Multiple sequence alignment - TraesCS1A01G000200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1A01G000200 chr1A 100.000 2642 0 0 1 2642 69095 71736 0 4879
1 TraesCS1A01G000200 chr1A 98.592 1917 26 1 727 2642 333772 331856 0 3389
2 TraesCS1A01G000200 chrUn 97.500 1920 44 3 727 2642 249830158 249828239 0 3277
3 TraesCS1A01G000200 chrUn 97.448 1920 45 3 727 2642 291535999 291537918 0 3271
4 TraesCS1A01G000200 chrUn 97.448 1920 44 4 727 2642 245706627 245708545 0 3269
5 TraesCS1A01G000200 chrUn 97.396 1920 46 3 727 2642 229309668 229307749 0 3265
6 TraesCS1A01G000200 chrUn 97.397 1921 45 4 727 2642 274340723 274338803 0 3265
7 TraesCS1A01G000200 chrUn 97.344 1920 47 3 727 2642 199875383 199877302 0 3260
8 TraesCS1A01G000200 chrUn 97.292 1920 48 3 727 2642 199905303 199907222 0 3254
9 TraesCS1A01G000200 chrUn 97.541 732 18 0 1 732 274341543 274340812 0 1253
10 TraesCS1A01G000200 chrUn 97.534 730 18 0 1 730 430447188 430447917 0 1249
11 TraesCS1A01G000200 chrUn 97.404 732 19 0 1 732 245705807 245706538 0 1247
12 TraesCS1A01G000200 chrUn 97.404 732 19 0 1 732 400881145 400881876 0 1247
13 TraesCS1A01G000200 chrUn 97.404 732 19 0 1 732 410916120 410915389 0 1247
14 TraesCS1A01G000200 chrUn 97.404 732 19 0 1 732 422724315 422725046 0 1247
15 TraesCS1A01G000200 chrUn 97.404 732 19 0 1 732 450280677 450279946 0 1247
16 TraesCS1A01G000200 chrUn 97.404 732 19 0 1 732 453573772 453574503 0 1247
17 TraesCS1A01G000200 chr1B 97.292 1920 48 3 727 2642 544594254 544596173 0 3254
18 TraesCS1A01G000200 chr5D 97.404 732 19 0 1 732 18998663 18999394 0 1247


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1A01G000200 chr1A 69095 71736 2641 False 4879 4879 100.000 1 2642 1 chr1A.!!$F1 2641
1 TraesCS1A01G000200 chr1A 331856 333772 1916 True 3389 3389 98.592 727 2642 1 chr1A.!!$R1 1915
2 TraesCS1A01G000200 chrUn 249828239 249830158 1919 True 3277 3277 97.500 727 2642 1 chrUn.!!$R2 1915
3 TraesCS1A01G000200 chrUn 291535999 291537918 1919 False 3271 3271 97.448 727 2642 1 chrUn.!!$F3 1915
4 TraesCS1A01G000200 chrUn 229307749 229309668 1919 True 3265 3265 97.396 727 2642 1 chrUn.!!$R1 1915
5 TraesCS1A01G000200 chrUn 199875383 199877302 1919 False 3260 3260 97.344 727 2642 1 chrUn.!!$F1 1915
6 TraesCS1A01G000200 chrUn 199905303 199907222 1919 False 3254 3254 97.292 727 2642 1 chrUn.!!$F2 1915
7 TraesCS1A01G000200 chrUn 274338803 274341543 2740 True 2259 3265 97.469 1 2642 2 chrUn.!!$R5 2641
8 TraesCS1A01G000200 chrUn 245705807 245708545 2738 False 2258 3269 97.426 1 2642 2 chrUn.!!$F8 2641
9 TraesCS1A01G000200 chrUn 430447188 430447917 729 False 1249 1249 97.534 1 730 1 chrUn.!!$F6 729
10 TraesCS1A01G000200 chrUn 400881145 400881876 731 False 1247 1247 97.404 1 732 1 chrUn.!!$F4 731
11 TraesCS1A01G000200 chrUn 410915389 410916120 731 True 1247 1247 97.404 1 732 1 chrUn.!!$R3 731
12 TraesCS1A01G000200 chrUn 422724315 422725046 731 False 1247 1247 97.404 1 732 1 chrUn.!!$F5 731
13 TraesCS1A01G000200 chrUn 450279946 450280677 731 True 1247 1247 97.404 1 732 1 chrUn.!!$R4 731
14 TraesCS1A01G000200 chrUn 453573772 453574503 731 False 1247 1247 97.404 1 732 1 chrUn.!!$F7 731
15 TraesCS1A01G000200 chr1B 544594254 544596173 1919 False 3254 3254 97.292 727 2642 1 chr1B.!!$F1 1915
16 TraesCS1A01G000200 chr5D 18998663 18999394 731 False 1247 1247 97.404 1 732 1 chr5D.!!$F1 731

