Multiple sequence alignment - TraesCS1A01G001700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G001700 chr1A 100.000 2297 0 0 1 2297 402455 404751 0 4242
1 TraesCS1A01G001700 chr1A 97.997 2297 46 0 1 2297 394015 396311 0 3988
2 TraesCS1A01G001700 chrUn 97.998 2298 44 2 1 2297 245706068 245708364 0 3988
3 TraesCS1A01G001700 chrUn 97.998 2298 45 1 1 2297 291535440 291537737 0 3988
4 TraesCS1A01G001700 chrUn 97.912 2299 46 2 1 2297 274341282 274338984 0 3978
5 TraesCS1A01G001700 chrUn 97.911 2298 47 1 1 2297 199874824 199877121 0 3976
6 TraesCS1A01G001700 chrUn 97.824 2298 49 1 1 2297 229310227 229307930 0 3965
7 TraesCS1A01G001700 chr1B 97.824 2298 49 1 1 2297 544623636 544625933 0 3965
8 TraesCS1A01G001700 chr1B 97.824 2298 47 2 1 2297 544593697 544595992 0 3964
9 TraesCS1A01G001700 chr5D 97.737 2298 51 1 1 2297 18998924 19001221 0 3954


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G001700 chr1A 402455 404751 2296 False 4242 4242 100.000 1 2297 1 chr1A.!!$F2 2296
1 TraesCS1A01G001700 chr1A 394015 396311 2296 False 3988 3988 97.997 1 2297 1 chr1A.!!$F1 2296
2 TraesCS1A01G001700 chrUn 245706068 245708364 2296 False 3988 3988 97.998 1 2297 1 chrUn.!!$F2 2296
3 TraesCS1A01G001700 chrUn 291535440 291537737 2297 False 3988 3988 97.998 1 2297 1 chrUn.!!$F3 2296
4 TraesCS1A01G001700 chrUn 274338984 274341282 2298 True 3978 3978 97.912 1 2297 1 chrUn.!!$R2 2296
5 TraesCS1A01G001700 chrUn 199874824 199877121 2297 False 3976 3976 97.911 1 2297 1 chrUn.!!$F1 2296
6 TraesCS1A01G001700 chrUn 229307930 229310227 2297 True 3965 3965 97.824 1 2297 1 chrUn.!!$R1 2296
7 TraesCS1A01G001700 chr1B 544623636 544625933 2297 False 3965 3965 97.824 1 2297 1 chr1B.!!$F2 2296
8 TraesCS1A01G001700 chr1B 544593697 544595992 2295 False 3964 3964 97.824 1 2297 1 chr1B.!!$F1 2296
9 TraesCS1A01G001700 chr5D 18998924 19001221 2297 False 3954 3954 97.737 1 2297 1 chr5D.!!$F1 2296

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
504 505 2.900273 GATGTGTAGGAGGGCGCA 59.1 61.111 10.83 0.0 0.0 6.09 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1656 1660 0.040204 CCAAAAGGAGGGGACATGCT 59.96 55.0 0.0 0.0 0.0 3.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
504 505 2.900273 GATGTGTAGGAGGGCGCA 59.100 61.111 10.83 0.0 0.00 6.09
883 884 4.717629 CGGAAGAGCACCGCACGA 62.718 66.667 0.00 0.0 43.74 4.35
1388 1389 4.498345 GCGGGAGTAACTATGACTCTCTTG 60.498 50.000 1.51 0.0 41.52 3.02
1567 1569 4.273480 CCGACTTTGTGAAATGACTTGAGT 59.727 41.667 0.00 0.0 0.00 3.41
1623 1626 8.234546 CGCAAGTGAAATACCACTACTTTTAAT 58.765 33.333 0.00 0.0 45.82 1.40
1936 1940 5.048846 AGGTGTCAGAAAAGTTACCACAT 57.951 39.130 0.00 0.0 0.00 3.21
1968 1972 3.286751 TGGCAGCCAAGCGTTCAC 61.287 61.111 13.33 0.0 34.64 3.18
2110 2114 7.038799 TCGTGAGAAAGGTTAGTTTTACCCTAT 60.039 37.037 0.00 0.0 34.79 2.57
2247 2251 7.152645 GGATTATGATTGAACGCCTCTAAGTA 58.847 38.462 0.00 0.0 0.00 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1567 1569 2.116238 GCTCCCACTTATCCTACACCA 58.884 52.381 0.00 0.00 0.00 4.17
1623 1626 6.313411 CGACCCACGGAATAAGTAAAATAACA 59.687 38.462 0.00 0.00 38.46 2.41
1656 1660 0.040204 CCAAAAGGAGGGGACATGCT 59.960 55.000 0.00 0.00 0.00 3.79
1899 1903 3.898123 TGACACCTCTAGCTTCAAACTCT 59.102 43.478 0.00 0.00 0.00 3.24
1936 1940 0.403655 TGCCACAAGCCAGTTATCCA 59.596 50.000 0.00 0.00 42.71 3.41
1968 1972 1.971962 GATCAAAAAGCAACGTCGCTG 59.028 47.619 0.00 0.00 42.89 5.18
2064 2068 1.429930 TGGTCTAAACCCAGCTCACA 58.570 50.000 0.00 0.00 45.83 3.58
2083 2087 5.936372 GGGTAAAACTAACCTTTCTCACGAT 59.064 40.000 0.00 0.00 37.18 3.73
2092 2096 8.387813 TGTCATCAATAGGGTAAAACTAACCTT 58.612 33.333 0.00 0.00 37.18 3.50
2110 2114 4.783764 ACTATCGTGACACTGTCATCAA 57.216 40.909 14.95 4.64 44.63 2.57
2205 2209 2.813908 CGGCACACGGTAGCTTCC 60.814 66.667 0.00 0.00 39.42 3.46
2231 2235 5.046878 TGGATTCTTACTTAGAGGCGTTCAA 60.047 40.000 0.00 0.00 33.51 2.69
2247 2251 1.945394 CGCATGCTAGCTTGGATTCTT 59.055 47.619 26.57 0.00 0.00 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.