45
857 858 1.821759 CACCAAACGCACACAGGGA 60.822 57.895 0.00 0.00 0.00 4.20
858 859 1.525995 ACCAAACGCACACAGGGAG 60.526 57.895 0.00 0.00 0.00 4.30
859 860 2.260869 CCAAACGCACACAGGGAGG 61.261 63.158 0.00 0.00 0.00 4.30
860 861 2.113139 AAACGCACACAGGGAGGG 59.887 61.111 0.00 0.00 0.00 4.30
861 862 3.491598 AAACGCACACAGGGAGGGG 62.492 63.158 0.00 0.00 0.00 4.79
862 863 4.954118 ACGCACACAGGGAGGGGA 62.954 66.667 0.00 0.00 0.00 4.81
863 864 3.636231 CGCACACAGGGAGGGGAA 61.636 66.667 0.00 0.00 0.00 3.97
864 865 2.843545 GCACACAGGGAGGGGAAA 59.156 61.111 0.00 0.00 0.00 3.13
865 866 1.152830 GCACACAGGGAGGGGAAAA 59.847 57.895 0.00 0.00 0.00 2.29
866 867 0.469144 GCACACAGGGAGGGGAAAAA 60.469 55.000 0.00 0.00 0.00 1.94
888 889 2.603473 AGCCCTCGCTACCACACA 60.603 61.111 0.00 0.00 46.08 3.72
889 890 1.990060 AGCCCTCGCTACCACACAT 60.990 57.895 0.00 0.00 46.08 3.21
890 891 1.521681 GCCCTCGCTACCACACATC 60.522 63.158 0.00 0.00 0.00 3.06
891 892 1.961180 GCCCTCGCTACCACACATCT 61.961 60.000 0.00 0.00 0.00 2.90
892 893 0.103208 CCCTCGCTACCACACATCTC 59.897 60.000 0.00 0.00 0.00 2.75
893 894 1.107114 CCTCGCTACCACACATCTCT 58.893 55.000 0.00 0.00 0.00 3.10
894 895 1.478510 CCTCGCTACCACACATCTCTT 59.521 52.381 0.00 0.00 0.00 2.85
895 896 2.688446 CCTCGCTACCACACATCTCTTA 59.312 50.000 0.00 0.00 0.00 2.10
896 897 3.489398 CCTCGCTACCACACATCTCTTAC 60.489 52.174 0.00 0.00 0.00 2.34
897 898 3.086282 TCGCTACCACACATCTCTTACA 58.914 45.455 0.00 0.00 0.00 2.41
898 899 3.128764 TCGCTACCACACATCTCTTACAG 59.871 47.826 0.00 0.00 0.00 2.74
899 900 3.119459 CGCTACCACACATCTCTTACAGT 60.119 47.826 0.00 0.00 0.00 3.55
900 901 4.095932 CGCTACCACACATCTCTTACAGTA 59.904 45.833 0.00 0.00 0.00 2.74
901 902 5.341617 GCTACCACACATCTCTTACAGTAC 58.658 45.833 0.00 0.00 0.00 2.73
902 903 5.125739 GCTACCACACATCTCTTACAGTACT 59.874 44.000 0.00 0.00 0.00 2.73
903 904 5.646577 ACCACACATCTCTTACAGTACTC 57.353 43.478 0.00 0.00 0.00 2.59
904 905 4.463186 ACCACACATCTCTTACAGTACTCC 59.537 45.833 0.00 0.00 0.00 3.85
905 906 4.462834 CCACACATCTCTTACAGTACTCCA 59.537 45.833 0.00 0.00 0.00 3.86
906 907 5.047306 CCACACATCTCTTACAGTACTCCAA 60.047 44.000 0.00 0.00 0.00 3.53
907 908 6.096036 CACACATCTCTTACAGTACTCCAAG 58.904 44.000 0.00 0.00 0.00 3.61
908 909 6.010850 ACACATCTCTTACAGTACTCCAAGA 58.989 40.000 12.80 12.80 0.00 3.02
909 910 6.665680 ACACATCTCTTACAGTACTCCAAGAT 59.334 38.462 13.52 6.56 0.00 2.40
910 911 7.147983 ACACATCTCTTACAGTACTCCAAGATC 60.148 40.741 13.52 0.00 0.00 2.75
911 912 7.068103 CACATCTCTTACAGTACTCCAAGATCT 59.932 40.741 13.52 0.00 0.00 2.75
912 913 7.284489 ACATCTCTTACAGTACTCCAAGATCTC 59.716 40.741 13.52 0.00 0.00 2.75
913 914 6.964464 TCTCTTACAGTACTCCAAGATCTCT 58.036 40.000 13.52 0.00 0.00 3.10
914 915 7.406916 TCTCTTACAGTACTCCAAGATCTCTT 58.593 38.462 13.52 0.00 36.45 2.85
915 916 8.549731 TCTCTTACAGTACTCCAAGATCTCTTA 58.450 37.037 13.52 0.00 34.28 2.10
916 917 9.179909 CTCTTACAGTACTCCAAGATCTCTTAA 57.820 37.037 13.52 0.00 34.28 1.85
917 918 9.179909 TCTTACAGTACTCCAAGATCTCTTAAG 57.820 37.037 10.36 0.00 34.28 1.85
918 919 6.783708 ACAGTACTCCAAGATCTCTTAAGG 57.216 41.667 1.85 0.00 34.28 2.69
919 920 6.494952 ACAGTACTCCAAGATCTCTTAAGGA 58.505 40.000 1.85 0.00 34.28 3.36
920 921 6.954684 ACAGTACTCCAAGATCTCTTAAGGAA 59.045 38.462 1.85 0.00 34.28 3.36
921 922 7.455008 ACAGTACTCCAAGATCTCTTAAGGAAA 59.545 37.037 1.85 0.00 34.28 3.13
922 923 8.482128 CAGTACTCCAAGATCTCTTAAGGAAAT 58.518 37.037 1.85 0.00 34.28 2.17
923 924 8.700973 AGTACTCCAAGATCTCTTAAGGAAATC 58.299 37.037 1.85 3.93 34.28 2.17
924 925 7.747809 ACTCCAAGATCTCTTAAGGAAATCT 57.252 36.000 1.85 6.07 34.28 2.40
925 926 7.791029 ACTCCAAGATCTCTTAAGGAAATCTC 58.209 38.462 1.85 0.00 34.28 2.75
926 927 7.130681 TCCAAGATCTCTTAAGGAAATCTCC 57.869 40.000 1.85 0.00 36.97 3.71
927 928 6.905776 TCCAAGATCTCTTAAGGAAATCTCCT 59.094 38.462 1.85 0.00 43.66 3.69
928 929 7.070571 TCCAAGATCTCTTAAGGAAATCTCCTC 59.929 40.741 1.85 0.00 42.08 3.71
929 930 7.216494 CAAGATCTCTTAAGGAAATCTCCTCC 58.784 42.308 1.85 0.00 42.08 4.30
930 931 7.071071 CAAGATCTCTTAAGGAAATCTCCTCCT 59.929 40.741 1.85 0.00 42.08 3.69
937 938 2.482494 GGAAATCTCCTCCTTCTCCCA 58.518 52.381 0.00 0.00 38.88 4.37
938 939 2.171659 GGAAATCTCCTCCTTCTCCCAC 59.828 54.545 0.00 0.00 38.88 4.61
939 940 1.490574 AATCTCCTCCTTCTCCCACG 58.509 55.000 0.00 0.00 0.00 4.94
940 941 1.045911 ATCTCCTCCTTCTCCCACGC 61.046 60.000 0.00 0.00 0.00 5.34
941 942 2.683933 TCCTCCTTCTCCCACGCC 60.684 66.667 0.00 0.00 0.00 5.68
942 943 3.003173 CCTCCTTCTCCCACGCCA 61.003 66.667 0.00 0.00 0.00 5.69
943 944 2.266055 CTCCTTCTCCCACGCCAC 59.734 66.667 0.00 0.00 0.00 5.01
944 945 2.525629 TCCTTCTCCCACGCCACA 60.526 61.111 0.00 0.00 0.00 4.17
945 946 2.358737 CCTTCTCCCACGCCACAC 60.359 66.667 0.00 0.00 0.00 3.82
946 947 2.358737 CTTCTCCCACGCCACACC 60.359 66.667 0.00 0.00 0.00 4.16
947 948 3.164977 TTCTCCCACGCCACACCA 61.165 61.111 0.00 0.00 0.00 4.17
948 949 3.469863 TTCTCCCACGCCACACCAC 62.470 63.158 0.00 0.00 0.00 4.16
952 953 4.866224 CCACGCCACACCACCACA 62.866 66.667 0.00 0.00 0.00 4.17
953 954 2.594303 CACGCCACACCACCACAT 60.594 61.111 0.00 0.00 0.00 3.21
954 955 2.281484 ACGCCACACCACCACATC 60.281 61.111 0.00 0.00 0.00 3.06
955 956 2.281414 CGCCACACCACCACATCA 60.281 61.111 0.00 0.00 0.00 3.07
956 957 2.616330 CGCCACACCACCACATCAC 61.616 63.158 0.00 0.00 0.00 3.06
957 958 1.228245 GCCACACCACCACATCACT 60.228 57.895 0.00 0.00 0.00 3.41
958 959 0.823356 GCCACACCACCACATCACTT 60.823 55.000 0.00 0.00 0.00 3.16
959 960 1.691196 CCACACCACCACATCACTTT 58.309 50.000 0.00 0.00 0.00 2.66
960 961 2.031120 CCACACCACCACATCACTTTT 58.969 47.619 0.00 0.00 0.00 2.27
961 962 3.218453 CCACACCACCACATCACTTTTA 58.782 45.455 0.00 0.00 0.00 1.52
962 963 3.004315 CCACACCACCACATCACTTTTAC 59.996 47.826 0.00 0.00 0.00 2.01
963 964 3.004315 CACACCACCACATCACTTTTACC 59.996 47.826 0.00 0.00 0.00 2.85
964 965 3.218453 CACCACCACATCACTTTTACCA 58.782 45.455 0.00 0.00 0.00 3.25
965 966 3.004315 CACCACCACATCACTTTTACCAC 59.996 47.826 0.00 0.00 0.00 4.16
966 967 3.117663 ACCACCACATCACTTTTACCACT 60.118 43.478 0.00 0.00 0.00 4.00
967 968 3.502211 CCACCACATCACTTTTACCACTC 59.498 47.826 0.00 0.00 0.00 3.51
968 969 4.389374 CACCACATCACTTTTACCACTCT 58.611 43.478 0.00 0.00 0.00 3.24
969 970 4.452455 CACCACATCACTTTTACCACTCTC 59.548 45.833 0.00 0.00 0.00 3.20
970 971 4.102524 ACCACATCACTTTTACCACTCTCA 59.897 41.667 0.00 0.00 0.00 3.27
971 972 4.692625 CCACATCACTTTTACCACTCTCAG 59.307 45.833 0.00 0.00 0.00 3.35
972 973 5.511373 CCACATCACTTTTACCACTCTCAGA 60.511 44.000 0.00 0.00 0.00 3.27
973 974 6.169094 CACATCACTTTTACCACTCTCAGAT 58.831 40.000 0.00 0.00 0.00 2.90
974 975 6.312426 CACATCACTTTTACCACTCTCAGATC 59.688 42.308 0.00 0.00 0.00 2.75
975 976 5.407407 TCACTTTTACCACTCTCAGATCC 57.593 43.478 0.00 0.00 0.00 3.36
976 977 4.838423 TCACTTTTACCACTCTCAGATCCA 59.162 41.667 0.00 0.00 0.00 3.41
977 978 5.047021 TCACTTTTACCACTCTCAGATCCAG 60.047 44.000 0.00 0.00 0.00 3.86
978 979 3.895232 TTTACCACTCTCAGATCCAGC 57.105 47.619 0.00 0.00 0.00 4.85
979 980 2.532250 TACCACTCTCAGATCCAGCA 57.468 50.000 0.00 0.00 0.00 4.41
980 981 1.649321 ACCACTCTCAGATCCAGCAA 58.351 50.000 0.00 0.00 0.00 3.91
981 982 2.194859 ACCACTCTCAGATCCAGCAAT 58.805 47.619 0.00 0.00 0.00 3.56
982 983 2.170187 ACCACTCTCAGATCCAGCAATC 59.830 50.000 0.00 0.00 0.00 2.67
983 984 2.435069 CCACTCTCAGATCCAGCAATCT 59.565 50.000 0.00 0.00 36.41 2.40
984 985 3.493002 CCACTCTCAGATCCAGCAATCTC 60.493 52.174 0.00 0.00 33.68 2.75
985 986 3.132467 CACTCTCAGATCCAGCAATCTCA 59.868 47.826 0.00 0.00 33.68 3.27
986 987 3.132646 ACTCTCAGATCCAGCAATCTCAC 59.867 47.826 0.00 0.00 33.68 3.51
987 988 3.102204 TCTCAGATCCAGCAATCTCACA 58.898 45.455 0.00 0.00 33.68 3.58
988 989 3.710165 TCTCAGATCCAGCAATCTCACAT 59.290 43.478 0.00 0.00 33.68 3.21
989 990 4.897670 TCTCAGATCCAGCAATCTCACATA 59.102 41.667 0.00 0.00 33.68 2.29
990 991 5.010820 TCTCAGATCCAGCAATCTCACATAG 59.989 44.000 0.00 0.00 33.68 2.23
991 992 3.747010 CAGATCCAGCAATCTCACATAGC 59.253 47.826 0.00 0.00 33.68 2.97
992 993 3.390311 AGATCCAGCAATCTCACATAGCA 59.610 43.478 0.00 0.00 29.89 3.49
993 994 2.910199 TCCAGCAATCTCACATAGCAC 58.090 47.619 0.00 0.00 0.00 4.40
994 995 2.236893 TCCAGCAATCTCACATAGCACA 59.763 45.455 0.00 0.00 0.00 4.57
995 996 3.011818 CCAGCAATCTCACATAGCACAA 58.988 45.455 0.00 0.00 0.00 3.33
996 997 3.064958 CCAGCAATCTCACATAGCACAAG 59.935 47.826 0.00 0.00 0.00 3.16
997 998 3.064958 CAGCAATCTCACATAGCACAAGG 59.935 47.826 0.00 0.00 0.00 3.61
998 999 2.223433 GCAATCTCACATAGCACAAGGC 60.223 50.000 0.00 0.00 45.30 4.35
1007 1008 4.102113 GCACAAGGCAATGGAGGT 57.898 55.556 0.00 0.00 43.97 3.85
1017 1018 1.081892 CAATGGAGGTTGCTCTCGTG 58.918 55.000 0.00 0.00 34.74 4.35
1018 1019 0.036010 AATGGAGGTTGCTCTCGTGG 60.036 55.000 0.00 0.00 34.74 4.94
1019 1020 1.903877 ATGGAGGTTGCTCTCGTGGG 61.904 60.000 0.00 0.00 34.74 4.61
1023 1024 3.414700 GTTGCTCTCGTGGGCGTG 61.415 66.667 4.68 0.00 39.49 5.34
1024 1025 4.680237 TTGCTCTCGTGGGCGTGG 62.680 66.667 4.68 0.00 39.49 4.94
1066 1067 1.349026 TCCTGTCCAAGCTCTTCAAGG 59.651 52.381 0.00 0.00 0.00 3.61
1067 1068 1.163554 CTGTCCAAGCTCTTCAAGGC 58.836 55.000 0.00 0.00 0.00 4.35
1071 1072 1.642952 CCAAGCTCTTCAAGGCGCTC 61.643 60.000 7.64 0.00 31.30 5.03
1072 1073 0.952497 CAAGCTCTTCAAGGCGCTCA 60.952 55.000 7.64 0.00 31.30 4.26
1073 1074 0.250467 AAGCTCTTCAAGGCGCTCAA 60.250 50.000 7.64 0.00 31.30 3.02
1074 1075 0.952984 AGCTCTTCAAGGCGCTCAAC 60.953 55.000 7.64 0.00 0.00 3.18
1101 1102 2.670934 AGCAAGCTCAAGGGCGTG 60.671 61.111 3.40 3.40 42.77 5.34
1123 1124 1.300620 CGTGAGGTCGAAGGCACAA 60.301 57.895 11.68 0.00 0.00 3.33
1128 1129 1.000955 GAGGTCGAAGGCACAAGAGAA 59.999 52.381 0.00 0.00 0.00 2.87
1132 1133 2.029828 GTCGAAGGCACAAGAGAAGAGA 60.030 50.000 0.00 0.00 0.00 3.10
1134 1135 2.928757 CGAAGGCACAAGAGAAGAGATG 59.071 50.000 0.00 0.00 0.00 2.90
1135 1136 3.367806 CGAAGGCACAAGAGAAGAGATGA 60.368 47.826 0.00 0.00 0.00 2.92
1139 1140 3.332919 GCACAAGAGAAGAGATGAGCAA 58.667 45.455 0.00 0.00 31.07 3.91
1140 1141 3.940221 GCACAAGAGAAGAGATGAGCAAT 59.060 43.478 0.00 0.00 31.07 3.56
1144 1145 5.759273 ACAAGAGAAGAGATGAGCAATATGC 59.241 40.000 0.00 0.00 45.46 3.14
1179 1180 2.278466 CTAGCAGACGCCGAGCAG 60.278 66.667 0.00 0.00 39.83 4.24
1193 1194 0.527385 GAGCAGCTCGACCATGAGAC 60.527 60.000 6.67 0.00 38.28 3.36
1194 1195 0.969917 AGCAGCTCGACCATGAGACT 60.970 55.000 0.00 0.00 38.28 3.24
1198 1199 2.290367 CAGCTCGACCATGAGACTAGAG 59.710 54.545 0.00 0.00 38.28 2.43
1199 1200 1.001815 GCTCGACCATGAGACTAGAGC 60.002 57.143 0.00 2.20 41.92 4.09
1204 1205 3.027412 GACCATGAGACTAGAGCTTGGA 58.973 50.000 16.69 0.00 32.81 3.53
1209 1210 2.028876 GAGACTAGAGCTTGGAGGGAC 58.971 57.143 0.00 0.00 0.00 4.46
1224 1225 2.951745 GACGATGTCCGCGAGCTG 60.952 66.667 8.23 0.00 43.32 4.24
1229 1230 2.564553 GATGTCCGCGAGCTGTCCTT 62.565 60.000 8.23 0.00 0.00 3.36
1230 1231 2.507324 GTCCGCGAGCTGTCCTTC 60.507 66.667 8.23 0.00 0.00 3.46
1245 1246 2.093447 GTCCTTCGACATGGAGGATTGT 60.093 50.000 6.09 0.00 38.99 2.71
1246 1247 2.093500 TCCTTCGACATGGAGGATTGTG 60.093 50.000 0.00 0.00 0.00 3.33
1253 1254 4.264253 GACATGGAGGATTGTGTTGATGA 58.736 43.478 0.00 0.00 0.00 2.92
1258 1259 4.202451 TGGAGGATTGTGTTGATGACTTCA 60.202 41.667 0.00 0.00 0.00 3.02
1265 1266 2.094894 GTGTTGATGACTTCATGGCTCG 59.905 50.000 0.00 0.00 36.57 5.03
1268 1269 0.654683 GATGACTTCATGGCTCGTGC 59.345 55.000 0.00 0.00 36.57 5.34
1269 1270 0.251354 ATGACTTCATGGCTCGTGCT 59.749 50.000 9.61 0.00 39.59 4.40
1273 1274 0.671472 CTTCATGGCTCGTGCTGACA 60.671 55.000 9.61 0.00 39.59 3.58
1274 1275 0.950555 TTCATGGCTCGTGCTGACAC 60.951 55.000 9.61 0.00 43.76 3.67
1275 1276 2.046892 ATGGCTCGTGCTGACACC 60.047 61.111 9.61 0.00 44.40 4.16
1276 1277 2.882677 ATGGCTCGTGCTGACACCA 61.883 57.895 9.61 0.00 44.40 4.17
1279 1280 2.320587 GCTCGTGCTGACACCAAGG 61.321 63.158 1.41 0.00 44.40 3.61
1280 1281 1.367471 CTCGTGCTGACACCAAGGA 59.633 57.895 0.00 0.00 44.40 3.36
1281 1282 0.249868 CTCGTGCTGACACCAAGGAA 60.250 55.000 0.00 0.00 44.40 3.36
1287 1288 1.952367 GCTGACACCAAGGAAGATGGG 60.952 57.143 0.00 0.00 42.48 4.00
1289 1290 0.681243 GACACCAAGGAAGATGGGCC 60.681 60.000 0.00 0.00 42.48 5.80
1290 1291 1.383799 CACCAAGGAAGATGGGCCA 59.616 57.895 9.61 9.61 42.48 5.36
1292 1293 0.486879 ACCAAGGAAGATGGGCCAAA 59.513 50.000 11.89 0.00 42.48 3.28
1293 1294 1.188863 CCAAGGAAGATGGGCCAAAG 58.811 55.000 11.89 0.00 34.15 2.77
1294 1295 1.188863 CAAGGAAGATGGGCCAAAGG 58.811 55.000 11.89 0.00 0.00 3.11
1295 1296 0.041684 AAGGAAGATGGGCCAAAGGG 59.958 55.000 11.89 0.00 37.18 3.95
1309 1310 0.860457 AAAGGGCTTCAAGGGGTTCT 59.140 50.000 0.00 0.00 0.00 3.01
1316 1317 2.693074 GCTTCAAGGGGTTCTTTGACAA 59.307 45.455 0.00 0.00 32.41 3.18
1318 1319 2.306847 TCAAGGGGTTCTTTGACAAGC 58.693 47.619 0.00 0.00 32.41 4.01
1322 1323 1.609072 GGGGTTCTTTGACAAGCTGAC 59.391 52.381 0.00 0.00 0.00 3.51
1323 1324 1.609072 GGGTTCTTTGACAAGCTGACC 59.391 52.381 0.00 0.00 31.48 4.02
1339 1340 1.578206 GACCAAGCTCAAACCTCGCC 61.578 60.000 0.00 0.00 0.00 5.54
1342 1343 0.169672 CAAGCTCAAACCTCGCCATG 59.830 55.000 0.00 0.00 0.00 3.66
1365 1366 1.060937 CGCCGGCGAGATCAAAAAG 59.939 57.895 44.86 9.41 42.83 2.27
1382 1383 3.064324 GCTCAAGGCCCGTGCAAT 61.064 61.111 0.00 0.00 40.13 3.56
1383 1384 3.056313 GCTCAAGGCCCGTGCAATC 62.056 63.158 0.00 0.00 40.13 2.67
1387 1388 2.954684 AAGGCCCGTGCAATCGAGA 61.955 57.895 0.00 0.00 40.13 4.04
1393 1394 1.291184 CCGTGCAATCGAGACAAGCA 61.291 55.000 0.00 0.00 0.00 3.91
1413 1414 4.708177 GCAAGAGGCATCAGAGGTATAAA 58.292 43.478 0.00 0.00 43.97 1.40
1415 1416 5.008118 GCAAGAGGCATCAGAGGTATAAAAC 59.992 44.000 0.00 0.00 43.97 2.43
1416 1417 6.352516 CAAGAGGCATCAGAGGTATAAAACT 58.647 40.000 0.00 0.00 0.00 2.66
1417 1418 5.923204 AGAGGCATCAGAGGTATAAAACTG 58.077 41.667 0.00 0.00 0.00 3.16
1422 1423 4.119442 TCAGAGGTATAAAACTGTCCGC 57.881 45.455 0.00 0.00 0.00 5.54
1424 1425 3.105283 AGAGGTATAAAACTGTCCGCCT 58.895 45.455 0.00 0.00 0.00 5.52
1425 1426 3.132467 AGAGGTATAAAACTGTCCGCCTC 59.868 47.826 0.00 0.00 40.95 4.70
1426 1427 3.105283 AGGTATAAAACTGTCCGCCTCT 58.895 45.455 0.00 0.00 0.00 3.69
1429 1430 3.914426 ATAAAACTGTCCGCCTCTCAT 57.086 42.857 0.00 0.00 0.00 2.90
1432 1433 0.534412 AACTGTCCGCCTCTCATCTG 59.466 55.000 0.00 0.00 0.00 2.90
1433 1434 0.323816 ACTGTCCGCCTCTCATCTGA 60.324 55.000 0.00 0.00 0.00 3.27
1435 1436 0.323816 TGTCCGCCTCTCATCTGACT 60.324 55.000 0.00 0.00 0.00 3.41
1436 1437 0.383949 GTCCGCCTCTCATCTGACTC 59.616 60.000 0.00 0.00 0.00 3.36
1437 1438 0.753479 TCCGCCTCTCATCTGACTCC 60.753 60.000 0.00 0.00 0.00 3.85
1439 1440 0.102120 CGCCTCTCATCTGACTCCAC 59.898 60.000 0.00 0.00 0.00 4.02
1441 1442 0.743688 CCTCTCATCTGACTCCACCG 59.256 60.000 0.00 0.00 0.00 4.94
1443 1444 1.142748 CTCATCTGACTCCACCGCC 59.857 63.158 0.00 0.00 0.00 6.13
1459 1460 1.072173 CCGCCTGTGATATTGATCCCA 59.928 52.381 0.00 0.00 0.00 4.37
1466 1467 3.053768 TGTGATATTGATCCCAGGTTGCA 60.054 43.478 0.00 0.00 0.00 4.08
1467 1468 3.316308 GTGATATTGATCCCAGGTTGCAC 59.684 47.826 0.00 0.00 0.00 4.57
1476 1477 1.811266 CAGGTTGCACGCGCTCTAT 60.811 57.895 5.73 0.00 39.64 1.98
1477 1478 1.519455 AGGTTGCACGCGCTCTATC 60.519 57.895 5.73 0.00 39.64 2.08
1478 1479 1.519455 GGTTGCACGCGCTCTATCT 60.519 57.895 5.73 0.00 39.64 1.98
1482 1483 1.946650 GCACGCGCTCTATCTGGAC 60.947 63.158 5.73 0.00 34.30 4.02
1485 1486 1.369448 CGCGCTCTATCTGGACGTC 60.369 63.158 7.13 7.13 0.00 4.34
1486 1487 1.728069 GCGCTCTATCTGGACGTCA 59.272 57.895 18.91 2.63 0.00 4.35
1487 1488 0.317436 GCGCTCTATCTGGACGTCAG 60.317 60.000 18.91 12.72 44.68 3.51
1489 1490 2.210961 CGCTCTATCTGGACGTCAGTA 58.789 52.381 18.91 1.31 43.76 2.74
1491 1492 3.303461 CGCTCTATCTGGACGTCAGTAAG 60.303 52.174 18.91 9.00 43.76 2.34
1497 1498 2.061773 CTGGACGTCAGTAAGCTTGTG 58.938 52.381 18.91 6.76 38.64 3.33
1506 1507 2.095059 CAGTAAGCTTGTGGGCATTGAC 60.095 50.000 9.86 0.00 34.17 3.18
1514 1515 0.180406 GTGGGCATTGACGGTCCTAT 59.820 55.000 5.55 0.00 0.00 2.57
1516 1517 0.468226 GGGCATTGACGGTCCTATGA 59.532 55.000 18.78 0.00 0.00 2.15
