Multiple sequence alignment - TraesCS1A01G001200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G001200 chr1A 100.000 2261 0 0 1 2261 286697 288957 0 4176
1 TraesCS1A01G001200 chr1A 98.453 2262 34 1 1 2261 59769 57508 0 3982
2 TraesCS1A01G001200 chrUn 97.304 2263 59 2 1 2261 229308527 229310789 0 3840
3 TraesCS1A01G001200 chrUn 97.173 2264 61 3 1 2261 274339581 274341844 0 3823
4 TraesCS1A01G001200 chrUn 97.172 2263 62 2 1 2261 291537140 291534878 0 3823
5 TraesCS1A01G001200 chrUn 97.128 2263 63 2 1 2261 199876524 199874262 0 3818
6 TraesCS1A01G001200 chrUn 97.084 2263 64 2 1 2261 199906444 199904182 0 3812
7 TraesCS1A01G001200 chrUn 97.039 2263 64 3 1 2261 3844114 3846375 0 3805
8 TraesCS1A01G001200 chr1B 97.304 2263 59 2 1 2261 544625336 544623074 0 3840
9 TraesCS1A01G001200 chr1B 97.260 2263 58 3 1 2261 544595395 544593135 0 3832


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G001200 chr1A 286697 288957 2260 False 4176 4176 100.000 1 2261 1 chr1A.!!$F1 2260
1 TraesCS1A01G001200 chr1A 57508 59769 2261 True 3982 3982 98.453 1 2261 1 chr1A.!!$R1 2260
2 TraesCS1A01G001200 chrUn 229308527 229310789 2262 False 3840 3840 97.304 1 2261 1 chrUn.!!$F2 2260
3 TraesCS1A01G001200 chrUn 274339581 274341844 2263 False 3823 3823 97.173 1 2261 1 chrUn.!!$F3 2260
4 TraesCS1A01G001200 chrUn 291534878 291537140 2262 True 3823 3823 97.172 1 2261 1 chrUn.!!$R3 2260
5 TraesCS1A01G001200 chrUn 199874262 199876524 2262 True 3818 3818 97.128 1 2261 1 chrUn.!!$R1 2260
6 TraesCS1A01G001200 chrUn 199904182 199906444 2262 True 3812 3812 97.084 1 2261 1 chrUn.!!$R2 2260
7 TraesCS1A01G001200 chrUn 3844114 3846375 2261 False 3805 3805 97.039 1 2261 1 chrUn.!!$F1 2260
8 TraesCS1A01G001200 chr1B 544623074 544625336 2262 True 3840 3840 97.304 1 2261 1 chr1B.!!$R2 2260
9 TraesCS1A01G001200 chr1B 544593135 544595395 2260 True 3832 3832 97.260 1 2261 1 chr1B.!!$R1 2260

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
236 239 1.009829 CTGTGGTTTCGCTGGATAGC 58.99 55.0 0.0 0.0 46.62 2.97 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1625 1628 1.644337 TCTAGTAGCTGGTTCCCTCCA 59.356 52.381 0.0 0.0 36.0 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
236 239 1.009829 CTGTGGTTTCGCTGGATAGC 58.990 55.000 0.00 0.0 46.62 2.97
941 944 1.171308 CGTCTCCGGACTTCCTAACA 58.829 55.000 0.00 0.0 40.10 2.41
1187 1190 3.541713 GCACCCCGGGTTTTGCAA 61.542 61.111 26.32 0.0 31.02 4.08
1625 1628 3.054065 CCAGCTATCCTGAGGGAAACTTT 60.054 47.826 0.00 0.0 45.78 2.66
1770 1773 5.300286 GCTCAGGCATAGTTCACCATATTTT 59.700 40.000 0.00 0.0 38.54 1.82
2189 2193 3.985925 GGCAATTTCAAGCACTCTTTGAG 59.014 43.478 0.00 0.0 35.52 3.02
2192 2196 5.218139 CAATTTCAAGCACTCTTTGAGTCC 58.782 41.667 0.00 0.0 41.37 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
236 239 0.987294 ATTCCCACTGTCCCTGTCTG 59.013 55.000 0.00 0.00 0.00 3.51
672 675 3.010584 ACAATGTAGGCAAGGGAAGTCAT 59.989 43.478 0.00 0.00 0.00 3.06
673 676 2.375174 ACAATGTAGGCAAGGGAAGTCA 59.625 45.455 0.00 0.00 0.00 3.41
1172 1175 3.220658 CGTTGCAAAACCCGGGGT 61.221 61.111 27.92 18.49 37.65 4.95
1230 1233 3.087253 CCCACACCCGGCCATCTA 61.087 66.667 2.24 0.00 0.00 1.98
1625 1628 1.644337 TCTAGTAGCTGGTTCCCTCCA 59.356 52.381 0.00 0.00 36.00 3.86
2139 2142 4.664677 CGATGGGGGTCGGCGATC 62.665 72.222 14.79 13.70 37.94 3.69
2189 2193 5.592104 TGAAAAGGACTTTGAAAAGGGAC 57.408 39.130 7.65 0.00 40.31 4.46
2192 2196 7.439356 GGAAAGATGAAAAGGACTTTGAAAAGG 59.561 37.037 7.65 0.00 40.31 3.11


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.