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
108 109 1.080501 CGCAAGGAAGCTGACGAGA 60.081 57.895 0.0 0.0 0.0 4.04 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1823 1923 0.112412 GAGCCAAAAGGAGGGGACAA 59.888 55.0 0.0 0.0 0.0 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
57 58 1.625818 GGACCAAGGAGTCTGACATGT 59.374 52.381 10.88 0.00 36.95 3.21
108 109 1.080501 CGCAAGGAAGCTGACGAGA 60.081 57.895 0.00 0.00 0.00 4.04
267 268 1.788621 CGAAGCGATACTGACGTGCG 61.789 60.000 0.00 0.00 0.00 5.34
334 335 3.300388 CATCTAGTAGCTGGTTCCCTCA 58.700 50.000 0.00 0.00 0.00 3.86
352 353 3.265479 CCTCAGAAGTTTCCCTCAGGATT 59.735 47.826 0.00 0.00 43.54 3.01
424 425 1.215647 GGACGCAACATCCTCGACT 59.784 57.895 0.00 0.00 33.03 4.18
549 550 4.734652 GGGATGAACCGAAAGCCA 57.265 55.556 0.00 0.00 40.11 4.75
641 642 3.600388 GTGGTCATGGAAGTCGAAATCT 58.400 45.455 0.00 0.00 0.00 2.40
1154 1251 2.054021 TCAGGTCTCCATGGTGAACAA 58.946 47.619 28.74 16.31 0.00 2.83
1244 1341 1.986757 GCTCTGAGGACTGGGCTCA 60.987 63.158 6.83 0.00 38.22 4.26
1667 1764 3.897122 AAGGGAACGGGCTTGGCA 61.897 61.111 0.00 0.00 0.00 4.92
1822 1922 3.782443 GTGGGTCGGAAGCGGGAT 61.782 66.667 0.00 0.00 0.00 3.85
1823 1923 3.006728 TGGGTCGGAAGCGGGATT 61.007 61.111 0.00 0.00 0.00 3.01
1918 2018 4.175337 GCTGGGGCGGCACATCTA 62.175 66.667 16.83 0.00 35.55 1.98
1971 2071 3.990469 GCTCAACGAGAACAGAAATCTCA 59.010 43.478 4.62 0.00 42.79 3.27
2100 2200 4.718961 AGGTGTTAGAAAAGTGAGCACAT 58.281 39.130 3.19 0.00 0.00 3.21
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
57 58 3.547249 GAACCCGTCGACTCGCACA 62.547 63.158 14.70 0.00 0.00 4.57
89 90 2.048222 TCGTCAGCTTCCTTGCGG 60.048 61.111 0.00 0.00 38.13 5.69
132 133 1.613630 AAGATCAGGGTCGGCCAGT 60.614 57.895 9.07 0.00 36.17 4.00
235 236 2.581354 CTTCGAGCCTCCACCAGG 59.419 66.667 0.00 0.00 46.82 4.45
267 268 1.993370 CCCAAGTCAGACGAACGATTC 59.007 52.381 0.14 0.00 0.00 2.52
334 335 2.646798 AGCAATCCTGAGGGAAACTTCT 59.353 45.455 0.00 0.00 45.78 2.85
352 353 1.264749 ACTCGTAATGGGCTCCAGCA 61.265 55.000 0.03 0.00 44.36 4.41
403 404 2.511600 GAGGATGTTGCGTCCCCG 60.512 66.667 3.94 0.00 40.21 5.73
415 416 9.720769 TTTAAAGTTTGAGAATAAGTCGAGGAT 57.279 29.630 0.00 0.00 0.00 3.24
543 544 1.602605 GGCACCGTAACCTGGCTTT 60.603 57.895 0.00 0.00 0.00 3.51
641 642 4.100344 TGAGTTGTTACACACTCCTTAGCA 59.900 41.667 17.95 4.15 30.51 3.49
1154 1251 0.482446 TTGTTCCATTGGCCAGAGGT 59.518 50.000 21.07 1.32 0.00 3.85
1278 1375 1.151668 GTGAGCAACACGAGCAATCT 58.848 50.000 0.00 0.00 39.78 2.40
1667 1764 1.909302 TCTTCTTTCCCCGCTGATTCT 59.091 47.619 0.00 0.00 0.00 2.40
1821 1921 1.149923 AGCCAAAAGGAGGGGACAAAT 59.850 47.619 0.00 0.00 0.00 2.32
1822 1922 0.560688 AGCCAAAAGGAGGGGACAAA 59.439 50.000 0.00 0.00 0.00 2.83
1823 1923 0.112412 GAGCCAAAAGGAGGGGACAA 59.888 55.000 0.00 0.00 0.00 3.18
1870 1970 1.361668 CCTGACAATGTCTTCCGCCG 61.362 60.000 14.97 0.00 33.15 6.46
1918 2018 5.497474 AGGACACCTGCGTTATCTTTTAAT 58.503 37.500 0.00 0.00 29.57 1.40
1971 2071 4.653801 AGCTTTTACCCTTTTGTTCCACAT 59.346 37.500 0.00 0.00 0.00 3.21
2100 2200 0.403655 TGCCACAAGCCAGTTATCCA 59.596 50.000 0.00 0.00 42.71 3.41
2290 2390 8.291032 CCTCTCGTACTAGGTTGAATTACTATG 58.709 40.741 0.00 0.00 0.00 2.23


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.