Multiple sequence alignment - TraesCS1A01G001500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G001500 chr1A 100.000 2420 0 0 1 2420 325099 327518 0 4470
1 TraesCS1A01G001500 chr1A 98.760 2420 30 0 1 2420 78445 76026 0 4303
2 TraesCS1A01G001500 chr1A 98.678 2420 31 1 1 2420 313753 316171 0 4290
3 TraesCS1A01G001500 chr1A 96.887 1542 46 2 879 2420 259493 257954 0 2580
4 TraesCS1A01G001500 chr1A 96.693 1542 50 1 879 2420 402375 400835 0 2564
5 TraesCS1A01G001500 chr1A 96.628 1542 52 0 879 2420 170133 168592 0 2560
6 TraesCS1A01G001500 chrUn 96.695 1543 50 1 879 2420 245705988 245704446 0 2566
7 TraesCS1A01G001500 chrUn 96.630 1543 51 1 879 2420 67492389 67493931 0 2560
8 TraesCS1A01G001500 chrUn 96.630 1543 51 1 879 2420 67501088 67502630 0 2560
9 TraesCS1A01G001500 chrUn 96.565 1543 52 1 879 2420 220751356 220752898 0 2555
10 TraesCS1A01G001500 chr3B 98.068 880 17 0 1 880 63024479 63025358 0 1531
11 TraesCS1A01G001500 chr6B 97.722 878 20 0 1 878 29522416 29523293 0 1511
12 TraesCS1A01G001500 chr6B 96.583 878 29 1 1 878 281480512 281481388 0 1454
13 TraesCS1A01G001500 chr5B 97.156 879 25 0 1 879 443202369 443203247 0 1485
14 TraesCS1A01G001500 chr4A 97.042 879 26 0 1 879 591977020 591977898 0 1480
15 TraesCS1A01G001500 chr7B 96.921 877 27 0 2 878 464606121 464606997 0 1471
16 TraesCS1A01G001500 chr4B 96.368 881 29 2 1 878 478527060 478527940 0 1447


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G001500 chr1A 325099 327518 2419 False 4470 4470 100.000 1 2420 1 chr1A.!!$F2 2419
1 TraesCS1A01G001500 chr1A 76026 78445 2419 True 4303 4303 98.760 1 2420 1 chr1A.!!$R1 2419
2 TraesCS1A01G001500 chr1A 313753 316171 2418 False 4290 4290 98.678 1 2420 1 chr1A.!!$F1 2419
3 TraesCS1A01G001500 chr1A 257954 259493 1539 True 2580 2580 96.887 879 2420 1 chr1A.!!$R3 1541
4 TraesCS1A01G001500 chr1A 400835 402375 1540 True 2564 2564 96.693 879 2420 1 chr1A.!!$R4 1541
5 TraesCS1A01G001500 chr1A 168592 170133 1541 True 2560 2560 96.628 879 2420 1 chr1A.!!$R2 1541
6 TraesCS1A01G001500 chrUn 245704446 245705988 1542 True 2566 2566 96.695 879 2420 1 chrUn.!!$R1 1541
7 TraesCS1A01G001500 chrUn 67492389 67493931 1542 False 2560 2560 96.630 879 2420 1 chrUn.!!$F1 1541
8 TraesCS1A01G001500 chrUn 67501088 67502630 1542 False 2560 2560 96.630 879 2420 1 chrUn.!!$F2 1541
9 TraesCS1A01G001500 chrUn 220751356 220752898 1542 False 2555 2555 96.565 879 2420 1 chrUn.!!$F3 1541
10 TraesCS1A01G001500 chr3B 63024479 63025358 879 False 1531 1531 98.068 1 880 1 chr3B.!!$F1 879
11 TraesCS1A01G001500 chr6B 29522416 29523293 877 False 1511 1511 97.722 1 878 1 chr6B.!!$F1 877
12 TraesCS1A01G001500 chr6B 281480512 281481388 876 False 1454 1454 96.583 1 878 1 chr6B.!!$F2 877
13 TraesCS1A01G001500 chr5B 443202369 443203247 878 False 1485 1485 97.156 1 879 1 chr5B.!!$F1 878
14 TraesCS1A01G001500 chr4A 591977020 591977898 878 False 1480 1480 97.042 1 879 1 chr4A.!!$F1 878
15 TraesCS1A01G001500 chr7B 464606121 464606997 876 False 1471 1471 96.921 2 878 1 chr7B.!!$F1 876
16 TraesCS1A01G001500 chr4B 478527060 478527940 880 False 1447 1447 96.368 1 878 1 chr4B.!!$F1 877

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
369 373 0.747852 TATGCACGCCGGACTTATCA 59.252 50.0 5.05 0.0 0.0 2.15 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2040 2046 0.969149 TCCACACGACTCTCAGCAAT 59.031 50.0 0.0 0.0 0.0 3.56 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
92 93 4.231273 TGATGAGAATCCCGGAATAAGGA 58.769 43.478 0.73 0.0 36.36 3.36
147 151 2.354199 GGAAACTGCTCTGCTAATGCTC 59.646 50.000 0.00 0.0 40.48 4.26
369 373 0.747852 TATGCACGCCGGACTTATCA 59.252 50.000 5.05 0.0 0.00 2.15
764 768 4.227527 CAGGAGTAGGGTTTTACCTCCATT 59.772 45.833 6.76 0.0 42.09 3.16
829 833 1.068741 CTGTTACCATCCGCCTAGACC 59.931 57.143 0.00 0.0 0.00 3.85
968 972 1.373497 CGCTCGTCAGCTTCCTTGT 60.373 57.895 0.00 0.0 44.40 3.16
1034 1038 2.105821 TCCTTGGTCCGTGTTTCAAGAT 59.894 45.455 0.00 0.0 38.96 2.40
1405 1409 2.573340 GGGCTGCATTCCCAAACG 59.427 61.111 16.86 0.0 43.37 3.60
1893 1899 0.537828 GGGGTTGGGAGCGTGTTTTA 60.538 55.000 0.00 0.0 0.00 1.52
2078 2085 6.813152 GTGTGGATTAAATAGCTTTGCAACAT 59.187 34.615 0.00 0.0 0.00 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
92 93 1.813178 TCGAAGCAGAGATCGTGTTCT 59.187 47.619 0.00 0.00 39.91 3.01
147 151 7.975616 CCTTTGTTTGAATCATTATACCACCTG 59.024 37.037 0.00 0.00 0.00 4.00
369 373 3.308688 CCCCTGAACCAGTCTTCAATGAT 60.309 47.826 0.00 0.00 29.66 2.45
764 768 3.003173 CAGGTTCGGGCCCTCTCA 61.003 66.667 22.43 0.00 0.00 3.27
829 833 4.029809 GGGGGTCCCGAACTGTGG 62.030 72.222 0.48 0.00 36.85 4.17
968 972 1.909700 GTTCTGAAACCTGGGATGCA 58.090 50.000 0.00 0.00 0.00 3.96
1405 1409 1.810030 GCCATCAACGAGTCGGGTC 60.810 63.158 18.30 1.06 0.00 4.46
2040 2046 0.969149 TCCACACGACTCTCAGCAAT 59.031 50.000 0.00 0.00 0.00 3.56
2078 2085 1.871418 AGCTTGCTAGTCATCCCTCA 58.129 50.000 0.00 0.00 0.00 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.