Multiple sequence alignment - TraesCS1A01G000300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G000300 chr1A 100.000 2297 0 0 1 2297 103607 105903 0 4242
1 TraesCS1A01G000300 chr1A 97.778 2295 51 0 3 2297 271955 269661 0 3956
2 TraesCS1A01G000300 chr1A 95.869 2324 69 3 1 2297 280247 277924 0 3735
3 TraesCS1A01G000300 chrUn 96.682 2321 51 2 3 2297 291535442 291537762 0 3836
4 TraesCS1A01G000300 chrUn 96.596 2321 52 3 3 2297 245706070 245708389 0 3823
5 TraesCS1A01G000300 chrUn 96.553 2321 54 2 3 2297 199874826 199877146 0 3819
6 TraesCS1A01G000300 chrUn 96.553 2321 54 2 3 2297 229310225 229307905 0 3819
7 TraesCS1A01G000300 chrUn 96.555 2322 53 3 3 2297 274341280 274338959 0 3819
8 TraesCS1A01G000300 chr1B 96.596 2321 51 4 3 2297 544593699 544596017 0 3823
9 TraesCS1A01G000300 chr1B 96.338 2321 59 2 3 2297 544623638 544625958 0 3792
10 TraesCS1A01G000300 chr1B 96.295 2321 60 2 3 2297 80730655 80728335 0 3786
11 TraesCS1A01G000300 chr1B 96.089 1662 39 2 3 1638 80710454 80708793 0 2686
12 TraesCS1A01G000300 chr1B 96.240 1383 26 2 941 2297 544586544 544587926 0 2242
13 TraesCS1A01G000300 chr5D 96.378 2319 58 2 3 2295 18998926 19001244 0 3794


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G000300 chr1A 103607 105903 2296 False 4242 4242 100.000 1 2297 1 chr1A.!!$F1 2296
1 TraesCS1A01G000300 chr1A 269661 271955 2294 True 3956 3956 97.778 3 2297 1 chr1A.!!$R1 2294
2 TraesCS1A01G000300 chr1A 277924 280247 2323 True 3735 3735 95.869 1 2297 1 chr1A.!!$R2 2296
3 TraesCS1A01G000300 chrUn 291535442 291537762 2320 False 3836 3836 96.682 3 2297 1 chrUn.!!$F3 2294
4 TraesCS1A01G000300 chrUn 245706070 245708389 2319 False 3823 3823 96.596 3 2297 1 chrUn.!!$F2 2294
5 TraesCS1A01G000300 chrUn 199874826 199877146 2320 False 3819 3819 96.553 3 2297 1 chrUn.!!$F1 2294
6 TraesCS1A01G000300 chrUn 229307905 229310225 2320 True 3819 3819 96.553 3 2297 1 chrUn.!!$R1 2294
7 TraesCS1A01G000300 chrUn 274338959 274341280 2321 True 3819 3819 96.555 3 2297 1 chrUn.!!$R2 2294
8 TraesCS1A01G000300 chr1B 544593699 544596017 2318 False 3823 3823 96.596 3 2297 1 chr1B.!!$F2 2294
9 TraesCS1A01G000300 chr1B 544623638 544625958 2320 False 3792 3792 96.338 3 2297 1 chr1B.!!$F3 2294
10 TraesCS1A01G000300 chr1B 80728335 80730655 2320 True 3786 3786 96.295 3 2297 1 chr1B.!!$R2 2294
11 TraesCS1A01G000300 chr1B 80708793 80710454 1661 True 2686 2686 96.089 3 1638 1 chr1B.!!$R1 1635
12 TraesCS1A01G000300 chr1B 544586544 544587926 1382 False 2242 2242 96.240 941 2297 1 chr1B.!!$F1 1356
13 TraesCS1A01G000300 chr5D 18998926 19001244 2318 False 3794 3794 96.378 3 2295 1 chr5D.!!$F1 2292

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
946 947 0.538057 AGGACCGAGTACCGTTCACA 60.538 55.0 4.32 0.0 36.31 3.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1976 2006 4.225942 TCTGCTTGACAATGGTAGGAAGAT 59.774 41.667 0.0 0.0 0.0 2.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
28 29 0.596577 TCGTTCGTCTGACTTGGGAG 59.403 55.000 6.21 0.0 0.00 4.30
494 495 0.674895 GCCATATGCCCCGATGAGTC 60.675 60.000 0.00 0.0 0.00 3.36
946 947 0.538057 AGGACCGAGTACCGTTCACA 60.538 55.000 4.32 0.0 36.31 3.58
1235 1236 3.004419 CAGTCAACTCAGAACTGGTACGA 59.996 47.826 1.93 0.0 0.00 3.43
1715 1744 0.474854 TCAGGTGGGGAGTTTGGCTA 60.475 55.000 0.00 0.0 0.00 3.93
1976 2006 3.603158 TTTTGATCCTTCGATGTCGGA 57.397 42.857 2.25 0.0 40.29 4.55
2082 2112 4.333649 TCGTGAGACAGGTTAGTATTACCG 59.666 45.833 0.00 0.0 36.49 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
28 29 2.360165 TCGATTAGTCTTTCGCCCCTAC 59.640 50.000 1.16 0.0 35.39 3.18
946 947 1.106285 GGTTATGAGTACGACCGGGT 58.894 55.000 6.32 0.0 0.00 5.28
1202 1203 3.807553 TGAGTTGACTGTTTCATGCTCA 58.192 40.909 0.00 0.0 40.97 4.26
1235 1236 1.064825 ACAGTCGGATTCCCCTTGTT 58.935 50.000 0.00 0.0 0.00 2.83
1715 1744 0.037590 TTTAACAGATGTGCCGCCCT 59.962 50.000 0.00 0.0 0.00 5.19
1976 2006 4.225942 TCTGCTTGACAATGGTAGGAAGAT 59.774 41.667 0.00 0.0 0.00 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.