Multiple sequence alignment - TraesCS1A01G000800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G000800 chr1A 100.000 2378 0 0 1 2378 181552 179175 0 4392
1 TraesCS1A01G000800 chr1A 98.402 2378 37 1 1 2378 403211 400835 0 4180
2 TraesCS1A01G000800 chr1A 96.846 2378 74 1 1 2378 394771 392395 0 3975
3 TraesCS1A01G000800 chrUn 97.016 2379 70 1 1 2378 245706824 245704446 0 3999
4 TraesCS1A01G000800 chrUn 96.805 2379 75 1 1 2378 291536196 291533818 0 3971
5 TraesCS1A01G000800 chrUn 96.763 2379 76 1 1 2378 67500252 67502630 0 3965
6 TraesCS1A01G000800 chrUn 96.595 2379 80 1 1 2378 229309471 229311849 0 3943
7 TraesCS1A01G000800 chrUn 96.343 2379 86 1 1 2378 199875580 199873202 0 3910
8 TraesCS1A01G000800 chr5D 96.847 2379 74 1 1 2378 18999680 18997302 0 3976
9 TraesCS1A01G000800 chr6B 96.511 2379 82 1 1 2378 111686033 111688411 0 3932


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G000800 chr1A 179175 181552 2377 True 4392 4392 100.000 1 2378 1 chr1A.!!$R1 2377
1 TraesCS1A01G000800 chr1A 400835 403211 2376 True 4180 4180 98.402 1 2378 1 chr1A.!!$R3 2377
2 TraesCS1A01G000800 chr1A 392395 394771 2376 True 3975 3975 96.846 1 2378 1 chr1A.!!$R2 2377
3 TraesCS1A01G000800 chrUn 245704446 245706824 2378 True 3999 3999 97.016 1 2378 1 chrUn.!!$R2 2377
4 TraesCS1A01G000800 chrUn 291533818 291536196 2378 True 3971 3971 96.805 1 2378 1 chrUn.!!$R3 2377
5 TraesCS1A01G000800 chrUn 67500252 67502630 2378 False 3965 3965 96.763 1 2378 1 chrUn.!!$F1 2377
6 TraesCS1A01G000800 chrUn 229309471 229311849 2378 False 3943 3943 96.595 1 2378 1 chrUn.!!$F2 2377
7 TraesCS1A01G000800 chrUn 199873202 199875580 2378 True 3910 3910 96.343 1 2378 1 chrUn.!!$R1 2377
8 TraesCS1A01G000800 chr5D 18997302 18999680 2378 True 3976 3976 96.847 1 2378 1 chr5D.!!$R1 2377
9 TraesCS1A01G000800 chr6B 111686033 111688411 2378 False 3932 3932 96.511 1 2378 1 chr6B.!!$F1 2377

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
777 778 1.007154 GTATCGCTTCGAGCCTCCC 60.007 63.158 2.0 0.0 39.91 4.3 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2036 2039 1.871418 AGCTTGCTAGTCATCCCTCA 58.129 50.0 0.0 0.0 0.0 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
153 154 3.009584 ACATGGAACCTTTCTCCTCTTCC 59.990 47.826 0.00 0.0 33.77 3.46
602 603 2.761208 AGTTTGAGAATCGGTCGAGGAT 59.239 45.455 0.00 0.0 38.61 3.24
777 778 1.007154 GTATCGCTTCGAGCCTCCC 60.007 63.158 2.00 0.0 39.91 4.30
1225 1226 1.619363 CCCATCCACTTCCCTCCCA 60.619 63.158 0.00 0.0 0.00 4.37
1365 1366 0.614812 GGGCTGCATTCCCAAACAAT 59.385 50.000 16.86 0.0 43.37 2.71
1617 1619 2.353406 GCTTAAACTCAGCGGGTAGTCA 60.353 50.000 0.00 0.0 0.00 3.41
1927 1930 3.057734 GTTCAAAGACTCGATGGTTCGT 58.942 45.455 0.00 0.0 45.65 3.85
1962 1965 2.236146 TCACACCAGGTATCGCATTTCT 59.764 45.455 0.00 0.0 0.00 2.52
2009 2012 1.880675 GAGATATCCGTTGCCGAGAGA 59.119 52.381 0.00 0.0 35.63 3.10
2036 2039 7.328249 CGTGTGGATTAAATAACTTTGCAACAT 59.672 33.333 0.00 0.0 0.00 2.71
2226 2229 0.454196 GTGCACGGTCTGTTTTGGTT 59.546 50.000 0.00 0.0 0.00 3.67
2249 2252 2.093447 GGGTCACGACAATGATCCTTCT 60.093 50.000 0.00 0.0 45.23 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
153 154 4.488126 TCAAATGAGAACTTTGAAGGCG 57.512 40.909 0.0 0.00 39.11 5.52
1203 1204 3.023735 GGGAAGTGGATGGGGGCT 61.024 66.667 0.0 0.00 0.00 5.19
1214 1215 1.428912 TGAAATTGCTGGGAGGGAAGT 59.571 47.619 0.0 0.00 0.00 3.01
1225 1226 4.340381 AGTCAAAGAGTGCTTGAAATTGCT 59.660 37.500 0.0 0.00 33.79 3.91
1657 1659 2.027837 GCCTCAAAATGACCCAGCAAAT 60.028 45.455 0.0 0.00 0.00 2.32
1927 1930 2.170166 GGTGTGAATTGCAGAATCCCA 58.830 47.619 0.0 0.00 0.00 4.37
1962 1965 2.353579 TCGCATCGATGAAGAACGTAGA 59.646 45.455 29.2 9.57 0.00 2.59
2009 2012 6.320494 TGCAAAGTTATTTAATCCACACGT 57.680 33.333 0.0 0.00 0.00 4.49
2036 2039 1.871418 AGCTTGCTAGTCATCCCTCA 58.129 50.000 0.0 0.00 0.00 3.86
2226 2229 2.747177 AGGATCATTGTCGTGACCCTA 58.253 47.619 0.0 0.00 40.50 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.