1518 1519 2.213499 GGCATTGACGGTCCTATGAAG 58.787 52.381 18.78 0.79 0.00 3.02
1519 1520 1.599542 GCATTGACGGTCCTATGAAGC 59.400 52.381 18.78 6.00 0.00 3.86
1527 1528 5.012046 TGACGGTCCTATGAAGCATATCATT 59.988 40.000 5.55 0.00 40.44 2.57
1530 1531 5.579904 CGGTCCTATGAAGCATATCATTGAG 59.420 44.000 5.20 0.00 40.44 3.02
1531 1532 5.879223 GGTCCTATGAAGCATATCATTGAGG 59.121 44.000 5.20 7.13 40.44 3.86
1534 1535 2.867624 TGAAGCATATCATTGAGGGGC 58.132 47.619 0.00 0.00 0.00 5.80
1536 1537 2.875094 AGCATATCATTGAGGGGCTC 57.125 50.000 3.67 0.00 0.00 4.70
1537 1538 2.060275 AGCATATCATTGAGGGGCTCA 58.940 47.619 3.67 0.00 38.87 4.26
1547 1548 3.524095 TGAGGGGCTCAAAAATGAAGA 57.476 42.857 0.00 0.00 37.57 2.87
1549 1550 4.419282 TGAGGGGCTCAAAAATGAAGATT 58.581 39.130 0.00 0.00 37.57 2.40
1550 1551 4.463891 TGAGGGGCTCAAAAATGAAGATTC 59.536 41.667 0.00 0.00 37.57 2.52
1551 1552 4.419282 AGGGGCTCAAAAATGAAGATTCA 58.581 39.130 0.00 0.00 42.14 2.57
1552 1553 7.260641 TGAGGGGCTCAAAAATGAAGATTCAT 61.261 38.462 2.17 2.17 42.36 2.57
1569 1570 5.816777 AGATTCATCTTCTAAGCAGCTTCAC 59.183 40.000 12.07 0.00 31.97 3.18
1588 1589 1.065401 ACGTGCTGTCAATTGTTGGTG 59.935 47.619 5.13 0.00 0.00 4.17
1591 1592 1.755959 TGCTGTCAATTGTTGGTGCTT 59.244 42.857 5.13 0.00 0.00 3.91
1621 1622 8.740123 TCTTGGTAAGACTACTCTCTCTAATG 57.260 38.462 0.00 0.00 31.20 1.90
1622 1623 6.945938 TGGTAAGACTACTCTCTCTAATGC 57.054 41.667 0.00 0.00 0.00 3.56
1629 1630 6.990349 AGACTACTCTCTCTAATGCAGTCTAC 59.010 42.308 0.00 0.00 39.64 2.59
1632 1633 5.265191 ACTCTCTCTAATGCAGTCTACCAA 58.735 41.667 0.00 0.00 0.00 3.67
1633 1634 5.717178 ACTCTCTCTAATGCAGTCTACCAAA 59.283 40.000 0.00 0.00 0.00 3.28
1635 1636 5.086104 TCTCTAATGCAGTCTACCAAACC 57.914 43.478 0.00 0.00 0.00 3.27
1636 1637 4.530553 TCTCTAATGCAGTCTACCAAACCA 59.469 41.667 0.00 0.00 0.00 3.67
1638 1639 5.428253 TCTAATGCAGTCTACCAAACCATC 58.572 41.667 0.00 0.00 0.00 3.51
1639 1640 3.719268 ATGCAGTCTACCAAACCATCA 57.281 42.857 0.00 0.00 0.00 3.07
1643 1644 4.646945 TGCAGTCTACCAAACCATCAAAAA 59.353 37.500 0.00 0.00 0.00 1.94
1671 1672 2.476619 CGATTGTTCAGCTTTCGTGTCT 59.523 45.455 0.00 0.00 0.00 3.41
1680 1681 1.192534 GCTTTCGTGTCTGTTTCTCGG 59.807 52.381 0.00 0.00 0.00 4.63
1683 1684 2.417339 TCGTGTCTGTTTCTCGGAAG 57.583 50.000 0.00 0.00 32.76 3.46
1687 1688 2.029290 GTGTCTGTTTCTCGGAAGCCTA 60.029 50.000 0.00 0.00 32.76 3.93
1689 1690 2.994578 GTCTGTTTCTCGGAAGCCTAAC 59.005 50.000 0.00 0.00 32.76 2.34
1693 1694 2.024176 TTCTCGGAAGCCTAACATGC 57.976 50.000 0.00 0.00 0.00 4.06
1698 1699 1.670811 CGGAAGCCTAACATGCGAAAT 59.329 47.619 0.00 0.00 32.02 2.17
1699 1700 2.539547 CGGAAGCCTAACATGCGAAATG 60.540 50.000 0.00 0.00 32.02 2.32
1710 1711 6.801539 AACATGCGAAATGTTCTAAGAGAA 57.198 33.333 10.20 0.00 37.69 2.87
1713 1714 7.467623 ACATGCGAAATGTTCTAAGAGAAATC 58.532 34.615 0.00 0.00 35.75 2.17
1717 1718 6.019801 GCGAAATGTTCTAAGAGAAATCGCTA 60.020 38.462 20.61 0.00 43.22 4.26
1722 1723 6.106673 TGTTCTAAGAGAAATCGCTAAAGGG 58.893 40.000 0.00 0.00 35.75 3.95
1723 1724 5.934402 TCTAAGAGAAATCGCTAAAGGGT 57.066 39.130 0.00 0.00 0.00 4.34
1724 1725 6.295719 TCTAAGAGAAATCGCTAAAGGGTT 57.704 37.500 0.00 0.00 0.00 4.11
1725 1726 6.106673 TCTAAGAGAAATCGCTAAAGGGTTG 58.893 40.000 0.00 0.00 0.00 3.77
1726 1727 4.553330 AGAGAAATCGCTAAAGGGTTGA 57.447 40.909 0.00 0.00 0.00 3.18
1727 1728 4.906618 AGAGAAATCGCTAAAGGGTTGAA 58.093 39.130 0.00 0.00 0.00 2.69
1728 1729 4.938226 AGAGAAATCGCTAAAGGGTTGAAG 59.062 41.667 0.00 0.00 0.00 3.02
1729 1730 4.906618 AGAAATCGCTAAAGGGTTGAAGA 58.093 39.130 0.00 0.00 0.00 2.87
1730 1731 5.501156 AGAAATCGCTAAAGGGTTGAAGAT 58.499 37.500 0.00 0.00 0.00 2.40
1731 1732 5.946377 AGAAATCGCTAAAGGGTTGAAGATT 59.054 36.000 0.00 0.00 0.00 2.40
1732 1733 7.110155 AGAAATCGCTAAAGGGTTGAAGATTA 58.890 34.615 0.00 0.00 0.00 1.75
1733 1734 6.679327 AATCGCTAAAGGGTTGAAGATTAC 57.321 37.500 0.00 0.00 0.00 1.89
1734 1735 5.416271 TCGCTAAAGGGTTGAAGATTACT 57.584 39.130 0.00 0.00 0.00 2.24
1735 1736 5.416947 TCGCTAAAGGGTTGAAGATTACTC 58.583 41.667 0.00 0.00 0.00 2.59
1736 1737 5.046878 TCGCTAAAGGGTTGAAGATTACTCA 60.047 40.000 0.00 0.00 0.00 3.41
1737 1738 5.063564 CGCTAAAGGGTTGAAGATTACTCAC 59.936 44.000 0.00 0.00 0.00 3.51
1738 1739 5.938125 GCTAAAGGGTTGAAGATTACTCACA 59.062 40.000 0.00 0.00 0.00 3.58
1739 1740 6.599638 GCTAAAGGGTTGAAGATTACTCACAT 59.400 38.462 0.00 0.00 0.00 3.21
1740 1741 7.201652 GCTAAAGGGTTGAAGATTACTCACATC 60.202 40.741 0.00 0.00 0.00 3.06
1741 1742 5.762179 AGGGTTGAAGATTACTCACATCA 57.238 39.130 0.00 0.00 0.00 3.07
1742 1743 5.491982 AGGGTTGAAGATTACTCACATCAC 58.508 41.667 0.00 0.00 0.00 3.06
1743 1744 5.249393 AGGGTTGAAGATTACTCACATCACT 59.751 40.000 0.00 0.00 0.00 3.41
1744 1745 5.940470 GGGTTGAAGATTACTCACATCACTT 59.060 40.000 0.00 0.00 0.00 3.16
1745 1746 6.092807 GGGTTGAAGATTACTCACATCACTTC 59.907 42.308 0.00 0.00 34.72 3.01
1746 1747 6.876257 GGTTGAAGATTACTCACATCACTTCT 59.124 38.462 0.00 0.00 35.05 2.85
1747 1748 7.148507 GGTTGAAGATTACTCACATCACTTCTG 60.149 40.741 0.00 0.00 35.05 3.02
1748 1749 7.232118 TGAAGATTACTCACATCACTTCTGA 57.768 36.000 0.00 0.00 35.05 3.27
1749 1750 7.845037 TGAAGATTACTCACATCACTTCTGAT 58.155 34.615 0.00 0.00 37.65 2.90
1757 1758 2.996249 ATCACTTCTGATGATGGCGT 57.004 45.000 0.00 0.00 35.65 5.68
1758 1759 2.014335 TCACTTCTGATGATGGCGTG 57.986 50.000 0.00 0.00 0.00 5.34
1759 1760 0.376152 CACTTCTGATGATGGCGTGC 59.624 55.000 0.00 0.00 0.00 5.34
1760 1761 0.036105 ACTTCTGATGATGGCGTGCA 60.036 50.000 0.00 0.00 0.00 4.57
1761 1762 1.306148 CTTCTGATGATGGCGTGCAT 58.694 50.000 0.00 0.00 0.00 3.96
1762 1763 1.263484 CTTCTGATGATGGCGTGCATC 59.737 52.381 0.00 10.38 40.92 3.91
1763 1764 0.533531 TCTGATGATGGCGTGCATCC 60.534 55.000 13.14 0.00 40.05 3.51
1764 1765 0.816421 CTGATGATGGCGTGCATCCA 60.816 55.000 12.24 12.24 40.05 3.41
1765 1766 1.096967 TGATGATGGCGTGCATCCAC 61.097 55.000 12.12 7.79 40.05 4.02
1766 1767 0.816825 GATGATGGCGTGCATCCACT 60.817 55.000 12.12 3.50 39.86 4.00
1767 1768 0.394762 ATGATGGCGTGCATCCACTT 60.395 50.000 12.12 0.00 39.86 3.16
1768 1769 0.251634 TGATGGCGTGCATCCACTTA 59.748 50.000 12.12 0.96 39.86 2.24
1769 1770 1.134128 TGATGGCGTGCATCCACTTAT 60.134 47.619 12.12 0.00 39.86 1.73
1770 1771 1.949525 GATGGCGTGCATCCACTTATT 59.050 47.619 12.12 0.00 39.86 1.40
1771 1772 1.093972 TGGCGTGCATCCACTTATTG 58.906 50.000 6.56 0.00 39.86 1.90
1772 1773 1.339535 TGGCGTGCATCCACTTATTGA 60.340 47.619 6.56 0.00 39.86 2.57
1773 1774 1.949525 GGCGTGCATCCACTTATTGAT 59.050 47.619 0.00 0.00 39.86 2.57
1774 1775 3.138304 GGCGTGCATCCACTTATTGATA 58.862 45.455 0.00 0.00 39.86 2.15
1775 1776 3.058914 GGCGTGCATCCACTTATTGATAC 60.059 47.826 0.00 0.00 39.86 2.24
1776 1777 3.559655 GCGTGCATCCACTTATTGATACA 59.440 43.478 0.00 0.00 39.86 2.29
1777 1778 4.552767 GCGTGCATCCACTTATTGATACAC 60.553 45.833 0.00 0.00 39.86 2.90
1778 1779 4.811024 CGTGCATCCACTTATTGATACACT 59.189 41.667 0.00 0.00 39.86 3.55
1779 1780 5.294306 CGTGCATCCACTTATTGATACACTT 59.706 40.000 0.00 0.00 39.86 3.16
1780 1781 6.510157 CGTGCATCCACTTATTGATACACTTC 60.510 42.308 0.00 0.00 39.86 3.01
1781 1782 5.523552 TGCATCCACTTATTGATACACTTCG 59.476 40.000 0.00 0.00 0.00 3.79
1782 1783 5.050091 GCATCCACTTATTGATACACTTCGG 60.050 44.000 0.00 0.00 0.00 4.30
1783 1784 5.018539 TCCACTTATTGATACACTTCGGG 57.981 43.478 0.00 0.00 0.00 5.14
1784 1785 4.712829 TCCACTTATTGATACACTTCGGGA 59.287 41.667 0.00 0.00 0.00 5.14
1785 1786 5.050490 CCACTTATTGATACACTTCGGGAG 58.950 45.833 0.00 0.00 0.00 4.30
1786 1787 4.508124 CACTTATTGATACACTTCGGGAGC 59.492 45.833 0.00 0.00 0.00 4.70
1787 1788 4.161565 ACTTATTGATACACTTCGGGAGCA 59.838 41.667 0.00 0.00 0.00 4.26
1788 1789 2.380084 TTGATACACTTCGGGAGCAC 57.620 50.000 0.00 0.00 0.00 4.40
1789 1790 0.535335 TGATACACTTCGGGAGCACC 59.465 55.000 0.00 0.00 0.00 5.01
1790 1791 0.824759 GATACACTTCGGGAGCACCT 59.175 55.000 0.00 0.00 36.97 4.00
1791 1792 0.824759 ATACACTTCGGGAGCACCTC 59.175 55.000 0.00 0.00 36.97 3.85
1803 1804 3.632855 GAGCACCTCCAGAACAAAAAG 57.367 47.619 0.00 0.00 0.00 2.27
1804 1805 2.952310 GAGCACCTCCAGAACAAAAAGT 59.048 45.455 0.00 0.00 0.00 2.66
1805 1806 4.134563 GAGCACCTCCAGAACAAAAAGTA 58.865 43.478 0.00 0.00 0.00 2.24
1806 1807 4.532834 AGCACCTCCAGAACAAAAAGTAA 58.467 39.130 0.00 0.00 0.00 2.24
1807 1808 4.580580 AGCACCTCCAGAACAAAAAGTAAG 59.419 41.667 0.00 0.00 0.00 2.34
1808 1809 4.793028 GCACCTCCAGAACAAAAAGTAAGC 60.793 45.833 0.00 0.00 0.00 3.09
1809 1810 4.338118 CACCTCCAGAACAAAAAGTAAGCA 59.662 41.667 0.00 0.00 0.00 3.91
1810 1811 5.010012 CACCTCCAGAACAAAAAGTAAGCAT 59.990 40.000 0.00 0.00 0.00 3.79
1811 1812 5.241728 ACCTCCAGAACAAAAAGTAAGCATC 59.758 40.000 0.00 0.00 0.00 3.91
1812 1813 5.241506 CCTCCAGAACAAAAAGTAAGCATCA 59.758 40.000 0.00 0.00 0.00 3.07
1813 1814 6.071728 CCTCCAGAACAAAAAGTAAGCATCAT 60.072 38.462 0.00 0.00 0.00 2.45
1814 1815 7.288810 TCCAGAACAAAAAGTAAGCATCATT 57.711 32.000 0.00 0.00 0.00 2.57
1815 1816 7.725251 TCCAGAACAAAAAGTAAGCATCATTT 58.275 30.769 0.00 0.00 0.00 2.32
1816 1817 8.855110 TCCAGAACAAAAAGTAAGCATCATTTA 58.145 29.630 0.00 0.00 0.00 1.40
1817 1818 9.132521 CCAGAACAAAAAGTAAGCATCATTTAG 57.867 33.333 0.00 0.00 0.00 1.85
1818 1819 9.683069 CAGAACAAAAAGTAAGCATCATTTAGT 57.317 29.630 0.00 0.00 0.00 2.24
1852 1853 8.830915 TCTATCTGTCTAGTTTCTTGGAATCT 57.169 34.615 0.00 0.00 0.00 2.40
1853 1854 9.261035 TCTATCTGTCTAGTTTCTTGGAATCTT 57.739 33.333 0.00 0.00 0.00 2.40
1856 1857 7.612677 TCTGTCTAGTTTCTTGGAATCTTACC 58.387 38.462 0.00 0.00 0.00 2.85
1857 1858 7.234782 TCTGTCTAGTTTCTTGGAATCTTACCA 59.765 37.037 0.00 0.00 35.47 3.25
1858 1859 7.386851 TGTCTAGTTTCTTGGAATCTTACCAG 58.613 38.462 0.00 0.00 38.70 4.00
1859 1860 7.016268 TGTCTAGTTTCTTGGAATCTTACCAGT 59.984 37.037 0.00 0.00 38.70 4.00
1860 1861 7.878644 GTCTAGTTTCTTGGAATCTTACCAGTT 59.121 37.037 0.00 0.00 38.70 3.16
1861 1862 8.095169 TCTAGTTTCTTGGAATCTTACCAGTTC 58.905 37.037 0.00 0.00 38.70 3.01
1862 1863 6.842676 AGTTTCTTGGAATCTTACCAGTTCT 58.157 36.000 0.00 0.00 38.70 3.01
1863 1864 7.290813 AGTTTCTTGGAATCTTACCAGTTCTT 58.709 34.615 0.00 0.00 38.70 2.52
1864 1865 7.780271 AGTTTCTTGGAATCTTACCAGTTCTTT 59.220 33.333 0.00 0.00 38.70 2.52
1865 1866 8.414003 GTTTCTTGGAATCTTACCAGTTCTTTT 58.586 33.333 0.00 0.00 38.70 2.27
1866 1867 8.533569 TTCTTGGAATCTTACCAGTTCTTTTT 57.466 30.769 0.00 0.00 38.70 1.94
1905 1906 4.572985 TGAGTGAATTGCAGAAAACCAG 57.427 40.909 0.00 0.00 0.00 4.00
1914 1915 2.168106 TGCAGAAAACCAGCACATTTGT 59.832 40.909 0.00 0.00 32.03 2.83
1954 1955 9.194271 GAAAACACTCTTCTACGAATTTCTACT 57.806 33.333 0.00 0.00 0.00 2.57
2051 2061 3.117474 TGGGTCCCACAAAAACTGATGTA 60.117 43.478 6.47 0.00 0.00 2.29
2058 2068 7.001674 TCCCACAAAAACTGATGTAGTGTAAT 58.998 34.615 0.00 0.00 40.26 1.89
2069 2079 3.666274 TGTAGTGTAATTGTTGGTCCCG 58.334 45.455 0.00 0.00 0.00 5.14
2105 2115 8.698210 AGACAAAATGTGATATGCAATTACCAT 58.302 29.630 0.00 0.00 0.00 3.55
2106 2116 8.876275 ACAAAATGTGATATGCAATTACCATC 57.124 30.769 0.00 0.00 0.00 3.51
2115 2125 7.678171 TGATATGCAATTACCATCTAGTCCCTA 59.322 37.037 0.00 0.00 0.00 3.53
2116 2126 5.546621 TGCAATTACCATCTAGTCCCTAC 57.453 43.478 0.00 0.00 0.00 3.18
2350 2509 1.599576 GGAGTTGGAGGAGACAGGC 59.400 63.158 0.00 0.00 0.00 4.85
2351 2510 0.907230 GGAGTTGGAGGAGACAGGCT 60.907 60.000 0.00 0.00 0.00 4.58
2355 2514 0.471780 TTGGAGGAGACAGGCTGACA 60.472 55.000 23.66 5.30 0.00 3.58
2397 2556 2.203294 GCGGTTGGTGGTCTTGGT 60.203 61.111 0.00 0.00 0.00 3.67
2406 2578 3.379445 GGTCTTGGTCGGAGGCGA 61.379 66.667 0.00 0.00 0.00 5.54
2420 2592 1.194781 AGGCGACTGGTGGTCTTGAT 61.195 55.000 0.00 0.00 42.44 2.57
2454 2626 2.116125 GGGCTGGTGTTCTTGGCT 59.884 61.111 0.00 0.00 0.00 4.75
2563 2771 3.771160 GGCGGACGAGGTGGATGT 61.771 66.667 0.00 0.00 0.00 3.06
2572 2780 3.087906 GGTGGATGTAGGGGCGGT 61.088 66.667 0.00 0.00 0.00 5.68
2573 2781 2.676265 GGTGGATGTAGGGGCGGTT 61.676 63.158 0.00 0.00 0.00 4.44
2588 2796 0.109458 CGGTTTGAGGTCGATGACGA 60.109 55.000 0.00 0.00 46.56 4.20
2691 2899 2.110213 GGGGTGACTCGTGTTGCA 59.890 61.111 0.00 0.00 0.00 4.08
2735 2954 1.326951 GGTGAGAGAGAGGTCAGGGC 61.327 65.000 0.00 0.00 0.00 5.19
2737 2956 0.115152 TGAGAGAGAGGTCAGGGCAA 59.885 55.000 0.00 0.00 0.00 4.52
2752 2971 2.685380 CAAGAGAGGAGGGGCGGT 60.685 66.667 0.00 0.00 0.00 5.68
2755 2974 2.444895 GAGAGGAGGGGCGGTGAT 60.445 66.667 0.00 0.00 0.00 3.06
2766 2985 3.190849 CGGTGATGTGAGCAGGCG 61.191 66.667 0.00 0.00 0.00 5.52
2850 3088 3.192633 GGTGTTTTGTGTGTTCAGGAAGT 59.807 43.478 0.00 0.00 0.00 3.01
2905 3146 1.212490 CGAACCGTTACGCCAGGTA 59.788 57.895 0.00 0.00 37.26 3.08
2906 3147 0.799534 CGAACCGTTACGCCAGGTAG 60.800 60.000 0.00 0.00 37.26 3.18
2936 3177 1.956477 GGCCCCACATGTCATAATCAC 59.044 52.381 0.00 0.00 0.00 3.06
2989 3231 7.383300 GTGTTTTCTGCAAAAGATTAAGCTCAT 59.617 33.333 0.00 0.00 33.93 2.90
3022 3264 3.861840 TCTGGCAGAAATTCGTAGAAGG 58.138 45.455 16.28 0.00 45.90 3.46
3032 3274 7.386848 CAGAAATTCGTAGAAGGGTGTTTTCTA 59.613 37.037 6.52 0.00 45.90 2.10
3042 3284 7.295340 AGAAGGGTGTTTTCTACAAACCTATT 58.705 34.615 0.00 0.00 42.44 1.73
3074 3316 4.022068 TGATGGTTTTCTGCAATTCACTCC 60.022 41.667 0.00 0.00 0.00 3.85
3075 3317 3.565307 TGGTTTTCTGCAATTCACTCCT 58.435 40.909 0.00 0.00 0.00 3.69
3076 3318 3.318839 TGGTTTTCTGCAATTCACTCCTG 59.681 43.478 0.00 0.00 0.00 3.86
3077 3319 3.569701 GGTTTTCTGCAATTCACTCCTGA 59.430 43.478 0.00 0.00 0.00 3.86
3078 3320 4.037923 GGTTTTCTGCAATTCACTCCTGAA 59.962 41.667 0.00 0.00 40.77 3.02
3091 3333 7.452880 TTCACTCCTGAATTTTTGATAGGTG 57.547 36.000 0.00 0.00 31.00 4.00
3092 3334 6.542821 TCACTCCTGAATTTTTGATAGGTGT 58.457 36.000 0.00 0.00 36.12 4.16
3093 3335 6.655003 TCACTCCTGAATTTTTGATAGGTGTC 59.345 38.462 0.00 0.00 34.17 3.67
3094 3336 5.946377 ACTCCTGAATTTTTGATAGGTGTCC 59.054 40.000 0.00 0.00 31.67 4.02
3095 3337 5.261216 TCCTGAATTTTTGATAGGTGTCCC 58.739 41.667 0.00 0.00 0.00 4.46
3096 3338 5.015178 TCCTGAATTTTTGATAGGTGTCCCT 59.985 40.000 0.00 0.00 45.51 4.20
3097 3339 5.716703 CCTGAATTTTTGATAGGTGTCCCTT 59.283 40.000 0.00 0.00 42.66 3.95
3098 3340 6.127619 CCTGAATTTTTGATAGGTGTCCCTTC 60.128 42.308 0.00 0.00 42.66 3.46
3099 3341 5.714806 TGAATTTTTGATAGGTGTCCCTTCC 59.285 40.000 0.00 0.00 42.66 3.46
3100 3342 4.733077 TTTTTGATAGGTGTCCCTTCCA 57.267 40.909 0.00 0.00 42.66 3.53
3101 3343 4.301072 TTTTGATAGGTGTCCCTTCCAG 57.699 45.455 0.00 0.00 42.66 3.86
3102 3344 2.940514 TGATAGGTGTCCCTTCCAGA 57.059 50.000 0.00 0.00 42.66 3.86
3103 3345 2.752030 TGATAGGTGTCCCTTCCAGAG 58.248 52.381 0.00 0.00 42.66 3.35
3104 3346 2.044492 TGATAGGTGTCCCTTCCAGAGT 59.956 50.000 0.00 0.00 42.66 3.24
3105 3347 2.715763 TAGGTGTCCCTTCCAGAGTT 57.284 50.000 0.00 0.00 42.66 3.01
3106 3348 2.715763 AGGTGTCCCTTCCAGAGTTA 57.284 50.000 0.00 0.00 38.13 2.24
3107 3349 3.207044 AGGTGTCCCTTCCAGAGTTAT 57.793 47.619 0.00 0.00 38.13 1.89
3108 3350 3.532102 AGGTGTCCCTTCCAGAGTTATT 58.468 45.455 0.00 0.00 38.13 1.40
3109 3351 4.695606 AGGTGTCCCTTCCAGAGTTATTA 58.304 43.478 0.00 0.00 38.13 0.98
3110 3352 4.470304 AGGTGTCCCTTCCAGAGTTATTAC 59.530 45.833 0.00 0.00 38.13 1.89
3111 3353 4.470304 GGTGTCCCTTCCAGAGTTATTACT 59.530 45.833 0.00 0.00 37.31 2.24
3112 3354 5.420409 GTGTCCCTTCCAGAGTTATTACTG 58.580 45.833 0.00 0.00 33.84 2.74
3113 3355 5.187186 GTGTCCCTTCCAGAGTTATTACTGA 59.813 44.000 0.00 0.00 36.38 3.41
3114 3356 5.964477 TGTCCCTTCCAGAGTTATTACTGAT 59.036 40.000 0.00 0.00 36.38 2.90
3115 3357 7.069578 GTGTCCCTTCCAGAGTTATTACTGATA 59.930 40.741 0.00 0.00 36.38 2.15
3116 3358 7.287927 TGTCCCTTCCAGAGTTATTACTGATAG 59.712 40.741 0.00 0.00 36.38 2.08
3117 3359 6.267928 TCCCTTCCAGAGTTATTACTGATAGC 59.732 42.308 0.00 0.00 36.38 2.97
3118 3360 6.042093 CCCTTCCAGAGTTATTACTGATAGCA 59.958 42.308 0.00 0.00 36.38 3.49
3119 3361 7.256475 CCCTTCCAGAGTTATTACTGATAGCAT 60.256 40.741 0.00 0.00 36.38 3.79
3120 3362 7.816995 CCTTCCAGAGTTATTACTGATAGCATC 59.183 40.741 0.00 0.00 36.38 3.91
3121 3363 6.914259 TCCAGAGTTATTACTGATAGCATCG 58.086 40.000 0.00 0.00 36.38 3.84
3122 3364 6.490381 TCCAGAGTTATTACTGATAGCATCGT 59.510 38.462 0.00 0.00 36.38 3.73
3123 3365 7.664318 TCCAGAGTTATTACTGATAGCATCGTA 59.336 37.037 0.00 0.00 36.38 3.43
