Multiple sequence alignment - TraesCS1A01G001000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G001000 chr1A 100.000 2297 0 0 1 2297 271957 269661 0 4242
1 TraesCS1A01G001000 chr1A 97.778 2295 51 0 3 2297 103609 105903 0 3956
2 TraesCS1A01G001000 chrUn 96.642 2323 52 2 1 2297 291535440 291537762 0 3834
3 TraesCS1A01G001000 chrUn 96.556 2323 53 3 1 2297 245706068 245708389 0 3821
4 TraesCS1A01G001000 chrUn 96.513 2323 55 2 1 2297 199874824 199877146 0 3818
5 TraesCS1A01G001000 chrUn 96.513 2323 55 2 1 2297 229310227 229307905 0 3818
6 TraesCS1A01G001000 chrUn 96.515 2324 54 3 1 2297 274341282 274338959 0 3818
7 TraesCS1A01G001000 chrUn 96.427 2323 57 2 1 2297 3845814 3843492 0 3807
8 TraesCS1A01G001000 chr1B 96.556 2323 52 4 1 2297 544593697 544596017 0 3821
9 TraesCS1A01G001000 chr1B 96.298 2323 60 2 1 2297 544623636 544625958 0 3790
10 TraesCS1A01G001000 chr1B 96.460 2062 47 2 1 2036 544613002 544615063 0 3380
11 TraesCS1A01G001000 chr1B 96.240 1383 26 2 941 2297 544586544 544587926 0 2242


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G001000 chr1A 269661 271957 2296 True 4242 4242 100.000 1 2297 1 chr1A.!!$R1 2296
1 TraesCS1A01G001000 chr1A 103609 105903 2294 False 3956 3956 97.778 3 2297 1 chr1A.!!$F1 2294
2 TraesCS1A01G001000 chrUn 291535440 291537762 2322 False 3834 3834 96.642 1 2297 1 chrUn.!!$F3 2296
3 TraesCS1A01G001000 chrUn 245706068 245708389 2321 False 3821 3821 96.556 1 2297 1 chrUn.!!$F2 2296
4 TraesCS1A01G001000 chrUn 199874824 199877146 2322 False 3818 3818 96.513 1 2297 1 chrUn.!!$F1 2296
5 TraesCS1A01G001000 chrUn 229307905 229310227 2322 True 3818 3818 96.513 1 2297 1 chrUn.!!$R2 2296
6 TraesCS1A01G001000 chrUn 274338959 274341282 2323 True 3818 3818 96.515 1 2297 1 chrUn.!!$R3 2296
7 TraesCS1A01G001000 chrUn 3843492 3845814 2322 True 3807 3807 96.427 1 2297 1 chrUn.!!$R1 2296
8 TraesCS1A01G001000 chr1B 544593697 544596017 2320 False 3821 3821 96.556 1 2297 1 chr1B.!!$F2 2296
9 TraesCS1A01G001000 chr1B 544623636 544625958 2322 False 3790 3790 96.298 1 2297 1 chr1B.!!$F4 2296
10 TraesCS1A01G001000 chr1B 544613002 544615063 2061 False 3380 3380 96.460 1 2036 1 chr1B.!!$F3 2035
11 TraesCS1A01G001000 chr1B 544586544 544587926 1382 False 2242 2242 96.240 941 2297 1 chr1B.!!$F1 1356

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
987 988 2.356535 GCATCAGGTCTCCAAGGTGAAT 60.357 50.0 0.0 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1988 2017 3.316308 ACTTGGTGAATTCTGCTTGACAC 59.684 43.478 7.05 0.0 0.0 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
148 149 4.263816 CCAATGATTAGAGGCATCAGGGAT 60.264 45.833 0.00 0.0 34.12 3.85
194 195 7.406916 TCAAACTTTAAATAGGTAGGATGGCA 58.593 34.615 0.00 0.0 0.00 4.92
195 196 7.556275 TCAAACTTTAAATAGGTAGGATGGCAG 59.444 37.037 0.00 0.0 0.00 4.85
245 246 2.674380 GTGCTCCAAGTGGGCCAG 60.674 66.667 6.40 0.0 36.21 4.85
266 267 2.356665 TTTGGTAAGCAGAACTGGCA 57.643 45.000 3.99 0.0 0.00 4.92
288 289 2.674754 GGGATGAACCGGAAGCCA 59.325 61.111 9.46 0.0 40.11 4.75
352 353 3.556423 GGGTGTTGGTCGATTAAGACAGT 60.556 47.826 11.90 0.0 42.62 3.55
430 431 2.745281 CGAATCAACTAGCCCCGAAAAA 59.255 45.455 0.00 0.0 0.00 1.94
987 988 2.356535 GCATCAGGTCTCCAAGGTGAAT 60.357 50.000 0.00 0.0 0.00 2.57
1465 1492 1.616159 CGAAACCACAACCAAGGGAT 58.384 50.000 0.00 0.0 0.00 3.85
1988 2017 1.067821 GATGTCGGCTCTTCCTACCAG 59.932 57.143 0.00 0.0 29.89 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
11 12 3.641906 CCCTATACCCAAGTCAGACGAAT 59.358 47.826 0.00 0.0 0.00 3.34
143 144 1.982395 TCGAGGACGTTGCATCCCT 60.982 57.895 1.05 0.0 40.69 4.20
148 149 0.892755 AATAGGTCGAGGACGTTGCA 59.107 50.000 0.00 0.0 40.69 4.08
194 195 4.400961 GCTCACCGAAGCAGCCCT 62.401 66.667 0.00 0.0 42.05 5.19
245 246 2.360801 TGCCAGTTCTGCTTACCAAAAC 59.639 45.455 0.00 0.0 0.00 2.43
266 267 0.748005 CTTCCGGTTCATCCCGCATT 60.748 55.000 0.00 0.0 46.71 3.56
352 353 1.191535 CTTCCATGACCACCGTCCTA 58.808 55.000 0.00 0.0 38.32 2.94
631 632 1.247567 GCTTACCCATGTGCAAGTGT 58.752 50.000 0.00 0.0 0.00 3.55
718 719 2.032680 CCGGCTCGGGAAATCTTAAA 57.967 50.000 5.79 0.0 44.15 1.52
1465 1492 3.680620 CTGATTCCGCCAAGCCCGA 62.681 63.158 0.00 0.0 0.00 5.14
1676 1705 3.245016 TGACAATGTCTTCTGCCAGGATT 60.245 43.478 14.97 0.0 33.15 3.01
1988 2017 3.316308 ACTTGGTGAATTCTGCTTGACAC 59.684 43.478 7.05 0.0 0.00 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.