Multiple sequence alignment - TraesCS1A01G001300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G001300 chr1A 100.000 2387 0 0 1 2387 296266 298652 0.000000e+00 4409.0
1 TraesCS1A01G001300 chr1A 98.377 2342 38 0 46 2387 49774 47433 0.000000e+00 4115.0
2 TraesCS1A01G001300 chr1A 96.541 2342 81 0 46 2387 120983 118642 0.000000e+00 3877.0
3 TraesCS1A01G001300 chr1A 97.959 49 1 0 1 49 49848 49800 4.230000e-13 86.1
4 TraesCS1A01G001300 chrUn 96.500 2343 81 1 46 2387 245706788 245704446 0.000000e+00 3871.0
5 TraesCS1A01G001300 chrUn 96.415 2343 83 1 46 2387 67500288 67502630 0.000000e+00 3860.0
6 TraesCS1A01G001300 chrUn 96.415 2343 83 1 46 2387 291536160 291533818 0.000000e+00 3860.0
7 TraesCS1A01G001300 chrUn 96.390 2327 83 1 62 2387 67491605 67493931 0.000000e+00 3831.0
8 TraesCS1A01G001300 chrUn 96.116 2343 90 1 46 2387 229309507 229311849 0.000000e+00 3821.0
9 TraesCS1A01G001300 chrUn 95.918 49 2 0 1 49 3845020 3845068 1.970000e-11 80.5
10 TraesCS1A01G001300 chrUn 95.918 49 2 0 1 49 67506399 67506447 1.970000e-11 80.5
11 TraesCS1A01G001300 chrUn 95.918 49 2 0 1 49 67509990 67510038 1.970000e-11 80.5
12 TraesCS1A01G001300 chrUn 95.918 49 2 0 1 49 199875618 199875570 1.970000e-11 80.5
13 TraesCS1A01G001300 chrUn 95.918 49 2 0 1 49 199905538 199905490 1.970000e-11 80.5
14 TraesCS1A01G001300 chrUn 95.918 49 2 0 1 49 237312503 237312455 1.970000e-11 80.5
15 TraesCS1A01G001300 chrUn 95.918 49 2 0 1 49 245706862 245706814 1.970000e-11 80.5
16 TraesCS1A01G001300 chrUn 95.918 49 2 0 1 49 249829923 249829971 1.970000e-11 80.5
17 TraesCS1A01G001300 chr5D 96.329 2343 85 1 46 2387 18999644 18997302 0.000000e+00 3849.0
18 TraesCS1A01G001300 chr6B 95.988 2343 93 1 46 2387 111686069 111688411 0.000000e+00 3805.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G001300 chr1A 296266 298652 2386 False 4409.000000 4409 100.000000 1 2387 1 chr1A.!!$F1 2386
1 TraesCS1A01G001300 chr1A 118642 120983 2341 True 3877.000000 3877 96.541000 46 2387 1 chr1A.!!$R1 2341
2 TraesCS1A01G001300 chr1A 47433 49848 2415 True 2100.550000 4115 98.168000 1 2387 2 chr1A.!!$R2 2386
3 TraesCS1A01G001300 chrUn 291533818 291536160 2342 True 3860.000000 3860 96.415000 46 2387 1 chrUn.!!$R4 2341
4 TraesCS1A01G001300 chrUn 67491605 67493931 2326 False 3831.000000 3831 96.390000 62 2387 1 chrUn.!!$F2 2325
5 TraesCS1A01G001300 chrUn 229309507 229311849 2342 False 3821.000000 3821 96.116000 46 2387 1 chrUn.!!$F3 2341
6 TraesCS1A01G001300 chrUn 245704446 245706862 2416 True 1975.750000 3871 96.209000 1 2387 2 chrUn.!!$R5 2386
7 TraesCS1A01G001300 chrUn 67500288 67510038 9750 False 1340.333333 3860 96.083667 1 2387 3 chrUn.!!$F5 2386
8 TraesCS1A01G001300 chr5D 18997302 18999644 2342 True 3849.000000 3849 96.329000 46 2387 1 chr5D.!!$R1 2341
9 TraesCS1A01G001300 chr6B 111686069 111688411 2342 False 3805.000000 3805 95.988000 46 2387 1 chr6B.!!$F1 2341

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
414 444 1.125093 TTCCATGACCACCGTCCTGT 61.125 55.0 0.0 0.0 38.32 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1644 1674 0.599991 AGCACACGTCGCTTTGATCA 60.6 50.0 3.15 0.0 35.82 2.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
414 444 1.125093 TTCCATGACCACCGTCCTGT 61.125 55.000 0.00 0.00 38.32 4.00
417 447 1.302511 ATGACCACCGTCCTGTTGC 60.303 57.895 0.00 0.00 38.32 4.17
432 462 3.074412 CTGTTGCCTTAATCGACCAACT 58.926 45.455 0.00 0.00 37.32 3.16
500 530 1.904990 TTCCGGTTCATCCCGCATCA 61.905 55.000 0.00 0.00 46.71 3.07
1696 1726 2.429610 GTCATTTTGAGGCCATCATGCT 59.570 45.455 5.01 0.00 37.89 3.79
1945 1976 0.031585 CGATGGTTCGCGGGATTCTA 59.968 55.000 6.13 0.00 38.75 2.10
2225 2256 3.411351 GATGACGCGTGCACGGTT 61.411 61.111 37.47 20.09 40.23 4.44
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
329 359 1.843851 ACTAGCCCCGAAAATGGATGA 59.156 47.619 0.00 0.00 0.00 2.92
414 444 2.617021 GGGAGTTGGTCGATTAAGGCAA 60.617 50.000 0.00 0.00 0.00 4.52
417 447 3.629142 AAGGGAGTTGGTCGATTAAGG 57.371 47.619 0.00 0.00 0.00 2.69
500 530 5.048013 GCCATTTTTGGTAAGCAGAACTAGT 60.048 40.000 0.00 0.00 0.00 2.57
1133 1163 3.542676 TGGACTGTTGTCGGCCGT 61.543 61.111 27.15 2.66 43.79 5.68
1230 1260 0.827507 AGTGCTTGAAATTGCCGGGT 60.828 50.000 2.18 0.00 0.00 5.28
1638 1668 4.162640 TCGCTTTGATCACGACCG 57.837 55.556 0.00 0.00 0.00 4.79
1644 1674 0.599991 AGCACACGTCGCTTTGATCA 60.600 50.000 3.15 0.00 35.82 2.92
1805 1835 3.785859 GCGGCATCTGGTCCCTCA 61.786 66.667 0.00 0.00 0.00 3.86
1849 1880 1.823260 CGTCACGCCAAAACACGCTA 61.823 55.000 0.00 0.00 0.00 4.26
1945 1976 2.290008 TGCGATACCTGGTGTGAATTGT 60.290 45.455 10.23 0.00 0.00 2.71
2225 2256 1.065345 TCGTGACCCTGACCAAAACAA 60.065 47.619 0.00 0.00 0.00 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.