3124 3366 8.297426 CCAGAGTTATTACTGATAGCATCGTAA 58.703 37.037 0.00 0.00 36.38 3.18
3125 3367 9.119329 CAGAGTTATTACTGATAGCATCGTAAC 57.881 37.037 0.00 0.00 36.38 2.50
3126 3368 8.847196 AGAGTTATTACTGATAGCATCGTAACA 58.153 33.333 0.00 0.00 34.07 2.41
3127 3369 8.798748 AGTTATTACTGATAGCATCGTAACAC 57.201 34.615 0.00 0.00 34.07 3.32
3128 3370 8.630917 AGTTATTACTGATAGCATCGTAACACT 58.369 33.333 0.00 0.08 34.07 3.55
3129 3371 9.245962 GTTATTACTGATAGCATCGTAACACTT 57.754 33.333 0.00 0.00 34.07 3.16
3132 3374 6.694877 ACTGATAGCATCGTAACACTTAGA 57.305 37.500 0.00 0.00 0.00 2.10
3133 3375 6.730175 ACTGATAGCATCGTAACACTTAGAG 58.270 40.000 0.00 0.00 0.00 2.43
3134 3376 6.073327 TGATAGCATCGTAACACTTAGAGG 57.927 41.667 0.00 0.00 0.00 3.69
3135 3377 5.593095 TGATAGCATCGTAACACTTAGAGGT 59.407 40.000 0.00 0.00 0.00 3.85
3136 3378 4.803098 AGCATCGTAACACTTAGAGGTT 57.197 40.909 0.00 0.00 0.00 3.50
3137 3379 5.909621 AGCATCGTAACACTTAGAGGTTA 57.090 39.130 0.00 0.00 0.00 2.85
3138 3380 6.466885 AGCATCGTAACACTTAGAGGTTAT 57.533 37.500 5.07 0.00 32.63 1.89
3139 3381 7.578310 AGCATCGTAACACTTAGAGGTTATA 57.422 36.000 5.07 0.00 32.63 0.98
3140 3382 8.004087 AGCATCGTAACACTTAGAGGTTATAA 57.996 34.615 5.07 0.00 32.63 0.98
3141 3383 8.472413 AGCATCGTAACACTTAGAGGTTATAAA 58.528 33.333 5.07 0.00 32.63 1.40
3142 3384 9.257651 GCATCGTAACACTTAGAGGTTATAAAT 57.742 33.333 5.07 0.00 32.63 1.40
3145 3387 9.793252 TCGTAACACTTAGAGGTTATAAATGAC 57.207 33.333 5.07 0.00 32.63 3.06
3146 3388 9.798994 CGTAACACTTAGAGGTTATAAATGACT 57.201 33.333 5.07 0.00 32.63 3.41
3149 3391 8.147244 ACACTTAGAGGTTATAAATGACTGGT 57.853 34.615 0.00 0.00 0.00 4.00
3150 3392 9.263446 ACACTTAGAGGTTATAAATGACTGGTA 57.737 33.333 0.00 0.00 0.00 3.25
3153 3395 9.543783 CTTAGAGGTTATAAATGACTGGTAACC 57.456 37.037 4.81 4.81 42.80 2.85
3154 3396 7.504926 AGAGGTTATAAATGACTGGTAACCA 57.495 36.000 13.27 0.00 44.16 3.67
3155 3397 7.924541 AGAGGTTATAAATGACTGGTAACCAA 58.075 34.615 13.27 0.00 44.16 3.67
3156 3398 8.557450 AGAGGTTATAAATGACTGGTAACCAAT 58.443 33.333 13.27 0.00 44.16 3.16
3157 3399 8.747538 AGGTTATAAATGACTGGTAACCAATC 57.252 34.615 13.27 0.00 44.16 2.67
3158 3400 7.778382 AGGTTATAAATGACTGGTAACCAATCC 59.222 37.037 13.27 0.00 44.16 3.01
3159 3401 7.255001 GGTTATAAATGACTGGTAACCAATCCG 60.255 40.741 7.52 0.00 42.31 4.18
3160 3402 3.713826 AATGACTGGTAACCAATCCGT 57.286 42.857 0.00 0.00 27.40 4.69
3161 3403 3.713826 ATGACTGGTAACCAATCCGTT 57.286 42.857 0.00 0.00 27.40 4.44
3162 3404 2.773487 TGACTGGTAACCAATCCGTTG 58.227 47.619 0.00 0.00 27.40 4.10
3163 3405 2.105134 TGACTGGTAACCAATCCGTTGT 59.895 45.455 0.00 0.00 27.40 3.32
3164 3406 3.143728 GACTGGTAACCAATCCGTTGTT 58.856 45.455 0.00 0.00 33.36 2.83
3165 3407 4.202336 TGACTGGTAACCAATCCGTTGTTA 60.202 41.667 0.00 0.00 27.40 2.41
3166 3408 4.067192 ACTGGTAACCAATCCGTTGTTAC 58.933 43.478 0.00 0.00 34.59 2.50
3167 3409 3.410508 TGGTAACCAATCCGTTGTTACC 58.589 45.455 19.03 19.03 43.29 2.85
3168 3410 3.181447 TGGTAACCAATCCGTTGTTACCA 60.181 43.478 22.75 22.75 45.97 3.25
3169 3411 3.819902 GGTAACCAATCCGTTGTTACCAA 59.180 43.478 20.29 0.00 42.97 3.67
3170 3412 3.994204 AACCAATCCGTTGTTACCAAC 57.006 42.857 0.00 0.00 46.09 3.77
3171 3413 2.232399 ACCAATCCGTTGTTACCAACC 58.768 47.619 0.00 0.00 46.71 3.77
3172 3414 2.158579 ACCAATCCGTTGTTACCAACCT 60.159 45.455 0.00 0.00 46.71 3.50
3173 3415 2.227865 CCAATCCGTTGTTACCAACCTG 59.772 50.000 0.00 0.00 46.71 4.00
3174 3416 1.530323 ATCCGTTGTTACCAACCTGC 58.470 50.000 0.00 0.00 46.71 4.85
3175 3417 0.180642 TCCGTTGTTACCAACCTGCA 59.819 50.000 0.00 0.00 46.71 4.41
3176 3418 1.025812 CCGTTGTTACCAACCTGCAA 58.974 50.000 0.00 0.00 46.71 4.08
3177 3419 1.611491 CCGTTGTTACCAACCTGCAAT 59.389 47.619 0.00 0.00 46.71 3.56
3178 3420 2.814919 CCGTTGTTACCAACCTGCAATA 59.185 45.455 0.00 0.00 46.71 1.90
3179 3421 3.442273 CCGTTGTTACCAACCTGCAATAT 59.558 43.478 0.00 0.00 46.71 1.28
3180 3422 4.082463 CCGTTGTTACCAACCTGCAATATT 60.082 41.667 0.00 0.00 46.71 1.28
3181 3423 5.092781 CGTTGTTACCAACCTGCAATATTC 58.907 41.667 0.00 0.00 46.71 1.75
3182 3424 4.955925 TGTTACCAACCTGCAATATTCG 57.044 40.909 0.00 0.00 0.00 3.34
3183 3425 3.692101 TGTTACCAACCTGCAATATTCGG 59.308 43.478 0.00 0.00 0.00 4.30
3184 3426 1.102978 ACCAACCTGCAATATTCGGC 58.897 50.000 0.00 0.00 0.00 5.54
3185 3427 1.102154 CCAACCTGCAATATTCGGCA 58.898 50.000 1.02 1.02 38.52 5.69
3190 3432 2.865492 TGCAATATTCGGCAGCACA 58.135 47.368 0.00 0.00 34.58 4.57
3191 3433 1.391577 TGCAATATTCGGCAGCACAT 58.608 45.000 0.00 0.00 34.58 3.21
3192 3434 1.065851 TGCAATATTCGGCAGCACATG 59.934 47.619 0.00 0.00 34.58 3.21
3207 3449 4.494350 GCACATGCTAATACCATTCTGG 57.506 45.455 0.00 0.00 39.97 3.86
3208 3450 3.885297 GCACATGCTAATACCATTCTGGT 59.115 43.478 3.97 3.97 45.43 4.00
3209 3451 4.261322 GCACATGCTAATACCATTCTGGTG 60.261 45.833 9.06 0.00 44.14 4.17
3210 3452 6.433522 GCACATGCTAATACCATTCTGGTGA 61.434 44.000 9.06 0.00 44.14 4.02
3211 3453 7.849194 GCACATGCTAATACCATTCTGGTGAA 61.849 42.308 9.06 0.00 44.14 3.18
3212 3454 9.740134 GCACATGCTAATACCATTCTGGTGAAC 62.740 44.444 9.06 0.00 44.14 3.18
3219 3461 2.494059 CCATTCTGGTGAACGAACAGT 58.506 47.619 0.00 0.00 34.71 3.55
3220 3462 2.480419 CCATTCTGGTGAACGAACAGTC 59.520 50.000 0.00 0.00 34.71 3.51
3221 3463 2.971660 TTCTGGTGAACGAACAGTCA 57.028 45.000 0.00 0.00 34.02 3.41
3222 3464 2.971660 TCTGGTGAACGAACAGTCAA 57.028 45.000 0.00 0.00 34.02 3.18
3223 3465 3.254470 TCTGGTGAACGAACAGTCAAA 57.746 42.857 0.00 0.00 34.02 2.69
3224 3466 2.933906 TCTGGTGAACGAACAGTCAAAC 59.066 45.455 0.00 0.00 34.02 2.93
3225 3467 2.675844 CTGGTGAACGAACAGTCAAACA 59.324 45.455 0.00 0.00 0.00 2.83
3226 3468 2.417239 TGGTGAACGAACAGTCAAACAC 59.583 45.455 0.00 0.00 0.00 3.32
3227 3469 2.417239 GGTGAACGAACAGTCAAACACA 59.583 45.455 0.00 0.00 0.00 3.72
3228 3470 3.413558 GTGAACGAACAGTCAAACACAC 58.586 45.455 0.00 0.00 0.00 3.82
3229 3471 3.124636 GTGAACGAACAGTCAAACACACT 59.875 43.478 0.00 0.00 0.00 3.55
3230 3472 3.749088 TGAACGAACAGTCAAACACACTT 59.251 39.130 0.00 0.00 0.00 3.16
3231 3473 4.930405 TGAACGAACAGTCAAACACACTTA 59.070 37.500 0.00 0.00 0.00 2.24
3232 3474 5.408909 TGAACGAACAGTCAAACACACTTAA 59.591 36.000 0.00 0.00 0.00 1.85
3233 3475 5.212589 ACGAACAGTCAAACACACTTAAC 57.787 39.130 0.00 0.00 0.00 2.01
3234 3476 4.933400 ACGAACAGTCAAACACACTTAACT 59.067 37.500 0.00 0.00 0.00 2.24
3235 3477 6.101332 ACGAACAGTCAAACACACTTAACTA 58.899 36.000 0.00 0.00 0.00 2.24
3236 3478 6.759827 ACGAACAGTCAAACACACTTAACTAT 59.240 34.615 0.00 0.00 0.00 2.12
3237 3479 7.063456 CGAACAGTCAAACACACTTAACTATG 58.937 38.462 0.00 0.00 0.00 2.23
3238 3480 7.042992 CGAACAGTCAAACACACTTAACTATGA 60.043 37.037 0.00 0.00 0.00 2.15
3239 3481 8.500753 AACAGTCAAACACACTTAACTATGAA 57.499 30.769 0.00 0.00 0.00 2.57
3240 3482 8.677148 ACAGTCAAACACACTTAACTATGAAT 57.323 30.769 0.00 0.00 0.00 2.57
3241 3483 9.120538 ACAGTCAAACACACTTAACTATGAATT 57.879 29.630 0.00 0.00 0.00 2.17
3242 3484 9.599322 CAGTCAAACACACTTAACTATGAATTC 57.401 33.333 0.00 0.00 0.00 2.17
3243 3485 9.561069 AGTCAAACACACTTAACTATGAATTCT 57.439 29.630 7.05 0.00 0.00 2.40
3262 3504 9.561069 TGAATTCTACAAAATCTATTCTAGGGC 57.439 33.333 7.05 0.00 0.00 5.19
3263 3505 9.561069 GAATTCTACAAAATCTATTCTAGGGCA 57.439 33.333 0.00 0.00 0.00 5.36
3264 3506 8.910351 ATTCTACAAAATCTATTCTAGGGCAC 57.090 34.615 0.00 0.00 0.00 5.01
3280 3522 2.488952 GGCACCTAGATTAGCTTCTGC 58.511 52.381 0.00 0.00 40.05 4.26
3281 3523 2.488952 GCACCTAGATTAGCTTCTGCC 58.511 52.381 0.00 0.00 40.80 4.85
3282 3524 2.158900 GCACCTAGATTAGCTTCTGCCA 60.159 50.000 0.00 0.00 40.80 4.92
3283 3525 3.682718 GCACCTAGATTAGCTTCTGCCAA 60.683 47.826 0.00 0.00 40.80 4.52
3284 3526 4.712476 CACCTAGATTAGCTTCTGCCAAT 58.288 43.478 0.00 0.00 40.80 3.16
3285 3527 4.514441 CACCTAGATTAGCTTCTGCCAATG 59.486 45.833 0.00 0.00 40.80 2.82
3286 3528 4.070716 CCTAGATTAGCTTCTGCCAATGG 58.929 47.826 0.00 0.00 40.80 3.16
3296 3538 2.435234 GCCAATGGCGTCCGTGTA 60.435 61.111 9.14 0.00 39.62 2.90
3297 3539 2.461110 GCCAATGGCGTCCGTGTAG 61.461 63.158 9.14 0.00 39.62 2.74
3298 3540 1.216977 CCAATGGCGTCCGTGTAGA 59.783 57.895 0.00 0.00 0.00 2.59
3299 3541 0.390603 CCAATGGCGTCCGTGTAGAA 60.391 55.000 0.00 0.00 0.00 2.10
3300 3542 0.719465 CAATGGCGTCCGTGTAGAAC 59.281 55.000 0.00 0.00 0.00 3.01
3301 3543 0.606604 AATGGCGTCCGTGTAGAACT 59.393 50.000 0.00 0.00 0.00 3.01
3302 3544 1.466856 ATGGCGTCCGTGTAGAACTA 58.533 50.000 0.00 0.00 0.00 2.24
3303 3545 1.246649 TGGCGTCCGTGTAGAACTAA 58.753 50.000 0.00 0.00 0.00 2.24
3304 3546 1.820519 TGGCGTCCGTGTAGAACTAAT 59.179 47.619 0.00 0.00 0.00 1.73
3305 3547 2.231964 TGGCGTCCGTGTAGAACTAATT 59.768 45.455 0.00 0.00 0.00 1.40
3306 3548 3.443329 TGGCGTCCGTGTAGAACTAATTA 59.557 43.478 0.00 0.00 0.00 1.40
3307 3549 4.082300 TGGCGTCCGTGTAGAACTAATTAA 60.082 41.667 0.00 0.00 0.00 1.40
3308 3550 4.864247 GGCGTCCGTGTAGAACTAATTAAA 59.136 41.667 0.00 0.00 0.00 1.52
3309 3551 5.220284 GGCGTCCGTGTAGAACTAATTAAAC 60.220 44.000 0.00 0.00 0.00 2.01
3310 3552 5.574443 GCGTCCGTGTAGAACTAATTAAACT 59.426 40.000 0.00 0.00 0.00 2.66
3311 3553 6.089954 GCGTCCGTGTAGAACTAATTAAACTT 59.910 38.462 0.00 0.00 0.00 2.66
3312 3554 7.442657 CGTCCGTGTAGAACTAATTAAACTTG 58.557 38.462 0.00 0.00 0.00 3.16
3313 3555 7.115378 CGTCCGTGTAGAACTAATTAAACTTGT 59.885 37.037 0.00 0.00 0.00 3.16
3314 3556 8.430828 GTCCGTGTAGAACTAATTAAACTTGTC 58.569 37.037 0.00 0.00 0.00 3.18
3315 3557 7.326789 TCCGTGTAGAACTAATTAAACTTGTCG 59.673 37.037 0.00 0.00 0.00 4.35
3316 3558 7.326789 CCGTGTAGAACTAATTAAACTTGTCGA 59.673 37.037 0.00 0.00 0.00 4.20
3317 3559 8.363755 CGTGTAGAACTAATTAAACTTGTCGAG 58.636 37.037 0.00 0.00 0.00 4.04
3318 3560 9.189723 GTGTAGAACTAATTAAACTTGTCGAGT 57.810 33.333 0.00 0.00 41.47 4.18
3324 3566 4.475527 AACTTGTCGAGTTGGGCC 57.524 55.556 4.56 0.00 46.66 5.80
3325 3567 1.529796 AACTTGTCGAGTTGGGCCA 59.470 52.632 0.00 0.00 46.66 5.36
3326 3568 0.818040 AACTTGTCGAGTTGGGCCAC 60.818 55.000 5.23 1.08 46.66 5.01
3327 3569 1.071471 CTTGTCGAGTTGGGCCACT 59.929 57.895 5.23 7.08 0.00 4.00
3328 3570 0.951040 CTTGTCGAGTTGGGCCACTC 60.951 60.000 19.84 19.84 40.02 3.51
3329 3571 1.407656 TTGTCGAGTTGGGCCACTCT 61.408 55.000 24.12 18.19 41.09 3.24
3330 3572 1.079750 GTCGAGTTGGGCCACTCTC 60.080 63.158 24.12 22.70 41.09 3.20
3331 3573 1.228894 TCGAGTTGGGCCACTCTCT 60.229 57.895 25.35 14.82 41.09 3.10
3332 3574 0.039180 TCGAGTTGGGCCACTCTCTA 59.961 55.000 25.35 17.22 41.09 2.43
3333 3575 0.895530 CGAGTTGGGCCACTCTCTAA 59.104 55.000 25.35 2.46 41.09 2.10
3334 3576 1.482593 CGAGTTGGGCCACTCTCTAAT 59.517 52.381 25.35 5.03 41.09 1.73
3335 3577 2.693591 CGAGTTGGGCCACTCTCTAATA 59.306 50.000 25.35 1.10 41.09 0.98
3336 3578 3.243569 CGAGTTGGGCCACTCTCTAATAG 60.244 52.174 25.35 12.69 41.09 1.73
3337 3579 3.707102 GAGTTGGGCCACTCTCTAATAGT 59.293 47.826 22.80 3.80 40.23 2.12
3338 3580 3.452627 AGTTGGGCCACTCTCTAATAGTG 59.547 47.826 5.23 0.00 43.26 2.74
3339 3581 3.116096 TGGGCCACTCTCTAATAGTGT 57.884 47.619 0.00 0.00 42.30 3.55
3340 3582 4.259933 TGGGCCACTCTCTAATAGTGTA 57.740 45.455 0.00 0.00 42.30 2.90
3341 3583 4.816126 TGGGCCACTCTCTAATAGTGTAT 58.184 43.478 0.00 0.00 42.30 2.29
3342 3584 5.960704 TGGGCCACTCTCTAATAGTGTATA 58.039 41.667 0.00 0.00 42.30 1.47
3343 3585 6.010850 TGGGCCACTCTCTAATAGTGTATAG 58.989 44.000 0.00 0.00 42.30 1.31
3344 3586 6.011481 GGGCCACTCTCTAATAGTGTATAGT 58.989 44.000 4.39 0.00 42.30 2.12
3345 3587 6.071840 GGGCCACTCTCTAATAGTGTATAGTG 60.072 46.154 4.39 0.00 42.30 2.74
3346 3588 6.490721 GGCCACTCTCTAATAGTGTATAGTGT 59.509 42.308 0.00 0.00 42.30 3.55
3347 3589 7.664731 GGCCACTCTCTAATAGTGTATAGTGTA 59.335 40.741 0.00 0.00 42.30 2.90
3348 3590 8.723311 GCCACTCTCTAATAGTGTATAGTGTAG 58.277 40.741 0.00 0.00 42.30 2.74
3349 3591 9.781633 CCACTCTCTAATAGTGTATAGTGTAGT 57.218 37.037 0.00 0.00 42.30 2.73
3386 3628 7.613551 TGGACTAAGGAAGAACTATTATCCC 57.386 40.000 0.00 0.00 32.15 3.85
3387 3629 6.557633 TGGACTAAGGAAGAACTATTATCCCC 59.442 42.308 0.00 0.00 32.15 4.81
3388 3630 6.557633 GGACTAAGGAAGAACTATTATCCCCA 59.442 42.308 0.00 0.00 32.15 4.96
3389 3631 7.376335 ACTAAGGAAGAACTATTATCCCCAC 57.624 40.000 0.00 0.00 32.15 4.61
3390 3632 6.906901 ACTAAGGAAGAACTATTATCCCCACA 59.093 38.462 0.00 0.00 32.15 4.17
3391 3633 6.652205 AAGGAAGAACTATTATCCCCACAA 57.348 37.500 0.00 0.00 32.15 3.33
3392 3634 6.652205 AGGAAGAACTATTATCCCCACAAA 57.348 37.500 0.00 0.00 32.15 2.83
3393 3635 7.226059 AGGAAGAACTATTATCCCCACAAAT 57.774 36.000 0.00 0.00 32.15 2.32
3394 3636 7.652554 AGGAAGAACTATTATCCCCACAAATT 58.347 34.615 0.00 0.00 32.15 1.82
3395 3637 8.787818 AGGAAGAACTATTATCCCCACAAATTA 58.212 33.333 0.00 0.00 32.15 1.40
3396 3638 9.416284 GGAAGAACTATTATCCCCACAAATTAA 57.584 33.333 0.00 0.00 0.00 1.40
3405 3647 9.722317 ATTATCCCCACAAATTAATCTAACCAA 57.278 29.630 0.00 0.00 0.00 3.67
3406 3648 9.722317 TTATCCCCACAAATTAATCTAACCAAT 57.278 29.630 0.00 0.00 0.00 3.16
3407 3649 7.416964 TCCCCACAAATTAATCTAACCAATG 57.583 36.000 0.00 0.00 0.00 2.82
3408 3650 7.185565 TCCCCACAAATTAATCTAACCAATGA 58.814 34.615 0.00 0.00 0.00 2.57
3409 3651 7.676043 TCCCCACAAATTAATCTAACCAATGAA 59.324 33.333 0.00 0.00 0.00 2.57
3410 3652 8.485392 CCCCACAAATTAATCTAACCAATGAAT 58.515 33.333 0.00 0.00 0.00 2.57
3411 3653 9.533253 CCCACAAATTAATCTAACCAATGAATC 57.467 33.333 0.00 0.00 0.00 2.52
3412 3654 9.533253 CCACAAATTAATCTAACCAATGAATCC 57.467 33.333 0.00 0.00 0.00 3.01
3417 3659 5.841957 AATCTAACCAATGAATCCACAGC 57.158 39.130 0.00 0.00 0.00 4.40
3418 3660 4.574674 TCTAACCAATGAATCCACAGCT 57.425 40.909 0.00 0.00 0.00 4.24
3419 3661 4.517285 TCTAACCAATGAATCCACAGCTC 58.483 43.478 0.00 0.00 0.00 4.09
3420 3662 2.134789 ACCAATGAATCCACAGCTCC 57.865 50.000 0.00 0.00 0.00 4.70
3421 3663 1.637553 ACCAATGAATCCACAGCTCCT 59.362 47.619 0.00 0.00 0.00 3.69
3422 3664 2.846206 ACCAATGAATCCACAGCTCCTA 59.154 45.455 0.00 0.00 0.00 2.94
3423 3665 3.266772 ACCAATGAATCCACAGCTCCTAA 59.733 43.478 0.00 0.00 0.00 2.69
3424 3666 3.629398 CCAATGAATCCACAGCTCCTAAC 59.371 47.826 0.00 0.00 0.00 2.34
3425 3667 4.264253 CAATGAATCCACAGCTCCTAACA 58.736 43.478 0.00 0.00 0.00 2.41
3426 3668 4.785346 ATGAATCCACAGCTCCTAACAT 57.215 40.909 0.00 0.00 0.00 2.71
3427 3669 4.574674 TGAATCCACAGCTCCTAACATT 57.425 40.909 0.00 0.00 0.00 2.71
3428 3670 4.922206 TGAATCCACAGCTCCTAACATTT 58.078 39.130 0.00 0.00 0.00 2.32
3429 3671 5.324409 TGAATCCACAGCTCCTAACATTTT 58.676 37.500 0.00 0.00 0.00 1.82
3430 3672 6.480763 TGAATCCACAGCTCCTAACATTTTA 58.519 36.000 0.00 0.00 0.00 1.52
3431 3673 6.599244 TGAATCCACAGCTCCTAACATTTTAG 59.401 38.462 0.00 0.00 35.35 1.85
3432 3674 4.261801 TCCACAGCTCCTAACATTTTAGC 58.738 43.478 0.00 0.00 34.36 3.09
3433 3675 4.019321 TCCACAGCTCCTAACATTTTAGCT 60.019 41.667 0.00 0.00 44.08 3.32
3434 3676 4.333926 CCACAGCTCCTAACATTTTAGCTC 59.666 45.833 0.00 0.00 41.44 4.09
3435 3677 4.333926 CACAGCTCCTAACATTTTAGCTCC 59.666 45.833 0.00 0.00 41.44 4.70
3436 3678 4.019321 ACAGCTCCTAACATTTTAGCTCCA 60.019 41.667 0.00 0.00 41.44 3.86
3437 3679 5.128919 CAGCTCCTAACATTTTAGCTCCAT 58.871 41.667 0.00 0.00 41.44 3.41
3438 3680 6.126768 ACAGCTCCTAACATTTTAGCTCCATA 60.127 38.462 0.00 0.00 41.44 2.74
3439 3681 6.426328 CAGCTCCTAACATTTTAGCTCCATAG 59.574 42.308 0.00 0.00 41.44 2.23
3440 3682 6.100424 AGCTCCTAACATTTTAGCTCCATAGT 59.900 38.462 0.00 0.00 39.23 2.12
3441 3683 6.425417 GCTCCTAACATTTTAGCTCCATAGTC 59.575 42.308 0.00 0.00 34.36 2.59
3442 3684 7.676683 TCCTAACATTTTAGCTCCATAGTCT 57.323 36.000 0.00 0.00 34.36 3.24
3443 3685 7.727181 TCCTAACATTTTAGCTCCATAGTCTC 58.273 38.462 0.00 0.00 34.36 3.36
3444 3686 7.344612 TCCTAACATTTTAGCTCCATAGTCTCA 59.655 37.037 0.00 0.00 34.36 3.27
3445 3687 7.439655 CCTAACATTTTAGCTCCATAGTCTCAC 59.560 40.741 0.00 0.00 34.36 3.51
3446 3688 5.675538 ACATTTTAGCTCCATAGTCTCACC 58.324 41.667 0.00 0.00 0.00 4.02
3447 3689 5.189736 ACATTTTAGCTCCATAGTCTCACCA 59.810 40.000 0.00 0.00 0.00 4.17
3448 3690 5.755409 TTTTAGCTCCATAGTCTCACCAA 57.245 39.130 0.00 0.00 0.00 3.67
3449 3691 5.755409 TTTAGCTCCATAGTCTCACCAAA 57.245 39.130 0.00 0.00 0.00 3.28
