Multiple sequence alignment - TraesCS1A01G001400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G001400 chr1A 100.000 2297 0 0 1 2297 305347 303051 0 4242
1 TraesCS1A01G001400 chr1A 98.520 2298 33 1 1 2297 86851 89148 0 4054
2 TraesCS1A01G001400 chr1A 96.968 2309 58 6 1 2297 31746 34054 0 3866
3 TraesCS1A01G001400 chrUn 97.445 2309 47 4 1 2297 291535440 291537748 0 3927
4 TraesCS1A01G001400 chrUn 97.445 2309 46 5 1 2297 245706068 245708375 0 3925
5 TraesCS1A01G001400 chrUn 97.401 2309 48 4 1 2297 199874824 199877132 0 3921
6 TraesCS1A01G001400 chrUn 97.401 2309 48 4 1 2297 229310227 229307919 0 3921
7 TraesCS1A01G001400 chrUn 97.403 2310 47 5 1 2297 274341282 274338973 0 3921
8 TraesCS1A01G001400 chrUn 97.358 2309 49 6 1 2297 199904744 199907052 0 3916
9 TraesCS1A01G001400 chrUn 97.228 2309 52 4 1 2297 3845814 3843506 0 3899
10 TraesCS1A01G001400 chr1B 97.401 2309 46 5 1 2297 544593697 544596003 0 3919
11 TraesCS1A01G001400 chr1B 97.399 2307 48 4 1 2295 544623636 544625942 0 3917
12 TraesCS1A01G001400 chr1B 97.151 1369 27 5 941 2297 544586544 544587912 0 2302


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G001400 chr1A 303051 305347 2296 True 4242 4242 100.000 1 2297 1 chr1A.!!$R1 2296
1 TraesCS1A01G001400 chr1A 86851 89148 2297 False 4054 4054 98.520 1 2297 1 chr1A.!!$F2 2296
2 TraesCS1A01G001400 chr1A 31746 34054 2308 False 3866 3866 96.968 1 2297 1 chr1A.!!$F1 2296
3 TraesCS1A01G001400 chrUn 291535440 291537748 2308 False 3927 3927 97.445 1 2297 1 chrUn.!!$F4 2296
4 TraesCS1A01G001400 chrUn 245706068 245708375 2307 False 3925 3925 97.445 1 2297 1 chrUn.!!$F3 2296
5 TraesCS1A01G001400 chrUn 199874824 199877132 2308 False 3921 3921 97.401 1 2297 1 chrUn.!!$F1 2296
6 TraesCS1A01G001400 chrUn 229307919 229310227 2308 True 3921 3921 97.401 1 2297 1 chrUn.!!$R2 2296
7 TraesCS1A01G001400 chrUn 274338973 274341282 2309 True 3921 3921 97.403 1 2297 1 chrUn.!!$R3 2296
8 TraesCS1A01G001400 chrUn 199904744 199907052 2308 False 3916 3916 97.358 1 2297 1 chrUn.!!$F2 2296
9 TraesCS1A01G001400 chrUn 3843506 3845814 2308 True 3899 3899 97.228 1 2297 1 chrUn.!!$R1 2296
10 TraesCS1A01G001400 chr1B 544593697 544596003 2306 False 3919 3919 97.401 1 2297 1 chr1B.!!$F2 2296
11 TraesCS1A01G001400 chr1B 544623636 544625942 2306 False 3917 3917 97.399 1 2295 1 chr1B.!!$F3 2294
12 TraesCS1A01G001400 chr1B 544586544 544587912 1368 False 2302 2302 97.151 941 2297 1 chr1B.!!$F1 1356

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
267 268 0.671251 TTGGTAAGCAAAACTGGCGG 59.329 50.0 0.0 0.0 36.08 6.13 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1463 1464 1.009829 CTGTGGTTTCGCTGGATAGC 58.99 55.0 0.0 0.0 46.62 2.97 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
258 259 2.050144 TGGGCCATTTTTGGTAAGCAA 58.950 42.857 0.00 0.00 0.00 3.91
267 268 0.671251 TTGGTAAGCAAAACTGGCGG 59.329 50.000 0.00 0.00 36.08 6.13
839 840 1.528309 CTGCCAACCCTGGAAACGT 60.528 57.895 0.00 0.00 46.92 3.99
1328 1329 5.425217 TGATTTCTACCCAGTGCTCTGAATA 59.575 40.000 17.19 7.84 43.76 1.75
1406 1407 3.265737 TCTTAAGGTAGCCAAATGCCTCA 59.734 43.478 1.85 0.00 42.71 3.86
1463 1464 0.987294 ATTCCCACTGTCCCTGTCTG 59.013 55.000 0.00 0.00 0.00 3.51
1518 1519 2.761195 GCGGAATCAGCGGGGAAAC 61.761 63.158 0.00 0.00 0.00 2.78
1788 1803 5.814705 CCTAAGATGAGCTCAACGAGAAAAT 59.185 40.000 22.50 0.00 0.00 1.82
2260 2275 1.519234 CCAAGCTAGCATGCGACGA 60.519 57.895 18.83 0.00 38.13 4.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
258 259 4.344865 ATCCCGCACCGCCAGTTT 62.345 61.111 0.00 0.0 0.00 2.66
839 840 1.229400 ACCCTACCTCCGGCTGAAA 60.229 57.895 0.00 0.0 0.00 2.69
1222 1223 1.067071 CCCTTGTCCGTACCAGTTCTC 60.067 57.143 0.00 0.0 0.00 2.87
1328 1329 6.647895 GCTTGGTTGAATTTCATCACTTTGAT 59.352 34.615 0.00 0.0 37.65 2.57
1406 1407 3.977427 TGCGCGTCACTAATTAGATGAT 58.023 40.909 19.38 0.0 0.00 2.45
1463 1464 1.009829 CTGTGGTTTCGCTGGATAGC 58.990 55.000 0.00 0.0 46.62 2.97
1518 1519 1.876156 GTCAAGCTCAACAGGGTCTTG 59.124 52.381 0.00 0.0 36.42 3.02
1788 1803 4.517453 CCCTTTTGTTCCACACGAGATTTA 59.483 41.667 0.00 0.0 0.00 1.40
1947 1962 1.915350 CAACGTCGCTATGAACGCTTA 59.085 47.619 0.00 0.0 0.00 3.09


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.