3450 3692 3.902881 AGCTCCATAGTCTCACCAAAG 57.097 47.619 0.00 0.00 0.00 2.77
3451 3693 2.093235 AGCTCCATAGTCTCACCAAAGC 60.093 50.000 0.00 0.00 0.00 3.51
3452 3694 2.093235 GCTCCATAGTCTCACCAAAGCT 60.093 50.000 0.00 0.00 0.00 3.74
3453 3695 3.620966 GCTCCATAGTCTCACCAAAGCTT 60.621 47.826 0.00 0.00 0.00 3.74
3454 3696 3.937706 CTCCATAGTCTCACCAAAGCTTG 59.062 47.826 0.00 0.00 0.00 4.01
3455 3697 3.327757 TCCATAGTCTCACCAAAGCTTGT 59.672 43.478 0.00 0.00 0.00 3.16
3456 3698 4.530553 TCCATAGTCTCACCAAAGCTTGTA 59.469 41.667 0.00 0.00 0.00 2.41
3457 3699 4.631813 CCATAGTCTCACCAAAGCTTGTAC 59.368 45.833 0.00 0.00 0.00 2.90
3458 3700 2.755650 AGTCTCACCAAAGCTTGTACG 58.244 47.619 0.00 0.00 0.00 3.67
3459 3701 1.194772 GTCTCACCAAAGCTTGTACGC 59.805 52.381 0.00 0.00 0.00 4.42
3460 3702 0.163788 CTCACCAAAGCTTGTACGCG 59.836 55.000 3.53 3.53 34.40 6.01
3461 3703 0.531090 TCACCAAAGCTTGTACGCGT 60.531 50.000 19.17 19.17 34.40 6.01
3462 3704 0.384230 CACCAAAGCTTGTACGCGTG 60.384 55.000 24.59 5.87 34.40 5.34
3463 3705 0.812412 ACCAAAGCTTGTACGCGTGT 60.812 50.000 24.59 6.91 34.40 4.49
3464 3706 1.141645 CCAAAGCTTGTACGCGTGTA 58.858 50.000 24.59 4.34 34.40 2.90
3478 3720 5.944049 ACGCGTGTACAATCAATACTAAG 57.056 39.130 12.93 0.00 0.00 2.18
3479 3721 4.802039 ACGCGTGTACAATCAATACTAAGG 59.198 41.667 12.93 0.00 0.00 2.69
3480 3722 5.038683 CGCGTGTACAATCAATACTAAGGA 58.961 41.667 0.00 0.00 0.00 3.36
3481 3723 5.690409 CGCGTGTACAATCAATACTAAGGAT 59.310 40.000 0.00 0.00 0.00 3.24
3482 3724 6.200286 CGCGTGTACAATCAATACTAAGGATT 59.800 38.462 0.00 0.00 0.00 3.01
3491 3733 9.956720 CAATCAATACTAAGGATTGTGGAATTC 57.043 33.333 0.00 0.00 41.70 2.17
3492 3734 9.927081 AATCAATACTAAGGATTGTGGAATTCT 57.073 29.630 5.23 0.00 36.02 2.40
3541 3783 8.422973 TTTTACCTGATTATTTCAATGCATGC 57.577 30.769 11.82 11.82 32.78 4.06
3542 3784 5.864418 ACCTGATTATTTCAATGCATGCT 57.136 34.783 20.33 1.07 32.78 3.79
3543 3785 6.964807 ACCTGATTATTTCAATGCATGCTA 57.035 33.333 20.33 5.73 32.78 3.49
3544 3786 7.534723 ACCTGATTATTTCAATGCATGCTAT 57.465 32.000 20.33 8.01 32.78 2.97
3545 3787 8.640063 ACCTGATTATTTCAATGCATGCTATA 57.360 30.769 20.33 0.00 32.78 1.31
3546 3788 9.251440 ACCTGATTATTTCAATGCATGCTATAT 57.749 29.630 20.33 0.44 32.78 0.86
3556 3798 8.565896 TCAATGCATGCTATATAAAACTAGGG 57.434 34.615 20.33 0.00 0.00 3.53
3557 3799 7.611467 TCAATGCATGCTATATAAAACTAGGGG 59.389 37.037 20.33 0.00 0.00 4.79
3558 3800 6.696042 TGCATGCTATATAAAACTAGGGGA 57.304 37.500 20.33 0.00 0.00 4.81
3559 3801 7.085476 TGCATGCTATATAAAACTAGGGGAA 57.915 36.000 20.33 0.00 0.00 3.97
3560 3802 7.522542 TGCATGCTATATAAAACTAGGGGAAA 58.477 34.615 20.33 0.00 0.00 3.13
3561 3803 8.001875 TGCATGCTATATAAAACTAGGGGAAAA 58.998 33.333 20.33 0.00 0.00 2.29
3562 3804 9.025041 GCATGCTATATAAAACTAGGGGAAAAT 57.975 33.333 11.37 0.00 0.00 1.82
3580 3822 9.725019 GGGGAAAATATATTTCAATTTCATCCC 57.275 33.333 21.88 21.88 39.42 3.85
3597 3839 9.887862 ATTTCATCCCTCAAATATAGAAATGGT 57.112 29.630 0.00 0.00 34.33 3.55
3598 3840 8.924511 TTCATCCCTCAAATATAGAAATGGTC 57.075 34.615 0.00 0.00 0.00 4.02
3599 3841 7.461749 TCATCCCTCAAATATAGAAATGGTCC 58.538 38.462 0.00 0.00 0.00 4.46
3600 3842 6.840090 TCCCTCAAATATAGAAATGGTCCA 57.160 37.500 0.00 0.00 0.00 4.02
3601 3843 7.406620 TCCCTCAAATATAGAAATGGTCCAT 57.593 36.000 0.00 0.00 0.00 3.41
3602 3844 7.233632 TCCCTCAAATATAGAAATGGTCCATG 58.766 38.462 4.74 0.00 0.00 3.66
3603 3845 7.073598 TCCCTCAAATATAGAAATGGTCCATGA 59.926 37.037 4.74 0.00 0.00 3.07
3604 3846 7.725397 CCCTCAAATATAGAAATGGTCCATGAA 59.275 37.037 4.74 0.00 0.00 2.57
3605 3847 8.571336 CCTCAAATATAGAAATGGTCCATGAAC 58.429 37.037 4.74 0.24 0.00 3.18
3606 3848 9.347240 CTCAAATATAGAAATGGTCCATGAACT 57.653 33.333 4.74 7.88 0.00 3.01
3615 3857 8.869109 AGAAATGGTCCATGAACTAAAAATTCA 58.131 29.630 4.74 0.00 40.25 2.57
3616 3858 9.143631 GAAATGGTCCATGAACTAAAAATTCAG 57.856 33.333 4.74 0.00 39.36 3.02
3617 3859 6.024552 TGGTCCATGAACTAAAAATTCAGC 57.975 37.500 0.00 0.00 39.36 4.26
3618 3860 5.538053 TGGTCCATGAACTAAAAATTCAGCA 59.462 36.000 0.00 0.00 39.36 4.41
3619 3861 6.041409 TGGTCCATGAACTAAAAATTCAGCAA 59.959 34.615 0.00 0.00 39.36 3.91
3620 3862 6.928492 GGTCCATGAACTAAAAATTCAGCAAA 59.072 34.615 0.00 0.00 39.36 3.68
3621 3863 7.603784 GGTCCATGAACTAAAAATTCAGCAAAT 59.396 33.333 0.00 0.00 39.36 2.32
3622 3864 8.650714 GTCCATGAACTAAAAATTCAGCAAATC 58.349 33.333 0.00 0.00 39.36 2.17
3623 3865 8.366401 TCCATGAACTAAAAATTCAGCAAATCA 58.634 29.630 0.00 0.00 39.36 2.57
3624 3866 9.158233 CCATGAACTAAAAATTCAGCAAATCAT 57.842 29.630 0.00 0.00 39.36 2.45
3629 3871 9.860898 AACTAAAAATTCAGCAAATCATAGTCC 57.139 29.630 0.00 0.00 0.00 3.85
3630 3872 8.470002 ACTAAAAATTCAGCAAATCATAGTCCC 58.530 33.333 0.00 0.00 0.00 4.46
3631 3873 7.486407 AAAAATTCAGCAAATCATAGTCCCT 57.514 32.000 0.00 0.00 0.00 4.20
3632 3874 6.705863 AAATTCAGCAAATCATAGTCCCTC 57.294 37.500 0.00 0.00 0.00 4.30
3633 3875 4.842531 TTCAGCAAATCATAGTCCCTCA 57.157 40.909 0.00 0.00 0.00 3.86
3634 3876 4.842531 TCAGCAAATCATAGTCCCTCAA 57.157 40.909 0.00 0.00 0.00 3.02
3635 3877 4.517285 TCAGCAAATCATAGTCCCTCAAC 58.483 43.478 0.00 0.00 0.00 3.18
3636 3878 4.225942 TCAGCAAATCATAGTCCCTCAACT 59.774 41.667 0.00 0.00 0.00 3.16
3637 3879 4.946157 CAGCAAATCATAGTCCCTCAACTT 59.054 41.667 0.00 0.00 0.00 2.66
3638 3880 5.065731 CAGCAAATCATAGTCCCTCAACTTC 59.934 44.000 0.00 0.00 0.00 3.01
3639 3881 4.336713 GCAAATCATAGTCCCTCAACTTCC 59.663 45.833 0.00 0.00 0.00 3.46
3640 3882 5.749462 CAAATCATAGTCCCTCAACTTCCT 58.251 41.667 0.00 0.00 0.00 3.36
3641 3883 5.622346 AATCATAGTCCCTCAACTTCCTC 57.378 43.478 0.00 0.00 0.00 3.71
3642 3884 4.061131 TCATAGTCCCTCAACTTCCTCA 57.939 45.455 0.00 0.00 0.00 3.86
3643 3885 4.425772 TCATAGTCCCTCAACTTCCTCAA 58.574 43.478 0.00 0.00 0.00 3.02
3644 3886 4.844085 TCATAGTCCCTCAACTTCCTCAAA 59.156 41.667 0.00 0.00 0.00 2.69
3645 3887 5.309543 TCATAGTCCCTCAACTTCCTCAAAA 59.690 40.000 0.00 0.00 0.00 2.44
3646 3888 4.092116 AGTCCCTCAACTTCCTCAAAAG 57.908 45.455 0.00 0.00 0.00 2.27
3647 3889 3.716872 AGTCCCTCAACTTCCTCAAAAGA 59.283 43.478 0.00 0.00 0.00 2.52
3648 3890 4.068599 GTCCCTCAACTTCCTCAAAAGAG 58.931 47.826 0.00 0.00 0.00 2.85
3649 3891 3.973973 TCCCTCAACTTCCTCAAAAGAGA 59.026 43.478 0.00 0.00 0.00 3.10
3650 3892 4.068599 CCCTCAACTTCCTCAAAAGAGAC 58.931 47.826 0.00 0.00 0.00 3.36
3651 3893 4.444876 CCCTCAACTTCCTCAAAAGAGACA 60.445 45.833 0.00 0.00 0.00 3.41
3652 3894 4.754114 CCTCAACTTCCTCAAAAGAGACAG 59.246 45.833 0.00 0.00 0.00 3.51
3653 3895 4.708177 TCAACTTCCTCAAAAGAGACAGG 58.292 43.478 0.00 0.00 0.00 4.00
3654 3896 4.408921 TCAACTTCCTCAAAAGAGACAGGA 59.591 41.667 0.00 0.00 32.94 3.86
3655 3897 5.072329 TCAACTTCCTCAAAAGAGACAGGAT 59.928 40.000 0.00 0.00 34.92 3.24
3656 3898 5.574970 ACTTCCTCAAAAGAGACAGGATT 57.425 39.130 0.00 0.00 34.92 3.01
3657 3899 5.946486 ACTTCCTCAAAAGAGACAGGATTT 58.054 37.500 0.00 0.00 34.92 2.17
3658 3900 6.368805 ACTTCCTCAAAAGAGACAGGATTTT 58.631 36.000 0.00 0.00 34.92 1.82
3659 3901 6.488344 ACTTCCTCAAAAGAGACAGGATTTTC 59.512 38.462 0.00 0.00 34.92 2.29
3660 3902 5.316987 TCCTCAAAAGAGACAGGATTTTCC 58.683 41.667 0.00 0.00 36.58 3.13
3661 3903 4.154918 CCTCAAAAGAGACAGGATTTTCCG 59.845 45.833 0.00 0.00 42.75 4.30
3662 3904 3.502211 TCAAAAGAGACAGGATTTTCCGC 59.498 43.478 0.00 0.00 42.75 5.54
3663 3905 2.859165 AAGAGACAGGATTTTCCGCA 57.141 45.000 0.00 0.00 42.75 5.69
3664 3906 2.100605 AGAGACAGGATTTTCCGCAC 57.899 50.000 0.00 0.00 42.75 5.34
3665 3907 1.087501 GAGACAGGATTTTCCGCACC 58.912 55.000 0.00 0.00 42.75 5.01
3666 3908 0.693049 AGACAGGATTTTCCGCACCT 59.307 50.000 0.00 0.00 42.75 4.00
3668 3910 2.183409 CAGGATTTTCCGCACCTGG 58.817 57.895 0.00 0.00 44.04 4.45
3669 3911 1.000896 AGGATTTTCCGCACCTGGG 60.001 57.895 0.00 0.00 42.75 4.45
3670 3912 2.710902 GGATTTTCCGCACCTGGGC 61.711 63.158 0.00 0.00 0.00 5.36
3671 3913 1.976474 GATTTTCCGCACCTGGGCA 60.976 57.895 0.00 0.00 0.00 5.36
3672 3914 2.212900 GATTTTCCGCACCTGGGCAC 62.213 60.000 0.00 0.00 0.00 5.01
3673 3915 2.992817 ATTTTCCGCACCTGGGCACA 62.993 55.000 0.00 0.00 0.00 4.57
3674 3916 4.947147 TTCCGCACCTGGGCACAC 62.947 66.667 0.00 0.00 0.00 3.82
3679 3921 4.704833 CACCTGGGCACACGGGAG 62.705 72.222 4.34 0.00 39.34 4.30
3684 3926 4.643387 GGGCACACGGGAGCTGTT 62.643 66.667 7.12 0.00 0.00 3.16
3685 3927 2.345991 GGCACACGGGAGCTGTTA 59.654 61.111 7.12 0.00 0.00 2.41
3686 3928 2.033194 GGCACACGGGAGCTGTTAC 61.033 63.158 7.12 0.00 0.00 2.50
3687 3929 1.301401 GCACACGGGAGCTGTTACA 60.301 57.895 0.00 0.00 0.00 2.41
3688 3930 1.566018 GCACACGGGAGCTGTTACAC 61.566 60.000 0.00 0.00 0.00 2.90
3689 3931 0.949105 CACACGGGAGCTGTTACACC 60.949 60.000 0.00 0.00 0.00 4.16
3690 3932 1.119574 ACACGGGAGCTGTTACACCT 61.120 55.000 0.00 0.00 0.00 4.00
3691 3933 0.034896 CACGGGAGCTGTTACACCTT 59.965 55.000 0.00 0.00 0.00 3.50
3692 3934 0.763035 ACGGGAGCTGTTACACCTTT 59.237 50.000 0.00 0.00 0.00 3.11
3693 3935 1.270678 ACGGGAGCTGTTACACCTTTC 60.271 52.381 0.00 0.00 0.00 2.62
3694 3936 1.002087 CGGGAGCTGTTACACCTTTCT 59.998 52.381 0.00 0.00 0.00 2.52
3695 3937 2.701107 GGGAGCTGTTACACCTTTCTC 58.299 52.381 0.00 0.00 0.00 2.87
3696 3938 2.303311 GGGAGCTGTTACACCTTTCTCT 59.697 50.000 0.00 0.00 0.00 3.10
3697 3939 3.244596 GGGAGCTGTTACACCTTTCTCTT 60.245 47.826 0.00 0.00 0.00 2.85
3698 3940 3.748568 GGAGCTGTTACACCTTTCTCTTG 59.251 47.826 0.00 0.00 0.00 3.02
3699 3941 4.381411 GAGCTGTTACACCTTTCTCTTGT 58.619 43.478 0.00 0.00 0.00 3.16
3700 3942 4.130118 AGCTGTTACACCTTTCTCTTGTG 58.870 43.478 0.00 0.00 36.11 3.33
3701 3943 3.877508 GCTGTTACACCTTTCTCTTGTGT 59.122 43.478 0.00 0.00 44.76 3.72
3702 3944 5.054477 GCTGTTACACCTTTCTCTTGTGTA 58.946 41.667 0.00 0.00 42.75 2.90
3703 3945 5.177696 GCTGTTACACCTTTCTCTTGTGTAG 59.822 44.000 0.00 0.00 43.88 2.74
3704 3946 6.229936 TGTTACACCTTTCTCTTGTGTAGT 57.770 37.500 0.00 0.00 43.88 2.73
3705 3947 6.278363 TGTTACACCTTTCTCTTGTGTAGTC 58.722 40.000 0.00 0.00 43.88 2.59
3706 3948 6.127281 TGTTACACCTTTCTCTTGTGTAGTCA 60.127 38.462 0.00 0.00 43.88 3.41
3707 3949 4.950050 ACACCTTTCTCTTGTGTAGTCAG 58.050 43.478 0.00 0.00 41.18 3.51
3708 3950 3.743396 CACCTTTCTCTTGTGTAGTCAGC 59.257 47.826 0.00 0.00 0.00 4.26
3709 3951 3.643792 ACCTTTCTCTTGTGTAGTCAGCT 59.356 43.478 0.00 0.00 0.00 4.24
3710 3952 4.833380 ACCTTTCTCTTGTGTAGTCAGCTA 59.167 41.667 0.00 0.00 0.00 3.32
3711 3953 5.482175 ACCTTTCTCTTGTGTAGTCAGCTAT 59.518 40.000 0.00 0.00 0.00 2.97
3712 3954 6.039616 CCTTTCTCTTGTGTAGTCAGCTATC 58.960 44.000 0.00 0.00 0.00 2.08
3713 3955 6.350528 CCTTTCTCTTGTGTAGTCAGCTATCA 60.351 42.308 0.00 0.00 0.00 2.15
3714 3956 6.590234 TTCTCTTGTGTAGTCAGCTATCAA 57.410 37.500 0.00 0.00 0.00 2.57
3715 3957 6.782082 TCTCTTGTGTAGTCAGCTATCAAT 57.218 37.500 0.00 0.00 0.00 2.57
3716 3958 6.800543 TCTCTTGTGTAGTCAGCTATCAATC 58.199 40.000 0.00 0.00 0.00 2.67
3717 3959 6.378280 TCTCTTGTGTAGTCAGCTATCAATCA 59.622 38.462 0.00 0.00 0.00 2.57
3718 3960 6.333416 TCTTGTGTAGTCAGCTATCAATCAC 58.667 40.000 0.00 0.00 0.00 3.06
3719 3961 4.672409 TGTGTAGTCAGCTATCAATCACG 58.328 43.478 0.00 0.00 0.00 4.35
3720 3962 3.487574 GTGTAGTCAGCTATCAATCACGC 59.512 47.826 0.00 0.00 0.00 5.34
3721 3963 3.381590 TGTAGTCAGCTATCAATCACGCT 59.618 43.478 0.00 0.00 0.00 5.07
3722 3964 3.533606 AGTCAGCTATCAATCACGCTT 57.466 42.857 0.00 0.00 0.00 4.68
3723 3965 3.193263 AGTCAGCTATCAATCACGCTTG 58.807 45.455 0.00 0.00 0.00 4.01
3724 3966 2.932614 GTCAGCTATCAATCACGCTTGT 59.067 45.455 0.00 0.00 0.00 3.16
3725 3967 2.931969 TCAGCTATCAATCACGCTTGTG 59.068 45.455 0.00 0.00 45.26 3.33
3726 3968 2.674852 CAGCTATCAATCACGCTTGTGT 59.325 45.455 0.00 0.00 44.22 3.72
3727 3969 2.932614 AGCTATCAATCACGCTTGTGTC 59.067 45.455 0.00 0.00 44.22 3.67
3728 3970 2.932614 GCTATCAATCACGCTTGTGTCT 59.067 45.455 0.00 0.00 44.22 3.41
3729 3971 4.112634 GCTATCAATCACGCTTGTGTCTA 58.887 43.478 0.00 0.00 44.22 2.59
3730 3972 4.026475 GCTATCAATCACGCTTGTGTCTAC 60.026 45.833 0.00 0.00 44.22 2.59
3731 3973 2.683968 TCAATCACGCTTGTGTCTACC 58.316 47.619 0.00 0.00 44.22 3.18
3732 3974 2.299013 TCAATCACGCTTGTGTCTACCT 59.701 45.455 0.00 0.00 44.22 3.08
3733 3975 3.067106 CAATCACGCTTGTGTCTACCTT 58.933 45.455 0.00 0.00 44.22 3.50
3734 3976 2.433868 TCACGCTTGTGTCTACCTTC 57.566 50.000 0.00 0.00 44.22 3.46
3735 3977 1.684450 TCACGCTTGTGTCTACCTTCA 59.316 47.619 0.00 0.00 44.22 3.02
3736 3978 2.101750 TCACGCTTGTGTCTACCTTCAA 59.898 45.455 0.00 0.00 44.22 2.69
3737 3979 3.067106 CACGCTTGTGTCTACCTTCAAT 58.933 45.455 0.00 0.00 38.84 2.57
3738 3980 4.021807 TCACGCTTGTGTCTACCTTCAATA 60.022 41.667 0.00 0.00 44.22 1.90
3762 4004 9.703892 ATAAGATTTTAGTGATAGCTAGCTGTG 57.296 33.333 27.68 0.00 0.00 3.66
3767 4009 2.692557 AGTGATAGCTAGCTGTGGTGAG 59.307 50.000 27.68 0.00 0.00 3.51
3769 4011 3.099905 TGATAGCTAGCTGTGGTGAGTT 58.900 45.455 27.68 0.00 0.00 3.01
3770 4012 3.515502 TGATAGCTAGCTGTGGTGAGTTT 59.484 43.478 27.68 0.00 0.00 2.66
3772 4014 2.772287 AGCTAGCTGTGGTGAGTTTTC 58.228 47.619 18.57 0.00 0.00 2.29
3773 4015 1.461127 GCTAGCTGTGGTGAGTTTTCG 59.539 52.381 7.70 0.00 0.00 3.46
3775 4017 2.902705 AGCTGTGGTGAGTTTTCGTA 57.097 45.000 0.00 0.00 0.00 3.43
3781 4023 2.095919 GTGGTGAGTTTTCGTACATGCC 60.096 50.000 0.00 0.00 0.00 4.40
3782 4024 1.467342 GGTGAGTTTTCGTACATGCCC 59.533 52.381 0.00 0.00 0.00 5.36
3788 4030 2.554893 GTTTTCGTACATGCCCCAAGAA 59.445 45.455 0.00 0.00 0.00 2.52
3792 4034 2.752354 TCGTACATGCCCCAAGAAATTG 59.248 45.455 0.00 0.00 0.00 2.32
3795 4037 4.438200 CGTACATGCCCCAAGAAATTGTAC 60.438 45.833 0.00 0.00 36.32 2.90
3797 4039 2.990740 TGCCCCAAGAAATTGTACCT 57.009 45.000 0.00 0.00 0.00 3.08
3799 4041 4.390129 TGCCCCAAGAAATTGTACCTTA 57.610 40.909 0.00 0.00 0.00 2.69
3800 4042 4.941713 TGCCCCAAGAAATTGTACCTTAT 58.058 39.130 0.00 0.00 0.00 1.73
3801 4043 6.080969 TGCCCCAAGAAATTGTACCTTATA 57.919 37.500 0.00 0.00 0.00 0.98
3802 4044 6.678547 TGCCCCAAGAAATTGTACCTTATAT 58.321 36.000 0.00 0.00 0.00 0.86
3803 4045 6.549364 TGCCCCAAGAAATTGTACCTTATATG 59.451 38.462 0.00 0.00 0.00 1.78
3804 4046 6.775629 GCCCCAAGAAATTGTACCTTATATGA 59.224 38.462 0.00 0.00 0.00 2.15
3805 4047 7.286775 GCCCCAAGAAATTGTACCTTATATGAA 59.713 37.037 0.00 0.00 0.00 2.57
3806 4048 9.367160 CCCCAAGAAATTGTACCTTATATGAAT 57.633 33.333 0.00 0.00 0.00 2.57
3860 4102 0.179004 TGCCAGGTACCTTGTTGTGG 60.179 55.000 13.15 11.59 0.00 4.17
3895 4137 2.555757 GAGCACAGAAGCATGGAAAACT 59.444 45.455 0.00 0.00 36.85 2.66
3898 4140 5.500234 AGCACAGAAGCATGGAAAACTATA 58.500 37.500 0.00 0.00 36.85 1.31
3901 4143 6.094048 GCACAGAAGCATGGAAAACTATAAGA 59.906 38.462 0.00 0.00 0.00 2.10
3907 4149 6.599445 AGCATGGAAAACTATAAGAGATGCT 58.401 36.000 0.00 0.00 39.27 3.79
3913 4155 8.325787 TGGAAAACTATAAGAGATGCTTTACCA 58.674 33.333 0.00 0.00 38.05 3.25
3923 4165 8.814038 AAGAGATGCTTTACCAAATAATGACT 57.186 30.769 0.00 0.00 31.11 3.41
3924 4166 8.218338 AGAGATGCTTTACCAAATAATGACTG 57.782 34.615 0.00 0.00 0.00 3.51
3938 4180 2.957402 TGACTGTGGGAGCAGAATTT 57.043 45.000 0.00 0.00 39.62 1.82
3961 4203 4.160594 TCACTACAACACGCAATAGTACG 58.839 43.478 0.00 0.00 0.00 3.67
3980 4222 2.290641 ACGGTTGCATCACTTTGTTCTC 59.709 45.455 0.00 0.00 0.00 2.87
3997 4239 3.735237 TCTCCTCAAGGCGATTATGTC 57.265 47.619 0.00 0.00 34.44 3.06
4015 4257 7.947782 TTATGTCTATAGAATGGAACCCCTT 57.052 36.000 3.40 0.00 0.00 3.95
4020 4262 7.070821 TGTCTATAGAATGGAACCCCTTAGTTC 59.929 40.741 3.40 0.00 44.45 3.01
4031 4273 0.175989 CCTTAGTTCCGCTGACTCCC 59.824 60.000 0.00 0.00 0.00 4.30
4073 4315 4.192317 AGCATTCCGTTCTGAGGATTTAC 58.808 43.478 0.00 0.00 37.65 2.01
4074 4316 4.080863 AGCATTCCGTTCTGAGGATTTACT 60.081 41.667 0.00 0.00 37.65 2.24
4078 4320 2.766828 CCGTTCTGAGGATTTACTCCCT 59.233 50.000 0.00 0.00 46.27 4.20
4081 4323 3.047695 TCTGAGGATTTACTCCCTCCC 57.952 52.381 0.00 0.00 46.43 4.30
4082 4324 2.317900 TCTGAGGATTTACTCCCTCCCA 59.682 50.000 0.00 0.00 46.43 4.37
4083 4325 2.436173 CTGAGGATTTACTCCCTCCCAC 59.564 54.545 0.00 0.00 46.43 4.61
4088 4330 3.898741 GGATTTACTCCCTCCCACTCTAG 59.101 52.174 0.00 0.00 38.19 2.43
4098 4340 6.078664 TCCCTCCCACTCTAGAAGAAATATC 58.921 44.000 0.00 0.00 0.00 1.63
4101 4343 7.898636 CCCTCCCACTCTAGAAGAAATATCTAT 59.101 40.741 0.00 0.00 33.77 1.98
4102 4344 8.748412 CCTCCCACTCTAGAAGAAATATCTATG 58.252 40.741 0.00 0.00 33.77 2.23
4123 4365 6.839124 ATGAAGATATTGGAAAAGTGTGCA 57.161 33.333 0.00 0.00 0.00 4.57
4127 4369 0.681175 ATTGGAAAAGTGTGCAGGGC 59.319 50.000 0.00 0.00 0.00 5.19
4129 4371 0.396974 TGGAAAAGTGTGCAGGGCTT 60.397 50.000 0.00 0.00 0.00 4.35
4132 4374 0.106015 AAAAGTGTGCAGGGCTTCCT 60.106 50.000 0.00 0.00 42.84 3.36
4148 4390 5.386060 GGCTTCCTTTGGCTATTATTACCT 58.614 41.667 0.00 0.00 0.00 3.08
4169 4411 4.281941 CCTTGTCTAGTATGCTGGCTGATA 59.718 45.833 0.00 0.00 0.00 2.15
4174 4416 3.931907 AGTATGCTGGCTGATAAACCA 57.068 42.857 0.00 0.00 0.00 3.67
4192 4434 3.683802 ACCAGCAGAAGAAGAATGGAAG 58.316 45.455 0.00 0.00 0.00 3.46
4197 4439 3.308046 GCAGAAGAAGAATGGAAGAGGGT 60.308 47.826 0.00 0.00 0.00 4.34
4201 4443 2.646798 AGAAGAATGGAAGAGGGTGCTT 59.353 45.455 0.00 0.00 0.00 3.91
4203 4445 1.988107 AGAATGGAAGAGGGTGCTTGA 59.012 47.619 0.00 0.00 0.00 3.02
4228 4470 5.163468 TGCTATTGGTTCTTCACTTGCAAAA 60.163 36.000 0.00 0.00 29.15 2.44
4231 4479 4.637483 TGGTTCTTCACTTGCAAAAGAG 57.363 40.909 10.96 0.00 31.16 2.85
4236 4484 2.057137 TCACTTGCAAAAGAGGCTGT 57.943 45.000 0.00 0.00 0.00 4.40
4239 4487 1.035139 CTTGCAAAAGAGGCTGTGGT 58.965 50.000 0.00 0.00 0.00 4.16
4246 4494 0.036952 AAGAGGCTGTGGTCATGACG 60.037 55.000 19.33 6.92 0.00 4.35
4258 4506 7.290110 TGTGGTCATGACGAAGATATTATCT 57.710 36.000 19.33 0.08 42.61 1.98
4286 4534 6.317391 CAGTTATTTTGATCTTCCTCACCCTC 59.683 42.308 0.00 0.00 0.00 4.30
4314 4562 4.960938 AGTTGCTTGTTGTATCTGAGTGA 58.039 39.130 0.00 0.00 0.00 3.41
4339 4587 9.092876 GAATTCCCAGAAGATCATATTATCGAC 57.907 37.037 0.00 0.00 0.00 4.20
4349 4597 7.085116 AGATCATATTATCGACAAACGGAGTC 58.915 38.462 0.00 0.00 45.00 3.36
4397 4645 1.634973 TCATCCATGAAGCACAAGGGA 59.365 47.619 0.00 7.44 37.86 4.20
4403 4651 0.397941 TGAAGCACAAGGGAGGAGTG 59.602 55.000 0.00 0.00 36.39 3.51
4406 4654 4.386413 CACAAGGGAGGAGTGCAC 57.614 61.111 9.40 9.40 0.00 4.57
4418 4666 1.373570 GAGTGCACATGAAGTAGGCC 58.626 55.000 21.04 0.00 0.00 5.19
4419 4667 0.391661 AGTGCACATGAAGTAGGCCG 60.392 55.000 21.04 0.00 0.00 6.13
4421 4669 1.819632 GCACATGAAGTAGGCCGGG 60.820 63.158 2.18 0.00 0.00 5.73
4429 4677 3.815809 TGAAGTAGGCCGGGATTATTTG 58.184 45.455 2.18 0.00 0.00 2.32
4459 4707 4.879104 GATCAACAAGAGCTTGATCCAG 57.121 45.455 16.47 0.00 44.40 3.86
4463 4711 1.074405 ACAAGAGCTTGATCCAGCCAA 59.926 47.619 14.83 0.00 42.93 4.52
4464 4712 2.291411 ACAAGAGCTTGATCCAGCCAAT 60.291 45.455 14.83 0.00 42.93 3.16
4465 4713 3.054139 ACAAGAGCTTGATCCAGCCAATA 60.054 43.478 14.83 0.00 42.93 1.90
4466 4714 3.488778 AGAGCTTGATCCAGCCAATAG 57.511 47.619 14.83 0.00 41.12 1.73
4467 4715 1.878734 GAGCTTGATCCAGCCAATAGC 59.121 52.381 14.83 0.00 41.12 2.97
4487 4735 4.511527 AGCAAATCATCAATCTGACGAGT 58.488 39.130 0.00 0.00 0.00 4.18
4488 4736 4.940046 AGCAAATCATCAATCTGACGAGTT 59.060 37.500 0.00 0.00 26.41 3.01
4494 4742 6.207691 TCATCAATCTGACGAGTTGTATGA 57.792 37.500 0.00 0.00 0.00 2.15
4496 4744 6.698766 TCATCAATCTGACGAGTTGTATGATG 59.301 38.462 0.00 0.00 41.67 3.07
4501 4749 4.096532 TCTGACGAGTTGTATGATGAGGTC 59.903 45.833 0.00 0.00 0.00 3.85
4503 4751 2.120232 CGAGTTGTATGATGAGGTCGC 58.880 52.381 0.00 0.00 0.00 5.19
4504 4752 2.479560 CGAGTTGTATGATGAGGTCGCA 60.480 50.000 0.00 0.00 0.00 5.10
4526 4774 2.860971 GCATGCCGGATTCATGACATTG 60.861 50.000 20.69 0.00 42.84 2.82
4543 4791 9.850628 CATGACATTGTTCTTGATTTCATAACT 57.149 29.630 0.00 0.00 0.00 2.24
4553 4801 3.119531 TGATTTCATAACTTGCAAGGCCG 60.120 43.478 29.18 14.86 0.00 6.13
4561 4809 1.238439 CTTGCAAGGCCGAAGAAGAA 58.762 50.000 19.14 0.00 0.00 2.52
4567 4815 3.490933 GCAAGGCCGAAGAAGAAAACTTT 60.491 43.478 0.00 0.00 0.00 2.66
4581 4829 9.300681 AGAAGAAAACTTTATGACATCATTGGA 57.699 29.630 0.00 0.00 37.76 3.53
4596 4844 5.197224 TCATTGGATGATGGAAAGAAGGT 57.803 39.130 0.00 0.00 33.59 3.50
4598 4846 3.370840 TGGATGATGGAAAGAAGGTGG 57.629 47.619 0.00 0.00 0.00 4.61
4599 4847 2.025037 TGGATGATGGAAAGAAGGTGGG 60.025 50.000 0.00 0.00 0.00 4.61
4602 4850 1.635487 TGATGGAAAGAAGGTGGGGAG 59.365 52.381 0.00 0.00 0.00 4.30
4615 4863 1.671379 GGGGAGACACAAGGTTCGC 60.671 63.158 0.00 0.00 0.00 4.70
4650 4901 2.288666 GAGCCGCACTAATGAAATGGA 58.711 47.619 0.00 0.00 0.00 3.41
4652 4903 3.290710 AGCCGCACTAATGAAATGGATT 58.709 40.909 0.00 0.00 0.00 3.01
4654 4905 3.316308 GCCGCACTAATGAAATGGATTCT 59.684 43.478 0.00 0.00 38.92 2.40
4704 4958 6.511767 CGATCACTTGCTATGTTTGGGTATTC 60.512 42.308 0.00 0.00 0.00 1.75
4707 4961 5.415701 CACTTGCTATGTTTGGGTATTCTGT 59.584 40.000 0.00 0.00 0.00 3.41
4709 4963 4.917385 TGCTATGTTTGGGTATTCTGTGT 58.083 39.130 0.00 0.00 0.00 3.72
4710 4964 5.321102 TGCTATGTTTGGGTATTCTGTGTT 58.679 37.500 0.00 0.00 0.00 3.32
4714 4968 3.701542 TGTTTGGGTATTCTGTGTTGCAA 59.298 39.130 0.00 0.00 0.00 4.08
4724 4990 3.485394 TCTGTGTTGCAATTTCCAGCTA 58.515 40.909 0.59 0.00 0.00 3.32
4763 5029 2.276201 CAGTTCTTCGTGTGTTGGACA 58.724 47.619 0.00 0.00 0.00 4.02
4768 5034 2.028476 TCTTCGTGTGTTGGACATAGGG 60.028 50.000 0.00 0.00 36.78 3.53
4778 5044 3.129262 TGGACATAGGGGAATGTGAGA 57.871 47.619 0.00 0.00 40.17 3.27
4779 5045 3.668821 TGGACATAGGGGAATGTGAGAT 58.331 45.455 0.00 0.00 40.17 2.75
4781 5047 4.141413 TGGACATAGGGGAATGTGAGATTG 60.141 45.833 0.00 0.00 40.17 2.67
4784 5050 6.409234 GGACATAGGGGAATGTGAGATTGTAA 60.409 42.308 0.00 0.00 40.17 2.41
4787 5053 7.557719 ACATAGGGGAATGTGAGATTGTAAAAG 59.442 37.037 0.00 0.00 38.65 2.27
4790 5056 5.105756 GGGGAATGTGAGATTGTAAAAGGTG 60.106 44.000 0.00 0.00 0.00 4.00
4792 5058 6.127897 GGGAATGTGAGATTGTAAAAGGTGAG 60.128 42.308 0.00 0.00 0.00 3.51
4795 5061 5.129634 TGTGAGATTGTAAAAGGTGAGCAA 58.870 37.500 0.00 0.00 0.00 3.91
4796 5062 5.592282 TGTGAGATTGTAAAAGGTGAGCAAA 59.408 36.000 0.00 0.00 0.00 3.68
4800 5066 3.658757 TGTAAAAGGTGAGCAAATGGC 57.341 42.857 0.00 0.00 45.30 4.40
4838 5104 4.051922 ACTTCTTCTCAAGTACTTGCGTG 58.948 43.478 27.49 19.46 40.24 5.34
4844 5110 1.060713 CAAGTACTTGCGTGTCGGAG 58.939 55.000 22.03 0.00 33.45 4.63
4849 5115 3.573772 CTTGCGTGTCGGAGCAGGA 62.574 63.158 0.00 0.00 44.72 3.86
4851 5117 2.125512 GCGTGTCGGAGCAGGATT 60.126 61.111 0.00 0.00 0.00 3.01
4856 5122 2.481276 CGTGTCGGAGCAGGATTGATAA 60.481 50.000 0.00 0.00 0.00 1.75
4857 5123 3.126831 GTGTCGGAGCAGGATTGATAAG 58.873 50.000 0.00 0.00 0.00 1.73
4858 5124 2.766263 TGTCGGAGCAGGATTGATAAGT 59.234 45.455 0.00 0.00 0.00 2.24
4860 5126 4.202121 TGTCGGAGCAGGATTGATAAGTAC 60.202 45.833 0.00 0.00 0.00 2.73
4864 5130 5.565045 CGGAGCAGGATTGATAAGTACTACC 60.565 48.000 0.00 0.00 0.00 3.18
4872 5138 6.016108 GGATTGATAAGTACTACCGAGCTTCT 60.016 42.308 0.00 0.00 0.00 2.85
4875 5141 5.996513 TGATAAGTACTACCGAGCTTCTAGG 59.003 44.000 0.00 0.00 32.46 3.02
4922 5188 1.165907 AACACTGGACATGCGTGGTG 61.166 55.000 11.36 10.79 33.13 4.17
4925 5191 2.356913 TGGACATGCGTGGTGTCG 60.357 61.111 11.36 0.00 45.32 4.35
4926 5192 2.048597 GGACATGCGTGGTGTCGA 60.049 61.111 11.36 0.00 45.32 4.20
4942 5208 2.690497 TGTCGAAATTGGAAAACTGCCA 59.310 40.909 0.00 0.00 0.00 4.92
4947 5213 4.386652 CGAAATTGGAAAACTGCCATCAAG 59.613 41.667 0.00 0.00 34.90 3.02
4985 5251 1.608283 GGTTGGCCCGTCTATATGCTC 60.608 57.143 0.00 0.00 0.00 4.26
4991 5257 2.035961 GCCCGTCTATATGCTCACTTCA 59.964 50.000 0.00 0.00 0.00 3.02
4993 5259 4.302455 CCCGTCTATATGCTCACTTCAAG 58.698 47.826 0.00 0.00 0.00 3.02
4994 5260 4.038042 CCCGTCTATATGCTCACTTCAAGA 59.962 45.833 0.00 0.00 0.00 3.02
4999 5265 6.861055 GTCTATATGCTCACTTCAAGACTAGC 59.139 42.308 0.00 0.00 31.59 3.42
5002 5268 2.630098 TGCTCACTTCAAGACTAGCTGT 59.370 45.455 0.00 0.00 0.00 4.40
5017 5283 5.930135 ACTAGCTGTTTATCGGATGGAATT 58.070 37.500 0.00 0.00 0.00 2.17
5020 5286 8.812972 ACTAGCTGTTTATCGGATGGAATTATA 58.187 33.333 0.00 0.00 0.00 0.98
5029 5295 5.330233 TCGGATGGAATTATAGGACAGCTA 58.670 41.667 0.00 0.00 0.00 3.32
5030 5296 5.778241 TCGGATGGAATTATAGGACAGCTAA 59.222 40.000 0.00 0.00 0.00 3.09
5054 5320 3.791973 GCTTAGAAGAGCTAGAGCACA 57.208 47.619 4.01 0.00 45.16 4.57
5057 5323 5.837437 GCTTAGAAGAGCTAGAGCACATTA 58.163 41.667 4.01 0.00 45.16 1.90
5077 5343 5.825593 TTATGGTCCTTGACTCTGAACTT 57.174 39.130 0.00 0.00 32.47 2.66
5080 5346 3.181465 TGGTCCTTGACTCTGAACTTGAC 60.181 47.826 0.00 0.00 32.47 3.18
5099 5365 4.016444 TGACAAGTTTCTGCAGGAACTTT 58.984 39.130 39.15 30.69 34.60 2.66
5133 5399 5.122396 CCAAGCTAAGGATGTTGAGTGTAAC 59.878 44.000 0.00 0.00 0.00 2.50
5155 5421 6.805016 ACTGTGATAGACCAATCTGATTCT 57.195 37.500 0.00 0.00 36.29 2.40
5156 5422 6.580788 ACTGTGATAGACCAATCTGATTCTG 58.419 40.000 0.00 0.00 36.29 3.02
5164 5430 5.474876 AGACCAATCTGATTCTGTGGAAAAC 59.525 40.000 11.96 2.79 32.27 2.43
5165 5431 5.139727 ACCAATCTGATTCTGTGGAAAACA 58.860 37.500 11.96 0.00 34.90 2.83
5167 5433 6.098124 ACCAATCTGATTCTGTGGAAAACAAA 59.902 34.615 11.96 0.00 38.67 2.83
5169 5435 5.186996 TCTGATTCTGTGGAAAACAAAGC 57.813 39.130 0.00 0.00 38.67 3.51
5170 5436 4.644234 TCTGATTCTGTGGAAAACAAAGCA 59.356 37.500 0.00 0.00 38.67 3.91
5172 5438 4.402155 TGATTCTGTGGAAAACAAAGCAGT 59.598 37.500 0.00 0.00 38.67 4.40
5227 5493 9.631452 TCGTACAATATTCATCATCTCAGAATC 57.369 33.333 0.00 0.00 34.19 2.52
5231 5497 7.390996 ACAATATTCATCATCTCAGAATCAGCC 59.609 37.037 0.00 0.00 34.19 4.85
5235 5501 2.102578 TCATCTCAGAATCAGCCACGA 58.897 47.619 0.00 0.00 0.00 4.35
5239 5505 1.220206 CAGAATCAGCCACGAGCCT 59.780 57.895 0.00 0.00 45.47 4.58
5240 5506 0.392193 CAGAATCAGCCACGAGCCTT 60.392 55.000 0.00 0.00 45.47 4.35
5241 5507 0.392193 AGAATCAGCCACGAGCCTTG 60.392 55.000 0.00 0.00 45.47 3.61
5242 5508 0.674895 GAATCAGCCACGAGCCTTGT 60.675 55.000 0.00 0.00 45.47 3.16
5243 5509 0.613260 AATCAGCCACGAGCCTTGTA 59.387 50.000 0.00 0.00 45.47 2.41
5244 5510 0.176680 ATCAGCCACGAGCCTTGTAG 59.823 55.000 0.00 0.00 45.47 2.74
5245 5511 1.185618 TCAGCCACGAGCCTTGTAGT 61.186 55.000 0.00 0.00 45.47 2.73
5246 5512 0.530744 CAGCCACGAGCCTTGTAGTA 59.469 55.000 0.00 0.00 45.47 1.82
5247 5513 1.067142 CAGCCACGAGCCTTGTAGTAA 60.067 52.381 0.00 0.00 45.47 2.24
5248 5514 1.621814 AGCCACGAGCCTTGTAGTAAA 59.378 47.619 0.00 0.00 45.47 2.01
5249 5515 2.038033 AGCCACGAGCCTTGTAGTAAAA 59.962 45.455 0.00 0.00 45.47 1.52
5250 5516 2.809696 GCCACGAGCCTTGTAGTAAAAA 59.190 45.455 0.00 0.00 34.35 1.94
5251 5517 3.439129 GCCACGAGCCTTGTAGTAAAAAT 59.561 43.478 0.00 0.00 34.35 1.82
5252 5518 4.436986 GCCACGAGCCTTGTAGTAAAAATC 60.437 45.833 0.00 0.00 34.35 2.17
5253 5519 4.693566 CCACGAGCCTTGTAGTAAAAATCA 59.306 41.667 0.00 0.00 0.00 2.57
5254 5520 5.163854 CCACGAGCCTTGTAGTAAAAATCAG 60.164 44.000 0.00 0.00 0.00 2.90
5255 5521 5.408604 CACGAGCCTTGTAGTAAAAATCAGT 59.591 40.000 0.00 0.00 0.00 3.41
5256 5522 5.638234 ACGAGCCTTGTAGTAAAAATCAGTC 59.362 40.000 0.00 0.00 0.00 3.51
5257 5523 5.637810 CGAGCCTTGTAGTAAAAATCAGTCA 59.362 40.000 0.00 0.00 0.00 3.41
5258 5524 6.183360 CGAGCCTTGTAGTAAAAATCAGTCAG 60.183 42.308 0.00 0.00 0.00 3.51
5259 5525 6.769512 AGCCTTGTAGTAAAAATCAGTCAGA 58.230 36.000 0.00 0.00 0.00 3.27
5260 5526 7.224297 AGCCTTGTAGTAAAAATCAGTCAGAA 58.776 34.615 0.00 0.00 0.00 3.02
5261 5527 7.389053 AGCCTTGTAGTAAAAATCAGTCAGAAG 59.611 37.037 0.00 0.00 0.00 2.85
5262 5528 7.361286 GCCTTGTAGTAAAAATCAGTCAGAAGG 60.361 40.741 0.00 0.00 0.00 3.46
5263 5529 7.661847 CCTTGTAGTAAAAATCAGTCAGAAGGT 59.338 37.037 0.00 0.00 0.00 3.50
5264 5530 8.974060 TTGTAGTAAAAATCAGTCAGAAGGTT 57.026 30.769 0.00 0.00 0.00 3.50
5265 5531 8.603242 TGTAGTAAAAATCAGTCAGAAGGTTC 57.397 34.615 0.00 0.00 0.00 3.62
5266 5532 8.429641 TGTAGTAAAAATCAGTCAGAAGGTTCT 58.570 33.333 0.00 0.00 38.25 3.01
5267 5533 7.971183 AGTAAAAATCAGTCAGAAGGTTCTC 57.029 36.000 0.00 0.00 34.74 2.87
5268 5534 7.740805 AGTAAAAATCAGTCAGAAGGTTCTCT 58.259 34.615 0.00 0.00 34.74 3.10
5269 5535 8.214364 AGTAAAAATCAGTCAGAAGGTTCTCTT 58.786 33.333 0.00 0.00 38.65 2.85
5270 5536 9.490379 GTAAAAATCAGTCAGAAGGTTCTCTTA 57.510 33.333 0.00 0.00 35.50 2.10
5271 5537 8.980481 AAAAATCAGTCAGAAGGTTCTCTTAA 57.020 30.769 0.00 0.00 35.50 1.85
5272 5538 8.980481 AAAATCAGTCAGAAGGTTCTCTTAAA 57.020 30.769 0.00 0.00 35.50 1.52
5273 5539 9.579932 AAAATCAGTCAGAAGGTTCTCTTAAAT 57.420 29.630 0.00 0.00 35.50 1.40
5286 5552 8.715842 AGGTTCTCTTAAATATAACCTCCTTCC 58.284 37.037 0.00 0.00 45.20 3.46
5287 5553 7.656542 GGTTCTCTTAAATATAACCTCCTTCCG 59.343 40.741 0.00 0.00 37.27 4.30
5288 5554 8.419442 GTTCTCTTAAATATAACCTCCTTCCGA 58.581 37.037 0.00 0.00 0.00 4.55
5289 5555 8.722622 TCTCTTAAATATAACCTCCTTCCGAT 57.277 34.615 0.00 0.00 0.00 4.18
5290 5556 8.585881 TCTCTTAAATATAACCTCCTTCCGATG 58.414 37.037 0.00 0.00 0.00 3.84
5291 5557 7.676947 TCTTAAATATAACCTCCTTCCGATGG 58.323 38.462 0.00 0.00 0.00 3.51
5292 5558 7.511371 TCTTAAATATAACCTCCTTCCGATGGA 59.489 37.037 3.14 3.14 0.00 3.41
5293 5559 6.509523 AAATATAACCTCCTTCCGATGGAA 57.490 37.500 4.66 0.00 39.66 3.53
5294 5560 6.704056 AATATAACCTCCTTCCGATGGAAT 57.296 37.500 4.66 0.00 41.23 3.01
5295 5561 4.625607 ATAACCTCCTTCCGATGGAATC 57.374 45.455 4.66 0.00 41.23 2.52
5296 5562 1.879575 ACCTCCTTCCGATGGAATCA 58.120 50.000 4.66 0.00 45.97 2.57
5297 5563 2.412591 ACCTCCTTCCGATGGAATCAT 58.587 47.619 4.66 0.00 45.97 2.45
5298 5564 2.105477 ACCTCCTTCCGATGGAATCATG 59.895 50.000 4.66 0.00 45.97 3.07
5299 5565 2.551721 CCTCCTTCCGATGGAATCATGG 60.552 54.545 4.66 0.00 45.97 3.66
5300 5566 2.105477 CTCCTTCCGATGGAATCATGGT 59.895 50.000 4.66 0.00 45.97 3.55
5301 5567 2.158769 TCCTTCCGATGGAATCATGGTG 60.159 50.000 0.45 0.00 45.97 4.17
5302 5568 1.605710 CTTCCGATGGAATCATGGTGC 59.394 52.381 0.00 0.00 45.97 5.01
5303 5569 0.179020 TCCGATGGAATCATGGTGCC 60.179 55.000 0.00 0.00 45.97 5.01
5304 5570 1.174712 CCGATGGAATCATGGTGCCC 61.175 60.000 0.00 0.00 45.97 5.36
5305 5571 0.179009 CGATGGAATCATGGTGCCCT 60.179 55.000 0.00 0.00 45.97 5.19
5306 5572 1.325355 GATGGAATCATGGTGCCCTG 58.675 55.000 0.00 0.00 44.70 4.45
5307 5573 0.757935 ATGGAATCATGGTGCCCTGC 60.758 55.000 0.00 0.00 31.34 4.85
5308 5574 1.380246 GGAATCATGGTGCCCTGCA 60.380 57.895 0.00 0.00 35.60 4.41
5309 5575 0.971959 GGAATCATGGTGCCCTGCAA 60.972 55.000 0.00 0.00 41.47 4.08
5310 5576 0.896923 GAATCATGGTGCCCTGCAAA 59.103 50.000 0.00 0.00 41.47 3.68
5311 5577 1.483415 GAATCATGGTGCCCTGCAAAT 59.517 47.619 0.00 0.00 41.47 2.32
5312 5578 1.117150 ATCATGGTGCCCTGCAAATC 58.883 50.000 0.00 0.00 41.47 2.17
5313 5579 0.971959 TCATGGTGCCCTGCAAATCC 60.972 55.000 0.00 0.00 41.47 3.01
5314 5580 0.974010 CATGGTGCCCTGCAAATCCT 60.974 55.000 0.00 0.00 41.47 3.24
5315 5581 0.252375 ATGGTGCCCTGCAAATCCTT 60.252 50.000 0.00 0.00 41.47 3.36
5316 5582 0.899717 TGGTGCCCTGCAAATCCTTC 60.900 55.000 0.00 0.00 41.47 3.46
5317 5583 0.899717 GGTGCCCTGCAAATCCTTCA 60.900 55.000 0.00 0.00 41.47 3.02
5318 5584 0.529378 GTGCCCTGCAAATCCTTCAG 59.471 55.000 0.00 0.00 41.47 3.02
5319 5585 0.112995 TGCCCTGCAAATCCTTCAGT 59.887 50.000 0.00 0.00 34.76 3.41
5320 5586 0.529378 GCCCTGCAAATCCTTCAGTG 59.471 55.000 0.00 0.00 0.00 3.66
5359 5625 1.968540 GGACCAGCGCTGCTCTTTT 60.969 57.895 31.96 10.50 36.40 2.27
5425 5691 1.669437 TATGTGTGCCGCTTTCGCA 60.669 52.632 0.00 0.00 35.30 5.10
5543 5809 4.492160 CCGCTTCTCGCAGCCGTA 62.492 66.667 0.00 0.00 39.08 4.02
6247 6513 5.128499 AGGAAGACTCACATCCTGATACTTG 59.872 44.000 0.00 0.00 43.86 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
17 18 3.492337 TGAAGGACCGCCATTAGTTTTT 58.508 40.909 0.00 0.00 36.29 1.94
18 19 3.149005 TGAAGGACCGCCATTAGTTTT 57.851 42.857 0.00 0.00 36.29 2.43
19 20 2.871096 TGAAGGACCGCCATTAGTTT 57.129 45.000 0.00 0.00 36.29 2.66
20 21 2.871096 TTGAAGGACCGCCATTAGTT 57.129 45.000 0.00 0.00 36.29 2.24
21 22 2.871096 TTTGAAGGACCGCCATTAGT 57.129 45.000 0.00 0.00 36.29 2.24
22 23 3.545703 AGATTTGAAGGACCGCCATTAG 58.454 45.455 0.00 0.00 36.29 1.73
23 24 3.644966 AGATTTGAAGGACCGCCATTA 57.355 42.857 0.00 0.00 36.29 1.90
24 25 2.514458 AGATTTGAAGGACCGCCATT 57.486 45.000 0.00 0.00 36.29 3.16
25 26 2.505819 AGTAGATTTGAAGGACCGCCAT 59.494 45.455 0.00 0.00 36.29 4.40
26 27 1.906574 AGTAGATTTGAAGGACCGCCA 59.093 47.619 0.00 0.00 36.29 5.69
27 28 2.693267 AGTAGATTTGAAGGACCGCC 57.307 50.000 0.00 0.00 0.00 6.13
28 29 4.924462 GCTATAGTAGATTTGAAGGACCGC 59.076 45.833 0.84 0.00 0.00 5.68
29 30 5.154932 CGCTATAGTAGATTTGAAGGACCG 58.845 45.833 0.84 0.00 0.00 4.79
30 31 5.471257 CCGCTATAGTAGATTTGAAGGACC 58.529 45.833 0.84 0.00 0.00 4.46
31 32 5.471257 CCCGCTATAGTAGATTTGAAGGAC 58.529 45.833 0.84 0.00 0.00 3.85
32 33 4.527038 CCCCGCTATAGTAGATTTGAAGGA 59.473 45.833 0.84 0.00 0.00 3.36
33 34 4.822026 CCCCGCTATAGTAGATTTGAAGG 58.178 47.826 0.84 0.00 0.00 3.46
34 35 4.021016 AGCCCCGCTATAGTAGATTTGAAG 60.021 45.833 0.84 0.00 36.99 3.02
35 36 3.901844 AGCCCCGCTATAGTAGATTTGAA 59.098 43.478 0.84 0.00 36.99 2.69
36 37 3.507411 AGCCCCGCTATAGTAGATTTGA 58.493 45.455 0.84 0.00 36.99 2.69
37 38 3.963428 AGCCCCGCTATAGTAGATTTG 57.037 47.619 0.84 0.00 36.99 2.32
82 83 9.875691 TGGCTATATGATTCATGTACAGTTATC 57.124 33.333 9.46 4.51 0.00 1.75
83 84 9.881649 CTGGCTATATGATTCATGTACAGTTAT 57.118 33.333 9.46 0.00 0.00 1.89
84 85 8.870116 ACTGGCTATATGATTCATGTACAGTTA 58.130 33.333 15.18 0.00 28.42 2.24
85 86 7.739825 ACTGGCTATATGATTCATGTACAGTT 58.260 34.615 15.18 6.01 28.42 3.16
86 87 7.015584 TGACTGGCTATATGATTCATGTACAGT 59.984 37.037 18.40 18.40 32.21 3.55
87 88 7.381323 TGACTGGCTATATGATTCATGTACAG 58.619 38.462 9.46 12.52 0.00 2.74
88 89 7.301868 TGACTGGCTATATGATTCATGTACA 57.698 36.000 9.46 0.00 0.00 2.90
89 90 8.783833 AATGACTGGCTATATGATTCATGTAC 57.216 34.615 9.46 2.87 0.00 2.90
91 92 9.445878 CTAAATGACTGGCTATATGATTCATGT 57.554 33.333 9.46 5.29 0.00 3.21
92 93 8.396390 GCTAAATGACTGGCTATATGATTCATG 58.604 37.037 9.46 0.00 0.00 3.07
93 94 8.105197 TGCTAAATGACTGGCTATATGATTCAT 58.895 33.333 4.28 4.28 0.00 2.57
94 95 7.452562 TGCTAAATGACTGGCTATATGATTCA 58.547 34.615 0.00 0.00 0.00 2.57
95 96 7.821359 TCTGCTAAATGACTGGCTATATGATTC 59.179 37.037 0.00 0.00 0.00 2.52
96 97 7.683578 TCTGCTAAATGACTGGCTATATGATT 58.316 34.615 0.00 0.00 0.00 2.57
97 98 7.250032 TCTGCTAAATGACTGGCTATATGAT 57.750 36.000 0.00 0.00 0.00 2.45
98 99 6.670695 TCTGCTAAATGACTGGCTATATGA 57.329 37.500 0.00 0.00 0.00 2.15
99 100 6.148480 GGTTCTGCTAAATGACTGGCTATATG 59.852 42.308 0.00 0.00 0.00 1.78
100 101 6.234177 GGTTCTGCTAAATGACTGGCTATAT 58.766 40.000 0.00 0.00 0.00 0.86
101 102 5.611374 GGTTCTGCTAAATGACTGGCTATA 58.389 41.667 0.00 0.00 0.00 1.31
102 103 4.455606 GGTTCTGCTAAATGACTGGCTAT 58.544 43.478 0.00 0.00 0.00 2.97
103 104 3.678806 CGGTTCTGCTAAATGACTGGCTA 60.679 47.826 0.00 0.00 0.00 3.93
104 105 2.716217 GGTTCTGCTAAATGACTGGCT 58.284 47.619 0.00 0.00 0.00 4.75
105 106 1.398390 CGGTTCTGCTAAATGACTGGC 59.602 52.381 0.00 0.00 0.00 4.85
106 107 2.699954 ACGGTTCTGCTAAATGACTGG 58.300 47.619 0.00 0.00 0.00 4.00
107 108 3.997021 AGAACGGTTCTGCTAAATGACTG 59.003 43.478 21.86 0.00 38.91 3.51
108 109 4.246458 GAGAACGGTTCTGCTAAATGACT 58.754 43.478 26.87 0.00 40.87 3.41
109 110 3.994392 TGAGAACGGTTCTGCTAAATGAC 59.006 43.478 26.87 10.23 40.87 3.06
110 111 4.265904 TGAGAACGGTTCTGCTAAATGA 57.734 40.909 26.87 0.00 40.87 2.57
111 112 5.356882 TTTGAGAACGGTTCTGCTAAATG 57.643 39.130 26.87 0.00 40.87 2.32
112 113 5.560183 CGTTTTGAGAACGGTTCTGCTAAAT 60.560 40.000 26.87 2.09 40.87 1.40
113 114 4.260456 CGTTTTGAGAACGGTTCTGCTAAA 60.260 41.667 26.87 20.55 40.87 1.85
114 115 3.246699 CGTTTTGAGAACGGTTCTGCTAA 59.753 43.478 26.87 16.88 40.87 3.09
115 116 2.798283 CGTTTTGAGAACGGTTCTGCTA 59.202 45.455 26.87 12.64 40.87 3.49
116 117 1.597663 CGTTTTGAGAACGGTTCTGCT 59.402 47.619 26.87 4.41 40.87 4.24
117 118 1.920272 GCGTTTTGAGAACGGTTCTGC 60.920 52.381 26.87 18.21 43.25 4.26
118 119 2.018717 GCGTTTTGAGAACGGTTCTG 57.981 50.000 26.87 12.78 43.25 3.02
123 124 2.658224 CGTTGTAGCGTTTTGAGAACGG 60.658 50.000 10.27 0.00 43.25 4.44
124 125 2.546665 CGTTGTAGCGTTTTGAGAACG 58.453 47.619 3.71 3.71 45.56 3.95
125 126 2.540931 TCCGTTGTAGCGTTTTGAGAAC 59.459 45.455 0.00 0.00 0.00 3.01
126 127 2.798283 CTCCGTTGTAGCGTTTTGAGAA 59.202 45.455 0.00 0.00 0.00 2.87
127 128 2.223876 ACTCCGTTGTAGCGTTTTGAGA 60.224 45.455 0.00 0.00 0.00 3.27
128 129 2.132762 ACTCCGTTGTAGCGTTTTGAG 58.867 47.619 0.00 0.00 0.00 3.02
129 130 2.228138 ACTCCGTTGTAGCGTTTTGA 57.772 45.000 0.00 0.00 0.00 2.69
130 131 4.259690 GCTATACTCCGTTGTAGCGTTTTG 60.260 45.833 0.00 0.00 31.39 2.44
131 132 3.861689 GCTATACTCCGTTGTAGCGTTTT 59.138 43.478 0.00 0.00 31.39 2.43
132 133 3.129988 AGCTATACTCCGTTGTAGCGTTT 59.870 43.478 0.00 0.00 43.19 3.60
133 134 2.686915 AGCTATACTCCGTTGTAGCGTT 59.313 45.455 0.00 0.00 43.19 4.84
134 135 2.033049 CAGCTATACTCCGTTGTAGCGT 59.967 50.000 0.00 0.00 43.19 5.07
135 136 2.604855 CCAGCTATACTCCGTTGTAGCG 60.605 54.545 0.00 0.00 43.19 4.26
136 137 2.862921 GCCAGCTATACTCCGTTGTAGC 60.863 54.545 0.00 0.00 39.77 3.58
137 138 2.623889 AGCCAGCTATACTCCGTTGTAG 59.376 50.000 0.00 0.00 0.00 2.74
138 139 2.662866 AGCCAGCTATACTCCGTTGTA 58.337 47.619 0.00 0.00 0.00 2.41
139 140 1.486211 AGCCAGCTATACTCCGTTGT 58.514 50.000 0.00 0.00 0.00 3.32
140 141 3.944055 ATAGCCAGCTATACTCCGTTG 57.056 47.619 10.42 0.00 37.47 4.10
141 142 4.957684 AAATAGCCAGCTATACTCCGTT 57.042 40.909 12.39 0.04 38.20 4.44
142 143 5.322754 TCTAAATAGCCAGCTATACTCCGT 58.677 41.667 12.39 0.00 38.20 4.69
143 144 5.899120 TCTAAATAGCCAGCTATACTCCG 57.101 43.478 12.39 1.49 38.20 4.63
144 145 7.234661 AGTTCTAAATAGCCAGCTATACTCC 57.765 40.000 12.39 0.55 38.20 3.85
145 146 9.549078 AAAAGTTCTAAATAGCCAGCTATACTC 57.451 33.333 12.39 2.10 38.20 2.59
146 147 9.549078 GAAAAGTTCTAAATAGCCAGCTATACT 57.451 33.333 12.39 8.96 38.20 2.12
147 148 9.549078 AGAAAAGTTCTAAATAGCCAGCTATAC 57.451 33.333 12.39 6.94 36.93 1.47
148 149 9.547753 CAGAAAAGTTCTAAATAGCCAGCTATA 57.452 33.333 12.39 0.00 36.74 1.31
149 150 7.500559 CCAGAAAAGTTCTAAATAGCCAGCTAT 59.499 37.037 6.34 6.34 38.16 2.97
150 151 6.823689 CCAGAAAAGTTCTAAATAGCCAGCTA 59.176 38.462 1.10 1.10 38.11 3.32
151 152 5.649831 CCAGAAAAGTTCTAAATAGCCAGCT 59.350 40.000 0.00 0.00 38.11 4.24
152 153 5.648092 TCCAGAAAAGTTCTAAATAGCCAGC 59.352 40.000 0.00 0.00 38.11 4.85
153 154 6.655003 TGTCCAGAAAAGTTCTAAATAGCCAG 59.345 38.462 0.00 0.00 38.11 4.85
154 155 6.539173 TGTCCAGAAAAGTTCTAAATAGCCA 58.461 36.000 0.00 0.00 38.11 4.75
155 156 7.306213 GTTGTCCAGAAAAGTTCTAAATAGCC 58.694 38.462 0.00 0.00 38.11 3.93
156 157 7.306213 GGTTGTCCAGAAAAGTTCTAAATAGC 58.694 38.462 0.00 0.00 38.11 2.97
157 158 7.172703 ACGGTTGTCCAGAAAAGTTCTAAATAG 59.827 37.037 0.00 0.00 38.11 1.73
158 159 6.993902 ACGGTTGTCCAGAAAAGTTCTAAATA 59.006 34.615 0.00 0.00 38.11 1.40
159 160 5.826208 ACGGTTGTCCAGAAAAGTTCTAAAT 59.174 36.000 0.00 0.00 38.11 1.40
160 161 5.187687 ACGGTTGTCCAGAAAAGTTCTAAA 58.812 37.500 0.00 0.00 38.11 1.85
161 162 4.773013 ACGGTTGTCCAGAAAAGTTCTAA 58.227 39.130 0.00 0.00 38.11 2.10
162 163 4.411256 ACGGTTGTCCAGAAAAGTTCTA 57.589 40.909 0.00 0.00 38.11 2.10
163 164 3.277142 ACGGTTGTCCAGAAAAGTTCT 57.723 42.857 0.00 0.00 41.70 3.01
164 165 3.872771 TGTACGGTTGTCCAGAAAAGTTC 59.127 43.478 0.00 0.00 0.00 3.01
165 166 3.876341 TGTACGGTTGTCCAGAAAAGTT 58.124 40.909 0.00 0.00 0.00 2.66
166 167 3.547054 TGTACGGTTGTCCAGAAAAGT 57.453 42.857 0.00 0.00 0.00 2.66
167 168 4.062293 TCATGTACGGTTGTCCAGAAAAG 58.938 43.478 0.00 0.00 0.00 2.27
168 169 4.074627 TCATGTACGGTTGTCCAGAAAA 57.925 40.909 0.00 0.00 0.00 2.29
169 170 3.755112 TCATGTACGGTTGTCCAGAAA 57.245 42.857 0.00 0.00 0.00 2.52
170 171 3.755112 TTCATGTACGGTTGTCCAGAA 57.245 42.857 0.00 0.00 0.00 3.02
171 172 3.259625 TGATTCATGTACGGTTGTCCAGA 59.740 43.478 0.00 0.00 0.00 3.86
172 173 3.595173 TGATTCATGTACGGTTGTCCAG 58.405 45.455 0.00 0.00 0.00 3.86
173 174 3.686916 TGATTCATGTACGGTTGTCCA 57.313 42.857 0.00 0.00 0.00 4.02
174 175 4.536364 CATGATTCATGTACGGTTGTCC 57.464 45.455 16.93 0.00 37.12 4.02
185 186 2.837498 TGACCGGCTACATGATTCATG 58.163 47.619 22.22 22.22 46.18 3.07
186 187 3.777106 ATGACCGGCTACATGATTCAT 57.223 42.857 0.00 0.00 0.00 2.57
187 188 3.558931 AATGACCGGCTACATGATTCA 57.441 42.857 0.00 0.00 0.00 2.57
188 189 4.213482 GGTAAATGACCGGCTACATGATTC 59.787 45.833 0.00 0.00 38.87 2.52
189 190 4.134563 GGTAAATGACCGGCTACATGATT 58.865 43.478 0.00 0.52 38.87 2.57
190 191 3.740115 GGTAAATGACCGGCTACATGAT 58.260 45.455 0.00 1.43 38.87 2.45
191 192 3.188159 GGTAAATGACCGGCTACATGA 57.812 47.619 0.00 0.00 38.87 3.07
201 202 3.803886 GGTCGCCGGTAAATGACC 58.196 61.111 1.90 9.61 45.91 4.02
202 203 1.135721 AGTAGGTCGCCGGTAAATGAC 59.864 52.381 1.90 3.88 0.00 3.06
203 204 1.406539 GAGTAGGTCGCCGGTAAATGA 59.593 52.381 1.90 0.00 0.00 2.57
204 205 1.135527 TGAGTAGGTCGCCGGTAAATG 59.864 52.381 1.90 0.00 0.00 2.32
205 206 1.477553 TGAGTAGGTCGCCGGTAAAT 58.522 50.000 1.90 0.00 0.00 1.40
206 207 1.255882 TTGAGTAGGTCGCCGGTAAA 58.744 50.000 1.90 0.00 0.00 2.01
207 208 1.255882 TTTGAGTAGGTCGCCGGTAA 58.744 50.000 1.90 0.00 0.00 2.85
208 209 1.067635 GTTTTGAGTAGGTCGCCGGTA 60.068 52.381 1.90 0.00 0.00 4.02
209 210 0.320160 GTTTTGAGTAGGTCGCCGGT 60.320 55.000 1.90 0.00 0.00 5.28
210 211 0.320073 TGTTTTGAGTAGGTCGCCGG 60.320 55.000 0.00 0.00 0.00 6.13
211 212 0.788391 GTGTTTTGAGTAGGTCGCCG 59.212 55.000 0.00 0.00 0.00 6.46
212 213 2.165319 AGTGTTTTGAGTAGGTCGCC 57.835 50.000 0.00 0.00 0.00 5.54
213 214 3.645884 TGTAGTGTTTTGAGTAGGTCGC 58.354 45.455 0.00 0.00 0.00 5.19
214 215 5.045215 TGTTGTAGTGTTTTGAGTAGGTCG 58.955 41.667 0.00 0.00 0.00 4.79
215 216 6.018180 CCTTGTTGTAGTGTTTTGAGTAGGTC 60.018 42.308 0.00 0.00 0.00 3.85
216 217 5.820947 CCTTGTTGTAGTGTTTTGAGTAGGT 59.179 40.000 0.00 0.00 0.00 3.08
217 218 5.277828 GCCTTGTTGTAGTGTTTTGAGTAGG 60.278 44.000 0.00 0.00 0.00 3.18
218 219 5.527582 AGCCTTGTTGTAGTGTTTTGAGTAG 59.472 40.000 0.00 0.00 0.00 2.57
219 220 5.433526 AGCCTTGTTGTAGTGTTTTGAGTA 58.566 37.500 0.00 0.00 0.00 2.59
220 221 4.270008 AGCCTTGTTGTAGTGTTTTGAGT 58.730 39.130 0.00 0.00 0.00 3.41
221 222 4.900635 AGCCTTGTTGTAGTGTTTTGAG 57.099 40.909 0.00 0.00 0.00 3.02
222 223 6.148811 GCTATAGCCTTGTTGTAGTGTTTTGA 59.851 38.462 14.13 0.00 34.31 2.69
223 224 6.314784 GCTATAGCCTTGTTGTAGTGTTTTG 58.685 40.000 14.13 0.00 34.31 2.44
224 225 6.496338 GCTATAGCCTTGTTGTAGTGTTTT 57.504 37.500 14.13 0.00 34.31 2.43
240 241 4.201960 GGTTCTGAAAAAGCTGGCTATAGC 60.202 45.833 16.78 16.78 44.01 2.97
241 242 5.189180 AGGTTCTGAAAAAGCTGGCTATAG 58.811 41.667 0.00 0.00 35.74 1.31
242 243 5.179452 AGGTTCTGAAAAAGCTGGCTATA 57.821 39.130 0.00 0.00 35.74 1.31
243 244 4.039603 AGGTTCTGAAAAAGCTGGCTAT 57.960 40.909 0.00 0.00 35.74 2.97
244 245 3.508845 AGGTTCTGAAAAAGCTGGCTA 57.491 42.857 0.00 0.00 35.74 3.93
245 246 2.371658 AGGTTCTGAAAAAGCTGGCT 57.628 45.000 0.00 0.00 35.74 4.75
246 247 3.459232 AAAGGTTCTGAAAAAGCTGGC 57.541 42.857 0.00 0.00 37.09 4.85
247 248 5.291858 GTCAAAAAGGTTCTGAAAAAGCTGG 59.708 40.000 0.00 0.00 37.09 4.85
248 249 5.868801 TGTCAAAAAGGTTCTGAAAAAGCTG 59.131 36.000 0.00 0.00 37.09 4.24
249 250 6.036577 TGTCAAAAAGGTTCTGAAAAAGCT 57.963 33.333 0.00 0.00 38.57 3.74
250 251 6.720012 TTGTCAAAAAGGTTCTGAAAAAGC 57.280 33.333 0.00 0.00 0.00 3.51
281 282 9.725019 CCACTAAATGATTGGCTATAGTATTCA 57.275 33.333 0.84 4.36 0.00 2.57
282 283 9.944376 TCCACTAAATGATTGGCTATAGTATTC 57.056 33.333 0.84 0.00 0.00 1.75
284 285 9.726438 GTTCCACTAAATGATTGGCTATAGTAT 57.274 33.333 0.84 0.00 0.00 2.12
285 286 8.710239 TGTTCCACTAAATGATTGGCTATAGTA 58.290 33.333 0.84 0.00 0.00 1.82
286 287 7.573710 TGTTCCACTAAATGATTGGCTATAGT 58.426 34.615 0.84 0.00 0.00 2.12
287 288 8.627208 ATGTTCCACTAAATGATTGGCTATAG 57.373 34.615 0.00 0.00 0.00 1.31
288 289 8.849168 CAATGTTCCACTAAATGATTGGCTATA 58.151 33.333 0.00 0.00 0.00 1.31
289 290 7.560991 TCAATGTTCCACTAAATGATTGGCTAT 59.439 33.333 0.00 0.00 0.00 2.97
290 291 6.889177 TCAATGTTCCACTAAATGATTGGCTA 59.111 34.615 0.00 0.00 0.00 3.93
291 292 5.716228 TCAATGTTCCACTAAATGATTGGCT 59.284 36.000 0.00 0.00 0.00 4.75
292 293 5.964758 TCAATGTTCCACTAAATGATTGGC 58.035 37.500 0.00 0.00 0.00 4.52
295 296 9.754382 GCAATATCAATGTTCCACTAAATGATT 57.246 29.630 0.00 0.00 0.00 2.57
296 297 8.362639 GGCAATATCAATGTTCCACTAAATGAT 58.637 33.333 0.00 0.00 0.00 2.45
297 298 7.560991 AGGCAATATCAATGTTCCACTAAATGA 59.439 33.333 0.00 0.00 0.00 2.57
298 299 7.719483 AGGCAATATCAATGTTCCACTAAATG 58.281 34.615 0.00 0.00 0.00 2.32
299 300 7.902920 AGGCAATATCAATGTTCCACTAAAT 57.097 32.000 0.00 0.00 0.00 1.40
300 301 8.052748 ACTAGGCAATATCAATGTTCCACTAAA 58.947 33.333 0.00 0.00 0.00 1.85
301 302 7.498900 CACTAGGCAATATCAATGTTCCACTAA 59.501 37.037 0.00 0.00 0.00 2.24
302 303 6.992123 CACTAGGCAATATCAATGTTCCACTA 59.008 38.462 0.00 0.00 0.00 2.74
303 304 5.824624 CACTAGGCAATATCAATGTTCCACT 59.175 40.000 0.00 0.00 0.00 4.00
304 305 5.590259 ACACTAGGCAATATCAATGTTCCAC 59.410 40.000 0.00 0.00 0.00 4.02
305 306 5.754782 ACACTAGGCAATATCAATGTTCCA 58.245 37.500 0.00 0.00 0.00 3.53
306 307 5.822519 TGACACTAGGCAATATCAATGTTCC 59.177 40.000 0.00 0.00 0.00 3.62
307 308 6.763135 TCTGACACTAGGCAATATCAATGTTC 59.237 38.462 0.00 0.00 0.00 3.18
308 309 6.653020 TCTGACACTAGGCAATATCAATGTT 58.347 36.000 0.00 0.00 0.00 2.71
309 310 6.239217 TCTGACACTAGGCAATATCAATGT 57.761 37.500 0.00 0.00 0.00 2.71
310 311 6.293298 GCTTCTGACACTAGGCAATATCAATG 60.293 42.308 0.00 0.00 0.00 2.82
311 312 5.762218 GCTTCTGACACTAGGCAATATCAAT 59.238 40.000 0.00 0.00 0.00 2.57
312 313 5.104776 AGCTTCTGACACTAGGCAATATCAA 60.105 40.000 0.00 0.00 0.00 2.57
313 314 4.406972 AGCTTCTGACACTAGGCAATATCA 59.593 41.667 0.00 0.00 0.00 2.15
314 315 4.954875 AGCTTCTGACACTAGGCAATATC 58.045 43.478 0.00 0.00 0.00 1.63
315 316 6.678568 ATAGCTTCTGACACTAGGCAATAT 57.321 37.500 0.00 0.00 0.00 1.28
316 317 7.069455 TGTTATAGCTTCTGACACTAGGCAATA 59.931 37.037 0.00 0.00 0.00 1.90
317 318 6.127054 TGTTATAGCTTCTGACACTAGGCAAT 60.127 38.462 0.00 0.00 0.00 3.56
318 319 5.186992 TGTTATAGCTTCTGACACTAGGCAA 59.813 40.000 0.00 0.00 0.00 4.52
319 320 4.709886 TGTTATAGCTTCTGACACTAGGCA 59.290 41.667 0.00 0.00 0.00 4.75
320 321 5.263968 TGTTATAGCTTCTGACACTAGGC 57.736 43.478 0.00 0.00 0.00 3.93
321 322 5.737635 GCCTGTTATAGCTTCTGACACTAGG 60.738 48.000 0.00 0.00 0.00 3.02
322 323 5.068460 AGCCTGTTATAGCTTCTGACACTAG 59.932 44.000 0.00 0.00 35.22 2.57
323 324 4.956700 AGCCTGTTATAGCTTCTGACACTA 59.043 41.667 0.00 0.00 35.22 2.74
324 325 3.772025 AGCCTGTTATAGCTTCTGACACT 59.228 43.478 0.00 0.00 35.22 3.55
325 326 4.130286 AGCCTGTTATAGCTTCTGACAC 57.870 45.455 0.00 0.00 35.22 3.67
326 327 5.932619 TTAGCCTGTTATAGCTTCTGACA 57.067 39.130 0.00 0.00 40.56 3.58
327 328 6.342111 ACTTTAGCCTGTTATAGCTTCTGAC 58.658 40.000 0.00 0.00 40.56 3.51
328 329 6.154534 TGACTTTAGCCTGTTATAGCTTCTGA 59.845 38.462 0.00 0.00 40.56 3.27
329 330 6.341316 TGACTTTAGCCTGTTATAGCTTCTG 58.659 40.000 0.00 0.00 40.56 3.02
330 331 6.546428 TGACTTTAGCCTGTTATAGCTTCT 57.454 37.500 0.00 0.00 40.56 2.85
331 332 5.235401 GCTGACTTTAGCCTGTTATAGCTTC 59.765 44.000 0.00 0.00 40.56 3.86
332 333 5.104735 AGCTGACTTTAGCCTGTTATAGCTT 60.105 40.000 0.00 0.00 44.76 3.74
333 334 4.407296 AGCTGACTTTAGCCTGTTATAGCT 59.593 41.667 0.00 0.00 44.76 3.32
334 335 4.698575 AGCTGACTTTAGCCTGTTATAGC 58.301 43.478 0.00 0.00 44.76 2.97
335 336 8.894768 AAATAGCTGACTTTAGCCTGTTATAG 57.105 34.615 0.00 0.00 44.76 1.31
337 338 9.681062 TTTAAATAGCTGACTTTAGCCTGTTAT 57.319 29.630 0.00 0.00 44.76 1.89
338 339 9.509956 TTTTAAATAGCTGACTTTAGCCTGTTA 57.490 29.630 0.00 0.00 44.76 2.41
339 340 7.996098 TTTAAATAGCTGACTTTAGCCTGTT 57.004 32.000 0.00 0.00 44.76 3.16
340 341 7.447238 TGTTTTAAATAGCTGACTTTAGCCTGT 59.553 33.333 0.00 0.00 44.76 4.00
341 342 7.816640 TGTTTTAAATAGCTGACTTTAGCCTG 58.183 34.615 0.00 0.00 44.76 4.85
342 343 7.996098 TGTTTTAAATAGCTGACTTTAGCCT 57.004 32.000 0.00 0.00 44.76 4.58
343 344 9.076596 CAATGTTTTAAATAGCTGACTTTAGCC 57.923 33.333 0.00 0.00 44.76 3.93
344 345 9.840427 TCAATGTTTTAAATAGCTGACTTTAGC 57.160 29.630 0.00 0.00 44.01 3.09
351 352 9.748708 GGCAATATCAATGTTTTAAATAGCTGA 57.251 29.630 0.00 0.00 0.00 4.26
352 353 8.693504 CGGCAATATCAATGTTTTAAATAGCTG 58.306 33.333 0.00 0.00 0.00 4.24
353 354 8.629158 TCGGCAATATCAATGTTTTAAATAGCT 58.371 29.630 0.00 0.00 0.00 3.32
354 355 8.795786 TCGGCAATATCAATGTTTTAAATAGC 57.204 30.769 0.00 0.00 0.00 2.97
355 356 9.950680 ACTCGGCAATATCAATGTTTTAAATAG 57.049 29.630 0.00 0.00 0.00 1.73
356 357 9.729023 CACTCGGCAATATCAATGTTTTAAATA 57.271 29.630 0.00 0.00 0.00 1.40
357 358 7.222611 GCACTCGGCAATATCAATGTTTTAAAT 59.777 33.333 0.00 0.00 43.97 1.40
358 359 6.529829 GCACTCGGCAATATCAATGTTTTAAA 59.470 34.615 0.00 0.00 43.97 1.52
359 360 6.033341 GCACTCGGCAATATCAATGTTTTAA 58.967 36.000 0.00 0.00 43.97 1.52
360 361 5.577835 GCACTCGGCAATATCAATGTTTTA 58.422 37.500 0.00 0.00 43.97 1.52
361 362 4.423732 GCACTCGGCAATATCAATGTTTT 58.576 39.130 0.00 0.00 43.97 2.43
362 363 4.032703 GCACTCGGCAATATCAATGTTT 57.967 40.909 0.00 0.00 43.97 2.83
363 364 3.698029 GCACTCGGCAATATCAATGTT 57.302 42.857 0.00 0.00 43.97 2.71
378 379 0.615331 TCCTTGTGATGAGGGCACTC 59.385 55.000 9.72 9.72 44.23 3.51
379 380 1.293062 ATCCTTGTGATGAGGGCACT 58.707 50.000 0.00 0.00 37.18 4.40
380 381 2.171448 AGTATCCTTGTGATGAGGGCAC 59.829 50.000 0.00 0.00 34.76 5.01
381 382 2.481441 AGTATCCTTGTGATGAGGGCA 58.519 47.619 0.00 0.00 34.76 5.36
382 383 3.244249 GGTAGTATCCTTGTGATGAGGGC 60.244 52.174 0.00 0.00 34.76 5.19
383 384 3.325135 GGGTAGTATCCTTGTGATGAGGG 59.675 52.174 0.00 0.00 34.76 4.30
384 385 3.325135 GGGGTAGTATCCTTGTGATGAGG 59.675 52.174 0.00 0.00 34.76 3.86
385 386 3.967326 TGGGGTAGTATCCTTGTGATGAG 59.033 47.826 0.00 0.00 34.76 2.90
386 387 4.002256 TGGGGTAGTATCCTTGTGATGA 57.998 45.455 0.00 0.00 34.76 2.92
387 388 4.263068 GGATGGGGTAGTATCCTTGTGATG 60.263 50.000 0.00 0.00 39.78 3.07
388 389 3.910627 GGATGGGGTAGTATCCTTGTGAT 59.089 47.826 0.00 0.00 39.78 3.06
389 390 3.314693 GGATGGGGTAGTATCCTTGTGA 58.685 50.000 0.00 0.00 39.78 3.58
390 391 3.771577 GGATGGGGTAGTATCCTTGTG 57.228 52.381 0.00 0.00 39.78 3.33
395 396 2.225066 ACGAGAGGATGGGGTAGTATCC 60.225 54.545 0.00 0.00 42.56 2.59
396 397 3.157750 ACGAGAGGATGGGGTAGTATC 57.842 52.381 0.00 0.00 0.00 2.24
397 398 4.949966 ATACGAGAGGATGGGGTAGTAT 57.050 45.455 0.00 0.00 29.43 2.12
398 399 4.736611 AATACGAGAGGATGGGGTAGTA 57.263 45.455 0.00 0.00 32.52 1.82
399 400 3.614568 AATACGAGAGGATGGGGTAGT 57.385 47.619 0.00 0.00 32.52 2.73
400 401 3.006967 CCAAATACGAGAGGATGGGGTAG 59.993 52.174 0.00 0.00 32.52 3.18
401 402 2.969950 CCAAATACGAGAGGATGGGGTA 59.030 50.000 0.00 0.00 32.52 3.69
402 403 1.768870 CCAAATACGAGAGGATGGGGT 59.231 52.381 0.00 0.00 32.52 4.95
403 404 1.768870 ACCAAATACGAGAGGATGGGG 59.231 52.381 0.00 0.00 34.78 4.96
404 405 3.560636 AACCAAATACGAGAGGATGGG 57.439 47.619 0.00 0.00 32.52 4.00
405 406 6.598064 ACTTTAAACCAAATACGAGAGGATGG 59.402 38.462 0.00 0.00 32.52 3.51
406 407 7.119262 ACACTTTAAACCAAATACGAGAGGATG 59.881 37.037 0.00 0.00 32.52 3.51
407 408 7.119262 CACACTTTAAACCAAATACGAGAGGAT 59.881 37.037 0.00 0.00 34.80 3.24
408 409 6.425721 CACACTTTAAACCAAATACGAGAGGA 59.574 38.462 0.00 0.00 0.00 3.71
409 410 6.425721 TCACACTTTAAACCAAATACGAGAGG 59.574 38.462 0.00 0.00 0.00 3.69
410 411 7.288672 GTCACACTTTAAACCAAATACGAGAG 58.711 38.462 0.00 0.00 0.00 3.20
411 412 6.203338 GGTCACACTTTAAACCAAATACGAGA 59.797 38.462 0.00 0.00 0.00 4.04
412 413 6.017770 TGGTCACACTTTAAACCAAATACGAG 60.018 38.462 0.00 0.00 38.80 4.18
413 414 5.821470 TGGTCACACTTTAAACCAAATACGA 59.179 36.000 0.00 0.00 38.80 3.43
414 415 6.062434 TGGTCACACTTTAAACCAAATACG 57.938 37.500 0.00 0.00 38.80 3.06
415 416 7.882179 AGATGGTCACACTTTAAACCAAATAC 58.118 34.615 0.00 0.00 44.48 1.89
416 417 9.747898 ATAGATGGTCACACTTTAAACCAAATA 57.252 29.630 0.00 0.00 44.48 1.40
417 418 6.976934 AGATGGTCACACTTTAAACCAAAT 57.023 33.333 0.00 0.00 44.48 2.32
418 419 7.942341 AGATAGATGGTCACACTTTAAACCAAA 59.058 33.333 0.00 0.00 44.48 3.28
419 420 7.458397 AGATAGATGGTCACACTTTAAACCAA 58.542 34.615 0.00 0.00 44.48 3.67
420 421 7.016153 AGATAGATGGTCACACTTTAAACCA 57.984 36.000 0.00 0.00 45.32 3.67
421 422 9.444600 TTTAGATAGATGGTCACACTTTAAACC 57.555 33.333 0.00 0.00 0.00 3.27
426 427 9.739276 TCATTTTTAGATAGATGGTCACACTTT 57.261 29.630 0.00 0.00 0.00 2.66
427 428 9.739276 TTCATTTTTAGATAGATGGTCACACTT 57.261 29.630 0.00 0.00 0.00 3.16
428 429 9.388506 CTTCATTTTTAGATAGATGGTCACACT 57.611 33.333 0.00 0.00 0.00 3.55
429 430 9.167311 ACTTCATTTTTAGATAGATGGTCACAC 57.833 33.333 0.00 0.00 0.00 3.82
481 482 7.814587 CCGAAAGCCAATTTTAAGAGAAAATCT 59.185 33.333 0.00 0.00 41.27 2.40
482 483 7.411912 GCCGAAAGCCAATTTTAAGAGAAAATC 60.412 37.037 0.00 0.00 34.35 2.17
483 484 6.368791 GCCGAAAGCCAATTTTAAGAGAAAAT 59.631 34.615 0.00 0.00 34.35 1.82
484 485 5.694458 GCCGAAAGCCAATTTTAAGAGAAAA 59.306 36.000 0.00 0.00 34.35 2.29
485 486 5.010617 AGCCGAAAGCCAATTTTAAGAGAAA 59.989 36.000 0.00 0.00 45.47 2.52
486 487 4.522789 AGCCGAAAGCCAATTTTAAGAGAA 59.477 37.500 0.00 0.00 45.47 2.87
487 488 4.079253 AGCCGAAAGCCAATTTTAAGAGA 58.921 39.130 0.00 0.00 45.47 3.10
488 489 4.415735 GAGCCGAAAGCCAATTTTAAGAG 58.584 43.478 0.00 0.00 45.47 2.85
489 490 3.119990 CGAGCCGAAAGCCAATTTTAAGA 60.120 43.478 0.00 0.00 45.47 2.10
490 491 3.171277 CGAGCCGAAAGCCAATTTTAAG 58.829 45.455 0.00 0.00 45.47 1.85
491 492 2.669950 GCGAGCCGAAAGCCAATTTTAA 60.670 45.455 0.00 0.00 45.47 1.52
492 493 1.135517 GCGAGCCGAAAGCCAATTTTA 60.136 47.619 0.00 0.00 45.47 1.52
493 494 0.388520 GCGAGCCGAAAGCCAATTTT 60.389 50.000 0.00 0.00 45.47 1.82
494 495 1.212751 GCGAGCCGAAAGCCAATTT 59.787 52.632 0.00 0.00 45.47 1.82
495 496 1.244019 AAGCGAGCCGAAAGCCAATT 61.244 50.000 0.00 0.00 45.47 2.32
496 497 1.244019 AAAGCGAGCCGAAAGCCAAT 61.244 50.000 0.00 0.00 45.47 3.16
497 498 1.452145 AAAAGCGAGCCGAAAGCCAA 61.452 50.000 0.00 0.00 45.47 4.52
498 499 0.604243 TAAAAGCGAGCCGAAAGCCA 60.604 50.000 0.00 0.00 45.47 4.75
499 500 0.733150 ATAAAAGCGAGCCGAAAGCC 59.267 50.000 0.00 0.00 45.47 4.35
500 501 3.668596 TTATAAAAGCGAGCCGAAAGC 57.331 42.857 0.00 0.00 44.25 3.51
501 502 7.097006 GCTTTATTTATAAAAGCGAGCCGAAAG 60.097 37.037 1.21 3.39 46.52 2.62
502 503 6.689669 GCTTTATTTATAAAAGCGAGCCGAAA 59.310 34.615 1.21 0.00 46.52 3.46
503 504 6.196571 GCTTTATTTATAAAAGCGAGCCGAA 58.803 36.000 1.21 0.00 46.52 4.30
504 505 5.744490 GCTTTATTTATAAAAGCGAGCCGA 58.256 37.500 1.21 0.00 46.52 5.54
513 514 9.646427 GGACATGGTGTTGCTTTATTTATAAAA 57.354 29.630 1.21 0.00 32.39 1.52
514 515 8.807118 TGGACATGGTGTTGCTTTATTTATAAA 58.193 29.630 0.00 0.00 0.00 1.40
515 516 8.354711 TGGACATGGTGTTGCTTTATTTATAA 57.645 30.769 0.00 0.00 0.00 0.98
516 517 7.946381 TGGACATGGTGTTGCTTTATTTATA 57.054 32.000 0.00 0.00 0.00 0.98
517 518 6.849085 TGGACATGGTGTTGCTTTATTTAT 57.151 33.333 0.00 0.00 0.00 1.40
518 519 6.849085 ATGGACATGGTGTTGCTTTATTTA 57.151 33.333 0.00 0.00 0.00 1.40
519 520 5.743636 ATGGACATGGTGTTGCTTTATTT 57.256 34.783 0.00 0.00 0.00 1.40
520 521 5.714333 TGTATGGACATGGTGTTGCTTTATT 59.286 36.000 0.00 0.00 0.00 1.40
521 522 5.260424 TGTATGGACATGGTGTTGCTTTAT 58.740 37.500 0.00 0.00 0.00 1.40
522 523 4.657013 TGTATGGACATGGTGTTGCTTTA 58.343 39.130 0.00 0.00 0.00 1.85
523 524 3.495331 TGTATGGACATGGTGTTGCTTT 58.505 40.909 0.00 0.00 0.00 3.51
524 525 3.153369 TGTATGGACATGGTGTTGCTT 57.847 42.857 0.00 0.00 0.00 3.91
525 526 2.819608 GTTGTATGGACATGGTGTTGCT 59.180 45.455 0.00 0.00 34.86 3.91
526 527 2.556189 TGTTGTATGGACATGGTGTTGC 59.444 45.455 0.00 0.00 34.86 4.17
527 528 4.278170 ACTTGTTGTATGGACATGGTGTTG 59.722 41.667 0.00 0.00 34.86 3.33
528 529 4.469657 ACTTGTTGTATGGACATGGTGTT 58.530 39.130 0.00 0.00 34.86 3.32
529 530 4.098914 ACTTGTTGTATGGACATGGTGT 57.901 40.909 0.00 0.00 34.86 4.16
530 531 4.094887 GCTACTTGTTGTATGGACATGGTG 59.905 45.833 0.00 0.00 34.86 4.17
531 532 4.261801 GCTACTTGTTGTATGGACATGGT 58.738 43.478 0.00 0.00 34.86 3.55
532 533 4.094887 GTGCTACTTGTTGTATGGACATGG 59.905 45.833 0.00 0.00 34.86 3.66
533 534 4.094887 GGTGCTACTTGTTGTATGGACATG 59.905 45.833 0.00 0.00 34.86 3.21
534 535 4.261801 GGTGCTACTTGTTGTATGGACAT 58.738 43.478 0.00 0.00 34.86 3.06
535 536 3.071747 TGGTGCTACTTGTTGTATGGACA 59.928 43.478 0.00 0.00 0.00 4.02
536 537 3.670625 TGGTGCTACTTGTTGTATGGAC 58.329 45.455 0.00 0.00 0.00 4.02
537 538 4.260985 CATGGTGCTACTTGTTGTATGGA 58.739 43.478 0.00 0.00 0.00 3.41
538 539 4.009675 ACATGGTGCTACTTGTTGTATGG 58.990 43.478 0.00 0.00 0.00 2.74
539 540 4.094887 GGACATGGTGCTACTTGTTGTATG 59.905 45.833 0.00 0.00 0.00 2.39
540 541 4.261801 GGACATGGTGCTACTTGTTGTAT 58.738 43.478 0.00 0.00 0.00 2.29
541 542 3.071747 TGGACATGGTGCTACTTGTTGTA 59.928 43.478 0.00 0.00 0.00 2.41
542 543 2.158682 TGGACATGGTGCTACTTGTTGT 60.159 45.455 0.00 0.00 0.00 3.32
543 544 2.503331 TGGACATGGTGCTACTTGTTG 58.497 47.619 0.00 0.00 0.00 3.33
544 545 2.949177 TGGACATGGTGCTACTTGTT 57.051 45.000 0.00 0.00 0.00 2.83
545 546 3.263170 TGTATGGACATGGTGCTACTTGT 59.737 43.478 0.00 0.68 0.00 3.16
546 547 3.872696 TGTATGGACATGGTGCTACTTG 58.127 45.455 0.00 0.00 0.00 3.16
547 548 4.164030 TGATGTATGGACATGGTGCTACTT 59.836 41.667 0.00 0.00 46.64 2.24
548 549 3.711190 TGATGTATGGACATGGTGCTACT 59.289 43.478 0.00 0.00 46.64 2.57
549 550 4.071961 TGATGTATGGACATGGTGCTAC 57.928 45.455 0.00 0.00 46.64 3.58
550 551 4.164030 ACTTGATGTATGGACATGGTGCTA 59.836 41.667 0.00 0.00 46.64 3.49
551 552 3.054139 ACTTGATGTATGGACATGGTGCT 60.054 43.478 0.00 0.00 46.64 4.40
552 553 3.282021 ACTTGATGTATGGACATGGTGC 58.718 45.455 0.00 0.00 46.64 5.01
553 554 4.512944 GCTACTTGATGTATGGACATGGTG 59.487 45.833 0.00 0.00 46.64 4.17
554 555 4.164030 TGCTACTTGATGTATGGACATGGT 59.836 41.667 0.00 0.00 46.64 3.55
555 556 4.707105 TGCTACTTGATGTATGGACATGG 58.293 43.478 0.00 0.00 46.64 3.66
556 557 6.682423 TTTGCTACTTGATGTATGGACATG 57.318 37.500 0.00 0.00 46.64 3.21
558 559 6.316140 GTGATTTGCTACTTGATGTATGGACA 59.684 38.462 0.00 0.00 40.72 4.02
559 560 6.238484 GGTGATTTGCTACTTGATGTATGGAC 60.238 42.308 0.00 0.00 0.00 4.02
560 561 5.822519 GGTGATTTGCTACTTGATGTATGGA 59.177 40.000 0.00 0.00 0.00 3.41
561 562 5.277490 CGGTGATTTGCTACTTGATGTATGG 60.277 44.000 0.00 0.00 0.00 2.74
562 563 5.523552 TCGGTGATTTGCTACTTGATGTATG 59.476 40.000 0.00 0.00 0.00 2.39
563 564 5.670485 TCGGTGATTTGCTACTTGATGTAT 58.330 37.500 0.00 0.00 0.00 2.29
564 565 5.079689 TCGGTGATTTGCTACTTGATGTA 57.920 39.130 0.00 0.00 0.00 2.29
565 566 3.935203 CTCGGTGATTTGCTACTTGATGT 59.065 43.478 0.00 0.00 0.00 3.06
566 567 4.183865 TCTCGGTGATTTGCTACTTGATG 58.816 43.478 0.00 0.00 0.00 3.07
567 568 4.471904 TCTCGGTGATTTGCTACTTGAT 57.528 40.909 0.00 0.00 0.00 2.57
568 569 3.953712 TCTCGGTGATTTGCTACTTGA 57.046 42.857 0.00 0.00 0.00 3.02
569 570 6.662414 TTTATCTCGGTGATTTGCTACTTG 57.338 37.500 0.00 0.00 36.65 3.16
570 571 7.865706 ATTTTATCTCGGTGATTTGCTACTT 57.134 32.000 0.00 0.00 36.65 2.24
571 572 8.204836 ACTATTTTATCTCGGTGATTTGCTACT 58.795 33.333 0.00 0.00 36.65 2.57
572 573 8.366671 ACTATTTTATCTCGGTGATTTGCTAC 57.633 34.615 0.00 0.00 36.65 3.58
573 574 8.421784 AGACTATTTTATCTCGGTGATTTGCTA 58.578 33.333 0.00 0.00 36.65 3.49
574 575 7.225538 CAGACTATTTTATCTCGGTGATTTGCT 59.774 37.037 0.00 0.00 36.65 3.91
575 576 7.011482 ACAGACTATTTTATCTCGGTGATTTGC 59.989 37.037 0.00 0.00 36.65 3.68
576 577 8.425577 ACAGACTATTTTATCTCGGTGATTTG 57.574 34.615 0.00 0.00 36.65 2.32
577 578 8.883731 CAACAGACTATTTTATCTCGGTGATTT 58.116 33.333 0.00 0.00 36.65 2.17
578 579 7.495934 CCAACAGACTATTTTATCTCGGTGATT 59.504 37.037 0.00 0.00 36.65 2.57
579 580 6.986817 CCAACAGACTATTTTATCTCGGTGAT 59.013 38.462 0.00 0.00 39.11 3.06
580 581 6.338146 CCAACAGACTATTTTATCTCGGTGA 58.662 40.000 0.00 0.00 0.00 4.02
581 582 5.523916 CCCAACAGACTATTTTATCTCGGTG 59.476 44.000 0.00 0.00 0.00 4.94
582 583 5.396436 CCCCAACAGACTATTTTATCTCGGT 60.396 44.000 0.00 0.00 0.00 4.69
583 584 5.057149 CCCCAACAGACTATTTTATCTCGG 58.943 45.833 0.00 0.00 0.00 4.63
584 585 4.511826 GCCCCAACAGACTATTTTATCTCG 59.488 45.833 0.00 0.00 0.00 4.04
585 586 5.437060 TGCCCCAACAGACTATTTTATCTC 58.563 41.667 0.00 0.00 0.00 2.75
586 587 5.450818 TGCCCCAACAGACTATTTTATCT 57.549 39.130 0.00 0.00 0.00 1.98
587 588 5.827797 TGATGCCCCAACAGACTATTTTATC 59.172 40.000 0.00 0.00 0.00 1.75
588 589 5.765510 TGATGCCCCAACAGACTATTTTAT 58.234 37.500 0.00 0.00 0.00 1.40
589 590 5.186256 TGATGCCCCAACAGACTATTTTA 57.814 39.130 0.00 0.00 0.00 1.52
590 591 4.019174 CTGATGCCCCAACAGACTATTTT 58.981 43.478 0.00 0.00 36.57 1.82
591 592 3.010584 ACTGATGCCCCAACAGACTATTT 59.989 43.478 9.09 0.00 36.57 1.40
592 593 2.578021 ACTGATGCCCCAACAGACTATT 59.422 45.455 9.09 0.00 36.57 1.73
593 594 2.200081 ACTGATGCCCCAACAGACTAT 58.800 47.619 9.09 0.00 36.57 2.12
594 595 1.656587 ACTGATGCCCCAACAGACTA 58.343 50.000 9.09 0.00 36.57 2.59
595 596 1.656587 TACTGATGCCCCAACAGACT 58.343 50.000 9.09 0.00 36.57 3.24
596 597 2.717639 ATACTGATGCCCCAACAGAC 57.282 50.000 9.09 0.00 36.57 3.51
597 598 4.037222 TCTTATACTGATGCCCCAACAGA 58.963 43.478 9.09 0.00 36.57 3.41
598 599 4.101585 TCTCTTATACTGATGCCCCAACAG 59.898 45.833 0.00 0.00 39.60 3.16
599 600 4.037222 TCTCTTATACTGATGCCCCAACA 58.963 43.478 0.00 0.00 0.00 3.33
600 601 4.689612 TCTCTTATACTGATGCCCCAAC 57.310 45.455 0.00 0.00 0.00 3.77
601 602 5.428457 TCTTTCTCTTATACTGATGCCCCAA 59.572 40.000 0.00 0.00 0.00 4.12
602 603 4.968719 TCTTTCTCTTATACTGATGCCCCA 59.031 41.667 0.00 0.00 0.00 4.96
603 604 5.552870 TCTTTCTCTTATACTGATGCCCC 57.447 43.478 0.00 0.00 0.00 5.80
604 605 8.128322 TCTATCTTTCTCTTATACTGATGCCC 57.872 38.462 0.00 0.00 0.00 5.36
605 606 9.988815 TTTCTATCTTTCTCTTATACTGATGCC 57.011 33.333 0.00 0.00 0.00 4.40
639 640 2.033372 TGATGCTATGGCCATTTGTGG 58.967 47.619 26.37 2.72 37.74 4.17
640 641 2.953648 TCTGATGCTATGGCCATTTGTG 59.046 45.455 26.37 12.92 37.74 3.33
641 642 3.220110 CTCTGATGCTATGGCCATTTGT 58.780 45.455 26.37 7.97 37.74 2.83
642 643 2.557056 CCTCTGATGCTATGGCCATTTG 59.443 50.000 26.37 18.06 37.74 2.32
643 644 2.444388 TCCTCTGATGCTATGGCCATTT 59.556 45.455 26.37 3.10 37.74 2.32
644 645 2.060275 TCCTCTGATGCTATGGCCATT 58.940 47.619 26.37 5.18 37.74 3.16
645 646 1.738474 TCCTCTGATGCTATGGCCAT 58.262 50.000 24.45 24.45 37.74 4.40
646 647 1.627329 GATCCTCTGATGCTATGGCCA 59.373 52.381 8.56 8.56 37.74 5.36
647 648 1.907936 AGATCCTCTGATGCTATGGCC 59.092 52.381 0.00 0.00 37.74 5.36
658 659 0.459078 TCTTCGCTGCAGATCCTCTG 59.541 55.000 20.43 0.00 46.90 3.35
659 660 0.746063 CTCTTCGCTGCAGATCCTCT 59.254 55.000 20.43 0.00 0.00 3.69
660 661 0.743688 TCTCTTCGCTGCAGATCCTC 59.256 55.000 20.43 0.00 0.00 3.71
661 662 0.746063 CTCTCTTCGCTGCAGATCCT 59.254 55.000 20.43 0.00 0.00 3.24
662 663 0.249405 CCTCTCTTCGCTGCAGATCC 60.249 60.000 20.43 0.00 0.00 3.36
663 664 0.459489 ACCTCTCTTCGCTGCAGATC 59.541 55.000 20.43 0.00 0.00 2.75
664 665 0.175302 CACCTCTCTTCGCTGCAGAT 59.825 55.000 20.43 0.00 0.00 2.90
665 666 1.181741 ACACCTCTCTTCGCTGCAGA 61.182 55.000 20.43 0.00 0.00 4.26
666 667 0.735632 GACACCTCTCTTCGCTGCAG 60.736 60.000 10.11 10.11 0.00 4.41
667 668 1.290324 GACACCTCTCTTCGCTGCA 59.710 57.895 0.00 0.00 0.00 4.41
668 669 1.803519 CGACACCTCTCTTCGCTGC 60.804 63.158 0.00 0.00 0.00 5.25
669 670 0.179176 CTCGACACCTCTCTTCGCTG 60.179 60.000 0.00 0.00 32.70 5.18
670 671 1.928706 GCTCGACACCTCTCTTCGCT 61.929 60.000 0.00 0.00 32.70 4.93
671 672 1.515304 GCTCGACACCTCTCTTCGC 60.515 63.158 0.00 0.00 32.70 4.70
672 673 0.179176 CTGCTCGACACCTCTCTTCG 60.179 60.000 0.00 0.00 0.00 3.79
673 674 0.457681 GCTGCTCGACACCTCTCTTC 60.458 60.000 0.00 0.00 0.00 2.87
674 675 1.181741 TGCTGCTCGACACCTCTCTT 61.182 55.000 0.00 0.00 0.00 2.85
675 676 1.181741 TTGCTGCTCGACACCTCTCT 61.182 55.000 0.00 0.00 0.00 3.10
676 677 1.011451 GTTGCTGCTCGACACCTCTC 61.011 60.000 0.00 0.00 0.00 3.20
677 678 1.005630 GTTGCTGCTCGACACCTCT 60.006 57.895 0.00 0.00 0.00 3.69
678 679 2.375766 CGTTGCTGCTCGACACCTC 61.376 63.158 11.00 0.00 0.00 3.85
679 680 2.356313 CGTTGCTGCTCGACACCT 60.356 61.111 11.00 0.00 0.00 4.00
680 681 2.661866 ACGTTGCTGCTCGACACC 60.662 61.111 19.95 0.00 0.00 4.16
681 682 2.546321 CACGTTGCTGCTCGACAC 59.454 61.111 19.95 1.81 0.00 3.67
682 683 3.337889 GCACGTTGCTGCTCGACA 61.338 61.111 19.95 0.00 40.96 4.35
683 684 3.287121 CTGCACGTTGCTGCTCGAC 62.287 63.158 19.95 13.31 45.31 4.20
684 685 3.037833 CTGCACGTTGCTGCTCGA 61.038 61.111 19.95 0.00 45.31 4.04
689 690 4.610890 TTGCGCTGCACGTTGCTG 62.611 61.111 9.73 10.68 45.31 4.41
690 691 4.612536 GTTGCGCTGCACGTTGCT 62.613 61.111 9.73 0.00 45.31 3.91
692 693 3.748071 TTGGTTGCGCTGCACGTTG 62.748 57.895 9.73 0.00 46.11 4.10
693 694 3.513438 TTGGTTGCGCTGCACGTT 61.513 55.556 9.73 0.00 46.11 3.99
694 695 4.250431 GTTGGTTGCGCTGCACGT 62.250 61.111 9.73 0.00 46.11 4.49
696 697 1.730547 GATGTTGGTTGCGCTGCAC 60.731 57.895 9.73 2.29 38.71 4.57
697 698 0.605050 TAGATGTTGGTTGCGCTGCA 60.605 50.000 9.73 0.00 36.47 4.41
698 699 0.179189 GTAGATGTTGGTTGCGCTGC 60.179 55.000 9.73 0.25 0.00 5.25
699 700 0.447801 GGTAGATGTTGGTTGCGCTG 59.552 55.000 9.73 0.00 0.00 5.18
700 701 0.676782 GGGTAGATGTTGGTTGCGCT 60.677 55.000 9.73 0.00 0.00 5.92
701 702 1.654023 GGGGTAGATGTTGGTTGCGC 61.654 60.000 0.00 0.00 0.00 6.09
702 703 0.322098 TGGGGTAGATGTTGGTTGCG 60.322 55.000 0.00 0.00 0.00 4.85
703 704 1.271926 ACTGGGGTAGATGTTGGTTGC 60.272 52.381 0.00 0.00 0.00 4.17
704 705 2.711542 GACTGGGGTAGATGTTGGTTG 58.288 52.381 0.00 0.00 0.00 3.77
705 706 1.278127 CGACTGGGGTAGATGTTGGTT 59.722 52.381 0.00 0.00 0.00 3.67
706 707 0.902531 CGACTGGGGTAGATGTTGGT 59.097 55.000 0.00 0.00 0.00 3.67
707 708 0.178068 CCGACTGGGGTAGATGTTGG 59.822 60.000 0.00 0.00 0.00 3.77
708 709 0.902531 ACCGACTGGGGTAGATGTTG 59.097 55.000 0.00 0.00 38.93 3.33
709 710 1.192428 GACCGACTGGGGTAGATGTT 58.808 55.000 0.00 0.00 41.40 2.71
710 711 1.035932 CGACCGACTGGGGTAGATGT 61.036 60.000 0.00 0.00 41.40 3.06
711 712 1.035932 ACGACCGACTGGGGTAGATG 61.036 60.000 7.14 0.00 41.40 2.90
712 713 0.548031 TACGACCGACTGGGGTAGAT 59.452 55.000 7.14 0.00 41.40 1.98
713 714 0.107508 CTACGACCGACTGGGGTAGA 60.108 60.000 7.14 0.00 43.58 2.59
714 715 0.393537 ACTACGACCGACTGGGGTAG 60.394 60.000 11.09 11.09 45.05 3.18
715 716 0.392998 GACTACGACCGACTGGGGTA 60.393 60.000 0.00 0.00 41.40 3.69
716 717 1.676967 GACTACGACCGACTGGGGT 60.677 63.158 0.00 0.00 44.89 4.95
717 718 2.413142 GGACTACGACCGACTGGGG 61.413 68.421 0.00 0.00 41.60 4.96
718 719 1.378250 AGGACTACGACCGACTGGG 60.378 63.158 0.00 0.00 40.75 4.45
719 720 1.801332 CAGGACTACGACCGACTGG 59.199 63.158 0.00 0.00 42.84 4.00
720 721 1.136984 GCAGGACTACGACCGACTG 59.863 63.158 0.00 0.00 0.00 3.51
721 722 1.002379 AGCAGGACTACGACCGACT 60.002 57.895 0.00 0.00 0.00 4.18
722 723 1.136984 CAGCAGGACTACGACCGAC 59.863 63.158 0.00 0.00 0.00 4.79
723 724 2.697761 GCAGCAGGACTACGACCGA 61.698 63.158 0.00 0.00 0.00 4.69
724 725 2.202623 GCAGCAGGACTACGACCG 60.203 66.667 0.00 0.00 0.00 4.79
725 726 1.035932 TAGGCAGCAGGACTACGACC 61.036 60.000 0.00 0.00 35.43 4.79
726 727 0.382515 CTAGGCAGCAGGACTACGAC 59.617 60.000 0.00 0.00 35.43 4.34
727 728 2.795165 CTAGGCAGCAGGACTACGA 58.205 57.895 0.00 0.00 35.43 3.43
743 744 4.794648 ATTGGCGCCCGCTTGCTA 62.795 61.111 26.77 0.00 41.60 3.49
763 764 2.340328 CCGGTTTGTTAGGCCAGGC 61.340 63.158 5.01 1.26 0.00 4.85
764 765 1.677633 CCCGGTTTGTTAGGCCAGG 60.678 63.158 5.01 0.00 0.00 4.45
765 766 0.250989 TTCCCGGTTTGTTAGGCCAG 60.251 55.000 5.01 0.00 0.00 4.85
766 767 0.406361 ATTCCCGGTTTGTTAGGCCA 59.594 50.000 5.01 0.00 0.00 5.36
767 768 0.815095 CATTCCCGGTTTGTTAGGCC 59.185 55.000 0.00 0.00 0.00 5.19
768 769 1.743394 CTCATTCCCGGTTTGTTAGGC 59.257 52.381 0.00 0.00 0.00 3.93
769 770 2.365582 CCTCATTCCCGGTTTGTTAGG 58.634 52.381 0.00 0.00 0.00 2.69
770 771 2.026636 TCCCTCATTCCCGGTTTGTTAG 60.027 50.000 0.00 0.00 0.00 2.34
771 772 1.986631 TCCCTCATTCCCGGTTTGTTA 59.013 47.619 0.00 0.00 0.00 2.41
772 773 0.774908 TCCCTCATTCCCGGTTTGTT 59.225 50.000 0.00 0.00 0.00 2.83
773 774 0.328258 CTCCCTCATTCCCGGTTTGT 59.672 55.000 0.00 0.00 0.00 2.83
774 775 0.328258 ACTCCCTCATTCCCGGTTTG 59.672 55.000 0.00 0.00 0.00 2.93
775 776 1.838077 CTACTCCCTCATTCCCGGTTT 59.162 52.381 0.00 0.00 0.00 3.27
776 777 1.497161 CTACTCCCTCATTCCCGGTT 58.503 55.000 0.00 0.00 0.00 4.44
777 778 1.049289 GCTACTCCCTCATTCCCGGT 61.049 60.000 0.00 0.00 0.00 5.28
778 779 1.048724 TGCTACTCCCTCATTCCCGG 61.049 60.000 0.00 0.00 0.00 5.73
779 780 0.105039 GTGCTACTCCCTCATTCCCG 59.895 60.000 0.00 0.00 0.00 5.14
780 781 0.105039 CGTGCTACTCCCTCATTCCC 59.895 60.000 0.00 0.00 0.00 3.97
781 782 0.530870 GCGTGCTACTCCCTCATTCC 60.531 60.000 0.00 0.00 0.00 3.01
782 783 0.175760 TGCGTGCTACTCCCTCATTC 59.824 55.000 0.00 0.00 0.00 2.67
783 784 0.613260 TTGCGTGCTACTCCCTCATT 59.387 50.000 0.00 0.00 0.00 2.57
784 785 0.613260 TTTGCGTGCTACTCCCTCAT 59.387 50.000 0.00 0.00 0.00 2.90
785 786 0.613260 ATTTGCGTGCTACTCCCTCA 59.387 50.000 0.00 0.00 0.00 3.86
786 787 1.009829 CATTTGCGTGCTACTCCCTC 58.990 55.000 0.00 0.00 0.00 4.30
787 788 1.026718 GCATTTGCGTGCTACTCCCT 61.027 55.000 1.76 0.00 41.82 4.20
788 789 1.305219 TGCATTTGCGTGCTACTCCC 61.305 55.000 9.48 0.00 45.27 4.30
789 790 0.179189 GTGCATTTGCGTGCTACTCC 60.179 55.000 9.48 0.00 45.27 3.85
790 791 0.179189 GGTGCATTTGCGTGCTACTC 60.179 55.000 9.48 0.01 45.27 2.59
791 792 0.888736 TGGTGCATTTGCGTGCTACT 60.889 50.000 9.48 0.00 45.27 2.57
792 793 0.171007 ATGGTGCATTTGCGTGCTAC 59.829 50.000 9.48 6.41 45.27 3.58
793 794 0.170784 CATGGTGCATTTGCGTGCTA 59.829 50.000 9.48 0.00 45.27 3.49
794 795 1.080366 CATGGTGCATTTGCGTGCT 60.080 52.632 9.48 0.00 45.27 4.40
795 796 1.346378 GACATGGTGCATTTGCGTGC 61.346 55.000 0.00 2.00 45.83 5.34
796 797 1.066656 CGACATGGTGCATTTGCGTG 61.067 55.000 0.00 0.00 45.83 5.34
797 798 1.209898 CGACATGGTGCATTTGCGT 59.790 52.632 0.00 0.00 45.83 5.24
798 799 1.514657 CCGACATGGTGCATTTGCG 60.515 57.895 0.00 0.00 45.83 4.85
799 800 1.806758 GCCGACATGGTGCATTTGC 60.807 57.895 0.00 0.00 41.21 3.68
800 801 1.153784 GGCCGACATGGTGCATTTG 60.154 57.895 0.00 0.00 41.21 2.32
801 802 1.184322 TTGGCCGACATGGTGCATTT 61.184 50.000 0.00 0.00 41.21 2.32
802 803 1.606025 TTGGCCGACATGGTGCATT 60.606 52.632 0.00 0.00 41.21 3.56
803 804 2.035469 TTGGCCGACATGGTGCAT 59.965 55.556 0.00 0.00 41.21 3.96
804 805 2.983030 GTTGGCCGACATGGTGCA 60.983 61.111 18.96 0.00 41.21 4.57
805 806 1.876497 ATTGTTGGCCGACATGGTGC 61.876 55.000 26.70 0.00 41.21 5.01
806 807 0.109179 CATTGTTGGCCGACATGGTG 60.109 55.000 26.70 19.95 41.21 4.17
807 808 0.251121 TCATTGTTGGCCGACATGGT 60.251 50.000 26.70 12.89 41.21 3.55
808 809 0.171007 GTCATTGTTGGCCGACATGG 59.829 55.000 26.70 20.18 42.50 3.66
809 810 0.880441 TGTCATTGTTGGCCGACATG 59.120 50.000 26.70 23.16 33.61 3.21
810 811 1.838112 ATGTCATTGTTGGCCGACAT 58.162 45.000 26.70 19.55 42.71 3.06
811 812 0.880441 CATGTCATTGTTGGCCGACA 59.120 50.000 22.64 22.64 42.19 4.35
812 813 0.881118 ACATGTCATTGTTGGCCGAC 59.119 50.000 17.01 17.01 0.00 4.79
813 814 0.880441 CACATGTCATTGTTGGCCGA 59.120 50.000 0.00 0.00 0.00 5.54
814 815 0.880441 TCACATGTCATTGTTGGCCG 59.120 50.000 0.00 0.00 0.00 6.13
815 816 3.598019 ATTCACATGTCATTGTTGGCC 57.402 42.857 0.00 0.00 0.00 5.36
816 817 4.386652 GTGAATTCACATGTCATTGTTGGC 59.613 41.667 29.43 0.13 45.75 4.52
830 831 2.116366 GTGCGTTTGGTGTGAATTCAC 58.884 47.619 28.10 28.10 46.59 3.18
831 832 1.745653 TGTGCGTTTGGTGTGAATTCA 59.254 42.857 3.38 3.38 0.00 2.57
832 833 2.116366 GTGTGCGTTTGGTGTGAATTC 58.884 47.619 0.00 0.00 0.00 2.17
833 834 1.474478 TGTGTGCGTTTGGTGTGAATT 59.526 42.857 0.00 0.00 0.00 2.17
834 835 1.065401 CTGTGTGCGTTTGGTGTGAAT 59.935 47.619 0.00 0.00 0.00 2.57
835 836 0.449786 CTGTGTGCGTTTGGTGTGAA 59.550 50.000 0.00 0.00 0.00 3.18
836 837 1.372838 CCTGTGTGCGTTTGGTGTGA 61.373 55.000 0.00 0.00 0.00 3.58
837 838 1.063972 CCTGTGTGCGTTTGGTGTG 59.936 57.895 0.00 0.00 0.00 3.82
838 839 2.118404 CCCTGTGTGCGTTTGGTGT 61.118 57.895 0.00 0.00 0.00 4.16
839 840 1.785041 CTCCCTGTGTGCGTTTGGTG 61.785 60.000 0.00 0.00 0.00 4.17
840 841 1.525995 CTCCCTGTGTGCGTTTGGT 60.526 57.895 0.00 0.00 0.00 3.67
841 842 2.260869 CCTCCCTGTGTGCGTTTGG 61.261 63.158 0.00 0.00 0.00 3.28
842 843 2.260869 CCCTCCCTGTGTGCGTTTG 61.261 63.158 0.00 0.00 0.00 2.93
843 844 2.113139 CCCTCCCTGTGTGCGTTT 59.887 61.111 0.00 0.00 0.00 3.60
844 845 3.953775 CCCCTCCCTGTGTGCGTT 61.954 66.667 0.00 0.00 0.00 4.84
845 846 4.954118 TCCCCTCCCTGTGTGCGT 62.954 66.667 0.00 0.00 0.00 5.24
846 847 2.690653 TTTTCCCCTCCCTGTGTGCG 62.691 60.000 0.00 0.00 0.00 5.34
847 848 0.469144 TTTTTCCCCTCCCTGTGTGC 60.469 55.000 0.00 0.00 0.00 4.57
848 849 3.839979 TTTTTCCCCTCCCTGTGTG 57.160 52.632 0.00 0.00 0.00 3.82
872 873 1.521681 GATGTGTGGTAGCGAGGGC 60.522 63.158 0.00 0.00 40.37 5.19
873 874 0.103208 GAGATGTGTGGTAGCGAGGG 59.897 60.000 0.00 0.00 0.00 4.30
874 875 1.107114 AGAGATGTGTGGTAGCGAGG 58.893 55.000 0.00 0.00 0.00 4.63
875 876 2.949451 AAGAGATGTGTGGTAGCGAG 57.051 50.000 0.00 0.00 0.00 5.03
876 877 3.086282 TGTAAGAGATGTGTGGTAGCGA 58.914 45.455 0.00 0.00 0.00 4.93
877 878 3.119459 ACTGTAAGAGATGTGTGGTAGCG 60.119 47.826 0.00 0.00 37.43 4.26
878 879 4.457834 ACTGTAAGAGATGTGTGGTAGC 57.542 45.455 0.00 0.00 37.43 3.58
879 880 6.183360 GGAGTACTGTAAGAGATGTGTGGTAG 60.183 46.154 0.00 0.00 37.43 3.18
880 881 5.651139 GGAGTACTGTAAGAGATGTGTGGTA 59.349 44.000 0.00 0.00 37.43 3.25
881 882 4.463186 GGAGTACTGTAAGAGATGTGTGGT 59.537 45.833 0.00 0.00 37.43 4.16
882 883 4.462834 TGGAGTACTGTAAGAGATGTGTGG 59.537 45.833 0.00 0.00 37.43 4.17
883 884 5.644977 TGGAGTACTGTAAGAGATGTGTG 57.355 43.478 0.00 0.00 37.43 3.82
884 885 6.010850 TCTTGGAGTACTGTAAGAGATGTGT 58.989 40.000 0.00 0.00 37.43 3.72
885 886 6.516739 TCTTGGAGTACTGTAAGAGATGTG 57.483 41.667 0.00 0.00 37.43 3.21
886 887 7.122715 AGATCTTGGAGTACTGTAAGAGATGT 58.877 38.462 18.16 8.76 37.43 3.06
887 888 7.502226 AGAGATCTTGGAGTACTGTAAGAGATG 59.498 40.741 18.16 0.00 37.43 2.90
888 889 7.582719 AGAGATCTTGGAGTACTGTAAGAGAT 58.417 38.462 18.16 11.61 37.43 2.75
889 890 6.964464 AGAGATCTTGGAGTACTGTAAGAGA 58.036 40.000 18.16 8.31 37.43 3.10
890 891 7.639113 AAGAGATCTTGGAGTACTGTAAGAG 57.361 40.000 18.16 4.17 34.09 2.85
891 892 9.179909 CTTAAGAGATCTTGGAGTACTGTAAGA 57.820 37.037 16.50 16.50 37.40 2.10
892 893 8.410141 CCTTAAGAGATCTTGGAGTACTGTAAG 58.590 40.741 0.00 4.71 37.40 2.34
893 894 8.114102 TCCTTAAGAGATCTTGGAGTACTGTAA 58.886 37.037 0.00 0.00 37.40 2.41
894 895 7.640313 TCCTTAAGAGATCTTGGAGTACTGTA 58.360 38.462 0.00 0.00 37.40 2.74
895 896 6.494952 TCCTTAAGAGATCTTGGAGTACTGT 58.505 40.000 0.00 0.00 37.40 3.55
896 897 7.411486 TTCCTTAAGAGATCTTGGAGTACTG 57.589 40.000 0.00 0.00 37.40 2.74
897 898 8.616799 ATTTCCTTAAGAGATCTTGGAGTACT 57.383 34.615 3.36 0.00 37.40 2.73
898 899 8.700973 AGATTTCCTTAAGAGATCTTGGAGTAC 58.299 37.037 3.36 0.00 42.35 2.73
899 900 8.846423 AGATTTCCTTAAGAGATCTTGGAGTA 57.154 34.615 3.36 0.00 42.35 2.59
900 901 7.147567 GGAGATTTCCTTAAGAGATCTTGGAGT 60.148 40.741 3.36 0.00 44.39 3.85
901 902 7.216494 GGAGATTTCCTTAAGAGATCTTGGAG 58.784 42.308 3.36 3.68 44.39 3.86
902 903 7.130681 GGAGATTTCCTTAAGAGATCTTGGA 57.869 40.000 3.36 1.87 44.39 3.53
917 918 2.171659 GTGGGAGAAGGAGGAGATTTCC 59.828 54.545 0.00 0.00 44.39 3.13
918 919 2.159028 CGTGGGAGAAGGAGGAGATTTC 60.159 54.545 0.00 0.00 0.00 2.17
919 920 1.834263 CGTGGGAGAAGGAGGAGATTT 59.166 52.381 0.00 0.00 0.00 2.17
920 921 1.490574 CGTGGGAGAAGGAGGAGATT 58.509 55.000 0.00 0.00 0.00 2.40
921 922 1.045911 GCGTGGGAGAAGGAGGAGAT 61.046 60.000 0.00 0.00 0.00 2.75
922 923 1.682684 GCGTGGGAGAAGGAGGAGA 60.683 63.158 0.00 0.00 0.00 3.71
923 924 2.726351 GGCGTGGGAGAAGGAGGAG 61.726 68.421 0.00 0.00 0.00 3.69
924 925 2.683933 GGCGTGGGAGAAGGAGGA 60.684 66.667 0.00 0.00 0.00 3.71
925 926 3.003173 TGGCGTGGGAGAAGGAGG 61.003 66.667 0.00 0.00 0.00 4.30
926 927 2.266055 GTGGCGTGGGAGAAGGAG 59.734 66.667 0.00 0.00 0.00 3.69
927 928 2.525629 TGTGGCGTGGGAGAAGGA 60.526 61.111 0.00 0.00 0.00 3.36
928 929 2.358737 GTGTGGCGTGGGAGAAGG 60.359 66.667 0.00 0.00 0.00 3.46
929 930 2.358737 GGTGTGGCGTGGGAGAAG 60.359 66.667 0.00 0.00 0.00 2.85
930 931 3.164977 TGGTGTGGCGTGGGAGAA 61.165 61.111 0.00 0.00 0.00 2.87
931 932 3.936203 GTGGTGTGGCGTGGGAGA 61.936 66.667 0.00 0.00 0.00 3.71
935 936 4.866224 TGTGGTGGTGTGGCGTGG 62.866 66.667 0.00 0.00 0.00 4.94
936 937 2.594303 ATGTGGTGGTGTGGCGTG 60.594 61.111 0.00 0.00 0.00 5.34
937 938 2.281484 GATGTGGTGGTGTGGCGT 60.281 61.111 0.00 0.00 0.00 5.68
938 939 2.281414 TGATGTGGTGGTGTGGCG 60.281 61.111 0.00 0.00 0.00 5.69
939 940 0.823356 AAGTGATGTGGTGGTGTGGC 60.823 55.000 0.00 0.00 0.00 5.01
940 941 1.691196 AAAGTGATGTGGTGGTGTGG 58.309 50.000 0.00 0.00 0.00 4.17
941 942 3.004315 GGTAAAAGTGATGTGGTGGTGTG 59.996 47.826 0.00 0.00 0.00 3.82
942 943 3.219281 GGTAAAAGTGATGTGGTGGTGT 58.781 45.455 0.00 0.00 0.00 4.16
943 944 3.004315 GTGGTAAAAGTGATGTGGTGGTG 59.996 47.826 0.00 0.00 0.00 4.17
944 945 3.117663 AGTGGTAAAAGTGATGTGGTGGT 60.118 43.478 0.00 0.00 0.00 4.16
945 946 3.486383 AGTGGTAAAAGTGATGTGGTGG 58.514 45.455 0.00 0.00 0.00 4.61
946 947 4.389374 AGAGTGGTAAAAGTGATGTGGTG 58.611 43.478 0.00 0.00 0.00 4.17
947 948 4.102524 TGAGAGTGGTAAAAGTGATGTGGT 59.897 41.667 0.00 0.00 0.00 4.16
948 949 4.641396 TGAGAGTGGTAAAAGTGATGTGG 58.359 43.478 0.00 0.00 0.00 4.17
949 950 5.541845 TCTGAGAGTGGTAAAAGTGATGTG 58.458 41.667 0.00 0.00 0.00 3.21
950 951 5.808366 TCTGAGAGTGGTAAAAGTGATGT 57.192 39.130 0.00 0.00 0.00 3.06
951 952 5.814705 GGATCTGAGAGTGGTAAAAGTGATG 59.185 44.000 0.00 0.00 0.00 3.07
952 953 5.485353 TGGATCTGAGAGTGGTAAAAGTGAT 59.515 40.000 0.00 0.00 0.00 3.06
953 954 4.838423 TGGATCTGAGAGTGGTAAAAGTGA 59.162 41.667 0.00 0.00 0.00 3.41
954 955 5.152623 TGGATCTGAGAGTGGTAAAAGTG 57.847 43.478 0.00 0.00 0.00 3.16
955 956 4.323104 GCTGGATCTGAGAGTGGTAAAAGT 60.323 45.833 0.00 0.00 0.00 2.66
956 957 4.187694 GCTGGATCTGAGAGTGGTAAAAG 58.812 47.826 0.00 0.00 0.00 2.27
957 958 3.582647 TGCTGGATCTGAGAGTGGTAAAA 59.417 43.478 0.00 0.00 0.00 1.52
958 959 3.173151 TGCTGGATCTGAGAGTGGTAAA 58.827 45.455 0.00 0.00 0.00 2.01
959 960 2.820178 TGCTGGATCTGAGAGTGGTAA 58.180 47.619 0.00 0.00 0.00 2.85
960 961 2.532250 TGCTGGATCTGAGAGTGGTA 57.468 50.000 0.00 0.00 0.00 3.25
961 962 1.649321 TTGCTGGATCTGAGAGTGGT 58.351 50.000 0.00 0.00 0.00 4.16
962 963 2.435069 AGATTGCTGGATCTGAGAGTGG 59.565 50.000 0.00 0.00 35.13 4.00
963 964 3.132467 TGAGATTGCTGGATCTGAGAGTG 59.868 47.826 3.14 0.00 36.54 3.51
964 965 3.132646 GTGAGATTGCTGGATCTGAGAGT 59.867 47.826 3.14 0.00 36.54 3.24
965 966 3.132467 TGTGAGATTGCTGGATCTGAGAG 59.868 47.826 3.14 0.00 36.54 3.20
966 967 3.102204 TGTGAGATTGCTGGATCTGAGA 58.898 45.455 3.14 0.00 36.54 3.27
967 968 3.538634 TGTGAGATTGCTGGATCTGAG 57.461 47.619 3.14 0.00 36.54 3.35
968 969 4.502777 GCTATGTGAGATTGCTGGATCTGA 60.503 45.833 3.14 0.00 36.54 3.27
969 970 3.747010 GCTATGTGAGATTGCTGGATCTG 59.253 47.826 3.14 0.00 36.54 2.90
970 971 3.390311 TGCTATGTGAGATTGCTGGATCT 59.610 43.478 0.00 0.00 39.04 2.75
971 972 3.497640 GTGCTATGTGAGATTGCTGGATC 59.502 47.826 0.00 0.00 0.00 3.36
972 973 3.118149 TGTGCTATGTGAGATTGCTGGAT 60.118 43.478 0.00 0.00 0.00 3.41
973 974 2.236893 TGTGCTATGTGAGATTGCTGGA 59.763 45.455 0.00 0.00 0.00 3.86
974 975 2.635714 TGTGCTATGTGAGATTGCTGG 58.364 47.619 0.00 0.00 0.00 4.85
975 976 3.064958 CCTTGTGCTATGTGAGATTGCTG 59.935 47.826 0.00 0.00 0.00 4.41
976 977 3.276857 CCTTGTGCTATGTGAGATTGCT 58.723 45.455 0.00 0.00 0.00 3.91
977 978 2.223433 GCCTTGTGCTATGTGAGATTGC 60.223 50.000 0.00 0.00 36.87 3.56
978 979 3.011818 TGCCTTGTGCTATGTGAGATTG 58.988 45.455 0.00 0.00 42.00 2.67
979 980 3.354948 TGCCTTGTGCTATGTGAGATT 57.645 42.857 0.00 0.00 42.00 2.40
980 981 3.354948 TTGCCTTGTGCTATGTGAGAT 57.645 42.857 0.00 0.00 42.00 2.75
981 982 2.857186 TTGCCTTGTGCTATGTGAGA 57.143 45.000 0.00 0.00 42.00 3.27
982 983 3.416119 CATTGCCTTGTGCTATGTGAG 57.584 47.619 0.00 0.00 44.80 3.51
987 988 1.285962 ACCTCCATTGCCTTGTGCTAT 59.714 47.619 0.00 0.00 42.00 2.97
988 989 0.698238 ACCTCCATTGCCTTGTGCTA 59.302 50.000 0.00 0.00 42.00 3.49
989 990 0.178953 AACCTCCATTGCCTTGTGCT 60.179 50.000 0.00 0.00 42.00 4.40
990 991 0.037975 CAACCTCCATTGCCTTGTGC 60.038 55.000 0.00 0.00 41.77 4.57
998 999 1.081892 CACGAGAGCAACCTCCATTG 58.918 55.000 0.00 0.00 38.96 2.82
999 1000 0.036010 CCACGAGAGCAACCTCCATT 60.036 55.000 0.00 0.00 38.96 3.16
1007 1008 4.680237 CCACGCCCACGAGAGCAA 62.680 66.667 0.00 0.00 43.93 3.91
1023 1024 3.995506 CTTCATCACCCCCGTGCCC 62.996 68.421 0.00 0.00 40.04 5.36
1024 1025 2.438434 CTTCATCACCCCCGTGCC 60.438 66.667 0.00 0.00 40.04 5.01
1025 1026 3.134127 GCTTCATCACCCCCGTGC 61.134 66.667 0.00 0.00 40.04 5.34
1071 1072 1.154525 CTTGCTGCGCTCTTCGTTG 60.155 57.895 9.73 0.00 41.07 4.10
1072 1073 2.959357 GCTTGCTGCGCTCTTCGTT 61.959 57.895 9.73 0.00 41.07 3.85